- Email: [email protected]
Antiobesity activities of indole-3-carbinol in high-fat-diet–induced obese mice
Nutrition 27 (2011) 463–470
Contents lists available at ScienceDirect
Nutrition journal homepage: www.nutritionjrnl.com
Basic nutritional investigation
Antiobesity activities of indole-3-carbinol in high-fat-diet–induced obese mice Hsiao-Pei Chang M.S. a, Mei-Lin Wang M.S. b, Ming-Hsing Chan M.D. c, Yen-Shuo Chiu M.D. d, *, Yue-Hwa Chen Ph.D. b, * a
School of Pharmacy, Taipei Medical University, Taipei, Taiwan School of Nutrition and Health Sciences, Taipei Medical University, Taipei, Taiwan c Department of Dentistry, National Yang-Ming University Hospital, I-Lan, Taiwan d Traumatology, Taipei Medical University–Taipei Municipal Wan Fang Hospital, Taipei, Taiwan b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 24 August 2009 Accepted 17 September 2010
Objective: This study investigated the effects of indole-3-carbinol (I3C), a cruciferous vegetable derivative, on obesity and its associated factors in high-fat-diet–induced obese (DIO) mice. Methods: Eighteen male C57BL/6 mice were randomly assigned to one of three groups: basal, high fat (HF), and HF þ 5 mg/kg of I3C intraperitoneally (HFI). After 12 wk of treatment, obesityassociated factors, including body weight, organ weight, serum concentrations of glucose, triacylglycerol, insulin, and adipokines, and macrophage accumulation and lipid metabolismassociated factors in epididymal adipose tissue were measured. Results: Body weight and epididymal adipose tissue weight were greater (P < 0.01), and adipocytes were larger in the HF group than in the basal and HFI groups. Compared with the HF group, the HFI group had improved glucose tolerance, a higher serum adiponectin concentration, lower serum glucose, triacylglycerol, insulin, and leptin concentrations, and less F4/80 expression in epididymal adipose tissue (P < 0.001). Furthermore, I3C treatment decreased acetyl coenzyme A carboxylase mRNA expression (P < 0.05) and increased peroxisome proliferator-activated receptor-g protein expression (P < 0.05) in epididymal adipose tissue of DIO mice. Conclusion: The I3C treatment decreased body weight and fat accumulation and infiltrated macrophages in epididymal adipose tissue of DIO mice, and these reductions were associated with improved glucose tolerance and with modulated expression of adipokines and lipogenic-associated gene products, including acetyl coenzyme A carboxylase and peroxisome proliferator-activated receptor-g. Ó 2011 Elsevier Inc. All rights reserved.
Keywords: Indole-3-carbinol Obesity Macrophage infiltration Glucose tolerance Adipokines Peroxisome proliferator-activated receptor
Introduction Obesity is always accompanied by excess lipid accumulation, impaired glucose tolerance, and elevated serum triacylglycerol (TG) concentration; thus, it is positively associated with the progression of various chronic diseases such as type 2 diabetes mellitus, cardiovascular diseases, and cancers. Adipogenesis, a process of lipid deposition and adipocyte differentiation, is regulated by several factors, including peroxisome proliferatoractivated receptors (PPARs) [1,2]. PPAR-g, one of the major Professor Chen and Dr. Chiu contributed equally to this work. This work was supported by grant 96TMU-WFH-18 from Taipei Medical University–Taipei Municipal Wan Fang Hospital, Taiwan, Republic of China. * Corresponding authors. Tel.: þ886-2-2736-1661, ext. 6550; fax:þ 886-22737-3112. E-mail addresses: [email protected] (Y.-S. Chiu), yuehwa@tmu. edu.tw (Y.-H. Chen). 0899-9007/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.nut.2010.09.006
forms of PPAR expressed in adipose tissue, is a vital regulator of adipogenesis because it regulates the expression of several adipogenesis-related genes, such as adipocyte fatty acid-binding protein (aP2), acetyl coenzyme A carboxylase (ACC), and fatty acid synthase. Thus, PPAR-g is important in the homeostasis of lipid and glucose metabolism [3]. In addition, obesity is considered a chronic low-grade inflammation state, so various inflammatory mediators have been linked to the pathogenesis of obesity-related disorders [4–6]. Cytokines and adipokines produced from infiltrated macrophages and adipocytes in expanded adipose tissue are thought to contribute to the inflammatory responses of obesity [7–9]. An overexpression of tumor necrosis factor-a, interleukin-6 (IL-6), resistin, and leptin, a suppression of adiponectin, and an excess accumulation of macrophages in adipose tissue have been reported in obese subjects [4–6], and these alterations have been reversed by weight reduction [10,11].
464
H.-P. Chang et al. / Nutrition 27 (2011) 463–470
Different studies have indicated that increased consumption of cruciferous vegetables (e.g., cabbage, broccoli, cauliflower, and Brussels sprouts) is associated with decreased risks of cancer and cardiovascular diseases, which may be due to their high contents of glucosinolates and their derivatives, including indole-3-carbinol (I3C) [12,13]. Previously, studies have reported that I3C inhibits cellular lipid synthesis in HepG2 cells [14], decreases serum cholesterol concentrations in hypercholesterolemic mice [15,16], and possesses anti-inflammatory activities in activated macrophages [17]. In addition, I3C acts as a phytoestrogen [18], and estrogen replacement therapy has been shown to improve insulin sensitivity, inhibit body fatness, and lower serum lipid and cholesterol levels [19,20]. However, data on the effects of I3C on obesity-related parameters are limited; therefore, the objective of this study was to investigate the effects of I3C on body weight, serum concentrations of lipid and adipokines, glucose tolerance, macrophage infiltration, and lipid metabolism–related genes in a high-fat-diet–induced obese (DIO) mouse model. Materials and methods Animals and diets Eighteen 5-wk-old male C57BL/6 mice obtained from the National Taiwan University Animal Center (Taipei, Taiwan) were maintained at 22 3 C under automatic lighting cycles. After a 1-wk acclimation period, mice were randomly assigned to one of three diet groupsdbasal (B), high fat (HF), and HF þ I3C (HFI)dand were housed in groups (three mice/cage). I3C was commercially purchased from Sigma Chemical (St. Louis, MO, USA) and was administered intraperitoneally three times per week at a dose of 5 mg/kg of body weight in a vehicle (polyethylene glycol:benzyl alcohol:ethanol:water, 40:0.1:10:49.9) [21]. The dose and dosing schedule of I3C was chosen because of its effectiveness on weight loss and no obvious toxicity in DIO mice from preliminary experiments. Animals in the B and HF groups received an equal volume of vehicle injection only. The diets were isocaloric, and the composition (Table 1) was a modified version of the diet used by Jiang et al. [22]. The HF diet induces hyperglycemia, hyperinsulinemia, hyperlipidemia, and obesity in animals after 12 wk of feeding [22]. All animals had free access to food and water, and the averaged group body weights and food intakes were recorded twice a week. At the end of the experiment (12 wk), mice were sacrificed after an overnight fasting. Organ weights were measured, and blood and epididymal adipose tissues were collected for analysis. This experimental protocol was approved by the institutional animal care and use committee at Taipei Medical University (LAC-96-0088). Biochemical measurements Serum glucose and TG concentrations were analyzed by using Randox Glucose and Randox TRIGS assay kits (Randox Labs, Crumlin, UK). An oral glucose tolerance test (OGTT) was performed at 12 wk. After the mice were deprived of food for 16 h, blood was withdrawn from the tail vein for the baseline measurements. The OGTT was performed by administering a glucose solution
(2 g/kg) by gavage and then measuring blood glucose concentrations at 0, 30, 60, 90, and 120 min with a glucometer (Bayers, Mishawaka, IN, USA). Histopathology and immunohistochemistry of adipose tissue After being fixed with paraformaldehyde, embedded in paraffin, and sliced, one piece of epididymal adipose tissue from three animals per group was stained with hematoxylin and eosin. For immunohistochemistry, the slides were blocked with H2O2 followed by sequentially incubating with anti-mouse F4/80 antibody (Serotec, Raleigh, NC, USA), biotinylated anti-rat immunoglobulin G (Vector Laboratories, Burlingame, CA, USA), and streptavidin horseradish peroxidase (Vector Laboratories). After treating with a 3,30 -diaminobenzidine substrate kit (Vector Laboratories) and staining with Grill’s hematoxylin, the sections were observed and photographed under a phase-contrast light microscope. Immunoblotting analysis Another piece of epididymal adipose tissue from three animals per group was lysed by RIPA buffer (10 mM Tris, pH 7.4; 150 mM NaCl; 1 mM ethylenediaminetetra-acetic acid; 0.1% sodium dodecyl sulfate; 1% Triton X-100; 1% sodium deoxycholate; and 0.25 mM phenyl methyl sulfonyl fluoride), and the cellular protein was obtained after centrifugation. After separation by 10% sodium dodecylsulfate polyacrylamide gel electrophoresis, the protein was transferred to a nitrocellulose membrane that was then blocked with non-fat dry milk followed by hybridization with an anti-mouse PPAR-g antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA). After washing and incubating with a secondary antibody (Santa Cruz Biotechnology), the immunocomplex was detected using Amersham ECL western blotting detection reagents (GE Healthcare, Piscataway, NJ, USA). The autoradiogram was visualized and quantified using Image-Pro Plus 4.5 (MediaCybernetic, Bethesda, MD, USA). Reverse transcriptase polymerase chain reaction and real-time polymerase chain reaction analyses Reverse transcriptase polymerase chain reaction (RT-PCR) and real-time PCR were performed to determine the mRNA expression of lipogenic-associated gene products and F4/80, respectively. After being extracted using TRIzol Reagent (Invitrogen Life Technologies, Carlsbad, CA, USA), total cellular RNA from epididymal adipose tissue of three animals per group was subjected to reverse transcription by SuperScript III (Invitrogen Life Technologies). For semiquantitative analysis of ACC, aP2, and glyceraldehyde-3-phosphate dehydrogenase, cDNA was subjected to PCR, which consisted of 32 cycles at 94 C for 1 min, 60 C for 90 s, and 72 C for 60 s. The PCR products were then separated by agarose gel, and the images were visualized and quantified using Image-Pro Plus 4.5 (MediaCybernetic). For analyses of F4/80 and b-actin, real-time PCR was achieved in a LightCycler (Roche Diagnostics, Basel, Switzerland) using LightCyclerFastStart DNA Master SYBR Green I (Roche Diagnostics, Indianapolis, IN, USA). The reactions were performed at 95 C for 10 s, 55 C for 10 s, and 72 C for 20 s for 45 cycles. Expression of the F4/80 mRNA was normalized to the expression of b-actin. Primer pairs for transcripts of interest were designed using Primer Express software (Applied Biosystems, Carlsbad, CA, USA) and are listed in Table 2. Measurement of adipokines The increased mass and infiltrated macrophages in adipose tissue in obesity are associated with an altered secretion of adipokines and cytokines; therefore, the adipokines secreted in the blood were investigated. Serum concentrations of leptin, adiponectin, resistin, macrophage chemoattractant protein-1 (MCP-1), and IL-6 were measured using enzyme-linked immunosorbent assay kits (R&D
Table 1 Composition of the diets (grams per kilogram)
Corn starch* Casein* Dextrin* Sucrose* Soybean oil Lard Cellulose* Mineral mixture*, y Vitamin mixture*, y L-cystine* Choline bitartrate Tert-butyl hydroquinone* * y
Basal diet
High-fat diet
465.692 140 155 100 40 0 50 35 10 1.8 2.5 0.01
125.1 184.3 125.1 128.9 152.9 152.9 65.8 46.1 13.2 2.4 3.3 0.01
Purchased from ICN Biochemicals (Costa Mesa, CA, USA). AIN-93 mineral mixture and AIN-93 vitamin mixture.
Table 2 Sequences of primers Primer
Sequences (50 to 30 )
Size
G3PDH
GCCATGCCCAGAGGGTGGTT (forward) AGGGGTCGACCTGGTCCTCA (reverse) GAACCTGGAAGCTTGTC (forward) ACTCTTGTGGAAGTCACG (reverse) TGACTGCCGAAACATCTCTG (forward) GCCTCTTCCTGACAAACGAG (reverse) AGCGATGTACGTAGCCATCC (forward) CTCTCAGCTGTGGTCGTCAA (reverse) TGCATCTAGCAATGGACAGC (forward) GCCTTCTGGATCCATTTGAA (reverse)
983 bp
aP2 ACC
b-actin F4/80
364 bp 239 bp 228 bp 169 bp
ACC, acetyl coenzyme-A carboxylase; aP2, adipocyte fatty acid-binding protein; G3PDH, glyceraldehyde-3-phosphate dehydrogenase
H.-P. Chang et al. / Nutrition 27 (2011) 463–470 Systems, Minneapolis, MN, USA), and insulin was measured by an radioimmunoassay kit (Mercodia, Uppsala, Sweden). Statistical analysis Results are expressed as mean standard deviation. One-way analysis of variance and then Fisher’s least significant difference test were used to determine statistical differences between groups with SAS 9.0 (SAS Institute, Cary, NC, USA). Differences were considered statistically significant at P < 0.05. Bonferroni’s correction was applied for multiple comparisons (time and treatment) of body weight and OGTT. Differences were considered statistically significant at P < 0.005. Analysis of covariance was also performed to test differences in organ weights by group and covary body weight. Bonferroni’s correction and analysis of covariance were determined with SPSS 15.0 (SPSS, Inc., Chicago, IL, USA).
Results Body and organ weights No significant differences in daily food intake were observed among groups (P ¼ 0.084; Fig. 1A); however, body weight was greater with the HF diet than the B diet at the end of the experiment (P < 0.001; Fig. 1B). In addition, no differences in the weights of the various organs were detected (P ¼ 0.12), except that the relative weight of epididymal adipose tissue was greater
Averaged food intake (g/mouse)
A
4
3
Biochemical measurements The HF diet significantly induced high fasting serum concentrations of TG (P < 0.005), glucose (P < 0.001; Fig. 2A), and insulin (P < 0.01; Fig. 2B) compared with animals on the B diet, and the animals showed poor glucose tolerance (P < 0.005) to the OGTT as shown by the blood glucose concentration at each time point (Fig. 2C) and the area curve under the curve for glucose (Fig. 2D) after 12 wk of feeding. However, these abnormalities induced by the HF diet were considerably ameliorated by the I3C treatment (P < 0.05). Histopathology and macrophage accumulation of adipose tissue Figure 3A indicates that the HF group had larger adipocytes than did the B group. Similar to the results for body weight, the size of the adipocytes in adipose tissue was significantly smaller in the HFI group. The immunohistochemical and real-time PCR analyses also showed greater F4/80 expression of epididymal adipose tissue in the HF than in the B group (P < 0.001); however, I3C significantly ameliorated (P < 0.001) the expressions of F4/80 (Fig. 3B,C).
As shown in Figure 4, mRNA expressions of ACC (a key enzyme of de novo lipogenesis) and aP2 (an adipocyte fatty acidbinding protein) were enhanced by the HF diet, whereas I3C suppressed (P < 0.05) 40% of the HF-enhanced ACC, although I3C did not significantly affect the HF-induced aP2 mRNA expression (P ¼ 0.27). Furthermore, the expression of the PPAR-g protein was suppressed (P < 0.05) in animals fed the HF diet compared with the B group; I3C reversed (P < 0.02) the HF-inhibited expression in the epididymal adipose tissue.
2
1
B HF HFI
0
2
4
6
8
10
12
Time (week)
Adipokines
50 B HF HFI
40
Body weight (g)
(P < 0.001) in the HF group (Table 3). Epididymal adipose tissue was significantly associated with the percentage of weight change (P < 0.001). Conversely, body weight was 18% lower (P < 0.001) and epididymal adipose tissue weight was significantly lower (P < 0.01) in the HFI group compared with the HF group.
Expression of lipid metabolism-associated factors
0
B
465
30
* * * * * *
20
* * *
10
As shown in Figure 5A, animals fed the HF diet for 8 wk had lower concentrations of serum adiponectin than did the animals in the B group (P < 0.05), but I3C reversed this decrease by the end of the experiment (P < 0.05). In contrast, the serum resistin concentration was not affected (P ¼ 0.08) by the HF diet, but I3C lowered the concentration at 8 wk (P < 0.001; Fig. 5B). Furthermore, the elevated serum leptin concentration induced by the HF diet was significantly suppressed (P < 0.05) by I3C treatment (Fig. 5C), and neither IL-6 (P ¼ 0.07) nor MCP-1 (P ¼ 0.13) changed in response to the HF diet or I3C treatment (data not shown). Discussion
0 0
2
4
6
8
10
12
14
week Fig. 1. Effects of indole-3-carbinol on averaged food intake (A) and body weight (B) in mice fed different diets for 12 wk. Values are presented as mean SD (n ¼ 6). * P < 0.005 compared with the HF group at the same time point. B, basal diet; HF, high-fat diet; HFI, high-fat diet þ intraperitoneally administered indole-3-carbinol.
Our observations demonstrated, for the first time, that I3Cda glucosinolate derivative from cruciferous vegetablesdcan affect adiposity, i.e., it decreased body weight, decreased the weight of epididymal fat mass, and modulated lipid metabolism-associated gene products in DIO mice. In addition, conditions associated with obesity–including high serum concentrations of glucose,
466
H.-P. Chang et al. / Nutrition 27 (2011) 463–470
Table 3 Effects of indole-3-carbinol on absolute and adjusted organ weights (grams)* Group
Organ Epididymal adipose tissue
Liver
Heart
Kidney
Spleen
2.65 0.47a 0.47 0.17a
3.82 0.18 0.94 0.02
0.47 0.10 0.44 0.04
1.11 0.06 1.11 0.06
0.28 0.07 0.29 0.04
6.73 1.53b 2.17 0.27b
3.43 0.67 1.04 0.09
0.42 0.08 0.51 0.07
1.12 0.12 1.1 0.1
0.23 0.05 0.21 0.06
3.00 0.82c 1.17 0.12c
3.65 0.31 1.1 0.04
0.42 0.08 0.41 0.03
1.05 0.08 1.04 0.05
0.25 0.05 0.25 0.03
B Absolute Adjustedy HF Absolute Adjustedy HFI Absolute Adjustedy
B, basal diet; HF, high-fat diet; HFI, high-fat diet þ 5 mg/kg of indole-3-carbinol intraperitoneally * Values are presented as mean SD (n ¼ 6). Data with different superscript letters significantly differ between groups in the same column (P < 0.05). y Data are adjusted weights by analysis of covariance.
TG, insulin, and leptin and low concentrations of serum adiponectin, poor glucose tolerance, and excess macrophage accumulation in the adipose tissuedwere ameliorated by intraperitoneal administration of I3C. Therefore, I3C may help prevent obesity, lipid accumulation, and related macrophage infiltration caused by the long-term consumption of an HF diet. I3C is a compound with a mildly nauseating odor, which may interfere food intake and thus body weight gain, although no evidence has shown it causes feed avoidance. To minimize the disparities in food intake and to ensure the animals received exact treatment
C Triglyceride Glucose
c 150 b 100
a
** 50
*
*
Blood glucose concentration (mg/dl)
Blood concentration (mg/dl)
A 200
doses, I3C was injected intraperitoneally, and the dose of 5 mg/kg may be achieved by a human taking one capsule of 500-mg I3C supplement without considering digestion and absorption. However, several acid-catalyzed compounds, such as indolo[3,2-b] carbazole and 3,30 -diindolylmethane, formed after oral consumption of I3C have been indicated to possess biological activities similar to I3C [18], so the overall antiobesity activities by oral consumption of I3C and/or cruciferous vegetables require further investigation. Nonetheless, the intraperitoneal administration of I3C provides an excellent baseline of studies
0
*
150
* # #*
#
100
# 50
HFI
0
D
1.8
30
60
90
120
Time (min) 1000
b
c
1.6
b
1.4 a
1.0 0.8 0.6 0.4
AUC glucose (mmol/l/120 min)
Serum insulin concentration (ug/l)
HF
2.0
1.2
B HF HFI
0 B
B
200
800
600
a
a
400
200
0.2 0.0
0 B
HF
HFI
B
HF
HFI
Fig. 2. Effects of indole-3-carbinol on serum concentrations of glucose and triacylglycerol (A) and insulin (B) in fasted animals and on blood glucose concentration after an oral glucose tolerance test (C) and AUC for glucose (D) in animals fed different diets for 12 wk. Values with different letters or symbols indicate significant differences between groups in the same parameter (P < 0.05). * P < 0.05 compared with the B group; # P < 0.05 compared with the HF group at the same time point. AUC, area under the curve; B, basal diet; HF, high-fat diet; HFI, high-fat diet þ intraperitoneally administered indole-3-carbinol.
H.-P. Chang et al. / Nutrition 27 (2011) 463–470
467
Fig. 3. Effects of indole-3-carbinol on histologic changes (A), expressions of F4/80 protein (200 magnification, B), and F4/80 mRNA (C) in epididymal adipose tissue in animals fed different diets for 12 wk. Tissues were fixed and stained with hematoxylin and eosin. F4/80 protein in epididymal adipose tissue was detected by immunohistochemistry, and F4/80 mRNA expression was determined by quantitative real-time polymerase chain reaction. The black arrows indicate F4/80 protein, which was observed near blood vessels and among large adipocytes in adipose tissue. Scale bar ¼ 100 mm. Values are presented as mean SD (n ¼ 3). Data with different letters indicate significant differences between groups (P < 0.05). B, basal diet; HF, high-fat diet; HFI, high-fat diet þ intraperitoneally administered indole-3-carbinol.
468
H.-P. Chang et al. / Nutrition 27 (2011) 463–470
A
1.0
3.0 aP2 ACC
2.5
**
2.0
c
* **
1.5 1.0
*
b a
0.5 0.0 B
HF
HFI
Protein expression (arbitary unit)
mRNA expression (arbitary unit)
B
PPAR-γ
c 0.8 b 0.6
a
0.4 0.2 0.0 B
HF
HFI
Fig. 4. Effects of indole-3-carbinol on the expression of lipid metabolism-associated gene products in epididymal adipose tissue in mice fed different diets for 12 wk. (A) The expression of aP2 and ACC mRNAs and PPAR-g protein was determined by reverse transcriptase polymerase chain reaction and western blot analysis, respectively. (B) The levels of different gene products were quantified from 3 independent experiments. Images represent three independent experiments. Data with different letters or symbols indicate significant differences between groups in the same parameter (P < 0.05). ACC, acetyl coenzyme-A carboxylase; aP2, adipocyte fatty acid-binding protein; B, basal diet; HF, high-fat diet; HFI, high-fat diet þ intraperitoneally administered indole-3-carbinol; PPAR-g, peroxisome proliferator-activated receptor-g.
of the effects of I3C itself that can be followed with studies using other routes of administration. Excess lipid accumulation is closely associated with insulin resistance, impaired glucose tolerance, and elevated serum TG concentration in obese subjects [23,24]. I3C treatment decreased lipogenic ACC expression in epididymal adipose tissue of DIO mice. An increased expression of ACC has been reported in the steatotic livers of ob/ob mice [25] and during the differentiation of cultured 3T3-L1 preadipocytes [26]. Parallel to the results we obtained, I3C has been reported to decrease TG contents by suppressing the mRNA expression of sterol regulatory element binding protein-1 (SREBP-1) and ACC in HepG2 cells [14]; therefore, these results suggest that I3C may act by decreasing the ACC expression to decrease TG synthesis and lipid contents in the adipose tissue in DIO mice. In addition, I3C increased HF-suppressed PPAR-g expression in epididymal adipose tissue. PPAR controls adipocyte differentiation and lipid metabolism by regulating lipogenic and lipolytic genes and thus enhances the efficiency of lipid utilization [1]. Exacerbated insulin resistance is
observed in PPAR-g gene knockout mice, indicating the importance of PPAR-g in obesity-related disorders [27]. Clinically, PPAR agonists have been used as lipid-lowering and antidiabetic drugs to resolve the symptoms of metabolic diseases [28], so the increased PPAR-g expression in adipose tissue by I3C treatment may assist adipocyte differentiation, enhance insulin sensitivity, and lower blood lipid concentrations. Furthermore, aryl hydrocarbon receptor (AhR) has been indicated to act as an inhibitor of TG synthesis and an early regulator of adipocyte differentiation [29]; AhR ligands are also able to downregulate hepatic PPAR-a to modulate lipid metabolism [30]. Being one of the ligands of the AhR [31], although not potent, I3C may act through AhR to decrease body weight/fat, lipid accumulation, blood glucose, and TG, and these consequences may lead to the improvement in insulin sensitivity in DIO mice. Alternatively, the effects of I3C on these metabolic changes may be related to its phytoestrogenic activity [18], because estrogen treatment has been shown to ameliorate HF diet-induced obesity, insulin resistance, glucose intolerance, and hyperlipidemia [19,20,32]. Taken together, I3C
H.-P. Chang et al. / Nutrition 27 (2011) 463–470
A
3000 b
2500
Adiponectin (pg/ml)
0 week 8 week 12 week
##
b
2000 #
a
#
1500 1000 500 0 B
B
HF
HFI
5000
4000
0 week 8 week 12 week
# ##
Resistin (pg/ml)
## 3000
#
2000
0 B
HF
HFI
2000 0 week 8 week 12 week
c
1500
Leptin (ng/ml)
attenuated by I3C. In addition, we have demonstrated that I3C enhanced serum adiponectin and decreased serum leptin concentrations in DIO mice. Decreased serum adiponectin concentrations have been observed in humans with high levels of visceral fat [34], and the intraperitoneal injection of adiponectin has been shown to improve insulin resistance by decreasing TG concentrations in the muscle and liver of obese mice [35]. Leptin is involved in the metabolism of glucose and lipid. Fasting serum leptin concentrations are elevated in obese patients in proportion to the degree of obesity [36], and it has been suggested that obesity may be the result of a resistance to leptin in a similar way as people with type 2 diabetes are resistant to insulin [37]. Thus, the enhancement of adiponectin and the inhibition of leptin by I3C in DIO mice suggest a potential role for I3C in the prevention of obesity-induced metabolic disorders. In contrast, neither the HF diet nor I3C administration affected serum concentrations of inflammatory adipokines, including resistin, IL-6 and MCP-1, although Black et al. [38] observed elevated expressions of IL-6 and MCP-1 mRNAs in adipose tissue after mice were fed an HF diet for 3 wk. It is possible that IL-6 and MCP-1 have short-term effects, and their expression may not be involved in the pathologic changes in DIO mice observed after 12 wk. These results suggest that I3C may be helpful in decreasing inflammatory conditions and thus decrease the pathologic changes observed in obese subjects. Conclusion
1000
C
469
Indole-3-carbinol inhibits obesity, improves hyperglycemia and hyperinsulinemia, and decreases infiltrated macrophages in epididymal adipose tissue of mice fed an HF diet; such effects are associated with the modulated expression of adipokines, ACC, and PPAR-g in epididymal adipose tissue. The results obtained from this study provide an alternative protective mechanism of cruciferous vegetable derivatives or their supplements in the prevention of obesity and its related metabolic disorders.
b
References 1000
500
0
##
# a
B
#
HF
HFI
Fig. 5. Effects of indole-3-carbinol on adiponectin (A), resistin (B), and leptin (C) in HF-induced obese mice fed different diets for 0, 8, or 12 wk. Serum concentrations of adiponectin, resistin, and leptin were determined using enzyme-linked immunosorbent assay. Values are presented as mean SD (n ¼ 6). Data with different letters or symbols indicate significant differences between groups at the same time point (P < 0.05). B, basal diet; HF, high-fat diet; HFI, high-fat diet þ intraperitoneally administered indole-3-carbinol.
may be useful in the treatment of HF diet–induced obesity and its associated disorders, such as hyperglycemia, insulin resistance, and hyperlipidemia, and these effects may be associated with AhR- and estrogen-mediated pathways. It has been indicated that inflammation may be a potential mechanism by which obesity leads to insulin resistance [4,33]. In epididymal adipose tissue, the macrophage-specific marker F4/80 was dramatically upregulated in obese mice, but was
[1] Rosen ED, Sarraf P, Troy AE, Bradwin G, Moore K, Milstone DS, et al. PPAR gamma is required for the differentiation of adipose tissue in vivo and in vitro. Mol Cell 1999;4:611–7. [2] Spiegelman BM, Hu E, Kim JB, Brun R. PPAR gamma and the control of adipogenesis. Biochimie 1997;79:111–2. [3] Berger JP. Role of PPARgamma, transcriptional cofactors, and adiponectin in the regulation of nutrient metabolism, adipogenesis and insulin action: view from the chair. Int J Obes 2005;29:S3–4. [4] Xu H, Barnes GT, Yang Q, Tan G, Yang D, Chou CJ, et al. Chronic inflammation in fat plays a crucial role in the development of obesity-related insulin resistance. J Clin Invest 2003;112:1821–30. [5] Wellen KE, Hotamisligil GS. Obesity-induced inflammatory changes in adipose tissue. J Clin Invest 2003;112:1785–8. [6] Weisberg SP, McCann D, Desai M, Rosenbaum M, Leibel RL, Ferrante Jr AW. Obesity is associated with macrophage accumulation in adipose tissue. J Clin Invest 2003;112:1796–808. [7] Wisse BE. The inflammatory syndrome: the role of adipose tissue cytokines in metabolic disorders linked to obesity. J Am Soc Nephrol 2004;15:2792–800. [8] Hotamisligil GS, Shargill NS, Spiegelman BM. Adipose expression of tumor necrosis factor-a: direct role in obesity-linked insulin resistance. Science 1993;259:87–91. [9] Das UN. Is obesity an inflammatory condition? Nutrition 2001;17:953–66. ment K, Viguerie N, Poitou C, Carette C, Pelloux V, Curat CA, Sicard A. [10] Cle Weight loss regulates inflammation-related genes in white adipose tissue of obese subjects. FASEB J 2004;18:1657–69. [11] Puglisi MJ, Fernandez ML. Modulation of C-reactive protein, tumor necrosis factor-alpha, and adiponectin by diet, exercise, and weight loss. J Nutr 2008;138:2293–6. [12] Liu S, Manson JE, Lee IM. Fruit and vegetable intake and risk of cardiovascular disease: the Women’s Health Study. Am J Clin Nutr 2000;72:922–8.
470
H.-P. Chang et al. / Nutrition 27 (2011) 463–470
[13] Verhoeven DTH, Goldbohm RA, van Poppel G, Verhagen H, van den Brandt PA. Epidemiological studies on Brassica vegetables and cancer risk. Cancer Epidemiol Biomarkers Prev 1996;5:733–48. [14] Maiyoh GK, Kuh JE, Casaschi A, Theriault AG. Cruciferous indole-3-carbinol inhibits apolipoprotein B secretion in HepG2 cells. J Nutr 2007;137:2185–9. [15] Dunn SE, LeBlanc GA. Hypocholesterolemic properties of plant indoles. Inhibition of acyl-CoA:cholesterol acyltransferase activity and reduction of serum LDL/VLDL cholesterol levels by glucobrassicin derivatives. Biochem Pharmacol 1994;47:359–64. [16] LeBlanc GA, Stuart JD, Dunn SE, Baldwin WS. Effect of the plant compound indole-3-carbinol on hepatic cholesterol homoeostasis. Food Chem Toxicol 1994;32:633–9. [17] Chen YH, Dai HJ, Chang HP. Suppression of inducible nitric oxide production by indole and isothiocyanate derivatives from Brassica plants in stimulated macrophages. Planta Med 2003;69:696–700. [18] Kim YS, Milner JA. Targets for indole-3-carbinol in cancer prevention. J Nutr Biochem 2005;16:65–73. [19] Salpeter SR, Walsh JME, Ormiston TM, Greyber E, Buckley NS, Salpeter EE. Meta-analysis: effect of hormone-replacement therapy on components of the metabolic syndrome in postmenopausal women. Diabetes Obes Metab 2006;72:922–8. [20] Tcheronv A, Calles-Escandon J, Sites CK, Poehlman ET. Menopause, central body fatness, and insulin resistance: effects of hormone-replacement therapy. Coron Artery Dis 1998;5:733–48. [21] Khor TO, Keum YS, Lin W. Combined inhibitory effects of curcumin and phenethyl isothiocyanate on the growth of human PC-3 prostate xenografts in immunodeficient mice. Cancer Res 2006;66:613–21. [22] Jiang T, Wang Z, Proctor G. Diet-induced obesity in C57BL/6J mice causes increased renal lipid accumulation and glomerulosclerosis via a sterol regulatory element-binding protein-1c–dependent pathway. J Biol Chem 2005;280:32317–25. [23] Bray GA. Medical consequences of obesity. J Clin Endocrinol Metab 2004;89:2583–9. [24] Zamboni M, Armellini F, Turcato E. Relationship between visceral fat, steroid hormones and insulin sensitivity in premenopausal obese women. J Intern Med 1994;236:521–7. [25] Shimomura I, Bashmakov Y, Horton JD. Increased levels of nuclear SREBP1c associated with fatty livers in two mouse models of diabetes mellitus. J Biol Chem 1999;274:30028–32.
[26] Gregoire FM, Smas CM, Sul HS. Understanding adipocyte differentiation. Physiol Rev 1998;78:783–809. [27] He W, Barak Y, Hevener A, Olson P. Adipose-specific peroxisome proliferatorsactivated receptor gamma knockout caused insulin resistance in fat and liver but not in muscle. Proc Natl Acad Sci U S A 2003;100:15715–7. [28] Jay MA, Ren J. Peroxisome proliferator-activated receptor (PPAR) in metabolic syndrome and type 2 diabetes mellitus. Curr Diabetes Rev 2007;3:33–9. [29] Alexander DL, Ganem LG, Fernandez-Salguero P, Gonzalez F, Jefcoate CR. Aryl-hydrocarbon receptor is an inhibitory regulator of lipid synthesis and of commitment to adipogenesis. J Cell Sci 1998;111:3311–22. [30] Shaban Z, El-Shazly S, Abdelhady S, Fattouh I, Muzandu K, Ishizuka M, et al. Down regulation of hepatic PPARalpha function by AhR ligand. J Vet Med Sci 2004;66:1377–86. [31] Bjeldanes LF, Kim JY, Grose KR, Batholomew JC, Bradfield CA. Aromatic hydrocarbon responsiveness-receptor agonists generated from indole-3carbinol in vitro and in vivo: comparisons with 2,3,7,8-tetracholordibenzo-p-dioxin. Proc Natl Acad Sci U S A 1991;88:9543–7. [32] Bryzgalova G, Lundholm L, Portwood N, Gustafsson J, Khan A, Efendic S, Dahlman-Wright K. Mechanisms of antidiabetogenic and body weightlowering effects of estrogen in high-fat diet-fed mice. Am J Physiol Endocrinol Metab 2008;295:E904–12. [33] Dandona P, Aljada A, Bandyopadhyay A. Inflammation: the link between insulin resistance, obesity and diabetes. Trends Immunol 2004;25:4–7. [34] Arita Y, Kihara S, Ouchi N. Paradoxical decrease of an adipose-specific protein, adiponectin, in obesity. Biochem Biophys Res Commun 1999;257:79–83. [35] Yamauchi T, Kamon J, Waki H. The fat-derived hormone adiponectin reverses insulin resistance associated with both lipoatrophy and obesity. Nat Med 2001;7:941–6. [36] Maffei M, Halaas J, Ravussin E. Leptin levels in human and rodent: measurement of plasma leptin and ob RNA in obese and weight-reduced subjects. Nat Med 1995;1:1155–61. [37] Considine RV, Sinha MK, Heiman ML, Kriauciunas A, Stephens TW, Nyce MR, et al. Serum immunoreactive-leptin concentrations in normalweight and obese humans. N Engl J Med 1996;334:292–5. [38] Black BL, Croom J, Eisen EJ, Petro AE, Edwards CL, Surwit RS. Differential effects of fat and sucrose on body composition in A/J and C57BL/6 mice. Metabolism 1998;47:1354–9.
Contents lists available at ScienceDirect
Nutrition journal homepage: www.nutritionjrnl.com
Basic nutritional investigation
Antiobesity activities of indole-3-carbinol in high-fat-diet–induced obese mice Hsiao-Pei Chang M.S. a, Mei-Lin Wang M.S. b, Ming-Hsing Chan M.D. c, Yen-Shuo Chiu M.D. d, *, Yue-Hwa Chen Ph.D. b, * a
School of Pharmacy, Taipei Medical University, Taipei, Taiwan School of Nutrition and Health Sciences, Taipei Medical University, Taipei, Taiwan c Department of Dentistry, National Yang-Ming University Hospital, I-Lan, Taiwan d Traumatology, Taipei Medical University–Taipei Municipal Wan Fang Hospital, Taipei, Taiwan b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 24 August 2009 Accepted 17 September 2010
Objective: This study investigated the effects of indole-3-carbinol (I3C), a cruciferous vegetable derivative, on obesity and its associated factors in high-fat-diet–induced obese (DIO) mice. Methods: Eighteen male C57BL/6 mice were randomly assigned to one of three groups: basal, high fat (HF), and HF þ 5 mg/kg of I3C intraperitoneally (HFI). After 12 wk of treatment, obesityassociated factors, including body weight, organ weight, serum concentrations of glucose, triacylglycerol, insulin, and adipokines, and macrophage accumulation and lipid metabolismassociated factors in epididymal adipose tissue were measured. Results: Body weight and epididymal adipose tissue weight were greater (P < 0.01), and adipocytes were larger in the HF group than in the basal and HFI groups. Compared with the HF group, the HFI group had improved glucose tolerance, a higher serum adiponectin concentration, lower serum glucose, triacylglycerol, insulin, and leptin concentrations, and less F4/80 expression in epididymal adipose tissue (P < 0.001). Furthermore, I3C treatment decreased acetyl coenzyme A carboxylase mRNA expression (P < 0.05) and increased peroxisome proliferator-activated receptor-g protein expression (P < 0.05) in epididymal adipose tissue of DIO mice. Conclusion: The I3C treatment decreased body weight and fat accumulation and infiltrated macrophages in epididymal adipose tissue of DIO mice, and these reductions were associated with improved glucose tolerance and with modulated expression of adipokines and lipogenic-associated gene products, including acetyl coenzyme A carboxylase and peroxisome proliferator-activated receptor-g. Ó 2011 Elsevier Inc. All rights reserved.
Keywords: Indole-3-carbinol Obesity Macrophage infiltration Glucose tolerance Adipokines Peroxisome proliferator-activated receptor
Introduction Obesity is always accompanied by excess lipid accumulation, impaired glucose tolerance, and elevated serum triacylglycerol (TG) concentration; thus, it is positively associated with the progression of various chronic diseases such as type 2 diabetes mellitus, cardiovascular diseases, and cancers. Adipogenesis, a process of lipid deposition and adipocyte differentiation, is regulated by several factors, including peroxisome proliferatoractivated receptors (PPARs) [1,2]. PPAR-g, one of the major Professor Chen and Dr. Chiu contributed equally to this work. This work was supported by grant 96TMU-WFH-18 from Taipei Medical University–Taipei Municipal Wan Fang Hospital, Taiwan, Republic of China. * Corresponding authors. Tel.: þ886-2-2736-1661, ext. 6550; fax:þ 886-22737-3112. E-mail addresses: [email protected] (Y.-S. Chiu), yuehwa@tmu. edu.tw (Y.-H. Chen). 0899-9007/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.nut.2010.09.006
forms of PPAR expressed in adipose tissue, is a vital regulator of adipogenesis because it regulates the expression of several adipogenesis-related genes, such as adipocyte fatty acid-binding protein (aP2), acetyl coenzyme A carboxylase (ACC), and fatty acid synthase. Thus, PPAR-g is important in the homeostasis of lipid and glucose metabolism [3]. In addition, obesity is considered a chronic low-grade inflammation state, so various inflammatory mediators have been linked to the pathogenesis of obesity-related disorders [4–6]. Cytokines and adipokines produced from infiltrated macrophages and adipocytes in expanded adipose tissue are thought to contribute to the inflammatory responses of obesity [7–9]. An overexpression of tumor necrosis factor-a, interleukin-6 (IL-6), resistin, and leptin, a suppression of adiponectin, and an excess accumulation of macrophages in adipose tissue have been reported in obese subjects [4–6], and these alterations have been reversed by weight reduction [10,11].
464
H.-P. Chang et al. / Nutrition 27 (2011) 463–470
Different studies have indicated that increased consumption of cruciferous vegetables (e.g., cabbage, broccoli, cauliflower, and Brussels sprouts) is associated with decreased risks of cancer and cardiovascular diseases, which may be due to their high contents of glucosinolates and their derivatives, including indole-3-carbinol (I3C) [12,13]. Previously, studies have reported that I3C inhibits cellular lipid synthesis in HepG2 cells [14], decreases serum cholesterol concentrations in hypercholesterolemic mice [15,16], and possesses anti-inflammatory activities in activated macrophages [17]. In addition, I3C acts as a phytoestrogen [18], and estrogen replacement therapy has been shown to improve insulin sensitivity, inhibit body fatness, and lower serum lipid and cholesterol levels [19,20]. However, data on the effects of I3C on obesity-related parameters are limited; therefore, the objective of this study was to investigate the effects of I3C on body weight, serum concentrations of lipid and adipokines, glucose tolerance, macrophage infiltration, and lipid metabolism–related genes in a high-fat-diet–induced obese (DIO) mouse model. Materials and methods Animals and diets Eighteen 5-wk-old male C57BL/6 mice obtained from the National Taiwan University Animal Center (Taipei, Taiwan) were maintained at 22 3 C under automatic lighting cycles. After a 1-wk acclimation period, mice were randomly assigned to one of three diet groupsdbasal (B), high fat (HF), and HF þ I3C (HFI)dand were housed in groups (three mice/cage). I3C was commercially purchased from Sigma Chemical (St. Louis, MO, USA) and was administered intraperitoneally three times per week at a dose of 5 mg/kg of body weight in a vehicle (polyethylene glycol:benzyl alcohol:ethanol:water, 40:0.1:10:49.9) [21]. The dose and dosing schedule of I3C was chosen because of its effectiveness on weight loss and no obvious toxicity in DIO mice from preliminary experiments. Animals in the B and HF groups received an equal volume of vehicle injection only. The diets were isocaloric, and the composition (Table 1) was a modified version of the diet used by Jiang et al. [22]. The HF diet induces hyperglycemia, hyperinsulinemia, hyperlipidemia, and obesity in animals after 12 wk of feeding [22]. All animals had free access to food and water, and the averaged group body weights and food intakes were recorded twice a week. At the end of the experiment (12 wk), mice were sacrificed after an overnight fasting. Organ weights were measured, and blood and epididymal adipose tissues were collected for analysis. This experimental protocol was approved by the institutional animal care and use committee at Taipei Medical University (LAC-96-0088). Biochemical measurements Serum glucose and TG concentrations were analyzed by using Randox Glucose and Randox TRIGS assay kits (Randox Labs, Crumlin, UK). An oral glucose tolerance test (OGTT) was performed at 12 wk. After the mice were deprived of food for 16 h, blood was withdrawn from the tail vein for the baseline measurements. The OGTT was performed by administering a glucose solution
(2 g/kg) by gavage and then measuring blood glucose concentrations at 0, 30, 60, 90, and 120 min with a glucometer (Bayers, Mishawaka, IN, USA). Histopathology and immunohistochemistry of adipose tissue After being fixed with paraformaldehyde, embedded in paraffin, and sliced, one piece of epididymal adipose tissue from three animals per group was stained with hematoxylin and eosin. For immunohistochemistry, the slides were blocked with H2O2 followed by sequentially incubating with anti-mouse F4/80 antibody (Serotec, Raleigh, NC, USA), biotinylated anti-rat immunoglobulin G (Vector Laboratories, Burlingame, CA, USA), and streptavidin horseradish peroxidase (Vector Laboratories). After treating with a 3,30 -diaminobenzidine substrate kit (Vector Laboratories) and staining with Grill’s hematoxylin, the sections were observed and photographed under a phase-contrast light microscope. Immunoblotting analysis Another piece of epididymal adipose tissue from three animals per group was lysed by RIPA buffer (10 mM Tris, pH 7.4; 150 mM NaCl; 1 mM ethylenediaminetetra-acetic acid; 0.1% sodium dodecyl sulfate; 1% Triton X-100; 1% sodium deoxycholate; and 0.25 mM phenyl methyl sulfonyl fluoride), and the cellular protein was obtained after centrifugation. After separation by 10% sodium dodecylsulfate polyacrylamide gel electrophoresis, the protein was transferred to a nitrocellulose membrane that was then blocked with non-fat dry milk followed by hybridization with an anti-mouse PPAR-g antibody (Santa Cruz Biotechnology, Santa Cruz, CA, USA). After washing and incubating with a secondary antibody (Santa Cruz Biotechnology), the immunocomplex was detected using Amersham ECL western blotting detection reagents (GE Healthcare, Piscataway, NJ, USA). The autoradiogram was visualized and quantified using Image-Pro Plus 4.5 (MediaCybernetic, Bethesda, MD, USA). Reverse transcriptase polymerase chain reaction and real-time polymerase chain reaction analyses Reverse transcriptase polymerase chain reaction (RT-PCR) and real-time PCR were performed to determine the mRNA expression of lipogenic-associated gene products and F4/80, respectively. After being extracted using TRIzol Reagent (Invitrogen Life Technologies, Carlsbad, CA, USA), total cellular RNA from epididymal adipose tissue of three animals per group was subjected to reverse transcription by SuperScript III (Invitrogen Life Technologies). For semiquantitative analysis of ACC, aP2, and glyceraldehyde-3-phosphate dehydrogenase, cDNA was subjected to PCR, which consisted of 32 cycles at 94 C for 1 min, 60 C for 90 s, and 72 C for 60 s. The PCR products were then separated by agarose gel, and the images were visualized and quantified using Image-Pro Plus 4.5 (MediaCybernetic). For analyses of F4/80 and b-actin, real-time PCR was achieved in a LightCycler (Roche Diagnostics, Basel, Switzerland) using LightCyclerFastStart DNA Master SYBR Green I (Roche Diagnostics, Indianapolis, IN, USA). The reactions were performed at 95 C for 10 s, 55 C for 10 s, and 72 C for 20 s for 45 cycles. Expression of the F4/80 mRNA was normalized to the expression of b-actin. Primer pairs for transcripts of interest were designed using Primer Express software (Applied Biosystems, Carlsbad, CA, USA) and are listed in Table 2. Measurement of adipokines The increased mass and infiltrated macrophages in adipose tissue in obesity are associated with an altered secretion of adipokines and cytokines; therefore, the adipokines secreted in the blood were investigated. Serum concentrations of leptin, adiponectin, resistin, macrophage chemoattractant protein-1 (MCP-1), and IL-6 were measured using enzyme-linked immunosorbent assay kits (R&D
Table 1 Composition of the diets (grams per kilogram)
Corn starch* Casein* Dextrin* Sucrose* Soybean oil Lard Cellulose* Mineral mixture*, y Vitamin mixture*, y L-cystine* Choline bitartrate Tert-butyl hydroquinone* * y
Basal diet
High-fat diet
465.692 140 155 100 40 0 50 35 10 1.8 2.5 0.01
125.1 184.3 125.1 128.9 152.9 152.9 65.8 46.1 13.2 2.4 3.3 0.01
Purchased from ICN Biochemicals (Costa Mesa, CA, USA). AIN-93 mineral mixture and AIN-93 vitamin mixture.
Table 2 Sequences of primers Primer
Sequences (50 to 30 )
Size
G3PDH
GCCATGCCCAGAGGGTGGTT (forward) AGGGGTCGACCTGGTCCTCA (reverse) GAACCTGGAAGCTTGTC (forward) ACTCTTGTGGAAGTCACG (reverse) TGACTGCCGAAACATCTCTG (forward) GCCTCTTCCTGACAAACGAG (reverse) AGCGATGTACGTAGCCATCC (forward) CTCTCAGCTGTGGTCGTCAA (reverse) TGCATCTAGCAATGGACAGC (forward) GCCTTCTGGATCCATTTGAA (reverse)
983 bp
aP2 ACC
b-actin F4/80
364 bp 239 bp 228 bp 169 bp
ACC, acetyl coenzyme-A carboxylase; aP2, adipocyte fatty acid-binding protein; G3PDH, glyceraldehyde-3-phosphate dehydrogenase
H.-P. Chang et al. / Nutrition 27 (2011) 463–470 Systems, Minneapolis, MN, USA), and insulin was measured by an radioimmunoassay kit (Mercodia, Uppsala, Sweden). Statistical analysis Results are expressed as mean standard deviation. One-way analysis of variance and then Fisher’s least significant difference test were used to determine statistical differences between groups with SAS 9.0 (SAS Institute, Cary, NC, USA). Differences were considered statistically significant at P < 0.05. Bonferroni’s correction was applied for multiple comparisons (time and treatment) of body weight and OGTT. Differences were considered statistically significant at P < 0.005. Analysis of covariance was also performed to test differences in organ weights by group and covary body weight. Bonferroni’s correction and analysis of covariance were determined with SPSS 15.0 (SPSS, Inc., Chicago, IL, USA).
Results Body and organ weights No significant differences in daily food intake were observed among groups (P ¼ 0.084; Fig. 1A); however, body weight was greater with the HF diet than the B diet at the end of the experiment (P < 0.001; Fig. 1B). In addition, no differences in the weights of the various organs were detected (P ¼ 0.12), except that the relative weight of epididymal adipose tissue was greater
Averaged food intake (g/mouse)
A
4
3
Biochemical measurements The HF diet significantly induced high fasting serum concentrations of TG (P < 0.005), glucose (P < 0.001; Fig. 2A), and insulin (P < 0.01; Fig. 2B) compared with animals on the B diet, and the animals showed poor glucose tolerance (P < 0.005) to the OGTT as shown by the blood glucose concentration at each time point (Fig. 2C) and the area curve under the curve for glucose (Fig. 2D) after 12 wk of feeding. However, these abnormalities induced by the HF diet were considerably ameliorated by the I3C treatment (P < 0.05). Histopathology and macrophage accumulation of adipose tissue Figure 3A indicates that the HF group had larger adipocytes than did the B group. Similar to the results for body weight, the size of the adipocytes in adipose tissue was significantly smaller in the HFI group. The immunohistochemical and real-time PCR analyses also showed greater F4/80 expression of epididymal adipose tissue in the HF than in the B group (P < 0.001); however, I3C significantly ameliorated (P < 0.001) the expressions of F4/80 (Fig. 3B,C).
As shown in Figure 4, mRNA expressions of ACC (a key enzyme of de novo lipogenesis) and aP2 (an adipocyte fatty acidbinding protein) were enhanced by the HF diet, whereas I3C suppressed (P < 0.05) 40% of the HF-enhanced ACC, although I3C did not significantly affect the HF-induced aP2 mRNA expression (P ¼ 0.27). Furthermore, the expression of the PPAR-g protein was suppressed (P < 0.05) in animals fed the HF diet compared with the B group; I3C reversed (P < 0.02) the HF-inhibited expression in the epididymal adipose tissue.
2
1
B HF HFI
0
2
4
6
8
10
12
Time (week)
Adipokines
50 B HF HFI
40
Body weight (g)
(P < 0.001) in the HF group (Table 3). Epididymal adipose tissue was significantly associated with the percentage of weight change (P < 0.001). Conversely, body weight was 18% lower (P < 0.001) and epididymal adipose tissue weight was significantly lower (P < 0.01) in the HFI group compared with the HF group.
Expression of lipid metabolism-associated factors
0
B
465
30
* * * * * *
20
* * *
10
As shown in Figure 5A, animals fed the HF diet for 8 wk had lower concentrations of serum adiponectin than did the animals in the B group (P < 0.05), but I3C reversed this decrease by the end of the experiment (P < 0.05). In contrast, the serum resistin concentration was not affected (P ¼ 0.08) by the HF diet, but I3C lowered the concentration at 8 wk (P < 0.001; Fig. 5B). Furthermore, the elevated serum leptin concentration induced by the HF diet was significantly suppressed (P < 0.05) by I3C treatment (Fig. 5C), and neither IL-6 (P ¼ 0.07) nor MCP-1 (P ¼ 0.13) changed in response to the HF diet or I3C treatment (data not shown). Discussion
0 0
2
4
6
8
10
12
14
week Fig. 1. Effects of indole-3-carbinol on averaged food intake (A) and body weight (B) in mice fed different diets for 12 wk. Values are presented as mean SD (n ¼ 6). * P < 0.005 compared with the HF group at the same time point. B, basal diet; HF, high-fat diet; HFI, high-fat diet þ intraperitoneally administered indole-3-carbinol.
Our observations demonstrated, for the first time, that I3Cda glucosinolate derivative from cruciferous vegetablesdcan affect adiposity, i.e., it decreased body weight, decreased the weight of epididymal fat mass, and modulated lipid metabolism-associated gene products in DIO mice. In addition, conditions associated with obesity–including high serum concentrations of glucose,
466
H.-P. Chang et al. / Nutrition 27 (2011) 463–470
Table 3 Effects of indole-3-carbinol on absolute and adjusted organ weights (grams)* Group
Organ Epididymal adipose tissue
Liver
Heart
Kidney
Spleen
2.65 0.47a 0.47 0.17a
3.82 0.18 0.94 0.02
0.47 0.10 0.44 0.04
1.11 0.06 1.11 0.06
0.28 0.07 0.29 0.04
6.73 1.53b 2.17 0.27b
3.43 0.67 1.04 0.09
0.42 0.08 0.51 0.07
1.12 0.12 1.1 0.1
0.23 0.05 0.21 0.06
3.00 0.82c 1.17 0.12c
3.65 0.31 1.1 0.04
0.42 0.08 0.41 0.03
1.05 0.08 1.04 0.05
0.25 0.05 0.25 0.03
B Absolute Adjustedy HF Absolute Adjustedy HFI Absolute Adjustedy
B, basal diet; HF, high-fat diet; HFI, high-fat diet þ 5 mg/kg of indole-3-carbinol intraperitoneally * Values are presented as mean SD (n ¼ 6). Data with different superscript letters significantly differ between groups in the same column (P < 0.05). y Data are adjusted weights by analysis of covariance.
TG, insulin, and leptin and low concentrations of serum adiponectin, poor glucose tolerance, and excess macrophage accumulation in the adipose tissuedwere ameliorated by intraperitoneal administration of I3C. Therefore, I3C may help prevent obesity, lipid accumulation, and related macrophage infiltration caused by the long-term consumption of an HF diet. I3C is a compound with a mildly nauseating odor, which may interfere food intake and thus body weight gain, although no evidence has shown it causes feed avoidance. To minimize the disparities in food intake and to ensure the animals received exact treatment
C Triglyceride Glucose
c 150 b 100
a
** 50
*
*
Blood glucose concentration (mg/dl)
Blood concentration (mg/dl)
A 200
doses, I3C was injected intraperitoneally, and the dose of 5 mg/kg may be achieved by a human taking one capsule of 500-mg I3C supplement without considering digestion and absorption. However, several acid-catalyzed compounds, such as indolo[3,2-b] carbazole and 3,30 -diindolylmethane, formed after oral consumption of I3C have been indicated to possess biological activities similar to I3C [18], so the overall antiobesity activities by oral consumption of I3C and/or cruciferous vegetables require further investigation. Nonetheless, the intraperitoneal administration of I3C provides an excellent baseline of studies
0
*
150
* # #*
#
100
# 50
HFI
0
D
1.8
30
60
90
120
Time (min) 1000
b
c
1.6
b
1.4 a
1.0 0.8 0.6 0.4
AUC glucose (mmol/l/120 min)
Serum insulin concentration (ug/l)
HF
2.0
1.2
B HF HFI
0 B
B
200
800
600
a
a
400
200
0.2 0.0
0 B
HF
HFI
B
HF
HFI
Fig. 2. Effects of indole-3-carbinol on serum concentrations of glucose and triacylglycerol (A) and insulin (B) in fasted animals and on blood glucose concentration after an oral glucose tolerance test (C) and AUC for glucose (D) in animals fed different diets for 12 wk. Values with different letters or symbols indicate significant differences between groups in the same parameter (P < 0.05). * P < 0.05 compared with the B group; # P < 0.05 compared with the HF group at the same time point. AUC, area under the curve; B, basal diet; HF, high-fat diet; HFI, high-fat diet þ intraperitoneally administered indole-3-carbinol.
H.-P. Chang et al. / Nutrition 27 (2011) 463–470
467
Fig. 3. Effects of indole-3-carbinol on histologic changes (A), expressions of F4/80 protein (200 magnification, B), and F4/80 mRNA (C) in epididymal adipose tissue in animals fed different diets for 12 wk. Tissues were fixed and stained with hematoxylin and eosin. F4/80 protein in epididymal adipose tissue was detected by immunohistochemistry, and F4/80 mRNA expression was determined by quantitative real-time polymerase chain reaction. The black arrows indicate F4/80 protein, which was observed near blood vessels and among large adipocytes in adipose tissue. Scale bar ¼ 100 mm. Values are presented as mean SD (n ¼ 3). Data with different letters indicate significant differences between groups (P < 0.05). B, basal diet; HF, high-fat diet; HFI, high-fat diet þ intraperitoneally administered indole-3-carbinol.
468
H.-P. Chang et al. / Nutrition 27 (2011) 463–470
A
1.0
3.0 aP2 ACC
2.5
**
2.0
c
* **
1.5 1.0
*
b a
0.5 0.0 B
HF
HFI
Protein expression (arbitary unit)
mRNA expression (arbitary unit)
B
PPAR-γ
c 0.8 b 0.6
a
0.4 0.2 0.0 B
HF
HFI
Fig. 4. Effects of indole-3-carbinol on the expression of lipid metabolism-associated gene products in epididymal adipose tissue in mice fed different diets for 12 wk. (A) The expression of aP2 and ACC mRNAs and PPAR-g protein was determined by reverse transcriptase polymerase chain reaction and western blot analysis, respectively. (B) The levels of different gene products were quantified from 3 independent experiments. Images represent three independent experiments. Data with different letters or symbols indicate significant differences between groups in the same parameter (P < 0.05). ACC, acetyl coenzyme-A carboxylase; aP2, adipocyte fatty acid-binding protein; B, basal diet; HF, high-fat diet; HFI, high-fat diet þ intraperitoneally administered indole-3-carbinol; PPAR-g, peroxisome proliferator-activated receptor-g.
of the effects of I3C itself that can be followed with studies using other routes of administration. Excess lipid accumulation is closely associated with insulin resistance, impaired glucose tolerance, and elevated serum TG concentration in obese subjects [23,24]. I3C treatment decreased lipogenic ACC expression in epididymal adipose tissue of DIO mice. An increased expression of ACC has been reported in the steatotic livers of ob/ob mice [25] and during the differentiation of cultured 3T3-L1 preadipocytes [26]. Parallel to the results we obtained, I3C has been reported to decrease TG contents by suppressing the mRNA expression of sterol regulatory element binding protein-1 (SREBP-1) and ACC in HepG2 cells [14]; therefore, these results suggest that I3C may act by decreasing the ACC expression to decrease TG synthesis and lipid contents in the adipose tissue in DIO mice. In addition, I3C increased HF-suppressed PPAR-g expression in epididymal adipose tissue. PPAR controls adipocyte differentiation and lipid metabolism by regulating lipogenic and lipolytic genes and thus enhances the efficiency of lipid utilization [1]. Exacerbated insulin resistance is
observed in PPAR-g gene knockout mice, indicating the importance of PPAR-g in obesity-related disorders [27]. Clinically, PPAR agonists have been used as lipid-lowering and antidiabetic drugs to resolve the symptoms of metabolic diseases [28], so the increased PPAR-g expression in adipose tissue by I3C treatment may assist adipocyte differentiation, enhance insulin sensitivity, and lower blood lipid concentrations. Furthermore, aryl hydrocarbon receptor (AhR) has been indicated to act as an inhibitor of TG synthesis and an early regulator of adipocyte differentiation [29]; AhR ligands are also able to downregulate hepatic PPAR-a to modulate lipid metabolism [30]. Being one of the ligands of the AhR [31], although not potent, I3C may act through AhR to decrease body weight/fat, lipid accumulation, blood glucose, and TG, and these consequences may lead to the improvement in insulin sensitivity in DIO mice. Alternatively, the effects of I3C on these metabolic changes may be related to its phytoestrogenic activity [18], because estrogen treatment has been shown to ameliorate HF diet-induced obesity, insulin resistance, glucose intolerance, and hyperlipidemia [19,20,32]. Taken together, I3C
H.-P. Chang et al. / Nutrition 27 (2011) 463–470
A
3000 b
2500
Adiponectin (pg/ml)
0 week 8 week 12 week
##
b
2000 #
a
#
1500 1000 500 0 B
B
HF
HFI
5000
4000
0 week 8 week 12 week
# ##
Resistin (pg/ml)
## 3000
#
2000
0 B
HF
HFI
2000 0 week 8 week 12 week
c
1500
Leptin (ng/ml)
attenuated by I3C. In addition, we have demonstrated that I3C enhanced serum adiponectin and decreased serum leptin concentrations in DIO mice. Decreased serum adiponectin concentrations have been observed in humans with high levels of visceral fat [34], and the intraperitoneal injection of adiponectin has been shown to improve insulin resistance by decreasing TG concentrations in the muscle and liver of obese mice [35]. Leptin is involved in the metabolism of glucose and lipid. Fasting serum leptin concentrations are elevated in obese patients in proportion to the degree of obesity [36], and it has been suggested that obesity may be the result of a resistance to leptin in a similar way as people with type 2 diabetes are resistant to insulin [37]. Thus, the enhancement of adiponectin and the inhibition of leptin by I3C in DIO mice suggest a potential role for I3C in the prevention of obesity-induced metabolic disorders. In contrast, neither the HF diet nor I3C administration affected serum concentrations of inflammatory adipokines, including resistin, IL-6 and MCP-1, although Black et al. [38] observed elevated expressions of IL-6 and MCP-1 mRNAs in adipose tissue after mice were fed an HF diet for 3 wk. It is possible that IL-6 and MCP-1 have short-term effects, and their expression may not be involved in the pathologic changes in DIO mice observed after 12 wk. These results suggest that I3C may be helpful in decreasing inflammatory conditions and thus decrease the pathologic changes observed in obese subjects. Conclusion
1000
C
469
Indole-3-carbinol inhibits obesity, improves hyperglycemia and hyperinsulinemia, and decreases infiltrated macrophages in epididymal adipose tissue of mice fed an HF diet; such effects are associated with the modulated expression of adipokines, ACC, and PPAR-g in epididymal adipose tissue. The results obtained from this study provide an alternative protective mechanism of cruciferous vegetable derivatives or their supplements in the prevention of obesity and its related metabolic disorders.
b
References 1000
500
0
##
# a
B
#
HF
HFI
Fig. 5. Effects of indole-3-carbinol on adiponectin (A), resistin (B), and leptin (C) in HF-induced obese mice fed different diets for 0, 8, or 12 wk. Serum concentrations of adiponectin, resistin, and leptin were determined using enzyme-linked immunosorbent assay. Values are presented as mean SD (n ¼ 6). Data with different letters or symbols indicate significant differences between groups at the same time point (P < 0.05). B, basal diet; HF, high-fat diet; HFI, high-fat diet þ intraperitoneally administered indole-3-carbinol.
may be useful in the treatment of HF diet–induced obesity and its associated disorders, such as hyperglycemia, insulin resistance, and hyperlipidemia, and these effects may be associated with AhR- and estrogen-mediated pathways. It has been indicated that inflammation may be a potential mechanism by which obesity leads to insulin resistance [4,33]. In epididymal adipose tissue, the macrophage-specific marker F4/80 was dramatically upregulated in obese mice, but was
[1] Rosen ED, Sarraf P, Troy AE, Bradwin G, Moore K, Milstone DS, et al. PPAR gamma is required for the differentiation of adipose tissue in vivo and in vitro. Mol Cell 1999;4:611–7. [2] Spiegelman BM, Hu E, Kim JB, Brun R. PPAR gamma and the control of adipogenesis. Biochimie 1997;79:111–2. [3] Berger JP. Role of PPARgamma, transcriptional cofactors, and adiponectin in the regulation of nutrient metabolism, adipogenesis and insulin action: view from the chair. Int J Obes 2005;29:S3–4. [4] Xu H, Barnes GT, Yang Q, Tan G, Yang D, Chou CJ, et al. Chronic inflammation in fat plays a crucial role in the development of obesity-related insulin resistance. J Clin Invest 2003;112:1821–30. [5] Wellen KE, Hotamisligil GS. Obesity-induced inflammatory changes in adipose tissue. J Clin Invest 2003;112:1785–8. [6] Weisberg SP, McCann D, Desai M, Rosenbaum M, Leibel RL, Ferrante Jr AW. Obesity is associated with macrophage accumulation in adipose tissue. J Clin Invest 2003;112:1796–808. [7] Wisse BE. The inflammatory syndrome: the role of adipose tissue cytokines in metabolic disorders linked to obesity. J Am Soc Nephrol 2004;15:2792–800. [8] Hotamisligil GS, Shargill NS, Spiegelman BM. Adipose expression of tumor necrosis factor-a: direct role in obesity-linked insulin resistance. Science 1993;259:87–91. [9] Das UN. Is obesity an inflammatory condition? Nutrition 2001;17:953–66. ment K, Viguerie N, Poitou C, Carette C, Pelloux V, Curat CA, Sicard A. [10] Cle Weight loss regulates inflammation-related genes in white adipose tissue of obese subjects. FASEB J 2004;18:1657–69. [11] Puglisi MJ, Fernandez ML. Modulation of C-reactive protein, tumor necrosis factor-alpha, and adiponectin by diet, exercise, and weight loss. J Nutr 2008;138:2293–6. [12] Liu S, Manson JE, Lee IM. Fruit and vegetable intake and risk of cardiovascular disease: the Women’s Health Study. Am J Clin Nutr 2000;72:922–8.
470
H.-P. Chang et al. / Nutrition 27 (2011) 463–470
[13] Verhoeven DTH, Goldbohm RA, van Poppel G, Verhagen H, van den Brandt PA. Epidemiological studies on Brassica vegetables and cancer risk. Cancer Epidemiol Biomarkers Prev 1996;5:733–48. [14] Maiyoh GK, Kuh JE, Casaschi A, Theriault AG. Cruciferous indole-3-carbinol inhibits apolipoprotein B secretion in HepG2 cells. J Nutr 2007;137:2185–9. [15] Dunn SE, LeBlanc GA. Hypocholesterolemic properties of plant indoles. Inhibition of acyl-CoA:cholesterol acyltransferase activity and reduction of serum LDL/VLDL cholesterol levels by glucobrassicin derivatives. Biochem Pharmacol 1994;47:359–64. [16] LeBlanc GA, Stuart JD, Dunn SE, Baldwin WS. Effect of the plant compound indole-3-carbinol on hepatic cholesterol homoeostasis. Food Chem Toxicol 1994;32:633–9. [17] Chen YH, Dai HJ, Chang HP. Suppression of inducible nitric oxide production by indole and isothiocyanate derivatives from Brassica plants in stimulated macrophages. Planta Med 2003;69:696–700. [18] Kim YS, Milner JA. Targets for indole-3-carbinol in cancer prevention. J Nutr Biochem 2005;16:65–73. [19] Salpeter SR, Walsh JME, Ormiston TM, Greyber E, Buckley NS, Salpeter EE. Meta-analysis: effect of hormone-replacement therapy on components of the metabolic syndrome in postmenopausal women. Diabetes Obes Metab 2006;72:922–8. [20] Tcheronv A, Calles-Escandon J, Sites CK, Poehlman ET. Menopause, central body fatness, and insulin resistance: effects of hormone-replacement therapy. Coron Artery Dis 1998;5:733–48. [21] Khor TO, Keum YS, Lin W. Combined inhibitory effects of curcumin and phenethyl isothiocyanate on the growth of human PC-3 prostate xenografts in immunodeficient mice. Cancer Res 2006;66:613–21. [22] Jiang T, Wang Z, Proctor G. Diet-induced obesity in C57BL/6J mice causes increased renal lipid accumulation and glomerulosclerosis via a sterol regulatory element-binding protein-1c–dependent pathway. J Biol Chem 2005;280:32317–25. [23] Bray GA. Medical consequences of obesity. J Clin Endocrinol Metab 2004;89:2583–9. [24] Zamboni M, Armellini F, Turcato E. Relationship between visceral fat, steroid hormones and insulin sensitivity in premenopausal obese women. J Intern Med 1994;236:521–7. [25] Shimomura I, Bashmakov Y, Horton JD. Increased levels of nuclear SREBP1c associated with fatty livers in two mouse models of diabetes mellitus. J Biol Chem 1999;274:30028–32.
[26] Gregoire FM, Smas CM, Sul HS. Understanding adipocyte differentiation. Physiol Rev 1998;78:783–809. [27] He W, Barak Y, Hevener A, Olson P. Adipose-specific peroxisome proliferatorsactivated receptor gamma knockout caused insulin resistance in fat and liver but not in muscle. Proc Natl Acad Sci U S A 2003;100:15715–7. [28] Jay MA, Ren J. Peroxisome proliferator-activated receptor (PPAR) in metabolic syndrome and type 2 diabetes mellitus. Curr Diabetes Rev 2007;3:33–9. [29] Alexander DL, Ganem LG, Fernandez-Salguero P, Gonzalez F, Jefcoate CR. Aryl-hydrocarbon receptor is an inhibitory regulator of lipid synthesis and of commitment to adipogenesis. J Cell Sci 1998;111:3311–22. [30] Shaban Z, El-Shazly S, Abdelhady S, Fattouh I, Muzandu K, Ishizuka M, et al. Down regulation of hepatic PPARalpha function by AhR ligand. J Vet Med Sci 2004;66:1377–86. [31] Bjeldanes LF, Kim JY, Grose KR, Batholomew JC, Bradfield CA. Aromatic hydrocarbon responsiveness-receptor agonists generated from indole-3carbinol in vitro and in vivo: comparisons with 2,3,7,8-tetracholordibenzo-p-dioxin. Proc Natl Acad Sci U S A 1991;88:9543–7. [32] Bryzgalova G, Lundholm L, Portwood N, Gustafsson J, Khan A, Efendic S, Dahlman-Wright K. Mechanisms of antidiabetogenic and body weightlowering effects of estrogen in high-fat diet-fed mice. Am J Physiol Endocrinol Metab 2008;295:E904–12. [33] Dandona P, Aljada A, Bandyopadhyay A. Inflammation: the link between insulin resistance, obesity and diabetes. Trends Immunol 2004;25:4–7. [34] Arita Y, Kihara S, Ouchi N. Paradoxical decrease of an adipose-specific protein, adiponectin, in obesity. Biochem Biophys Res Commun 1999;257:79–83. [35] Yamauchi T, Kamon J, Waki H. The fat-derived hormone adiponectin reverses insulin resistance associated with both lipoatrophy and obesity. Nat Med 2001;7:941–6. [36] Maffei M, Halaas J, Ravussin E. Leptin levels in human and rodent: measurement of plasma leptin and ob RNA in obese and weight-reduced subjects. Nat Med 1995;1:1155–61. [37] Considine RV, Sinha MK, Heiman ML, Kriauciunas A, Stephens TW, Nyce MR, et al. Serum immunoreactive-leptin concentrations in normalweight and obese humans. N Engl J Med 1996;334:292–5. [38] Black BL, Croom J, Eisen EJ, Petro AE, Edwards CL, Surwit RS. Differential effects of fat and sucrose on body composition in A/J and C57BL/6 mice. Metabolism 1998;47:1354–9.