- Email: [email protected]
Antifungal activity of volatile emitted from Enterobacter asburiae Vt-7 against Aspergillus flavus and aflatoxins in peanuts during storage
Food Control 106 (2019) 106718
Contents lists available at ScienceDirect
Food Control journal homepage: www.elsevier.com/locate/foodcont
Antifungal activity of volatile emitted from Enterobacter asburiae Vt-7 against Aspergillus flavus and aflatoxins in peanuts during storage
T
An-Dong Gonga,d,∗, Fei-Yan Donga, Meng-Jun Hub, Xian-Wei Konga, Fen-Fen Weia, Shuang-Jun Gongc, Yi-Mei Zhanga, Jing-Bo Zhangd, Ai-Bo Wue, Yu-Cai Liaod a
College of Life Science, Xinyang Normal University, Xinyang, 464000, China Department of Plant Science and Landscape Architecture, University of Maryland, College Park, MD, 20742, USA c Institute of Plant Protection and Soil Science, Hubei Academy of Agricultural Sciences, Wuhan, 430070, China d Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan, 430070, China e Shanghai Institute for Biological Sciences, Chinese Academy of Sciences, Shanghai, 200031, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Aspergillus flavus Aflatoxin Postharvest Enterobacter asburiae Volatile 1-Pentanol Phenylethyl alcohol
The contamination of food with Aspergillus flavus and subsequent aflatoxins is considered as one of the most severe safety problems in the world. The application of microorganisms and the produced bio-active compounds is considered as the most promising method for controlling foodborne pathogens and mycotoxins contamination both in pre- and post-harvest. Vt-7, identified as Enterobacter asburiae, was able to completely inhibit the growth of Aspergillus flavus (AF) and other seven important fungal pathogens by the production of volatiles. Additionally, it can also significantly inhibited AF infection on peanuts in storage, down-regulated the gene expression of aflatoxin biosynthesis and eventually prevented aflatoxins production. Scanning electron microscope further proved that Vt-7 volatiles prevented conidia germination of AF on peanut surface, and severely destroyed the conidia structure. Gas chromatography – tandem mass spectrometry revealed that two abundant compounds (1Pentanol and Phenylethyl Alcohol) were involved in the volatile profiles. They showed great antagonistic activity against AF with minimal inhibitory concentration at 200 μL/L. Therefore, E. asburiae Vt-7, and volatiles 1Pentanol and Phenylethyl Alcohol were effective agents in controlling AF and aflatoxins in peanut during storage. They will provide novel strategies for the application of microbe and bio-active compounds against fungal pathogens and mycotoxins in food and grains during storage.
1. Introduction
contamination can often result in a significant economic losses. The total losses of crop caused by aflatoxin in the USA was reported to be nearly $500 million annually (Outlaw et al., 2006; Wu., 2015), and the additional annual costs of disease management was about $20 - $50 million (Robens & Crdwell, 2003). In order to minimize the potential health risk, permissible levels for aflatoxins have been implemented to control AF in foods and feed stuffs in over 100 countries (Bui-Klimke, Guclu, Kensler, Yuan, & Wu, 2014). However, owing to the food shortages, some less developed countries have not yet regulated aflatoxin levels and consequently led to serious human health issues (Medina, Rodriguez, & Magan, 2014; Shephard, 2008). Thus, inhibition of the development of AF and aflatoxins is of paramount importance to those less developed countries. Currently, the control of AF and aflatoxins at storage largely relies on artificial removal, temperature and humidity control as well as chemical agents
Aspergillus flavus (AF) is ubiquitous aflatoxigenic pathogen which can infect many important crops at pre- and post-harvest, such as maize, peanut, rice, cottonseed and their products (Asters et al., 2014; Kamika & Takoy, 2011). The fungus can produce highly toxic and carcinogenic aflatoxins, posing a major threat to animal and human health worldwide (Kirk, Bah, & Montesano, 2006; Kuang et al., 2015; Wild & Montesano, 2009). To date, eighteen different aflatoxins produced by Aspergillus species have been reported (Strosnider et al., 2006). Among them, AFB1 is considered to be the most toxic and carcinogenic to humans and livestock, which has been classified as Group I carcinogen to humans by the International Agency for Research (IARC) (Robens & Cardwell, 2003; Zhuang, Lohmar, Satterlee, Cary, & Calvo, 2016). In addition to causing serious health issues, AF and aflatoxins
Abbreviations: AF, Aspergillus flavus; BMM, Butane,1-methoxy-3-methyl; PA, Phenylethyl Alcohol ∗ Corresponding author. College of Life Science, Xinyang Normal University, Xinyang, 464000, China. E-mail address: [email protected] (A.-D. Gong). https://doi.org/10.1016/j.foodcont.2019.106718 Received 21 February 2019; Received in revised form 14 June 2019; Accepted 15 June 2019 Available online 18 June 2019 0956-7135/ © 2019 Elsevier Ltd. All rights reserved.
Food Control 106 (2019) 106718
A.-D. Gong, et al.
121 °C for 20 min. The kernels were placed in 4 °C and used within 2 days. Eight phytopathgenic fungal including Fusarium graminearum, Alternaria alternata, Aspergillus flavus, Aspergillus niger, Aspergillus fumigatus, Botrytis cinerea, Colletotrichum graminicola and Magnaporthe oryzae were isolated from disease plants, and stored in our tests to detect the broad antifungal activity of strain Vt-7 (Gong et al., 2015).
(Torres, Barros, Palacios, Chulze, & Battilani, 2014). However, these control measures are time-consuming and costly. The application of chemical agents may also cause contaminations in food and environment, and stimulated the production of aflatoxins in food (Santos, Marín, Sanchis, & Ramos, 2011). Moreover, the rate of emergence of resistant AF strains increases rapidly due to the intensive use of chemical agents (Tian et al., 2016). Plant-derived antifungal bioactive compounds, such as Peumus boldus, Lippie turbinate (Passone & Etcheverry, 2014), clove (Eugenia caryophillis) (Thobunluepop, 2009), Cuminum cyminum (Kedia, Prakash, Mishra, & Dubey, 2014), lemongrass (Paranagama, Abeysekera, Abeywickrama, & Nugaliyadde, 2003), and soybean (Cleveland, Carter-Wientjes, De Lucca, & Boue, 2009), have found effective for the control of AF post-harvest. However, extraction of antifungal compounds requires a large amount of plant sources which are not always available. Microbes, however, are often widely spread and easy to culture, which have been found effective against a wide range of fungal pathogens. For example, Bacillus megaterium (Kong, Shan, Liu, Wang, & Yu, 2010; Chen, Kong, & Liang, 2019), B. pumilus (Cho et al., 2009) and Shewanella algae (Gong et al., 2015) have been used in controlling AF and aflatoxins at storage. In addition to some secondary metabolite (such as lipopeptides) used for AF control at storage, volatiles emitted from certain bacteria have also shown efficacy against fungi. In fact, microorganisms produce a wealth of small volatile compounds with the potential to act as infochemicals (Peñuelas et al., 2014). So far, approximately 1,300 microbial volatiles obtained from c.a. 600 microorganisms are currently registered in the volatile database (http://bioinformatics.charite.de/mvoc/) (Lemfack, Nickel, Dunkel, Preissner, & Piechulla, 2014). Although a large number of volatiles have been reported, only 50 discrete volatiles were effective for controlling fungal pathogens (Piechulla, Lemfack, & Kai, 2017). Compared to the treatment of direct application of living bacterial strains, the use of volatiles can often achieve a better coverage due to its gas property. Unfortunately, very few bio-active volatiles were found effective in controlling AF and aflatoxins. Our previous work revealed that volatiles produced by Shewanella algae, including dimethyl trisulfide and 2,4-bis (1,1-dimethylethyl)phenol, can significantly inhibit the growth of AF in vitro and the conidia germination, and prevent aflatoxins production in stored peanut and maize (Gong et al., 2015). In the present study, we further report yet another uncharacterized volatile, emitted by an E. asburiae strain, showing strong efficacy for AF control and aflatoxins preventation. The objectives of our study are to 1) evaluate the antifungal effect of E. asburiae Vt-7 on mycelial growth against AF; 2) identify the effective bio-active compounds emitted from strain Vt-7, 3) test the biocontrol activity against AF and aflatoxins in storage, and elucidate the inhibitory mechanism of volatiles on AF cell structure.
2.2. Identification of strain Vt-7 Vt-7 was cultured in NB medium and incubated in a shaker (Zhicheng Analytical Instrument Manufacturing Co., Ltd., Shanghai, China) at 200 rpm at 28 °C in darkness for 48 h. The bacterial body was collected for DNA extraction as described previously (Gong et al., 2014). The 16S rRNA sequences were amplified with 16S rRNA universal primers (Gong et al., 2014). PCR was conducted at 95 °C for 5 min; followed by 35 cycles at 95 °C for 30 s, 55 °C for 40 s and 72 °C for 40 s; and a final extension at 72 °C for 10 min. PCR products were separated on agarose gel (1%) in 1x Tris-acetate EDTA buffer at 100 v for 30 min. Sequencing was conducted at Tianyi Huiyuan Biotechnology Co., Ltd. The sequences of the strain Vt-7 were then blasted against the NCBI database (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Based on blast results, sequences of 16S rRNA from other closely related bacterial species, including E. asburiae (KT766080.1, JQ659696.1, MH071322.1, AB004744.1 and JQ795786.1), Enterobacter aerogenes (KJ631293.1, KJ631292.1), Leclercia adecarboxylate (KT937143.1, KU705736.1), Enterobacter bugandensis (NR148649.1) and other homologous strains retrieved from Gu (Gu, Li, Yang, & Huo, 2014) were used to construct the phylogenetic tree using neighbor-joining method as described previously (Chen, Li, Li, Song, & Miao, 2017; Ding et al., 2015). Biochemical activity of strain Vt-7 was identified using BIOLOG MicroStation™ System (Biolog Inc, USA). Briefly, fresh Vt-7 clone was inoculated into IF-A GEN III Inoculating Fluid to OD600 = 0.95, and then the suspension were injected into GEN III MicroPlate and cultured at 37 °C for 12 h in darkness. The biochemical reaction of Vt-7 in each cell of MicroPlate was then aligned with bacterial database in BIOLOG MicroStation™ System (Banik, Mukhopadhaya, & Dangar, 2016). 2.3. Antagonistic activity of volatiles from strain Vt-7 against AF mycelia To prove the antagonistic activity of volatiles from Vt-7, antifungal activity of volatiles against AF mycelia was conducted in two sealed petri dishes (90 mm in diameter) as described previously (Fernando, Ramarathnam, Krishnamoorthy, & Savchuk, 2005). Fresh AF conidia inoculated in PDB medium and cultured at 150 rpm and 28 °C for 2 days to produce mycelial pellet. The produced AF pellets were inoculated on PDA center challenging with strain Vt-7 in sealed airspace to detect the antifungal efficiency, respectively. Fresh AF mycelial pellet was inoculated to the center of one PDA plate using a tweezer. The other plate was equally divided into two parts. One part contains NA medium with Fresh Vt-7 cells spread on the surface (100 μL, OD600 = 1.7), and the other part was added with active charcoal (6 g). The two plates were placed FTF with PDA plate above. Four treatments were included in the experiment, including (1) AF mycelia pellet, (2) AF and charcoal, (3) AF and strain Vt-7, (4) AF, Vt-7 and charcoals. All plates were cultured at 28 °C in darkness. After 4 days of incubation, the mycelial diameter of AF in each treatment was measured.
2. Materials and methods 2.1. Microorganisms and plants Strain Vt-7 used in this study was isolated from rhizosphere soil of tea in a garden of cheyun mountain (North: N32°11′56.03″, East: E113°46′36.95″), Xinyang City, Henan Province in China. Briefly, the soil around the tea roots about 5–10 cm in depth was collected for bacterial screening. The soil was diluted to the concentration of 10−6 with sterilized water. The resulting 100 μL suspension was spread onto NA plate and incubated for 48 h. The bacterial clone was then streaked onto another NA plate, and the bodies were collected and tested the antagonistic activity against AF in face-to-face (FTF) dual cultural methods (Gong et al., 2015). Bacteria Vt-7 with antifungal activity against AF was selected for further experiments. Bacterial suspension in 25% glycerol was placed in −80 °C freeze (Zhongke Meiling Co., Ltd, Hefei, China) for long-term storage. Regular-sized peanuts (cv. Silihong) were purchased from local grocery stores. Peanut kernels were placed in dishes and autoclaved at
2.4. RNA extraction and RT-qPCR analysis AF pellet was inoculated on a PDA plate and incubated for 5 days. The resulting fresh conidia were washed off and filtered through single layer gauze and diluted to 106 cfu/mL. 100 μL conidia suspension was then spread on a PDA plate. A NA plate inoculated with Vt-7 was placed FTF with the PDA plate containing AF conidial suspension and incubated at 28 °C in darkness. The conidia on PDA surface without Vt-7 2
Food Control 106 (2019) 106718
A.-D. Gong, et al.
(Thermo Scientific, CA, USA) (Warth et al., 2012). Authentic reference standard aflatoxins (AFB1, AFB2, AFG1, and AFG2) purchased from Sigma (Sigma-Aldrich, St. Louis, MO, USA) were used as standards for quantitative analysis.
Table 1 Primers used in RT-qPCR analysis. Gene name
Gene functions
Primers used in the RT-qPCR
EstA
Esterase, versicona hemiacetal acetate to versiconal NOR dehydrogenase, norsolorinic acid to averantin Monooxygenase/oxidase, VA to DMST Acetyl-CoA carbosylase, AcetylCoA to Malonlyl-CoA Noranthrone monooxygenase, Noranthrone to norsolorinic acid Endogenous control, Reference gene
F: GGGCACTATCGCGCTATGA R: CGGACGTGCCCATCA F: AAGATGCTGGGCACGTTTG R: CATGGGTGAGGACGAATTGG F: ACCGCGTTGCACATCGT R: TGGGTGTCCACAACCTTCGT F: GCATCTGGATCGCCCTCT R: AGCGAGGATACCGAGGAT F: ATGGTAAGACCTGCCTGCTA R: GCGGTGTTCGTAGCGTTC
norB ordB AccC NorM
β-tubulin
2.7. Ultra-structure analysis of AF cells on peanut affected by Vt-7 Ultra-structure of AF cell on infected peanuts surface at aw 0.92 were examined through JSM-4800 scanning electron microscopy (SEM) (Hitachi, Tokyo, Japan). Peanuts in control and Vt-7 treatments were fixed with 0.1% (v/v) osmic acid for 1h, respectively. One small piece of the peanut coat was tore off and affixed to SEM stubs. Then, the samples were spraying with gold and examined with a SEM (Boukaew & Prasertsan, 2014).
F: AGCAGGCGAAGAAGGAGG R: ACGCCACGCATTTGATCTTC
2.8. Broad antagonistic activity of strain Vt-7 treatment was used as control. The organism of AF in the two treatments were collected 24 hpi used for RNA extraction. Total RNA was extracted with Trizol reagent (Invitrogen) according to the manufacturer's protocol. After DNaseI treatment, 2 μg of RNA was added to a 20 μL reaction system to synthesize first-strand cDNA using the Reverse Transcription System (Promega) according to the manufacturer's instructions. Using 1.0 μL of 1:20 diluted cDNA as template, PCR was performed in a 20 μL reaction volume with Bio-Rod SYBRII Super-Mix buffer on a Bio-Rad iQ2 PCR system (Bio-Rad) (Li, Ding, Zhou, & Wang, 2017). Five specific genes involved in aflatoxins biosynthesis pathway, including EstA (Esterase), norB (NOR dehydrogenase), ordB (Monooxygenase/oxidase), AccC (Acetyl-CoA carbosylase) and NorM (Noranthrone monooxygenase) were selected for RT-qPCR analysis (Table 1). β-tubulin gene was used as the endogenous control (reference gene) due to its relatively stable expression level (Hua, Beck, Sarreal, & Gee, 2014). The relative quantification of gene expression changes was calculated by using the 2−ΔΔCt method (Chai, Meng, Gao, Xu, & Wang, 2018; Chai, Li, & Wang, 2017).
Broad antifungal activity of the strain Vt-7 against other important fungi pathogens were tested using the FTF method described above. Eight pathogens were used in our test including Fusarium graminearum, Alternaria alternata, Aspergillus flavus, Aspergillus niger, Aspergillus fumigatus, Botrytis cinerea, Colletotrichum graminicola and Magnaporthe oryzae. The inhibition rate was calculated: Inhibition rate (%) = (the mycelia diameter of control – the mycelia diameter of Vt-7 treatment)/ the diameter of control × 100. 2.9. Volatiles identification and inhibitory analysis Vt-7 was spread on the surface of NA medium in a 100 mL flask and cultured in darkness at 28 °C for 24 h. The produced volatiles were collected with solid-phase micro-extraction (SPME) fiber containing divinylbenzene/carboxen/polydimethlsiloxane and detected with Gas chromatography–tandem mass spectrometry (GC-MS/MS) system (5977-7000D, Agilent Technologies Inc.) according to Gong's methods (Gong et al., 2015). The experiment was tested for two times. The compounds in Vt-7 profiles omitting the compounds appeared in control were considered as the final volatiles. To detect the antifungal activity of volatiles from Vt-7, authentic reference standard compound was purchased and used in the tests. Fresh AF pellet and conidia (10 μL of conidia of a 5Ⅹ105 cfu/mL) was inoculated to the center of PDA plate. Paper disk on another petri dish was added with authentic standard to a final concentration of 10 μL/L, 50 μL/L, 100 μL/L and 200 μL/L (compound volume to airspace volume), respectively. Disks added with water were used as control. Two dishes were sealed FTF and incubated at 28 °C as described before. The inhibition rate was calculated according to the method described above.
2.5. Control of AF and aflatoxins on peanuts with strain Vt-7 It is known that the water activity (aw) level of crop seeds is critical for pathogen infection and mycotoxin production (Liu et al., 2017). High aw levels always cause severe disease symptom. Biocontrol effect of strain Vt-7 against AF on harvested peanut were tested in a sealed desiccator (2.5 L airspace) with two different aw. Autoclaved peanut kernels (100 g) were inoculated with AF conidial suspension (1 mL, 5Ⅹ106 cfu/mL) (Gong et al., 2015). Sterilized water was then added to adjust aw to 0.86 and 0.92 using an electronic dewpoint water activity meter (Aqualab Series 3 model TE; Decagon Devices; Pullman, Washington, USA), respectively. The samples at each aw level were divided into two parts. One part was challenged with strain Vt-7 (the bacteria smeared on NA plate at the bottom of the desiccator), and the other part cultured in another desiccator challenged with plain NA plate as a control. The experiment was conducted twice independently. The maize and peanuts from treatments were collected 5 days post inoculation (dpi), and dried at 60 °C for four days. The dried samples were milled for aflatoxins extraction and quantification.
2.10. Data analysis All experiments were carried out at least in twice and results were reported as means ± standard deviations. The significant differences between mean values were determined using Student's T tests (p < 0.05) following one-way analysis of variance (ANOVA). The statistical analysis was performed using SPSS 16.0 software (SPSS Inc., Chicago, USA). 3. Results
2.6. Quantitative analysis of aflatoxins in peanuts 3.1. Identification of antifungal bacterial strain Vt-7 Aflatoxins in milled peanuts were extracted with organic reagent. One gram of milled sample was dissolved in 5 mL acetonitrile/water (84/16, v/v), vortex for 1 min, and sonicate for 60 min. After centrifugation, 1 mL of supernatant was transferred to a new tube, and mixed well with 1 mL of hexane for 10 min. The upper (organic) layer was sampled and detected through LC-ESI-MS with a Thermo Surveyor plus HPLC system coupled to a TSQ Quantum Ultra mass spectrometer
The 16S rRNA sequence of Vt-7 was blasted in GenBank database. The sequences are aligned into Enterobater genera, and showed great homologous to E. asburiae, E. aerogenes, L. adecarboxylata and E. bugandensis species. These homologous strains with similarity more than 97% were selected for the construction of the physiological tree. As a result, strain Vt-17 and E. asburiae could gather into a separated branch 3
Food Control 106 (2019) 106718
A.-D. Gong, et al.
Fig. 1. Phylogenetic tree of Vt-7 and other homologous strains retrieved from GenBank database based on 16S rRNA sequences. The tree was constructed with neighbor-joining methods and the scale bar represents the number of substitutions per base position.
(Fig. 1). That further proved that Vt-7 exhibited higher homology to E. asburiae. But, we can clearly found that strain Vt-7 and homologous E. asburiae strains had a long genetic distance in the branch. The biochemical analysis further proved that strain Vt-7 showed the greatest homologous to strain E. asburiae in BIOLOG MicroStation™ database (Biolog Inc, USA). Both of them could use 26 carbon resources such as D-Raffinose, α-D-Glucose, D-Sorbitol and Dextrin so on. They also showed same reaction in the tolerance to different concentration of NaCl, pH, some chemical agents and antibiotics. But, Vt-7 showed some specific biochemical reactions different from E. asburiae strain such as the application of Tween 40, α-D-Lactose, D-Melibiose, L-Galactonic Acid, Acetoacetic Acid, D-Malic Acid, D-Turanose, Mucic Acid and Formic Acid. Based on the molecular and biochemical analysis, we could conclude that strain Vt-7 was identified as E. asburiae in the study. But owing to the long genetic distance and other different biochemical reactions, it was speculated that Vt-7 may be a novel subspecies in E. asburiae.
Fig. 2. The inhibitory effect of volatiles from strain Vt-7 against AF. Mycelia pellet of AF was inoculated to the center of PDA plate (CK), challenged with active charcoal (CK + C), Vt-7 (CK + Vt-7) or both of them (CK + C + Vt-7), respectively.
3.2. Antifungal activity of volatiles from Vt-7 The mycelia of AF in control group grew quickly and spread over the surface of PDA plate in 5 days (Fig. 2). The diameter of mycelium in control treatment was up to 4.7 cm 5 dpi. In Vt-7 amended group, Vt-7 could greatly inhibit the growth of AF mycelia in dual-culture. The diameter of AF mycelia is less than 1 cm 5 dpi (Fig. 2). When active charcoal was added into the control treatment, the growth of mycelia was not affected, and the diameter is 4.7 cm 5 dpi. When active charcoal was added into the Vt-7 treatment, the mycelia
could grow to the diameter of 4.2 cm, which is larger than Vt-7 added treatment, but less than control and active charcoal only treatment. These results proved that volatiles produced by Vt-7 play important roles in controlling AF.
4
Food Control 106 (2019) 106718
A.-D. Gong, et al.
quantified in the test. Two aflatoxins (AFB1 and AFB2) in control samples were detected through LC-ESI-MS 5 dpi. Total aflatoxins of peanuts in control treatment was 404.72 and 831.92 ppb at aw 0.86 and 0.92, respectively. The most toxic compound, AFB1 occupied larger amount, and the concentration is up to 369.23 and 651.50 ppb, respectively. On the contrary, no aflatoxin was detected in any of the peanut samples treated with strain Vt-7. 3.5. Structural analysis of AF inoculated on peanut surface Scanning electron microscopy (SEM) was used to examine the structures of AF inoculated on peanut of aw 0.92 5 dpi. As shown in Fig. 5, AF mycelia covered the whole surface of peanut with the production of green conidia in control. On the contrary, no mycelia appeared on the surface of peanut kernels in Vt-7 added treatment. The same results were also observed under SEM. In control samples, AF conidia, mycelial structures, and conidiophore were ubiquitous on the peanut surface. In Vt-7 treatment, only few abnormal conidia appeared on the peanut surface. In addition, the conidia found on the treated samples were severely deformed.
Fig. 3. Relative expression of genes involved in aflatoxin biosynthesis after treatment of volatiles from Vt-7. The expression level was calculated with 2△△ct method (ΔΔct = ΔCt in Vt-7 treatment– ΔCt in control treatment). * means significant difference at p < 0.05.
3.3. Inhibitory effect of Vt-7 against aflatoxin biosynthesis in transcriptional level
3.6. Broad spectrum antifungal activity of volatiles from strain Vt-7 For a better understanding of the effect of volatiles on aflatoxins production, the expression of genes was analyzed. Five genes with important functions in aflatoxin biosynthesis pathway of AF were selected for RT-qPCR analysis, and all genes were down-regulated by affected by volatiles from Vt-7compared to control treatment. Especially for norB gene, the expression was down regulated up to 13.86 fold. The expression of other two genes including ordB, norM were decreased by 3.64 and 3.29 folds with significant differences compared to control treatment, respectively (Fig. 3).
Eight important phytopathogenic fungi including Fusarium graminearum, Alternaria alternata, Aspergillus flavus, Aspergillus niger, Aspergillus fumigatus, Botrytis cinerea, Colletotrichum graminicola and Magnaporthe oryzae were used to test the broad antifungal activity of strain Vt-7. Some of fungi including Fusarium graminearum, Colletotrichum graminicola, Aspergillus flavus and Botrytis cinerea, grew quickly on the surface of PDA plate, the diameter of mycelia ranged between 7 and 9 cm 5 dpi. The other four fungi grow slowly on PDA plate with diameter less than 5.5 cm 5 dpi. In Vt-7 treatment, the growth of fungi was greatly inhibited, and few mycelia were observed on PDA plate, respectively. The inhibition rate of Vt-7 against Fusarium graminearum, Magnaporthe oryzae, Colletotrichum graminicola, Alternaria alternata and Botrytis cinerea was up to 100%, respectively. The inhibition activity against Aspergillus niger and Aspergillus fumigatus is 83.1% and 97.8% respectively (Fig. 6). These results demonstrate that strain Vt-7 produced active volatiles which provide an efficient and wide spectrum of antifungal activity against phytopathogenic fungi from different genera.
3.4. Bio-control activity of Vt-7 against AF and aflatoxins in storage As shown in Fig. 4, the disease symptom of peanuts at aw 0.92 is more severe than that of aw 0.86 in control. The kernel surface in control treatment was covered with abundant AF conidia and mycelia. The disease incidence of peanuts was up to100% both at aw 0.86 and 0.92, respectively. In Vt-7 treatment, no disease symptom was detected on the Vt-7-treated peanuts at both aw. The growth of AF on peanuts was greatly inhibited by the production of volatiles from Vt-7. The disease incidence of peanuts was 0%, and the inhibition rate was up to 100% compared to control treatment. Additionally, the content of aflatoxins in each treatment was also
3.7. Identification of volatiles from strain Vt-7 Volatiles from strain Vt-7 were collected by solid phase micro-extraction (SPME) syringe and analyzed with GC-MS/MS system. Three putative volatiles were detected in the volatiles of Vt-7 (Fig. 7 and Table 2). These compounds with relative abundance (peak area to the total peak area of all compounds) more than 2% were identified as Butane,1-methoxy-3-methyl- (BMM, 102 Da), 1-Pentanol (88 Da) (Supplementary Fig. 1) and Phenylethyl Alcohol (PA, 122 Da) (Supplementary Fig. 2) through aligned in National Institute of Standards and Technology (NIST) 17 MS database. The retention time of them in GC-MS/MS ranged from 2.576 to 10.607 min, respectively. 1Pentanol is the most abundant compounds in volatiles Vt-7 with relative abundance up to 70.13%. The other two compounds are less than that (BMM contains 13.60%, and PA is 3.8%). To prove the potential bio-activity of them, two compounds (1-Pentanol and PA) with standard were purchased and tested their antagonistic activity against AF mycelia and conidia.
Fig. 4. Biocontrol efficacy of volatiles from Vt-7 against Aspergillus flavus and aflatoxins on peanuts of aw 0.8 and aw 0.9. (A) Phenotypes of peanuts infected with Aspergillus flavus in the presence (Vt-7+CK) or absence (CK) of strain Vt-7 at 28 °C for 5 days. (B) AFB1 and AFB2 in peanut samples were detected using LC-ESI-MS system.
3.8. Minimal inhibitory concentration analysis of volatiles from Vt-7 against AF 1-Pentanol and PA standards were diluted to different concentrations and co-cultural with AF in sealed petri dishes to test the antifungal 5
Food Control 106 (2019) 106718
A.-D. Gong, et al.
Fig. 5. Scanning electron microscope analysis of Aspergillus flavus on peanut surface. Peanuts of aw 0.92 inoculated with A. flavus conidia was incubated with (Vt7+CK) or without (CK) the strain Vt-7 for 5 days. co: conidia, cp: conidiophore, my: mycelia, sg: sterigma.
chemical agents were always sprayed on the surface of grain bulk, which could inhibit the growth of AF on the surface. But it is difficult to control the conidia existed in the air or inside the grain bulk. Hence, it was difficult for long term storage. Volatiles would be ideal control agents due to its gas property that can fully be in contact with the floating conidia of AF. The mycelial growth of AF on PDA plate was greatly inhibited when challenged with Vt-7 in sealed airspace. It therefore stands to reason that volatiles from Vt-7 are the main factors affecting the AF growth in a sealed airspace. Effective biocontrol activity was also observed in peanuts inoculation tests of two water activity at storage. Conidia inoculated on peanuts challenged with Vt-7 did not germinate, and the structure of conidia was severely damaged by volatiles, resulting in dehydrated surface and shrinking cell bodies. Additionally, the expression of genes in aflatoxin biosynthesis pathways was down regulated by volatiles from Vt-7. These genes, including AccC(Acetyl-CoA to Malonlyl-CoA, first reaction and rate-limiting step in aflatoxins pathway), NorM(Noranthrone monooxygenase, a front gene in aflatoxins pathway), norB (NOR dehydrogenase, a middle gene in aflatoxins pathway) and ordB (Monooxygenase/oxidase, a late gene in aflatoxins pathway) distributed in the whole pathway of aflatoxins biosynthesis and play essential roles in the process. And all the transcript levels of these genes were reduced by volatiles, which in turn resulted in the eventually prevention of aflatoxins production in peanuts samples at storage. Additionally, we also proved that volatiles from Vt-7 could greatly inhibit the growth of other seven important fungal strains. These fungi include Fusarium graminearum, Colletotrichum sp., Alternaria alternata, Botrytis cinerea and Aspergillus sp. These fungal strains can cause severe disease on crops, fruits, vegetables and other food products in field and storage. In the tests, we also proved that strain Vt-7 can greatly inhibit the growth of these fungi strains in vitro, and the inhibition rate against some strains was up to 100%. That opens a new insight for the application of strain Vt-7, as well as the volatiles, as antioxidant and antiseptic agent to control crop, vegetable, fruit and food disease in storage. Among the currently identified microbe volatiles, the most effective compounds against AF were 2,4-bis (1,1-dimethylethyl)-phenol and dimethyl trisulfide from Shewanella algae with MICs of 100, 200 μL/L, respectively. However, the relative abundances of these two compounds were only 14.195% and 0.504%, respectively (Gong et al.,
activity. The results showed that both could easily evaporate, and inhibit AF mycelia growth and conidia germination at the concentrations ranged from 10 to 200 μL/L (compound volume/airspace volume). The inhibition rate ranged from 20 to 100%. PA showed better antagonistic activity, the minimal inhibitory concentrations (MIC) of PA against AF mycelia and conidia are 200 and 100 μL/L, respectively (Fig. 8). For 1Pentanol, the MICs to AF conidia and mycelia are 200 μL/L and more than 200 μL/L, respectively. 4. Discussion A. flavus and its carcinogen aflatoxins cause great deleterious effect to humans all over the world. The prevention of AF and aflatoxin has been being considered as essential in the storage of food and oil crops. Here, we identified and showed that two novel antifungal volatiles (1Pentanol and PA) produced by E. asburiae Vt-7 can inhibit AF growth, conidia germination, gene expression in aflatoxin biosynthesis, and aflatoxins contamination in peanuts at storage. In addition, the volatiles were found effective against all fungal pathogens tested in vitro, indicting a broad spectrum antifungal activity. To the best of our knowledge, this is the first report of volatiles from Enterobacter spp. with antagonistic activity against AF and its associated aflatoxins. Strain Vt-7 was isolated from 100 year old tea rhizosphere in Cheyun mountain about an altitude of 800 m. The soil is acid at pH 4.5–5.5. Because of pruning in every year, the soil contains large amount of humus. Hence, large temperature variation, acidic environment and abundant humus may endow new species and novel functional microbes. For strain Vt-7, the phylogeny results showed that it gathered with E. asburiae species in one branch. But, it also exhibited a long genetic distance with these homologous E. asburiae strains in the branch. Moreover, Vt-7 also had 12 specific biochemical reactions (among all 76 reactions) different from E. asburiae. Based on the molecular and biochemical analysis, we concluded that strain Vt-7 was identified to be E. asburiae, and, it was also most possibly a novel subspecies in E. asburiae, which needed further evidence to prove that. Since AF is an airborne fungal pathogen, the great damage of AF to food and foodstuff at post-harvest was mostly because of the production of airborne conidia. Conidia could rapidly spread in the whole storage space, induce plant disease and produce aflatoxins. Traditional
Fig. 6. Broad antifungal activity of strain Vt-7 against eight fungal pathogens. Each fungus was cultured on PDA plate with (Vt-7+CK) or without (CK) the Vt-7, respectively. The diameters of fungal colonies were measured to calculate the inhibition rate. Eight different fungal strains including Fusarium graminearum (Fg), Magnaporthe oryzae(Mo), Aspergillus nigro (An), Aspergillus flavus(AF), Colletotrichum graminicola(Cg), Alternaria alternata(Aa), Aspergillus fumigatus (Afu) and Botrytis cinerea(Bc) were used in the tests. 6
Food Control 106 (2019) 106718
A.-D. Gong, et al.
Fig. 7. GC-MS/MS spectra of volatiles emitted from strain Vt-7. Volatile compounds of Vt-7 cultured on NA plate were detected 24 hpi. The compounds identified in Vt-7 (Vt-7+NA) spectra omitting the same compounds in blank NA (NA) medium were considered as authentic. Table 2 GC-MS/MS analysis of VOCs from strain Vt-7 on NA plate. The compounds identified in Vt-7 spectra omitting the same compounds in CK were considered as authentic compounds. a Retention time of each compound detected in GC-MS/MS spectra. b The area of each identified compound to the total area of all identified compound in spectra. c, d Match and R. match mean the forward and reverse similarity of compound spectra to entries in the NIST 17 MS spectral database, respectively. e molecular weight. No
Compounds name
RT (min)
1 2 3
Butane,1-methoxy-3-methyl1-Pentanol Phenylethyl Alcohol
2.576 2.88 10.607
a
Area (%)b
Match
13.60 70.13 3.80
934 948 879
c
R. match 941 958 919
d
formula
MW
C6H14O C5H12O C8H10O
102 88 122
e
aflatoxins. 1-Pentanol showed high effect of inhibition against conidial germination at MIC of 200 μL/L (compound volume/airspace volume) in sealed airspace. Pentanol is commonly used as an internal combustion fuel, which can also be used as partial substitute to diesel or biodiesel fuel (Nanthagopal et al., 2018). To reduce the use of fossil fuels, research has been carried out to develop cost-effective methods to produce chemically identical bio-pentanol using fermentation (Rude & Schirmer, 2009). Our results also provided an alternative biological method for the production of pentanol by using bacteria E. aerogenes Vt7. PA (3.8%, 122 Da) showed better antagonistic activity than 1-pentanol against AF. As a natural compound, PA commonly existed in soybean and mung beans (Lee & Shibamoto, 2000). It is considered as a safe additive in a wide variety of cosmetic products and foods such as beer, wine, olive oil, grapes, tea, apple juice, and coffee. It could also be used as antioxidative agents to extend the shelf-life and quality of strawberries at storage (Mo & Sung, 2007). In fact, volatiles from microbe have been widely used in many aspects of agriculture. For example, it can be used as effective agents in controlling plant pathogens and promoting plant growth in soil. Dimethyl disulfide (DMDS) has been applied in different crops, providing satisfactory control of root knot nematodes and cyst nematodes (Curto, Dongiovanni, Sasanelli, Santori, & Myrta, 2014; Fritsch et al., 2014; Sasanelli, Dongiovanni, Santori, & Myrta, 2014), as well as other soil-borne pathogens including Sclerotium rolfsii, Verticillium dahlia and Rhizoctonia solani (Fritsch, 2004.). Recently, Papazlatani showed that DMDS with great antifungal activity even at the low dose rate (56.4 g m−2) can drastically reduce the population of the major soil borne tomato pathogens F. oxysporum and R. solani (Papazlatani et al., 2016). Another volatile (caryophyllene) from antagonistic strain Fusarium oxysporum MSA35 can repress gene expression of two putative virulence genes in pathogenic F. oxysporum lactucae, which influences the mycelial growth and repress disease (Minerdi, Bossi, Gullino, & Garibaldi, 2009). In this study, 1-pentanol and PA produced by strain Vt-7 showed high antagonistic activity against broad pathogens, hence, we believe that the strain Vt-7 would endow more effective biocontrol activity against pathogens in soil as well. This work, investigates for the first time the capability of E. aerogenes Vt-7 as an effective mechanism of action against postharvest
Fig. 8. MIC analysis of volatiles against mycelia growth and conidia germination of AF. Two individual compounds 1-Pentanol and Phenylethyl Alcohol (PA) at different concentrations were assayed for their inhibition activity against mycelial growth and conidial germination on PDA for 4 days.
2015). Based on our results, PA and 1-Pentanol showed similar biocontrol efficacy at relative low concentration of 100, 200 μL/L. Moreover, the abundances of these two compounds were 73.93% in Vt-7 volatiles. In the volatile profile of Vt-7, 1-Pentanol was the most abundant compounds with relative abundance at 70.13%. The small molecular weight of 1-Pentanol (88 Da) warrants its high volatility which in turn can easily spread in sealed space to control AF and 7
Food Control 106 (2019) 106718
A.-D. Gong, et al.
pathogens. The results provide favorable evidence about the biocontrol activity of Vt-7, as well as the produced volatiles, PA and 1-Pentanol, against AF, aflatoxins and other important fungal pathogens. We believe that the strain Vt-7 and its volatiles (PA and 1-Pentanol), can serve as novel biocontrol agents in controlling food and crop pathogens and mycotoxins in storage.
Shewanella algae strain YM8 produces volatiles with strong inhibition activity against Aspergillus pathogens and aflatoxins. Frontiers in Microbiology, 6, 1091. Gong, A. D., Li, H. P., Yuan, Q. S., Song, X. S., Yao, W., He, W. J., et al. (2014). Antagonistic mechanism of iturin A and plipastatin A from Bacillus amyloliquefaciens S76-3 from wheat spikes against Fusarium graminearum. PLoS One, 10 e0116871. Gu, C. T., Li, C. Y., Yang, L. J., & Huo, G. C. (2014). Enterobacter xiangfangensis sp. nov., isolated from Chinese traditional sourdough, and reclassification of Enterobacter sacchari Zhu et al. 2013 as Kosakonia sacchari comb. nov. International Journal of Systematic and Evolutionary Microbiology, 64, 2650–2656. Hua, S. S. T., Beck, J. J., Sarreal, S. B. L., & Gee, W. (2014). The major volatile compound 2-phenylethanol from the biocontrol yeast, Pichia anomala, inhibits growth and expression of aflatoxin biosynthetic genes of Aspergillus flavus. Mycotoxin Research, 30, 71–78. Kamika, I., & Takoy, L. L. (2011). Natural occurrence of aflatoxin B1 in peanut collected from kinshasa, democratic republic of Congo. Food Control, 22, 1760–1764. Kedia, A., Prakash, B., Mishra, P. K., & Dubey, N. K. (2014). Antifungal and antiaflatoxigenic properties of Cuminum cyminum (L.) seed essential oil and its efficacy as a preservative in stored commodities. International Journal of Food Microbiology, 168, 1–7. Kirk, G. D., Bah, E., & Montesano, R. (2006). Molecular epidemiology of human liver cancer: Insights into etiology, pathogenesis and prevention from the Gambia, west Africa. Carcinogenesis, 27, 2070–2082. Kong, Q., Shan, S. H., Liu, Q. Z., Wang, X. D., & Yu, F. T. (2010). Biocontrol of Aspergillus flavus on peanut kernels by use of a strain of marine Bacillus megaterium. International Journal of Food Microbiology, 139, 31–35. Kuang, S. Y., Lekawanvijit, S., Maneekarn, N., Thongsawat, S., Brodovicz, K., Nelson, K., et al. (2015). Hepatitis B 1762T/1764A mutations, hepatitis C infection, and codon 249 p53 mutations in hepatocellular carcinomas from Thailand. Cancer Epidemiology Biomarkers & Prevention, 14, 380–384. Lee, K. G., & Shibamoto, T. (2000). Antioxidant properties of aroma compounds isolated from soybeans and mung beans. Journal of Agricultural and Food Chemistry, 48, 4290–4293. Lemfack, M. C., Nickel, J., Dunkel, M., Preissner, R., & Piechulla, B. (2014). mVOC: a database of microbial volatiles. Nucleic Acids Research, 42, 744–748. Li, Z. Q., Ding, B., Zhou, X. P., & Wang, G. L. (2017). The rice dynamin-related protein OsDRP1E negatively regulates programmed cell death by controlling the release of cytochrome c from mitochondria. PLoS Pathogens, 13 e1006157. Liu, X., Guan, X. L., Xing, F. G., Lv, C., Dai, X. F., & Liu, Y. (2017). Effect of water activity and temperature on the growth of Aspergillus flavus, the expression of aflatoxin biosynthetic genes and aflatoxin production in shelled peanuts. Food Control, 82, 325–332. Medina, A., Rodriguez, A., & Magan, N. (2014). Effect of climate change on Aspergillus flavus and aflatoxin B1 production. Frontiers in Microbiology, 5, 348. Minerdi, D., Bossi, S., Gullino, M. L., & Garibaldi, A. (2009). Volatile organic compounds: A potential direct long-distance mechanism for antagonistic action of Fusarium oxysporum strain MSA 35. Environmental Microbiology, 11, 844–854. Mo, E. K., & Sung, C. K. (2007). Phenylethyl alcohol (PEA) application slows fungal growth and maintains aroma in strawberry. Postharvest Biology and Technology, 45, 234–239. Nanthagopal, K., Ashok, B., Saravanan, B., Patel, D., Sudarshan, B., & Ramasamy, R. A. (2018). An assessment on the effects of 1-pentanol and 1-butanol as additives with Calophyllum Inophyllum biodiesel. Energy Conversion and Management, 158, 70–80. Outlaw, J., Waller, M., Richardson, J., Richburg, N., Russell, L., Welch, M., et al. (2006). Economics of aflatoxin risk management in the selected Southern States. Agricultural and Applied Economics Association. Papazlatani, C., Rousidou, C., Katsoula, A., Kolyvas, M., Genitsaris, S., Papadopoulou, K. K., et al. (2016). Assessment of the impact of the fumigant dimethyl disulfide on the dynamics of major fungal plant pathogens in greenhouse soils. European Journal of Plant Pathology, 146, 391–400. Paranagama, P. A., Abeysekera, K. H., Abeywickrama, K., & Nugaliyadde, L. (2003). Fungicidal and anti-aflatoxigenic effects of the essential oil of Cymbopogon citratus (DC.) Stapf. (lemongrass) against Aspergillus flavus Link. isolated from stored rice. Letters in Applied Microbiology, 37, 86–90. Passone, M. A., & Etcheverry, M. (2014). Antifungal impact of volatile fractions of Peumus boldus and Lippia turbinata on Aspergillus section Flavi and residual levels of these oils in irradiated peanut. International Journal of Food Microbiology, 168, 17–23. Peñuelas, J., Asensio, D., Tholl, D., Wenke, K., Rosenkranz, M., Piechulla, B., et al. (2014). Biogenic volatile emissions from the soil. Plant, Cell and Environment, 37, 1866–1891. Piechulla, B., Lemfack, M. C., & Kai, M. (2017). Effects of discrete bioactive microbial volatiles on plants and fungi. Plant, Cell and Environment, 40, 2042–2067. Robens, J., & Cardwell, K. (2003). The costs of mycotoxin management to the USA: Management of aflatoxins in the United States. Journal of Toxicology - Toxin Reviews, 22, 139–152. Rude, M. A., & Schirmer, A. (2009). New microbial fuels: A biotech perspective. Current Opinion in Microbiology, 12, 274–281. Santos, L., Marín, S., Sanchis, V., & Ramos, A. J. (2011). In vitro effect of some fungicides on growth and aflatoxins production by Aspergillus flavus isolated from Capsicum powder. Food Additives & Contaminants: Part A, 28, 98–106. Sasanelli, N., Dongiovanni, C., Santori, A., & Myrta, A. (2014). Control of the root-knot nematode Meloidogyne incognita by dimethyl disulfide (DMDS) applied in drip irrigation on melon and tomato in Apulia and Basilicata (Italy). Acta Horticulturae, 1044, 401–404. Shephard, G. S. (2008). Impact of mycotoxins on human health in developing countries. Food Additives & Contaminants: Part A, 25, 146–151. Strosnider, H., Azziz-Baumgartner, E., Banziger, M., Bhat, R. V., Breiman, R., Brune, M., et al. (2006). Workgroup report: Public health strategies for reducing aflatoxin
Conflicts of interest The authors declare that they have no conflict of interest. Acknowledgments This work was supported by the National Natural Science Foundation of China (31701740), Scientific and Technological Project in Henan Province (182102110018), Scientific Research Key Project Fund of Ministry of Education in Henan province (16A180036), Opening Subject of Key Laboratory of Integrated Pest Management in Crops in Central China, Ministry of Agriculture (2018ZTSJJ2), and Nanhu Scholars Program for Young Scholars of XYNU. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.foodcont.2019.106718. References Asters, M. C., Williams, W. P., Perkins, A. D., Mylroie, J. E., Windham, G. L., & Shan, X. Y. (2014). Relating significance and relations of differentially expressed genes in response to Aspergillus flavus infection in maize. Scientific Reports, 4, 4815. Banik, A., Mukhopadhaya, S. K., & Dangar, T. K. (2016). Characterization of N 2-fixing plant growth promoting endophytic and epiphytic bacterial community of Indian cultivated and wild rice (Oryza spp.) genotypes. Planta, 243, 799–812. Boukaew, S., & Prasertsan, P. (2014). Suppression of rice sheath blight disease using a heat stable culture filtrate from Streptomyces philanthi RM-1-138. Crop Protection, 61, 1–10. Bui-Klimke, T. R., Guclu, H., Kensler, T. W., Yuan, J. M., & Wu, F. (2014). Aflatoxin regulations and global pistachio trade: Insights from social network analysis. PLoS One, 9 e92149. Chai, L. Q., Li, W. W., & Wang, X. W. (2017). Identification and characterization of two arasin-like peptides in red swamp crayfish Procambarus clarkii. Fish & Shellfish Immunology, 70, 673–681. Chai, L. Q., Meng, J. H., Gao, J., Xu, Y. H., & Wang, X. W. (2018). Identification of a crustacean beta-1,3-glucanase related protein as a pattern recognition protein in antibacterial response. Fish & Shellfish Immunology, 80, 155–164. Chen, Y. J., Kong, Q., & Liang, Y. (2019). Three newly identified peptides from Bacillus megaterium strongly inhibit the growth and aflatoxin B1 production of Aspergillus flavus. Food Control, 95, 41–49. Chen, M. Y., Li, K., Li, H. P., Song, C. P., & Miao, Y. C. (2017). The glutathione peroxidase gene family in gossypium hirsutum: Genome-wide identification, classification, gene expression and functional analysis. Scientific Reports, 7, 15. Cho, K. M., Math, R. K., Hong, S. Y., Asraful Islam, S. M., Mandanna, D. K., Cho, J. J., et al. (2009). Iturin produced by Bacillus pumilus HY1 from Korean soybean sauce (kanjang) inhibits growth of aflatoxin producing fungi. Food Control, 20, 402–406. Cleveland, T. E., Carter-Wientjes, C. H., De Lucca, A. J., & Boue, S. M. (2009). Effect of soybean volatile compounds on Aspergillus flavus growth and aflatoxin production. Journal of Food Science, 74, 83–87. Curto, G., Dongiovanni, C., Sasanelli, N., Santori, A., & Myrta, A. (2014). Efficacy of dimethyl disulfide (DMDS) in the control of the root-knot nematode Meloidogyne incognita and the cyst nematode Heterodera carotae on carrot in field condition in Italy. VIII international symposium on chemical and non-chemical soil and substrate disinfestation: Vol 1044, (pp. 405–410). Ding, W., Si, M., Zhang, W. P., Zhang, Y. L., Chen, C., Zhang, L., et al. (2015). Functional characterization of a vanillin dehydrogenase in Corynebacterium glutamicum. Scientific Reports, 5, 8044. Fernando, W. G. D., Ramarathnam, R., Krishnamoorthy, A. S., & Savchuk, S. C. (2005). Identification and use of potential bacterial organic antifungal volatiles in biocontrol. Soil Biology and Biochemistry, 37, 955–964. Fritsch, J. (2004). Dimethyl disulfide as a new chemical potential alternative to methyl bromide in soil disinfestation in France. VI international symposium on chemical and non-chemical soil and substrate disinfestation-SD 2004: Vol 698, (pp. 71–76). Fritsch, J., Fouillet, T., Charles, P., Fargier-Puech, P., Ramponi-Bur, C., Descamps, S., et al. (2014). French experiences with dimethyl disulfide (DMDS) as a nematicide in vegetable crops. VIII international symposium on chemical and non-chemical soil and substrate disinfestation: Vol 1044, (pp. 427–433). Gong, A. D., Li, H. P., Shen, L., Zhang, J. B., Wu, A. B., He, W. J., et al. (2015). The
8
Food Control 106 (2019) 106718
A.-D. Gong, et al.
Warth, B., Sulyok, M., Fruhmann, P., Mikula, H., Berthiller, F., Schuhmacher, R., et al. (2012). Development and validation of a rapid multi-biomarker liquid chromatography/tandem mass spectrometry method to assess human exposure to mycotoxins. Rapid Communications in Mass Spectrometry, 26, 1533–1540. Wild, C. P., & Montesano, R. (2009). A model of interaction: Aflatoxins and hepatitis viruses in liver cancer aetiology and prevention. Cancer Letters, 286, 22–28. Wu, F. (2015). Global impacts of aflatoxin in maize: Trade and human health. World Mycotoxin Journal, 8, 137–142. Zhuang, Z., Lohmar, J. M., Satterlee, T., Cary, J. W., & Calvo, A. M. (2016). The master transcription factor mtfA governs aflatoxin production, morphological development and pathogenicity in the fungus Aspergillus flavus. Toxins, 8, 29.
exposure in developing countries. Environmental Health Perspectives, 114, 1898–1903. Thobunluepop, P. (2009). The inhibitory effect of the various seed coating substances against rice seed borne fungi and their shelf-life during storage. Pakistan Journal of Biological Sciences, 12, 1102–1110. Tian, J., Wang, Y. Z., Lu, Z. Q., Sun, C. H., Zhang, M., Zhu, A. H., et al. (2016). Perillaldehyde, a promising antifungal agent used in food preservation, triggers apoptosis through a metacaspase-dependent pathway in Aspergillus flavus. Journal of Agricultural and Food Chemistry, 64, 7404–7413. Torres, A. M., Barros, G. G., Palacios, S. A., Chulze, S. N., & Battilani, P. (2014). Review on pre- and post-harvest management of peanuts to minimize aflatoxin contamination. Food Research International, 62, 11–19.
9
Contents lists available at ScienceDirect
Food Control journal homepage: www.elsevier.com/locate/foodcont
Antifungal activity of volatile emitted from Enterobacter asburiae Vt-7 against Aspergillus flavus and aflatoxins in peanuts during storage
T
An-Dong Gonga,d,∗, Fei-Yan Donga, Meng-Jun Hub, Xian-Wei Konga, Fen-Fen Weia, Shuang-Jun Gongc, Yi-Mei Zhanga, Jing-Bo Zhangd, Ai-Bo Wue, Yu-Cai Liaod a
College of Life Science, Xinyang Normal University, Xinyang, 464000, China Department of Plant Science and Landscape Architecture, University of Maryland, College Park, MD, 20742, USA c Institute of Plant Protection and Soil Science, Hubei Academy of Agricultural Sciences, Wuhan, 430070, China d Molecular Biotechnology Laboratory of Triticeae Crops, Huazhong Agricultural University, Wuhan, 430070, China e Shanghai Institute for Biological Sciences, Chinese Academy of Sciences, Shanghai, 200031, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Aspergillus flavus Aflatoxin Postharvest Enterobacter asburiae Volatile 1-Pentanol Phenylethyl alcohol
The contamination of food with Aspergillus flavus and subsequent aflatoxins is considered as one of the most severe safety problems in the world. The application of microorganisms and the produced bio-active compounds is considered as the most promising method for controlling foodborne pathogens and mycotoxins contamination both in pre- and post-harvest. Vt-7, identified as Enterobacter asburiae, was able to completely inhibit the growth of Aspergillus flavus (AF) and other seven important fungal pathogens by the production of volatiles. Additionally, it can also significantly inhibited AF infection on peanuts in storage, down-regulated the gene expression of aflatoxin biosynthesis and eventually prevented aflatoxins production. Scanning electron microscope further proved that Vt-7 volatiles prevented conidia germination of AF on peanut surface, and severely destroyed the conidia structure. Gas chromatography – tandem mass spectrometry revealed that two abundant compounds (1Pentanol and Phenylethyl Alcohol) were involved in the volatile profiles. They showed great antagonistic activity against AF with minimal inhibitory concentration at 200 μL/L. Therefore, E. asburiae Vt-7, and volatiles 1Pentanol and Phenylethyl Alcohol were effective agents in controlling AF and aflatoxins in peanut during storage. They will provide novel strategies for the application of microbe and bio-active compounds against fungal pathogens and mycotoxins in food and grains during storage.
1. Introduction
contamination can often result in a significant economic losses. The total losses of crop caused by aflatoxin in the USA was reported to be nearly $500 million annually (Outlaw et al., 2006; Wu., 2015), and the additional annual costs of disease management was about $20 - $50 million (Robens & Crdwell, 2003). In order to minimize the potential health risk, permissible levels for aflatoxins have been implemented to control AF in foods and feed stuffs in over 100 countries (Bui-Klimke, Guclu, Kensler, Yuan, & Wu, 2014). However, owing to the food shortages, some less developed countries have not yet regulated aflatoxin levels and consequently led to serious human health issues (Medina, Rodriguez, & Magan, 2014; Shephard, 2008). Thus, inhibition of the development of AF and aflatoxins is of paramount importance to those less developed countries. Currently, the control of AF and aflatoxins at storage largely relies on artificial removal, temperature and humidity control as well as chemical agents
Aspergillus flavus (AF) is ubiquitous aflatoxigenic pathogen which can infect many important crops at pre- and post-harvest, such as maize, peanut, rice, cottonseed and their products (Asters et al., 2014; Kamika & Takoy, 2011). The fungus can produce highly toxic and carcinogenic aflatoxins, posing a major threat to animal and human health worldwide (Kirk, Bah, & Montesano, 2006; Kuang et al., 2015; Wild & Montesano, 2009). To date, eighteen different aflatoxins produced by Aspergillus species have been reported (Strosnider et al., 2006). Among them, AFB1 is considered to be the most toxic and carcinogenic to humans and livestock, which has been classified as Group I carcinogen to humans by the International Agency for Research (IARC) (Robens & Cardwell, 2003; Zhuang, Lohmar, Satterlee, Cary, & Calvo, 2016). In addition to causing serious health issues, AF and aflatoxins
Abbreviations: AF, Aspergillus flavus; BMM, Butane,1-methoxy-3-methyl; PA, Phenylethyl Alcohol ∗ Corresponding author. College of Life Science, Xinyang Normal University, Xinyang, 464000, China. E-mail address: [email protected] (A.-D. Gong). https://doi.org/10.1016/j.foodcont.2019.106718 Received 21 February 2019; Received in revised form 14 June 2019; Accepted 15 June 2019 Available online 18 June 2019 0956-7135/ © 2019 Elsevier Ltd. All rights reserved.
Food Control 106 (2019) 106718
A.-D. Gong, et al.
121 °C for 20 min. The kernels were placed in 4 °C and used within 2 days. Eight phytopathgenic fungal including Fusarium graminearum, Alternaria alternata, Aspergillus flavus, Aspergillus niger, Aspergillus fumigatus, Botrytis cinerea, Colletotrichum graminicola and Magnaporthe oryzae were isolated from disease plants, and stored in our tests to detect the broad antifungal activity of strain Vt-7 (Gong et al., 2015).
(Torres, Barros, Palacios, Chulze, & Battilani, 2014). However, these control measures are time-consuming and costly. The application of chemical agents may also cause contaminations in food and environment, and stimulated the production of aflatoxins in food (Santos, Marín, Sanchis, & Ramos, 2011). Moreover, the rate of emergence of resistant AF strains increases rapidly due to the intensive use of chemical agents (Tian et al., 2016). Plant-derived antifungal bioactive compounds, such as Peumus boldus, Lippie turbinate (Passone & Etcheverry, 2014), clove (Eugenia caryophillis) (Thobunluepop, 2009), Cuminum cyminum (Kedia, Prakash, Mishra, & Dubey, 2014), lemongrass (Paranagama, Abeysekera, Abeywickrama, & Nugaliyadde, 2003), and soybean (Cleveland, Carter-Wientjes, De Lucca, & Boue, 2009), have found effective for the control of AF post-harvest. However, extraction of antifungal compounds requires a large amount of plant sources which are not always available. Microbes, however, are often widely spread and easy to culture, which have been found effective against a wide range of fungal pathogens. For example, Bacillus megaterium (Kong, Shan, Liu, Wang, & Yu, 2010; Chen, Kong, & Liang, 2019), B. pumilus (Cho et al., 2009) and Shewanella algae (Gong et al., 2015) have been used in controlling AF and aflatoxins at storage. In addition to some secondary metabolite (such as lipopeptides) used for AF control at storage, volatiles emitted from certain bacteria have also shown efficacy against fungi. In fact, microorganisms produce a wealth of small volatile compounds with the potential to act as infochemicals (Peñuelas et al., 2014). So far, approximately 1,300 microbial volatiles obtained from c.a. 600 microorganisms are currently registered in the volatile database (http://bioinformatics.charite.de/mvoc/) (Lemfack, Nickel, Dunkel, Preissner, & Piechulla, 2014). Although a large number of volatiles have been reported, only 50 discrete volatiles were effective for controlling fungal pathogens (Piechulla, Lemfack, & Kai, 2017). Compared to the treatment of direct application of living bacterial strains, the use of volatiles can often achieve a better coverage due to its gas property. Unfortunately, very few bio-active volatiles were found effective in controlling AF and aflatoxins. Our previous work revealed that volatiles produced by Shewanella algae, including dimethyl trisulfide and 2,4-bis (1,1-dimethylethyl)phenol, can significantly inhibit the growth of AF in vitro and the conidia germination, and prevent aflatoxins production in stored peanut and maize (Gong et al., 2015). In the present study, we further report yet another uncharacterized volatile, emitted by an E. asburiae strain, showing strong efficacy for AF control and aflatoxins preventation. The objectives of our study are to 1) evaluate the antifungal effect of E. asburiae Vt-7 on mycelial growth against AF; 2) identify the effective bio-active compounds emitted from strain Vt-7, 3) test the biocontrol activity against AF and aflatoxins in storage, and elucidate the inhibitory mechanism of volatiles on AF cell structure.
2.2. Identification of strain Vt-7 Vt-7 was cultured in NB medium and incubated in a shaker (Zhicheng Analytical Instrument Manufacturing Co., Ltd., Shanghai, China) at 200 rpm at 28 °C in darkness for 48 h. The bacterial body was collected for DNA extraction as described previously (Gong et al., 2014). The 16S rRNA sequences were amplified with 16S rRNA universal primers (Gong et al., 2014). PCR was conducted at 95 °C for 5 min; followed by 35 cycles at 95 °C for 30 s, 55 °C for 40 s and 72 °C for 40 s; and a final extension at 72 °C for 10 min. PCR products were separated on agarose gel (1%) in 1x Tris-acetate EDTA buffer at 100 v for 30 min. Sequencing was conducted at Tianyi Huiyuan Biotechnology Co., Ltd. The sequences of the strain Vt-7 were then blasted against the NCBI database (https://blast.ncbi.nlm.nih.gov/Blast.cgi). Based on blast results, sequences of 16S rRNA from other closely related bacterial species, including E. asburiae (KT766080.1, JQ659696.1, MH071322.1, AB004744.1 and JQ795786.1), Enterobacter aerogenes (KJ631293.1, KJ631292.1), Leclercia adecarboxylate (KT937143.1, KU705736.1), Enterobacter bugandensis (NR148649.1) and other homologous strains retrieved from Gu (Gu, Li, Yang, & Huo, 2014) were used to construct the phylogenetic tree using neighbor-joining method as described previously (Chen, Li, Li, Song, & Miao, 2017; Ding et al., 2015). Biochemical activity of strain Vt-7 was identified using BIOLOG MicroStation™ System (Biolog Inc, USA). Briefly, fresh Vt-7 clone was inoculated into IF-A GEN III Inoculating Fluid to OD600 = 0.95, and then the suspension were injected into GEN III MicroPlate and cultured at 37 °C for 12 h in darkness. The biochemical reaction of Vt-7 in each cell of MicroPlate was then aligned with bacterial database in BIOLOG MicroStation™ System (Banik, Mukhopadhaya, & Dangar, 2016). 2.3. Antagonistic activity of volatiles from strain Vt-7 against AF mycelia To prove the antagonistic activity of volatiles from Vt-7, antifungal activity of volatiles against AF mycelia was conducted in two sealed petri dishes (90 mm in diameter) as described previously (Fernando, Ramarathnam, Krishnamoorthy, & Savchuk, 2005). Fresh AF conidia inoculated in PDB medium and cultured at 150 rpm and 28 °C for 2 days to produce mycelial pellet. The produced AF pellets were inoculated on PDA center challenging with strain Vt-7 in sealed airspace to detect the antifungal efficiency, respectively. Fresh AF mycelial pellet was inoculated to the center of one PDA plate using a tweezer. The other plate was equally divided into two parts. One part contains NA medium with Fresh Vt-7 cells spread on the surface (100 μL, OD600 = 1.7), and the other part was added with active charcoal (6 g). The two plates were placed FTF with PDA plate above. Four treatments were included in the experiment, including (1) AF mycelia pellet, (2) AF and charcoal, (3) AF and strain Vt-7, (4) AF, Vt-7 and charcoals. All plates were cultured at 28 °C in darkness. After 4 days of incubation, the mycelial diameter of AF in each treatment was measured.
2. Materials and methods 2.1. Microorganisms and plants Strain Vt-7 used in this study was isolated from rhizosphere soil of tea in a garden of cheyun mountain (North: N32°11′56.03″, East: E113°46′36.95″), Xinyang City, Henan Province in China. Briefly, the soil around the tea roots about 5–10 cm in depth was collected for bacterial screening. The soil was diluted to the concentration of 10−6 with sterilized water. The resulting 100 μL suspension was spread onto NA plate and incubated for 48 h. The bacterial clone was then streaked onto another NA plate, and the bodies were collected and tested the antagonistic activity against AF in face-to-face (FTF) dual cultural methods (Gong et al., 2015). Bacteria Vt-7 with antifungal activity against AF was selected for further experiments. Bacterial suspension in 25% glycerol was placed in −80 °C freeze (Zhongke Meiling Co., Ltd, Hefei, China) for long-term storage. Regular-sized peanuts (cv. Silihong) were purchased from local grocery stores. Peanut kernels were placed in dishes and autoclaved at
2.4. RNA extraction and RT-qPCR analysis AF pellet was inoculated on a PDA plate and incubated for 5 days. The resulting fresh conidia were washed off and filtered through single layer gauze and diluted to 106 cfu/mL. 100 μL conidia suspension was then spread on a PDA plate. A NA plate inoculated with Vt-7 was placed FTF with the PDA plate containing AF conidial suspension and incubated at 28 °C in darkness. The conidia on PDA surface without Vt-7 2
Food Control 106 (2019) 106718
A.-D. Gong, et al.
(Thermo Scientific, CA, USA) (Warth et al., 2012). Authentic reference standard aflatoxins (AFB1, AFB2, AFG1, and AFG2) purchased from Sigma (Sigma-Aldrich, St. Louis, MO, USA) were used as standards for quantitative analysis.
Table 1 Primers used in RT-qPCR analysis. Gene name
Gene functions
Primers used in the RT-qPCR
EstA
Esterase, versicona hemiacetal acetate to versiconal NOR dehydrogenase, norsolorinic acid to averantin Monooxygenase/oxidase, VA to DMST Acetyl-CoA carbosylase, AcetylCoA to Malonlyl-CoA Noranthrone monooxygenase, Noranthrone to norsolorinic acid Endogenous control, Reference gene
F: GGGCACTATCGCGCTATGA R: CGGACGTGCCCATCA F: AAGATGCTGGGCACGTTTG R: CATGGGTGAGGACGAATTGG F: ACCGCGTTGCACATCGT R: TGGGTGTCCACAACCTTCGT F: GCATCTGGATCGCCCTCT R: AGCGAGGATACCGAGGAT F: ATGGTAAGACCTGCCTGCTA R: GCGGTGTTCGTAGCGTTC
norB ordB AccC NorM
β-tubulin
2.7. Ultra-structure analysis of AF cells on peanut affected by Vt-7 Ultra-structure of AF cell on infected peanuts surface at aw 0.92 were examined through JSM-4800 scanning electron microscopy (SEM) (Hitachi, Tokyo, Japan). Peanuts in control and Vt-7 treatments were fixed with 0.1% (v/v) osmic acid for 1h, respectively. One small piece of the peanut coat was tore off and affixed to SEM stubs. Then, the samples were spraying with gold and examined with a SEM (Boukaew & Prasertsan, 2014).
F: AGCAGGCGAAGAAGGAGG R: ACGCCACGCATTTGATCTTC
2.8. Broad antagonistic activity of strain Vt-7 treatment was used as control. The organism of AF in the two treatments were collected 24 hpi used for RNA extraction. Total RNA was extracted with Trizol reagent (Invitrogen) according to the manufacturer's protocol. After DNaseI treatment, 2 μg of RNA was added to a 20 μL reaction system to synthesize first-strand cDNA using the Reverse Transcription System (Promega) according to the manufacturer's instructions. Using 1.0 μL of 1:20 diluted cDNA as template, PCR was performed in a 20 μL reaction volume with Bio-Rod SYBRII Super-Mix buffer on a Bio-Rad iQ2 PCR system (Bio-Rad) (Li, Ding, Zhou, & Wang, 2017). Five specific genes involved in aflatoxins biosynthesis pathway, including EstA (Esterase), norB (NOR dehydrogenase), ordB (Monooxygenase/oxidase), AccC (Acetyl-CoA carbosylase) and NorM (Noranthrone monooxygenase) were selected for RT-qPCR analysis (Table 1). β-tubulin gene was used as the endogenous control (reference gene) due to its relatively stable expression level (Hua, Beck, Sarreal, & Gee, 2014). The relative quantification of gene expression changes was calculated by using the 2−ΔΔCt method (Chai, Meng, Gao, Xu, & Wang, 2018; Chai, Li, & Wang, 2017).
Broad antifungal activity of the strain Vt-7 against other important fungi pathogens were tested using the FTF method described above. Eight pathogens were used in our test including Fusarium graminearum, Alternaria alternata, Aspergillus flavus, Aspergillus niger, Aspergillus fumigatus, Botrytis cinerea, Colletotrichum graminicola and Magnaporthe oryzae. The inhibition rate was calculated: Inhibition rate (%) = (the mycelia diameter of control – the mycelia diameter of Vt-7 treatment)/ the diameter of control × 100. 2.9. Volatiles identification and inhibitory analysis Vt-7 was spread on the surface of NA medium in a 100 mL flask and cultured in darkness at 28 °C for 24 h. The produced volatiles were collected with solid-phase micro-extraction (SPME) fiber containing divinylbenzene/carboxen/polydimethlsiloxane and detected with Gas chromatography–tandem mass spectrometry (GC-MS/MS) system (5977-7000D, Agilent Technologies Inc.) according to Gong's methods (Gong et al., 2015). The experiment was tested for two times. The compounds in Vt-7 profiles omitting the compounds appeared in control were considered as the final volatiles. To detect the antifungal activity of volatiles from Vt-7, authentic reference standard compound was purchased and used in the tests. Fresh AF pellet and conidia (10 μL of conidia of a 5Ⅹ105 cfu/mL) was inoculated to the center of PDA plate. Paper disk on another petri dish was added with authentic standard to a final concentration of 10 μL/L, 50 μL/L, 100 μL/L and 200 μL/L (compound volume to airspace volume), respectively. Disks added with water were used as control. Two dishes were sealed FTF and incubated at 28 °C as described before. The inhibition rate was calculated according to the method described above.
2.5. Control of AF and aflatoxins on peanuts with strain Vt-7 It is known that the water activity (aw) level of crop seeds is critical for pathogen infection and mycotoxin production (Liu et al., 2017). High aw levels always cause severe disease symptom. Biocontrol effect of strain Vt-7 against AF on harvested peanut were tested in a sealed desiccator (2.5 L airspace) with two different aw. Autoclaved peanut kernels (100 g) were inoculated with AF conidial suspension (1 mL, 5Ⅹ106 cfu/mL) (Gong et al., 2015). Sterilized water was then added to adjust aw to 0.86 and 0.92 using an electronic dewpoint water activity meter (Aqualab Series 3 model TE; Decagon Devices; Pullman, Washington, USA), respectively. The samples at each aw level were divided into two parts. One part was challenged with strain Vt-7 (the bacteria smeared on NA plate at the bottom of the desiccator), and the other part cultured in another desiccator challenged with plain NA plate as a control. The experiment was conducted twice independently. The maize and peanuts from treatments were collected 5 days post inoculation (dpi), and dried at 60 °C for four days. The dried samples were milled for aflatoxins extraction and quantification.
2.10. Data analysis All experiments were carried out at least in twice and results were reported as means ± standard deviations. The significant differences between mean values were determined using Student's T tests (p < 0.05) following one-way analysis of variance (ANOVA). The statistical analysis was performed using SPSS 16.0 software (SPSS Inc., Chicago, USA). 3. Results
2.6. Quantitative analysis of aflatoxins in peanuts 3.1. Identification of antifungal bacterial strain Vt-7 Aflatoxins in milled peanuts were extracted with organic reagent. One gram of milled sample was dissolved in 5 mL acetonitrile/water (84/16, v/v), vortex for 1 min, and sonicate for 60 min. After centrifugation, 1 mL of supernatant was transferred to a new tube, and mixed well with 1 mL of hexane for 10 min. The upper (organic) layer was sampled and detected through LC-ESI-MS with a Thermo Surveyor plus HPLC system coupled to a TSQ Quantum Ultra mass spectrometer
The 16S rRNA sequence of Vt-7 was blasted in GenBank database. The sequences are aligned into Enterobater genera, and showed great homologous to E. asburiae, E. aerogenes, L. adecarboxylata and E. bugandensis species. These homologous strains with similarity more than 97% were selected for the construction of the physiological tree. As a result, strain Vt-17 and E. asburiae could gather into a separated branch 3
Food Control 106 (2019) 106718
A.-D. Gong, et al.
Fig. 1. Phylogenetic tree of Vt-7 and other homologous strains retrieved from GenBank database based on 16S rRNA sequences. The tree was constructed with neighbor-joining methods and the scale bar represents the number of substitutions per base position.
(Fig. 1). That further proved that Vt-7 exhibited higher homology to E. asburiae. But, we can clearly found that strain Vt-7 and homologous E. asburiae strains had a long genetic distance in the branch. The biochemical analysis further proved that strain Vt-7 showed the greatest homologous to strain E. asburiae in BIOLOG MicroStation™ database (Biolog Inc, USA). Both of them could use 26 carbon resources such as D-Raffinose, α-D-Glucose, D-Sorbitol and Dextrin so on. They also showed same reaction in the tolerance to different concentration of NaCl, pH, some chemical agents and antibiotics. But, Vt-7 showed some specific biochemical reactions different from E. asburiae strain such as the application of Tween 40, α-D-Lactose, D-Melibiose, L-Galactonic Acid, Acetoacetic Acid, D-Malic Acid, D-Turanose, Mucic Acid and Formic Acid. Based on the molecular and biochemical analysis, we could conclude that strain Vt-7 was identified as E. asburiae in the study. But owing to the long genetic distance and other different biochemical reactions, it was speculated that Vt-7 may be a novel subspecies in E. asburiae.
Fig. 2. The inhibitory effect of volatiles from strain Vt-7 against AF. Mycelia pellet of AF was inoculated to the center of PDA plate (CK), challenged with active charcoal (CK + C), Vt-7 (CK + Vt-7) or both of them (CK + C + Vt-7), respectively.
3.2. Antifungal activity of volatiles from Vt-7 The mycelia of AF in control group grew quickly and spread over the surface of PDA plate in 5 days (Fig. 2). The diameter of mycelium in control treatment was up to 4.7 cm 5 dpi. In Vt-7 amended group, Vt-7 could greatly inhibit the growth of AF mycelia in dual-culture. The diameter of AF mycelia is less than 1 cm 5 dpi (Fig. 2). When active charcoal was added into the control treatment, the growth of mycelia was not affected, and the diameter is 4.7 cm 5 dpi. When active charcoal was added into the Vt-7 treatment, the mycelia
could grow to the diameter of 4.2 cm, which is larger than Vt-7 added treatment, but less than control and active charcoal only treatment. These results proved that volatiles produced by Vt-7 play important roles in controlling AF.
4
Food Control 106 (2019) 106718
A.-D. Gong, et al.
quantified in the test. Two aflatoxins (AFB1 and AFB2) in control samples were detected through LC-ESI-MS 5 dpi. Total aflatoxins of peanuts in control treatment was 404.72 and 831.92 ppb at aw 0.86 and 0.92, respectively. The most toxic compound, AFB1 occupied larger amount, and the concentration is up to 369.23 and 651.50 ppb, respectively. On the contrary, no aflatoxin was detected in any of the peanut samples treated with strain Vt-7. 3.5. Structural analysis of AF inoculated on peanut surface Scanning electron microscopy (SEM) was used to examine the structures of AF inoculated on peanut of aw 0.92 5 dpi. As shown in Fig. 5, AF mycelia covered the whole surface of peanut with the production of green conidia in control. On the contrary, no mycelia appeared on the surface of peanut kernels in Vt-7 added treatment. The same results were also observed under SEM. In control samples, AF conidia, mycelial structures, and conidiophore were ubiquitous on the peanut surface. In Vt-7 treatment, only few abnormal conidia appeared on the peanut surface. In addition, the conidia found on the treated samples were severely deformed.
Fig. 3. Relative expression of genes involved in aflatoxin biosynthesis after treatment of volatiles from Vt-7. The expression level was calculated with 2△△ct method (ΔΔct = ΔCt in Vt-7 treatment– ΔCt in control treatment). * means significant difference at p < 0.05.
3.3. Inhibitory effect of Vt-7 against aflatoxin biosynthesis in transcriptional level
3.6. Broad spectrum antifungal activity of volatiles from strain Vt-7 For a better understanding of the effect of volatiles on aflatoxins production, the expression of genes was analyzed. Five genes with important functions in aflatoxin biosynthesis pathway of AF were selected for RT-qPCR analysis, and all genes were down-regulated by affected by volatiles from Vt-7compared to control treatment. Especially for norB gene, the expression was down regulated up to 13.86 fold. The expression of other two genes including ordB, norM were decreased by 3.64 and 3.29 folds with significant differences compared to control treatment, respectively (Fig. 3).
Eight important phytopathogenic fungi including Fusarium graminearum, Alternaria alternata, Aspergillus flavus, Aspergillus niger, Aspergillus fumigatus, Botrytis cinerea, Colletotrichum graminicola and Magnaporthe oryzae were used to test the broad antifungal activity of strain Vt-7. Some of fungi including Fusarium graminearum, Colletotrichum graminicola, Aspergillus flavus and Botrytis cinerea, grew quickly on the surface of PDA plate, the diameter of mycelia ranged between 7 and 9 cm 5 dpi. The other four fungi grow slowly on PDA plate with diameter less than 5.5 cm 5 dpi. In Vt-7 treatment, the growth of fungi was greatly inhibited, and few mycelia were observed on PDA plate, respectively. The inhibition rate of Vt-7 against Fusarium graminearum, Magnaporthe oryzae, Colletotrichum graminicola, Alternaria alternata and Botrytis cinerea was up to 100%, respectively. The inhibition activity against Aspergillus niger and Aspergillus fumigatus is 83.1% and 97.8% respectively (Fig. 6). These results demonstrate that strain Vt-7 produced active volatiles which provide an efficient and wide spectrum of antifungal activity against phytopathogenic fungi from different genera.
3.4. Bio-control activity of Vt-7 against AF and aflatoxins in storage As shown in Fig. 4, the disease symptom of peanuts at aw 0.92 is more severe than that of aw 0.86 in control. The kernel surface in control treatment was covered with abundant AF conidia and mycelia. The disease incidence of peanuts was up to100% both at aw 0.86 and 0.92, respectively. In Vt-7 treatment, no disease symptom was detected on the Vt-7-treated peanuts at both aw. The growth of AF on peanuts was greatly inhibited by the production of volatiles from Vt-7. The disease incidence of peanuts was 0%, and the inhibition rate was up to 100% compared to control treatment. Additionally, the content of aflatoxins in each treatment was also
3.7. Identification of volatiles from strain Vt-7 Volatiles from strain Vt-7 were collected by solid phase micro-extraction (SPME) syringe and analyzed with GC-MS/MS system. Three putative volatiles were detected in the volatiles of Vt-7 (Fig. 7 and Table 2). These compounds with relative abundance (peak area to the total peak area of all compounds) more than 2% were identified as Butane,1-methoxy-3-methyl- (BMM, 102 Da), 1-Pentanol (88 Da) (Supplementary Fig. 1) and Phenylethyl Alcohol (PA, 122 Da) (Supplementary Fig. 2) through aligned in National Institute of Standards and Technology (NIST) 17 MS database. The retention time of them in GC-MS/MS ranged from 2.576 to 10.607 min, respectively. 1Pentanol is the most abundant compounds in volatiles Vt-7 with relative abundance up to 70.13%. The other two compounds are less than that (BMM contains 13.60%, and PA is 3.8%). To prove the potential bio-activity of them, two compounds (1-Pentanol and PA) with standard were purchased and tested their antagonistic activity against AF mycelia and conidia.
Fig. 4. Biocontrol efficacy of volatiles from Vt-7 against Aspergillus flavus and aflatoxins on peanuts of aw 0.8 and aw 0.9. (A) Phenotypes of peanuts infected with Aspergillus flavus in the presence (Vt-7+CK) or absence (CK) of strain Vt-7 at 28 °C for 5 days. (B) AFB1 and AFB2 in peanut samples were detected using LC-ESI-MS system.
3.8. Minimal inhibitory concentration analysis of volatiles from Vt-7 against AF 1-Pentanol and PA standards were diluted to different concentrations and co-cultural with AF in sealed petri dishes to test the antifungal 5
Food Control 106 (2019) 106718
A.-D. Gong, et al.
Fig. 5. Scanning electron microscope analysis of Aspergillus flavus on peanut surface. Peanuts of aw 0.92 inoculated with A. flavus conidia was incubated with (Vt7+CK) or without (CK) the strain Vt-7 for 5 days. co: conidia, cp: conidiophore, my: mycelia, sg: sterigma.
chemical agents were always sprayed on the surface of grain bulk, which could inhibit the growth of AF on the surface. But it is difficult to control the conidia existed in the air or inside the grain bulk. Hence, it was difficult for long term storage. Volatiles would be ideal control agents due to its gas property that can fully be in contact with the floating conidia of AF. The mycelial growth of AF on PDA plate was greatly inhibited when challenged with Vt-7 in sealed airspace. It therefore stands to reason that volatiles from Vt-7 are the main factors affecting the AF growth in a sealed airspace. Effective biocontrol activity was also observed in peanuts inoculation tests of two water activity at storage. Conidia inoculated on peanuts challenged with Vt-7 did not germinate, and the structure of conidia was severely damaged by volatiles, resulting in dehydrated surface and shrinking cell bodies. Additionally, the expression of genes in aflatoxin biosynthesis pathways was down regulated by volatiles from Vt-7. These genes, including AccC(Acetyl-CoA to Malonlyl-CoA, first reaction and rate-limiting step in aflatoxins pathway), NorM(Noranthrone monooxygenase, a front gene in aflatoxins pathway), norB (NOR dehydrogenase, a middle gene in aflatoxins pathway) and ordB (Monooxygenase/oxidase, a late gene in aflatoxins pathway) distributed in the whole pathway of aflatoxins biosynthesis and play essential roles in the process. And all the transcript levels of these genes were reduced by volatiles, which in turn resulted in the eventually prevention of aflatoxins production in peanuts samples at storage. Additionally, we also proved that volatiles from Vt-7 could greatly inhibit the growth of other seven important fungal strains. These fungi include Fusarium graminearum, Colletotrichum sp., Alternaria alternata, Botrytis cinerea and Aspergillus sp. These fungal strains can cause severe disease on crops, fruits, vegetables and other food products in field and storage. In the tests, we also proved that strain Vt-7 can greatly inhibit the growth of these fungi strains in vitro, and the inhibition rate against some strains was up to 100%. That opens a new insight for the application of strain Vt-7, as well as the volatiles, as antioxidant and antiseptic agent to control crop, vegetable, fruit and food disease in storage. Among the currently identified microbe volatiles, the most effective compounds against AF were 2,4-bis (1,1-dimethylethyl)-phenol and dimethyl trisulfide from Shewanella algae with MICs of 100, 200 μL/L, respectively. However, the relative abundances of these two compounds were only 14.195% and 0.504%, respectively (Gong et al.,
activity. The results showed that both could easily evaporate, and inhibit AF mycelia growth and conidia germination at the concentrations ranged from 10 to 200 μL/L (compound volume/airspace volume). The inhibition rate ranged from 20 to 100%. PA showed better antagonistic activity, the minimal inhibitory concentrations (MIC) of PA against AF mycelia and conidia are 200 and 100 μL/L, respectively (Fig. 8). For 1Pentanol, the MICs to AF conidia and mycelia are 200 μL/L and more than 200 μL/L, respectively. 4. Discussion A. flavus and its carcinogen aflatoxins cause great deleterious effect to humans all over the world. The prevention of AF and aflatoxin has been being considered as essential in the storage of food and oil crops. Here, we identified and showed that two novel antifungal volatiles (1Pentanol and PA) produced by E. asburiae Vt-7 can inhibit AF growth, conidia germination, gene expression in aflatoxin biosynthesis, and aflatoxins contamination in peanuts at storage. In addition, the volatiles were found effective against all fungal pathogens tested in vitro, indicting a broad spectrum antifungal activity. To the best of our knowledge, this is the first report of volatiles from Enterobacter spp. with antagonistic activity against AF and its associated aflatoxins. Strain Vt-7 was isolated from 100 year old tea rhizosphere in Cheyun mountain about an altitude of 800 m. The soil is acid at pH 4.5–5.5. Because of pruning in every year, the soil contains large amount of humus. Hence, large temperature variation, acidic environment and abundant humus may endow new species and novel functional microbes. For strain Vt-7, the phylogeny results showed that it gathered with E. asburiae species in one branch. But, it also exhibited a long genetic distance with these homologous E. asburiae strains in the branch. Moreover, Vt-7 also had 12 specific biochemical reactions (among all 76 reactions) different from E. asburiae. Based on the molecular and biochemical analysis, we concluded that strain Vt-7 was identified to be E. asburiae, and, it was also most possibly a novel subspecies in E. asburiae, which needed further evidence to prove that. Since AF is an airborne fungal pathogen, the great damage of AF to food and foodstuff at post-harvest was mostly because of the production of airborne conidia. Conidia could rapidly spread in the whole storage space, induce plant disease and produce aflatoxins. Traditional
Fig. 6. Broad antifungal activity of strain Vt-7 against eight fungal pathogens. Each fungus was cultured on PDA plate with (Vt-7+CK) or without (CK) the Vt-7, respectively. The diameters of fungal colonies were measured to calculate the inhibition rate. Eight different fungal strains including Fusarium graminearum (Fg), Magnaporthe oryzae(Mo), Aspergillus nigro (An), Aspergillus flavus(AF), Colletotrichum graminicola(Cg), Alternaria alternata(Aa), Aspergillus fumigatus (Afu) and Botrytis cinerea(Bc) were used in the tests. 6
Food Control 106 (2019) 106718
A.-D. Gong, et al.
Fig. 7. GC-MS/MS spectra of volatiles emitted from strain Vt-7. Volatile compounds of Vt-7 cultured on NA plate were detected 24 hpi. The compounds identified in Vt-7 (Vt-7+NA) spectra omitting the same compounds in blank NA (NA) medium were considered as authentic. Table 2 GC-MS/MS analysis of VOCs from strain Vt-7 on NA plate. The compounds identified in Vt-7 spectra omitting the same compounds in CK were considered as authentic compounds. a Retention time of each compound detected in GC-MS/MS spectra. b The area of each identified compound to the total area of all identified compound in spectra. c, d Match and R. match mean the forward and reverse similarity of compound spectra to entries in the NIST 17 MS spectral database, respectively. e molecular weight. No
Compounds name
RT (min)
1 2 3
Butane,1-methoxy-3-methyl1-Pentanol Phenylethyl Alcohol
2.576 2.88 10.607
a
Area (%)b
Match
13.60 70.13 3.80
934 948 879
c
R. match 941 958 919
d
formula
MW
C6H14O C5H12O C8H10O
102 88 122
e
aflatoxins. 1-Pentanol showed high effect of inhibition against conidial germination at MIC of 200 μL/L (compound volume/airspace volume) in sealed airspace. Pentanol is commonly used as an internal combustion fuel, which can also be used as partial substitute to diesel or biodiesel fuel (Nanthagopal et al., 2018). To reduce the use of fossil fuels, research has been carried out to develop cost-effective methods to produce chemically identical bio-pentanol using fermentation (Rude & Schirmer, 2009). Our results also provided an alternative biological method for the production of pentanol by using bacteria E. aerogenes Vt7. PA (3.8%, 122 Da) showed better antagonistic activity than 1-pentanol against AF. As a natural compound, PA commonly existed in soybean and mung beans (Lee & Shibamoto, 2000). It is considered as a safe additive in a wide variety of cosmetic products and foods such as beer, wine, olive oil, grapes, tea, apple juice, and coffee. It could also be used as antioxidative agents to extend the shelf-life and quality of strawberries at storage (Mo & Sung, 2007). In fact, volatiles from microbe have been widely used in many aspects of agriculture. For example, it can be used as effective agents in controlling plant pathogens and promoting plant growth in soil. Dimethyl disulfide (DMDS) has been applied in different crops, providing satisfactory control of root knot nematodes and cyst nematodes (Curto, Dongiovanni, Sasanelli, Santori, & Myrta, 2014; Fritsch et al., 2014; Sasanelli, Dongiovanni, Santori, & Myrta, 2014), as well as other soil-borne pathogens including Sclerotium rolfsii, Verticillium dahlia and Rhizoctonia solani (Fritsch, 2004.). Recently, Papazlatani showed that DMDS with great antifungal activity even at the low dose rate (56.4 g m−2) can drastically reduce the population of the major soil borne tomato pathogens F. oxysporum and R. solani (Papazlatani et al., 2016). Another volatile (caryophyllene) from antagonistic strain Fusarium oxysporum MSA35 can repress gene expression of two putative virulence genes in pathogenic F. oxysporum lactucae, which influences the mycelial growth and repress disease (Minerdi, Bossi, Gullino, & Garibaldi, 2009). In this study, 1-pentanol and PA produced by strain Vt-7 showed high antagonistic activity against broad pathogens, hence, we believe that the strain Vt-7 would endow more effective biocontrol activity against pathogens in soil as well. This work, investigates for the first time the capability of E. aerogenes Vt-7 as an effective mechanism of action against postharvest
Fig. 8. MIC analysis of volatiles against mycelia growth and conidia germination of AF. Two individual compounds 1-Pentanol and Phenylethyl Alcohol (PA) at different concentrations were assayed for their inhibition activity against mycelial growth and conidial germination on PDA for 4 days.
2015). Based on our results, PA and 1-Pentanol showed similar biocontrol efficacy at relative low concentration of 100, 200 μL/L. Moreover, the abundances of these two compounds were 73.93% in Vt-7 volatiles. In the volatile profile of Vt-7, 1-Pentanol was the most abundant compounds with relative abundance at 70.13%. The small molecular weight of 1-Pentanol (88 Da) warrants its high volatility which in turn can easily spread in sealed space to control AF and 7
Food Control 106 (2019) 106718
A.-D. Gong, et al.
pathogens. The results provide favorable evidence about the biocontrol activity of Vt-7, as well as the produced volatiles, PA and 1-Pentanol, against AF, aflatoxins and other important fungal pathogens. We believe that the strain Vt-7 and its volatiles (PA and 1-Pentanol), can serve as novel biocontrol agents in controlling food and crop pathogens and mycotoxins in storage.
Shewanella algae strain YM8 produces volatiles with strong inhibition activity against Aspergillus pathogens and aflatoxins. Frontiers in Microbiology, 6, 1091. Gong, A. D., Li, H. P., Yuan, Q. S., Song, X. S., Yao, W., He, W. J., et al. (2014). Antagonistic mechanism of iturin A and plipastatin A from Bacillus amyloliquefaciens S76-3 from wheat spikes against Fusarium graminearum. PLoS One, 10 e0116871. Gu, C. T., Li, C. Y., Yang, L. J., & Huo, G. C. (2014). Enterobacter xiangfangensis sp. nov., isolated from Chinese traditional sourdough, and reclassification of Enterobacter sacchari Zhu et al. 2013 as Kosakonia sacchari comb. nov. International Journal of Systematic and Evolutionary Microbiology, 64, 2650–2656. Hua, S. S. T., Beck, J. J., Sarreal, S. B. L., & Gee, W. (2014). The major volatile compound 2-phenylethanol from the biocontrol yeast, Pichia anomala, inhibits growth and expression of aflatoxin biosynthetic genes of Aspergillus flavus. Mycotoxin Research, 30, 71–78. Kamika, I., & Takoy, L. L. (2011). Natural occurrence of aflatoxin B1 in peanut collected from kinshasa, democratic republic of Congo. Food Control, 22, 1760–1764. Kedia, A., Prakash, B., Mishra, P. K., & Dubey, N. K. (2014). Antifungal and antiaflatoxigenic properties of Cuminum cyminum (L.) seed essential oil and its efficacy as a preservative in stored commodities. International Journal of Food Microbiology, 168, 1–7. Kirk, G. D., Bah, E., & Montesano, R. (2006). Molecular epidemiology of human liver cancer: Insights into etiology, pathogenesis and prevention from the Gambia, west Africa. Carcinogenesis, 27, 2070–2082. Kong, Q., Shan, S. H., Liu, Q. Z., Wang, X. D., & Yu, F. T. (2010). Biocontrol of Aspergillus flavus on peanut kernels by use of a strain of marine Bacillus megaterium. International Journal of Food Microbiology, 139, 31–35. Kuang, S. Y., Lekawanvijit, S., Maneekarn, N., Thongsawat, S., Brodovicz, K., Nelson, K., et al. (2015). Hepatitis B 1762T/1764A mutations, hepatitis C infection, and codon 249 p53 mutations in hepatocellular carcinomas from Thailand. Cancer Epidemiology Biomarkers & Prevention, 14, 380–384. Lee, K. G., & Shibamoto, T. (2000). Antioxidant properties of aroma compounds isolated from soybeans and mung beans. Journal of Agricultural and Food Chemistry, 48, 4290–4293. Lemfack, M. C., Nickel, J., Dunkel, M., Preissner, R., & Piechulla, B. (2014). mVOC: a database of microbial volatiles. Nucleic Acids Research, 42, 744–748. Li, Z. Q., Ding, B., Zhou, X. P., & Wang, G. L. (2017). The rice dynamin-related protein OsDRP1E negatively regulates programmed cell death by controlling the release of cytochrome c from mitochondria. PLoS Pathogens, 13 e1006157. Liu, X., Guan, X. L., Xing, F. G., Lv, C., Dai, X. F., & Liu, Y. (2017). Effect of water activity and temperature on the growth of Aspergillus flavus, the expression of aflatoxin biosynthetic genes and aflatoxin production in shelled peanuts. Food Control, 82, 325–332. Medina, A., Rodriguez, A., & Magan, N. (2014). Effect of climate change on Aspergillus flavus and aflatoxin B1 production. Frontiers in Microbiology, 5, 348. Minerdi, D., Bossi, S., Gullino, M. L., & Garibaldi, A. (2009). Volatile organic compounds: A potential direct long-distance mechanism for antagonistic action of Fusarium oxysporum strain MSA 35. Environmental Microbiology, 11, 844–854. Mo, E. K., & Sung, C. K. (2007). Phenylethyl alcohol (PEA) application slows fungal growth and maintains aroma in strawberry. Postharvest Biology and Technology, 45, 234–239. Nanthagopal, K., Ashok, B., Saravanan, B., Patel, D., Sudarshan, B., & Ramasamy, R. A. (2018). An assessment on the effects of 1-pentanol and 1-butanol as additives with Calophyllum Inophyllum biodiesel. Energy Conversion and Management, 158, 70–80. Outlaw, J., Waller, M., Richardson, J., Richburg, N., Russell, L., Welch, M., et al. (2006). Economics of aflatoxin risk management in the selected Southern States. Agricultural and Applied Economics Association. Papazlatani, C., Rousidou, C., Katsoula, A., Kolyvas, M., Genitsaris, S., Papadopoulou, K. K., et al. (2016). Assessment of the impact of the fumigant dimethyl disulfide on the dynamics of major fungal plant pathogens in greenhouse soils. European Journal of Plant Pathology, 146, 391–400. Paranagama, P. A., Abeysekera, K. H., Abeywickrama, K., & Nugaliyadde, L. (2003). Fungicidal and anti-aflatoxigenic effects of the essential oil of Cymbopogon citratus (DC.) Stapf. (lemongrass) against Aspergillus flavus Link. isolated from stored rice. Letters in Applied Microbiology, 37, 86–90. Passone, M. A., & Etcheverry, M. (2014). Antifungal impact of volatile fractions of Peumus boldus and Lippia turbinata on Aspergillus section Flavi and residual levels of these oils in irradiated peanut. International Journal of Food Microbiology, 168, 17–23. Peñuelas, J., Asensio, D., Tholl, D., Wenke, K., Rosenkranz, M., Piechulla, B., et al. (2014). Biogenic volatile emissions from the soil. Plant, Cell and Environment, 37, 1866–1891. Piechulla, B., Lemfack, M. C., & Kai, M. (2017). Effects of discrete bioactive microbial volatiles on plants and fungi. Plant, Cell and Environment, 40, 2042–2067. Robens, J., & Cardwell, K. (2003). The costs of mycotoxin management to the USA: Management of aflatoxins in the United States. Journal of Toxicology - Toxin Reviews, 22, 139–152. Rude, M. A., & Schirmer, A. (2009). New microbial fuels: A biotech perspective. Current Opinion in Microbiology, 12, 274–281. Santos, L., Marín, S., Sanchis, V., & Ramos, A. J. (2011). In vitro effect of some fungicides on growth and aflatoxins production by Aspergillus flavus isolated from Capsicum powder. Food Additives & Contaminants: Part A, 28, 98–106. Sasanelli, N., Dongiovanni, C., Santori, A., & Myrta, A. (2014). Control of the root-knot nematode Meloidogyne incognita by dimethyl disulfide (DMDS) applied in drip irrigation on melon and tomato in Apulia and Basilicata (Italy). Acta Horticulturae, 1044, 401–404. Shephard, G. S. (2008). Impact of mycotoxins on human health in developing countries. Food Additives & Contaminants: Part A, 25, 146–151. Strosnider, H., Azziz-Baumgartner, E., Banziger, M., Bhat, R. V., Breiman, R., Brune, M., et al. (2006). Workgroup report: Public health strategies for reducing aflatoxin
Conflicts of interest The authors declare that they have no conflict of interest. Acknowledgments This work was supported by the National Natural Science Foundation of China (31701740), Scientific and Technological Project in Henan Province (182102110018), Scientific Research Key Project Fund of Ministry of Education in Henan province (16A180036), Opening Subject of Key Laboratory of Integrated Pest Management in Crops in Central China, Ministry of Agriculture (2018ZTSJJ2), and Nanhu Scholars Program for Young Scholars of XYNU. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.foodcont.2019.106718. References Asters, M. C., Williams, W. P., Perkins, A. D., Mylroie, J. E., Windham, G. L., & Shan, X. Y. (2014). Relating significance and relations of differentially expressed genes in response to Aspergillus flavus infection in maize. Scientific Reports, 4, 4815. Banik, A., Mukhopadhaya, S. K., & Dangar, T. K. (2016). Characterization of N 2-fixing plant growth promoting endophytic and epiphytic bacterial community of Indian cultivated and wild rice (Oryza spp.) genotypes. Planta, 243, 799–812. Boukaew, S., & Prasertsan, P. (2014). Suppression of rice sheath blight disease using a heat stable culture filtrate from Streptomyces philanthi RM-1-138. Crop Protection, 61, 1–10. Bui-Klimke, T. R., Guclu, H., Kensler, T. W., Yuan, J. M., & Wu, F. (2014). Aflatoxin regulations and global pistachio trade: Insights from social network analysis. PLoS One, 9 e92149. Chai, L. Q., Li, W. W., & Wang, X. W. (2017). Identification and characterization of two arasin-like peptides in red swamp crayfish Procambarus clarkii. Fish & Shellfish Immunology, 70, 673–681. Chai, L. Q., Meng, J. H., Gao, J., Xu, Y. H., & Wang, X. W. (2018). Identification of a crustacean beta-1,3-glucanase related protein as a pattern recognition protein in antibacterial response. Fish & Shellfish Immunology, 80, 155–164. Chen, Y. J., Kong, Q., & Liang, Y. (2019). Three newly identified peptides from Bacillus megaterium strongly inhibit the growth and aflatoxin B1 production of Aspergillus flavus. Food Control, 95, 41–49. Chen, M. Y., Li, K., Li, H. P., Song, C. P., & Miao, Y. C. (2017). The glutathione peroxidase gene family in gossypium hirsutum: Genome-wide identification, classification, gene expression and functional analysis. Scientific Reports, 7, 15. Cho, K. M., Math, R. K., Hong, S. Y., Asraful Islam, S. M., Mandanna, D. K., Cho, J. J., et al. (2009). Iturin produced by Bacillus pumilus HY1 from Korean soybean sauce (kanjang) inhibits growth of aflatoxin producing fungi. Food Control, 20, 402–406. Cleveland, T. E., Carter-Wientjes, C. H., De Lucca, A. J., & Boue, S. M. (2009). Effect of soybean volatile compounds on Aspergillus flavus growth and aflatoxin production. Journal of Food Science, 74, 83–87. Curto, G., Dongiovanni, C., Sasanelli, N., Santori, A., & Myrta, A. (2014). Efficacy of dimethyl disulfide (DMDS) in the control of the root-knot nematode Meloidogyne incognita and the cyst nematode Heterodera carotae on carrot in field condition in Italy. VIII international symposium on chemical and non-chemical soil and substrate disinfestation: Vol 1044, (pp. 405–410). Ding, W., Si, M., Zhang, W. P., Zhang, Y. L., Chen, C., Zhang, L., et al. (2015). Functional characterization of a vanillin dehydrogenase in Corynebacterium glutamicum. Scientific Reports, 5, 8044. Fernando, W. G. D., Ramarathnam, R., Krishnamoorthy, A. S., & Savchuk, S. C. (2005). Identification and use of potential bacterial organic antifungal volatiles in biocontrol. Soil Biology and Biochemistry, 37, 955–964. Fritsch, J. (2004). Dimethyl disulfide as a new chemical potential alternative to methyl bromide in soil disinfestation in France. VI international symposium on chemical and non-chemical soil and substrate disinfestation-SD 2004: Vol 698, (pp. 71–76). Fritsch, J., Fouillet, T., Charles, P., Fargier-Puech, P., Ramponi-Bur, C., Descamps, S., et al. (2014). French experiences with dimethyl disulfide (DMDS) as a nematicide in vegetable crops. VIII international symposium on chemical and non-chemical soil and substrate disinfestation: Vol 1044, (pp. 427–433). Gong, A. D., Li, H. P., Shen, L., Zhang, J. B., Wu, A. B., He, W. J., et al. (2015). The
8
Food Control 106 (2019) 106718
A.-D. Gong, et al.
Warth, B., Sulyok, M., Fruhmann, P., Mikula, H., Berthiller, F., Schuhmacher, R., et al. (2012). Development and validation of a rapid multi-biomarker liquid chromatography/tandem mass spectrometry method to assess human exposure to mycotoxins. Rapid Communications in Mass Spectrometry, 26, 1533–1540. Wild, C. P., & Montesano, R. (2009). A model of interaction: Aflatoxins and hepatitis viruses in liver cancer aetiology and prevention. Cancer Letters, 286, 22–28. Wu, F. (2015). Global impacts of aflatoxin in maize: Trade and human health. World Mycotoxin Journal, 8, 137–142. Zhuang, Z., Lohmar, J. M., Satterlee, T., Cary, J. W., & Calvo, A. M. (2016). The master transcription factor mtfA governs aflatoxin production, morphological development and pathogenicity in the fungus Aspergillus flavus. Toxins, 8, 29.
exposure in developing countries. Environmental Health Perspectives, 114, 1898–1903. Thobunluepop, P. (2009). The inhibitory effect of the various seed coating substances against rice seed borne fungi and their shelf-life during storage. Pakistan Journal of Biological Sciences, 12, 1102–1110. Tian, J., Wang, Y. Z., Lu, Z. Q., Sun, C. H., Zhang, M., Zhu, A. H., et al. (2016). Perillaldehyde, a promising antifungal agent used in food preservation, triggers apoptosis through a metacaspase-dependent pathway in Aspergillus flavus. Journal of Agricultural and Food Chemistry, 64, 7404–7413. Torres, A. M., Barros, G. G., Palacios, S. A., Chulze, S. N., & Battilani, P. (2014). Review on pre- and post-harvest management of peanuts to minimize aflatoxin contamination. Food Research International, 62, 11–19.
9