Antioxidant enzyme systems and the ascorbate–glutathione cycle as contributing factors to cadmium accumulation and tolerance in two oilseed rape cultivars (Brassica napus L.) under moderate cadmium stress

Chemosphere 138 (2015) 526–536

Contents lists available at ScienceDirect

Chemosphere journal homepage: www.elsevier.com/locate/chemosphere

Antioxidant enzyme systems and the ascorbate–glutathione cycle as contributing factors to cadmium accumulation and tolerance in two oilseed rape cultivars (Brassica napus L.) under moderate cadmium stress Zhichao Wu, Xiaohu Zhao, Xuecheng Sun, Qiling Tan, Yafang Tang, Zhaojun Nie, Chanjuan Qu, Zuoxin Chen, Chengxiao Hu ⇑ Hubei Provincial Engineering Laboratory for New Fertilizers/Research Center of Trace Elements, Huazhong Agricultural University, Wuhan 430070, China

h i g h l i g h t s  Cd accumulation in L351 was higher than L338, particularly with increasing levels of Cd exposure.  SOD was not the key factor contributing the differences of Cd accumulation in L351 and L338.  Antioxidant enzymes and the GSH–AsA cycle contribute to cadmium accumulation and tolerance.

a r t i c l e

i n f o

Article history: Received 27 January 2015 Received in revised form 13 June 2015 Accepted 25 June 2015

Keywords: Cd Oxidative stress Antioxidant enzyme activities Reactive oxygen species Gene expression

a b s t r a c t Oilseed rape (Brassica napus L.) with high tolerance to cadmium (Cd) may be used in the phytoremediation of Cd-contaminated fields. However, the mechanisms responsible for Cd accumulation and tolerance in oilseed rape are still poorly understood. Here, we investigated the physiological and molecular processes involved in Cd tolerance of two oilseed rape cultivars with different Cd accumulation abilities. The total Cd accumulation in cultivar L351 was higher than cultivar L338, particularly with increasing concentrations of Cd exposure. L338 was a more pronounced Cd-sensitive cultivar than L351, while higher activities of antioxidant enzymes (CAT, APX, GR, DHAR) as well as higher contents of GSH and AsA were all observed in L351 under Cd treatments, especially at high levels. No differences were found in SOD activities between the two cultivars under the same Cd treatments, suggesting that SOD was not the key factor in relation to the differences of Cd tolerance and accumulation between them. Gene expression levels of BnFe-SOD, BnCAT, BnAPX, BcGR and BoDHAR in roots of L351 were relatively higher than that in L338 under Cd exposure as well as BnCAT and BcGR in leaves. It is concluded that antioxidant enzymes and the ascorbate–glutathione cycle play important roles in oilseed rape Cd accumulation and tolerance. Ó 2015 Published by Elsevier Ltd.

1. Introduction Cadmium (Cd) is one of the most toxic heavy metal elements without any known beneficial function in plants (Wang et al., 2007). Due to the anthropogenic, industrial and agricultural processes, large areas of agricultural lands are contaminated with Cd, which causes a series of severe phyto-toxicities including growth inhibition, leaf chlorosis, declines in nitrogen metabolism, photosynthesis, respiration and mineral nutrition, and even plant death (Smeets et al., 2008; Hasan et al., 2009). ⇑ Corresponding author at: College of Resources and Environment, Huazhong Agricultural University, No. 1, Shizishan Street, Hongshan District, Wuhan, Hubei Province 430070, China. E-mail address: [email protected] (C. Hu). http://dx.doi.org/10.1016/j.chemosphere.2015.06.080 0045-6535/Ó 2015 Published by Elsevier Ltd.

To remove Cd from contaminated sites, the cost-efficient and environmentally friendly remediation technology, phytoremediation, is often applied since some plant species, especially fast growing, high biomass and easily harvested crop plants such as Brassica species, which has been identified to have the ability to hyperaccumulate heavy metals (Wang et al., 2009). There are generally two tactics applied to promote the efficiency of phytoremediation. One is selecting for desirable high-Cd accumulation species. Another approach is to use molecular techniques to re-engineer plants that accumulate and tolerate high concentrations of toxic metals to improve their phytoremediation ability (Wang et al., 2009). However, these methods demand a mechanistic understanding of the relationship between Cd accumulation and tolerance, both at the physiological and molecular levels.

Z. Wu et al. / Chemosphere 138 (2015) 526–536

However, little work has been done to date in this area of research for oilseed rape. As reported, Cd induces the disturbance of cellular redox balance leading to the accumulation of reactive oxygen species (ROS), causing severe damage to plant cells (Hasan et al., 2009). Fortunately, plants have evolved a range of protective and repair systems to minimize the occurrence of oxidative damage. There are defense systems which either react with ROS and maintain them at a very low level or are antioxidant enzymes such as superoxide dismutase (SOD), catalase (CAT), ascorbate peroxidase (APX), glutathione reductase (GR) and dehydroascorbate reductase (DHAR) (Nahakpam and Shah, 2011) as well as antioxidants such as glutathione (GSH) and ascorbic acid (AsA) (Shah et al., 2001; Mittler, 2002). In plants, O 2 can first be converted to H2O2 by catalysis with SOD, and further degraded into H2O by CAT and APX. GR and DHAR play important roles in keeping the metabolic balance between GSH and AsA contents, which are also involved in heavy metal detoxification (Sharma and Dietz, 2009). Although antioxidant enzyme activities and antioxidant contents in plants under heavy metal stress may be stimulated, be unaffected or be inhibited depending on plant species, metal ions, concentrations and exposure duration (Schützendübel and Polle, 2002), overexpression of these enzymes in various plants has been confirmed to contribute to higher tolerance and accumulation of Cd (Seth, 2012). The objectives of the present study were to investigate the physiological and molecular processes underlying the potential relationship between Cd accumulation and tolerance in two oilseed rape cultivars with discrepant Cd accumulation levels in tissues and evaluated the response and mechanism of Brassica napus L. species against Cd stress in relation to facilitate the development of new strategies to create metal-tolerant, biofortified plants suitable for the phytoremediation of Cd-contaminated sites. 2. Materials and methods 2.1. Plant materials and growth conditions Two contrasting oilseed rape cultivars L338 and L351, were selected by the Cd contents in shoots from 56 oilseed rape cultivars through solution culture and pot experiments, and were used for all experiments. Seeds were germinated via immersing in deionized water at 28 °C under a dark conditions. After one week, 18 morphologically uniform seedlings were selected and inserted into plate holes in a black polyethylene box (52  33  7 cm) containing 10 L half-strength modified Hoagland solution for 5 d and subsequently full-strength for another 5 d. The full-strength modified Hoagland solution was as described by Nakamura et al. (2008). The pH of the solution was adjusted to 6.7 with 1.0 M NaOH. The containers were kept in a greenhouse maintained with a 16 h photo period and temperature controlled at 20–25 °C. The nutrient solution was aerated continuously with an air pump and renewed once every 4 d. After cultivation for 10 d, Cd was added into the medium as CdCl2 in four concentrations: 0, 0.03, 0.3 and 1 mg L1 Cd. After three weeks, samples were harvested and used for the determination of various parameters. Each treatment was replicated four times.

527

with a controlled temperature to 160 °C, and subsequently was subjected to determination of Cd concentration by flame atomic absorption spectrometry (Z-2000; HITACHI, Tokyo, Japan). 2.3. Transmission electron microscopy analysis After exposure to 0 and 1 mg L1 Cd for three weeks, the leaf fragments (about 1 mm2) and root tips (about 2–3 mm) were fixed in 2.5% (v/v) glutaraldehyde in 50 mM sodium phosphate buffer (PBS, pH 6.8) for 4 h at room temperature and then washed three times with PBS. Samples were post-fixed in 1% (m/v) OsO4 in 50 mM sodium cacodylate (pH 7.2) for 1 h and washed three times with PBS. After that, the samples were dehydrated in a graded series of ethanol (30, 40, 50, 60, 70, 80, 90, 95, and 100%, v/v) for 15–20 min and then in absolute acetone for 20 min. After dehydration, the samples were embedded in Spurr’s resin overnight. After heating the specimens at 70 °C for 9 h, the ultrathin sections (80 nm) were cut and mounted on copper grids for observation under the transmission electron microscope (TEM H7650, HITACHI, Japan) at 60.0 kV. 2.4. Determination of hydrogen peroxide (H2O2) and malondialdehyde (MDA) contents Fresh material (about 0.5 g) was homogenized in 0.1% (w/v) cold trichloroacetic acid (TCA). After centrifugation at 12,000g for 20 min, the extract supernatant was used for determination of H2O2 and MDA levels. The H2O2 content was performed as described by Alexieva et al. (2001). The reaction mixture contained 0.5 mL of plant extract supernatant, 0.5 mL of 100 mM Kphosphate buffer (pH 6.8) and 2 mL reagent (1 M KI w/v in fresh double-distilled water). 0.1% TCA solution without material extract was used as the blank. The mixture was incubated for 1 h in the dark and the absorbance was measured at 390 nm. The amount of hydrogen peroxide was calculated according to a standard curve with known concentrations of H2O2. For MDA determinations, 1 mL of supernatant was mixed with 4 mL of TBA reagent (0.5% of TBA in 20% TCA). The reaction mixture was heated at 95 °C for 30 min in a water bath, quickly cooled in an ice bath and centrifuged at 12,000g for 15 min. The MDA content was calculated from the difference between the absorbance values at 532 and 600 nm with a extinction coefficient of 155 mM cm1 as described by Ben Amor et al. (2005). 2.5. Determination of glutathione and ascorbate Leaves and roots (0.5 g FW) were homogenized in 3 mL ice-cold acidic extraction buffer (5% meta-phosphoric acid (containing 1 mM ethylenediaminetetraacetic acid, EDTA) using a mortar and a pestle. Homogenates were centrifuged at 12,000g for 20 min at 4 °C and the supernatant was collected for analysis of glutathione and ascorbate with a spectrophotometer (UV-5200; METASH., Shanghai, China) at 25 °C. Glutathione was estimated following the method reported by Anderson (1985) and Ascorbate content was determined by a previous reported method by Law et al. (1983) with expression as lM per gram FW materials. 2.6. Determination of antioxidant enzymes

2.2. Determination of Cd Plants were thoroughly washed with deionized water, and roots were soaked in 20 mM EDTA-Na2 iced solution for 15 min to remove excess of metal ions from root surfaces. Samples of oilseed rape shoots and roots were dried at 70 °C for 72 h. Using the mixture acid of HNO3 and HClO4 (4:1, v/v), the dried plant sample was digested at the 20:1 ratio of acid volume (mL) to tissue weight (g)

Leaves and root stored at 80 °C (0.3–0.5 g FW) were ground in liquid nitrogen with a chilled mortar and a pestle under ice-cold conditions. They were subsequently homogenized in 50 mM K-phosphate buffer (pH 7.0) containing 0.4 mM EDTA-4H, 5 mM ascorbate, and 2% polyvinyl polypyrrolidone. Homogenates were centrifuged at 12,000g for 20 min at 4 °C, and the supernatant was used for protein and enzyme determination. Protein

528

Z. Wu et al. / Chemosphere 138 (2015) 526–536

concentration in the supernatant was measured according to the method of Wu et al. (2014). All enzymic activities and protein contents were measured spectrophotometrically (UV-5200; METASH, Shanghai, China) at 25 °C. SOD activity was assayed as described by Beauchamp and Fridovich (1971) and one unit of activity is the amount of protein required to inhibit 50% initial reduction of nitroblue tetrazolium under light. CAT activity was determined following the method of Aebi (1984) and one unit was defined as the amount of enzyme to decompose 1 lM min1 of hydrogen peroxide. APX activity was determined as described previously in Nakano and Asada (1987) and one unit was defined as the amount of enzyme to decompose 1 lM min1 of hydrogen peroxide. GR activity was calculated by the procedure of Halliwell and Foyer (1978) and one unit was defined as the amount of enzyme to decompose 1 lM min1 of oxidized glutathione. DHAR activity was measured as described by Foyer et al. (1989) and one unit was defined as the amount of enzyme to decompose 1 lM min1 of dehydroascorbate. All the activities of enzymes were expressed as unit per milligram protein.

compared to the respective controls of 0 mg L1 Cd (P < 0.05). While for L351, only high level of 1 mg L1 Cd significantly decreased the dry weights in shoots and roots being of 13% and 19% higher compared to their respective controls (P < 0.05). Shoot Cd concentrations for L351 cultivar were 93%, 97% and 109% higher than that in L338 under the 0.03, 0.3 and 1 mg L1 Cd treatments respectively (P < 0.01). In contrast root Cd concentrations for L338 were 86%, 49% and 23% higher than that in L351 for the three Cd treatments respectively (P < 0.01). Shoot Cd accumulations for L351 were 99%, 121% and 178% higher than that in L338 under the 0.03, 0.3 and 1 mg L1 Cd treatments respectively (P < 0.01). Root Cd accumulations for L338 were 62% (P < 0.01) and 22% (P < 0.05) higher than that in L351 under the 0.03 and 0.3 mg L1 Cd treatments respectively, while for the 1 mg L1 Cd treatment root Cd accumulation in L351 was 20% (P < 0.05) higher than that in L338. Total Cd accumulation for L351 displayed an increasing tendency compared to L338 being of 5%, 31% and 83% higher under the Cd treatments of 0.03, 0.3 and 1 mg L1 Cd respectively. These results show that the L351 cultivar is more tolerant and a better Cd accumulator compared to the L338 cultivar.

2.7. Total RNA extraction and quantitative RT-PCR 3.2. Analysis of plant samples under transmission electron microscopy One-week-old seedlings exposed to three Cd levels (0, 0.06 and 0.6 mg L1) for three weeks were used for gene expression analysis. Nutrient solution was aerated continuously and renewed every 5 d. Each treatment was replicated four times. Shoots and roots were separated, washed cleanly with deionized water, and stored at 80 °C. The methods of total RNA extraction and quantitative RT-PCR were as described by Wu et al. (2015). Primers designed for the genes and reference genes are detailed in Table 1. The relative quantities of the transcripts were calculated according to Pfaffl (2001).

As shown in Fig. 1, TEM micrographs of the control leaf mesophyll cells of L351 and L338 cultivars show well-developed chloroplasts having closely-arranged and well-aligned granum thylakoids. Under 1 mg L1 Cd exposure, in L351 the chloroplasts look the same as in control plants and in L338 they are much more oval than elongated. Cd application induced the number of vacuoles in root tip cells of both cultivars, especially in L351. These results suggest that with Cd exposure more pronounced damage to subcellular structure occurred with the L338 compared to the L351 cultivar.

2.8. Statistical analysis of data All data were statistically analyzed using SPSS 20.0. Analysis of variance (ANOVA followed by LSD multiple comparison) was performed on data sets, with the mean and SE of each treatment calculated. 3. Results 3.1. Plant mass and Cd accumulation As shown in Table 2, the treatments of Cd (=0.3 mg L1) significantly decreased the dry weights in shoots and roots of L338 with the values of 14% and 36% in shoots, and 22% and 44% in roots as

3.3. Analysis of hydrogen peroxide (H2O2) and malondialdehyde (MDA) contents Hydrogen peroxide (H2O2) and malondialdehyde (MDA) contents in roots and shoots are considered as important indices of evaluating the degree of antioxidant damage to Cd stress. As shown in Fig. 2, the treatments of Cd (=0.3 mg L1) significantly increased the H2O2 contents in shoots and roots of L338 with the values of 42% and 76% higher in shoots, and 82% and 112% higher in roots as compared to the respective controls (Fig. 2A and B, P < 0.05). While for L351, only high level of 1 mg L1 Cd significantly increased the H2O2 contents in shoots and roots being of 23% and 31% higher compared to their respective controls

Table 1 Sequences of primers used for RT-PCR. Target

Primer sequences (50 –30 )

Annealing temperature (°C)

Amplification efficiency (%)

Genebank accession no.

BnActin2.1

F CTCTTTCACACGCCATCCTCC R GATTCCAGCAGCTTCCATTCC F CAGGACTATTGATAACTTCT R GTCATCCGAGTAGTAGAT F TTGTGGTATTATTGGTCTT R TATGTGTTCTTTCGTCTTA F ATTACAACAATGCTCTCG R ACTCATCTTCTTCACCAA F GAGTAATCAGCAGAGAAG R AAGCATCAAGAGGATAAG F AAGATGACGAAGAACTAC R AACAACCTAAGAGCAATG F GAAGTTTGATGAGAAATGG R TGAGATAATCGTTGAATGT F GGTGAAGGAAGAATAGTT R TTCGTCAGATGTAATAGC

57.5

94

FJ529167.1

51

89

JN163870.1

51

91

AY970822.1

51

92

EU487185.1

60

94

EF634058.1

57.5

92

Y11461.1

63

95

AB125638.1

63

100

AF008441.2

BnCAT BnCu/Zn-SOD BnMn-SOD BnFe-SOD BnAPX BoDHAR BcGR

529

Z. Wu et al. / Chemosphere 138 (2015) 526–536 Table 2 Biomass, Cd concentrations and Cd accumulation in tissues of L338 and L351. Index

Shoot DW (g plant1) Root DW (g plant1) Shoot Cd content (lg g1 DW) Root Cd content (lg g1 DW) Shoot Cd accumulation (lg plant1) Root Cd accumulation (lg plant1) Total Cd accumulation (lg plant1)

Cd 0 mg L1

Cd 0.03 mg L1 L338

Cd 0.3 mg L1

L338

L351

1.42 ± 0.11a 0.41 ± 0.03a ND

1.39 ± 0.09a 0.42 ± 0.03a ND

ND

ND

–

–

6.93 ± 0.52

13.77 ± 1.26⁄⁄

36.80 ± 3.55

81.49 ± 7.15⁄⁄

–

–

14.93 ± 1.35⁄⁄

9.24 ± 0.64

71.08 ± 5.16⁄

59.47 ± 5.34

–

–

21.86 ± 1.60

1.38 ± 0.09a 0.39 ± 0.04a 5.02 ± 0.47 38.27 ± 3.94⁄⁄

L351

L338

Cd 1 mg L1

1.41 ± 0.12a 0.42 ± 0.03a 9.71 ± 1.04⁄⁄ 20.54 ± 1.68

23.01 ± 1.97

1.22 ± 0.11b 0.32 ± 0.04b 30.16 ± 3.14 222.13 ± 18.47⁄⁄

107.80 ± 9.14

L351 1.37 ± 0.11a 0.40 ± 0.04a 59.48 ± 4.69⁄⁄ 148.68 ± 12.06

140.96 ± 12.08⁄⁄

L338 0.91 ± 0.08c 0.23 ± 0.03c 76.64 ± 5.84 465.43 ± 20.34⁄⁄

L351 1.21 ± 0.08b 0.34 ± 0.04b 160.38 ± 11.98⁄⁄ 378.67 ± 35.47

69.74 ± 5.42

194.06 ± 14.13⁄⁄

107.05 ± 8.73

128.75 ± 11.51⁄

176.79 ± 14.32

322.81 ± 25.06⁄⁄

Data are the means of four replicates (±SE). Values followed by the different letters indicate significant differences based on one-way ANOVA followed by LSD test (P < 0.05) for each cultivar at different Cd treatments. ⁄ and ⁄⁄ indicate separation between the two oilseed rape cultivars at the same Cd treatment by ANOVA followed by LSD multiple comparison (⁄: P < 0.05, ⁄⁄: P < 0.01 respectively). ‘ND’ indicates ‘not detected’.

Fig. 1. Electron micrographs of leaf mesophyll and root tip cells of L338 and L351 under 0 and 1 mg L1 Cd exposure. A and B – leaf mesophyll cells of L351 and L338 controls respectively. C and D – leaf mesophyll cells of 351 and L338 at 1 mg L1 Cd respectively. E and F – root tip cells of L351 and L338 controls respectively. G and H – root tip cells of L351 and L338 at 1 mg L1 Cd respectively. S-starch grains, Chl-chloroplast, Thy-thylakoids, CM-cell membrane, V-vacuole, M-mitochondria, NM-nuclear membrane, Nnucleus, Nue-nucleoli.

(Fig. 2A and B, P < 0.05). Additionally, the H2O2 contents in L338 were significantly high than that in L351 being of 43% and 35% for shoots, and 59% and 45% for roots at the same treatments of

Cd (=0.3 mg L1) respectively (Fig. 2A and B, P < 0.01). Similar tendencies were also found in the MDA contents. For L338, the treatments of Cd (=0.3 mg L1) significantly increased the MDA

530

Z. Wu et al. / Chemosphere 138 (2015) 526–536

Fig. 2. Hydrogen peroxide (H2O2) and malondialdehyde (MDA) contents in leaves and roots of L338 and L351. Data are the means of four replicates (±SE). Values followed by the different letters indicate significant differences based on one-way ANOVA followed by LSD test (P < 0.05) for each cultivar at different Cd treatments. ⁄ and ⁄⁄ indicate separation between the two oilseed rape cultivars at the same Cd treatment by ANOVA followed by LSD multiple comparison (⁄: P < 0.05, ⁄⁄: P < 0.01 respectively).

contents in shoots and roots being of 40% and 108% higher in shoots, and 45% and 86% higher in roots as compared to their respective controls (Fig. 2C and D, P < 0.05). While for L351, only the treatment of 1 mg L1 Cd significantly increased the MDA contents in shoots and roots being of 45% and 31% higher compared to their respective controls (Fig. 2C and D, P < 0.05). Additionally, the MDA contents in L338 were significantly high than that in L351 being of 17% and 43% for shoots, and 33% and 50% for roots at the same treatments of Cd (=0.3 mg L1) respectively (Fig. 2A and B, P < 0.05). Based on the results of H2O2 and MDA contents, the L338 cultivar suffers from a greater extent of oxidative damage than the L351 cultivar at high toxic Cd levels.

shoots being of 21% compared to the control (Fig. 3C, P < 0.05), and only the treatment of 1 mg L1 Cd significantly increased the AsA contents in roots being of 24% compared to the control (Fig. 3D, P < 0.05). The AsA contents in shoots of L351 were significantly higher than that in L338 at each Cd level being 23–30% higher as the Cd concentrations increased from 0 to 0.3 mg L1 (Fig. 3C, P < 0.05). While for roots, only at the treatment of 0.03 mg L1 Cd, the AsA content in L351 was significantly 48% higher than that in L338, (Fig. 3D, P < 0.01). These results indicate that the superior GSH and AsA contents in the L351 cultivar, especially for GSH, may account for its greater ability to tolerate Cd stress. 3.5. Analysis of antioxidative enzyme activity

3.4. Analysis of GSH and AsA contents GSH and AsA, as low molecular antioxidants, are two key components in the GSH–AsA cycle to maintain the cellular redox status. As shown in Fig. 3, the treatments of Cd (=0.3 mg L1) significantly increased the GSH contents in shoots and roots of L338 with the values of 27% and 43% higher in shoots, and 52% and 29% higher in roots as compared to the respective controls (Fig. 3A and B, P < 0.05). Similar trends were also found in L351 being of 40% and 93% higher in shoots, and 92% and 83% higher in roots as compared to the respective controls (Fig. 3A and B, P < 0.05). Shoot GSH contents in L351 were significantly higher than that in L338 at each Cd level, being 40–77% higher as the Cd concentrations increased from 0 to 1 mg L1 (Fig. 3A, P < 0.01), and being of 31–80% for root GSH contents at individual Cd exposure, except for the treatment of 0.03 mg L1 Cd (Fig. 3B, P < 0.05). The treatments of Cd (=0.3 mg L1) significantly increased the AsA contents in shoots and roots of L338 with the values of 25% and 28% higher in shoots, and 20% and 44% higher in roots as compared to the respective controls (Fig. 3C and D, P < 0.05). While for L351, only the treatment of 0.3 mg L1 Cd significantly increased the AsA contents in

The key enzymes, namely SOD, CAT, APX, GR and DHAR exhibited differential responses to Cd treatments in shoots and roots of the L351 and L338 cultivars. SOD is a key enzyme that converts superoxide radicals into less toxic agents, producing H2O2. As shown in Fig. 4A and B, significant increase in SOD activities of shoots and roots were observed in both cultivars with the treatments of Cd (=0.3 mg L1) as compared to their respective controls (except for root SOD in L338 at 0.3 mg L1 Cd). However, no significant differences were observed in SOD activities between the two cultivars under the same Cd treatments, either in shoots or roots, suggesting that SOD was not the key factor contributing the differences of Cd accumulation in L351 and L338. CAT and APX are two important enzymes that scavenge excess of H2O2 by catalyzing it into water and divalent oxygen. As shown in Fig. 4C-F, shoot CAT activity in the L338 cultivar showed a sharp decrease with the treatments of Cd (=0.3 mg L1) (Fig. 4C, P < 0.05), while CAT activity in the L351 cultivar remained constant across Cd treatments as compared to their respective controls (Fig. 4C). For roots, the treatments of Cd (=0.3 mg L1) significantly

Z. Wu et al. / Chemosphere 138 (2015) 526–536

531

Fig. 3. GSH and AsA contents in leaves and roots of L338 and L351. Data are the means of four replicates (±SE). Values followed by the different letters indicate significant differences based on one-way ANOVA followed by LSD test (P < 0.05) for each cultivar at different Cd treatments. ⁄ and ⁄⁄ indicate separation between the two oilseed rape cultivars at the same Cd treatment by ANOVA followed by LSD multiple comparison (⁄: P < 0.05, ⁄⁄: P < 0.01 respectively).

increased CAT activities in both cultivars compared to their respective controls (Fig. 4D, P < 0.05). Shoot CAT activity was significantly higher in L351 than that in L338 at each Cd level being 22–104% higher as the Cd concentrations increased from 0 to 1 mg L1 (Fig. 4C, P < 0.05). However, no significant differences were observed in root CAT activities between the two cultivars under the same Cd treatments (Fig. 4D). With APX, the treatment of 0.3 mg L1 Cd significantly increased shoot APX activity in L338, while 1 mg L1 Cd significantly decreased shoot APX activity compared to its control (Fig. 4E, P < 0.05). In L351, the treatments of Cd (=0.3 mg L1) significantly increased shoot APX activity compared to its control (Fig. 4E, P < 0.01), and APX activities were markedly higher in the L351 than that in L338 cultivar with the levels ranging from 25% to 98% higher as the Cd concentrations increased from 0 to 1 mg L1 (Fig. 4E, P < 0.01). For roots, the treatments of Cd (=0.3 mg L1) significantly increased the root APX activity in both two cultivar as compared to their respective controls (Fig. 4F, P < 0.05), and were significantly higher in L351 than that in L338 being of 33% and 65% higher respectively (Fig. 4F, P < 0.01). GR and DHAR are the two key enzymes that scavenge ROS through maintaining a high reduced contents of AsA and GSH. The treatments of Cd (=0.3 mg L1) greatly decreased the shoot GR activity in L338 (P < 0.05), while no changes were found in shoot GR activity in L351 as compared to their respective controls (Fig. 4G), and GR activity was significantly higher in L351 than in L338 being of 35% and 130% higher under the same Cd exposure (=0.3 mg L1) respectively (Fig. 4G, P < 0.01). For roots, the treatments of Cd (=0.3 mg L1) markedly increased GR activities in both cultivars compared to their respective controls, and were significantly higher in L351 than in L338 cultivar at each Cd level being 23–62% higher as the Cd concentrations increased from 0 to 1 mg L1 (Fig. 4H, P < 0.05). Additionally, the treatments of Cd (=0.3 mg L1) also markedly increased DHAR activity in shoots and roots of two cultivars as compared to their respective controls (except for L338 shoot at 1 mg L1 Cd), and were significantly

higher in the L351 than in L338 with levels of 24% and 56% higher for shoots, and 20% and 42% for roots under the same Cd exposure respectively (Fig. 4I–J, P < 0.05). These results demonstrate that higher CAT, APX, GR and DHAR activities in shoots and roots of the L351 cultivar may contribute to its higher tolerance to Cd stress compared to the L338 cultivar. 3.6. Analysis of gene expression related to antioxidative enzymes Transcriptional levels of antioxidants enzymes were responded differentially to the external Cd concentrations. As shown in Fig. 5, the expression levels of BnCu/Zu-SOD were significantly induced in leaves of both cultivars at the treatment of 0.06 mg L1 Cd compared to their respective controls (P < 0.05), and were significantly higher in L351 than in L338 being of 28% and 29% higher under the same Cd treatments of 0 and 0.06 mg L1 respectively (Fig. 5A, P < 0.01). However, no significant differences were observed in roots between the two cultivars under Cd treatments (Fig. 5B). The expression levels of BnMn-SOD were significantly induced in L338 at the treatment of 0.06 mg L1 Cd (P < 0.05), while no changes were found in L351 as compared to their respective controls, and were 21% higher in L338 than in L351 (Fig. 5C, P < 0.01). For root, the high Cd application of 0.6 mg L1 resulted in significant decreases in the expression levels BnMn-SOD of both cultivars compared to their respective controls (P < 0.05), and were 38%, 68% and 31% higher in L338 than in L351 under the same treatments of Cd exposure respectively (Fig. 5D, P < 0.01). For BnFe-SOD, the treatment of 0.06 mg L1 Cd significantly induces its expression in L351 (P < 0.05), while no differences were found in L338 compared to their respective controls, and was 24% higher in L351 than that in L338 cultivar at the treatment of 0.06 mg L1 Cd (Fig. 5E, P < 0.01). Cd application significantly decreased the expression of root BnFe-SOD in L338 (P < 0.05), while significantly induced its expression in L351 at the treatment of 0.06 mg L1 Cd as compared to its control, and were 437% and 176% higher in

532

Z. Wu et al. / Chemosphere 138 (2015) 526–536

Fig. 4. Antioxidative enzyme activities in leaves and roots of L338 and L351. Data are the means of four replicates (±SE). Values followed by the different letters indicate significant differences based on one-way ANOVA followed by LSD test (P < 0.05) for each cultivar at different Cd treatments. ⁄ and ⁄⁄ indicate separation between the two oilseed rape cultivars at the same Cd treatment by ANOVA followed by LSD multiple comparison (⁄: P < 0.05, ⁄⁄: P < 0.01 respectively).

Z. Wu et al. / Chemosphere 138 (2015) 526–536

533

Fig. 5. Expression levels of antioxidative enzyme genes in leaves and roots of L338 and L351. Data are the means of four replicates (±SE). Values followed by the different letters indicate significant differences based on one-way ANOVA followed by LSD test (P < 0.05) for each cultivar at different Cd treatments. ⁄ and ⁄⁄ indicate separation between the two oilseed rape cultivars at the same Cd treatment by ANOVA followed by LSD multiple comparison (⁄: P < 0.05, ⁄⁄: P < 0.01 respectively).

534

Z. Wu et al. / Chemosphere 138 (2015) 526–536

L351 than in L338 under the same treatments of 0.06 and 0.6 mg L1 Cd respectively (Fig. 5F, P < 0.01). Transcript levels of BnCAT in leaves in the L338 cultivar appeared to be significantly decreased by exposure to 0.06 mg L1 Cd (P < 0.05), while were greatly induced in the L351 cultivar at the level of 0.6 mg L1 Cd compared to their respective controls (Fig. 5G, P < 0.01), and were significantly higher in L351 than that in L338 being of 29% and 58% under the same treatments of 0.06 and 0.6 mg L1 Cd respectively (Fig. 5G, P < 0.05). While for roots, the treatment of 0.06 mg L1 Cd significantly induced BnCAT expression in L338, while 0.6 mg L1 Cd significantly induced BnCAT expression in L351 compared to their respective controls (P < 0.05), and were 58%, 35% and 87% higher in L351 than that in L338 under the same treatments of 0, 0.06 and 0.6 mg L1 Cd respectively (Fig. 5H, P < 0.01). With BnAPX expression, Cd application resulted in significant decreases in leaves and roots of L338, whereas this trend was noticed only in leaves of L351 compared to their respective controls (Figs. 5I–J, P < 0.05). For roots, the expression levels of BnAPX in L351 were 63% and 167% higher than in L338 under the same treatments of 0.06 and 0.6 mg L1 Cd respectively (Fig. 5I–J, P < 0.01). Furthermore, transcript levels of some vital genes involved in the GSH–AsA cycle were investigated. The high Cd treatment of 0.6 mg L1 Cd resulted in a significant decrease in the expression level of leaf BcGR in L338, and a great increase in L351 compared to their respective controls (Fig. 5K, P < 0.05). Similar expression patterns also were observed in roots. The expression levels of shoot BcGR in L338 was significant higher than in L351(22% higher) at the treatment of 0 mg L1 Cd (P < 0.05), while in L351 was significant higher than in L338 (59 higher) at the treatment of 0.6 mg L1 Cd (Fig. 5K, P < 0.01). For roots, the expression levels of BcGR in L351 were significantly higher than that in L338 being of 253% and 403% under the same treatments of 0.06 and 0.6 mg L1 Cd respectively (Fig. 5L, P < 0.05). With BoDHAR, only the treatment of 0.06 mg L1 Cd significantly induced its expression in shoots of L351 (P < 0.05), while no differences were found in shoots of L338 as compared to their respective controls (Fig. 5M). For roots, Cd application significantly decreased its expression levels in roots of the L338 cultivar, while significantly induced at 0.6 and 0.6 mg L1 Cd compared to their respective controls, and was 226% and 76% higher in L351 than in L338 under the same treatments of 0.06 and 0.6 mg L1 Cd respectively (Fig. 5M–N, P < 0.01). These results suggest that higher transcriptional levels of several important genes involved in BnCAT, BnAPX, BcGR, BoDHAR in the L351 cultivar compared to the L338 cultivar, especially in roots, may contribute to its higher tolerance to Cd stress compared to the L338 cultivar.

4. Discussion Generally, plants can be classified into four groups: metal-sensitive species, metal-resistant excluder species, metaltolerant non-hyperaccumulator species, and metal-hypertolerant hyper-accumulator species, each having different molecular mechanisms to accomplish their resistance/tolerance to metal stress or decrease the negative consequences caused by metal toxicity (Lin and Aarts, 2012). Brassica species are well known as metal accumulators and have been investigated for many years for the discrepant accumulation ranges of heavy metals (Wu et al., 2015). In our study, a visual symptom was observed that Cd caused a more significant reduction in the growth of the L338 cultivar expressed as dry biomass in shoots and roots than for the L351 cultivar, especially at high doses (Table 2). The growth inhibition induced by Cd in the L338 cultivar could be mainly due to the increased H2O2 and MDA contents in shoots and roots as well as the

ultrastructural changes in chloroplasts and vacuoles numbers (Figs. 1 and 2). The L351 cultivar tended to accumulate more Cd in shoots rather than in roots compared with the L338 cultivar, which partly shows its capability to avoid or mitigate Cd-induced stress (Najeeb et al., 2011). The total Cd accumulation in the L351 was higher than in the L338 cultivar, and this trend became more accentuated with the increasing concentration of Cd exposure (Table 2). These findings suggested that in B. napus, the L351 is a more Cd-tolerant and Cd-accumulating cultivar compared to L338. As reported, Cd load in plant organs can impair important physiological/biochemical processes by inducing generation of ROS, and disturbing the antioxidative systems and electron transport chains (Anjum et al., 2013). Plants have developed various defense systems that act as important tolerance mechanisms against Cd induced oxidative stress (Mishra et al., 2006). One of these mechanisms is the employment of an enzymatic antioxidant system such as SOD, CAT, and APX. SOD enzyme is an essential component as it catalyzes the dismutation of O 2 to H2O2 with markedly high reaction rates. In our study, Cd application induced a significant increase in SOD activities in shoots and roots of both cultivars, while no great differences were found between them at the same Cd treatment (Fig. 4A and B), this may be explained, at least in part, by the fact that the transcriptional responses of SOD isozyme genes show different trends in shoots and roots of the two cultivars under Cd treatments (Fig. 5A–F). Similar tendency have also been found in other Cd-accumulator plants (Boominathan and Doran, 2003; Sun et al., 2007), while contrasting results have been reported in non-accumulator plants (Gallego et al., 1996; Sandalio et al., 2001). Overexpression of SOD isozymes in transgenic plants enhanced their tolerance to oxidative stress caused by heavy metals (Basu et al., 2001; Lee et al., 2007). These results suggested that increasing SOD activities by Cd application may be propitious to improve Cd tolerance, but SOD was not the key enzyme responsible for Cd-tolerance of these two cultivars under Cd stress. CAT and APX are the two key enzymes in scavenging H2O2, and converting it to water and molecular oxygen. In our study, high levels of CAT and APX activities and large increase in the L351 cultivar with increasing Cd concentrations were observed, while their activities were either significantly inhibited or maintained unchanged in the L338 cultivar (Fig. 4C–F). Additionally, the transcriptional levels of CAT and APX enzymes were generally higher in the L351 than in the L338 cultivar, especially in roots at high doses of Cd treatment (Fig. 5G–J). Reports have also shown increases in CAT and APX activities in metal-accumulators, such as Sedum Alfredii (Jin et al., 2008), Brassica juncea (Mobin and Khan, 2007) and Triticum aestivum (Khan et al., 2007), while the opposite results were also observed in B. napus (Meng et al., 2009), B. juncea (Ahmad et al., 2011) and Arabidopsis thaliana (Cuypers et al., 2011). Up-regulation of APX can increase the ability to overcome Cd stress in A. thaliana (Chiang et al., 2006). Due to the lower CAT and APX activities, the L338 cultivar might not be entirely able to remove H2O2, in turn H2O2 accumulation leading to an oxidative burst (Mohamed et al., 2012). These results imply that the L351 cultivar possesses an effective scavenging mechanism to remove H2O2 resulting from Cd stress, as evidenced by the lower H2O2 contents compared to the L338 cultivar, and may contribute to defend against Cd stress. Another antioxidant system involved in Cd detoxification is the GSH–AsA cycle composing of several antioxidants such as GSH, AsA, and the key antioxidant enzymes of GR and DHAR. Enhanced activities of the GSH–AsA cycle observed under Cd stress appear to be due to the need to maintain a favorable redox status, by maintaining sufficient levels of GSH and reduced AsA to overcome the possible problems of oxidation (Ranieri et al., 1996). In

Z. Wu et al. / Chemosphere 138 (2015) 526–536

our study, the GSH and AsA contents in shoots and roots of the L351 cultivar are significantly generally higher than in the L338 cultivar (Fig. 3A–D) as well as the activities (Fig. 4G–J) and the transcriptional levels of GR and DHAR enzymes (Fig. 5K–N). In A. thaliana, the expression of the GSH gene is induced by Cd treatments contributing to Cd tolerance, while a decrease in GSH levels reduces Cd tolerance (Semane et al., 2007; Wójcik and Tukiendorf, 2011). Also, in other plant, Cd-tolerant plants have higher levels of GSH than Cd-sensitive plants (Cai et al., 2011). These results suggested that the higher efficiency of the GSH–AsA cycle also accounted for the higher tolerance of the Cd-accumulator L351 cultivar compared to the non-Cd-accumulator L338 under Cd exposure. 5. Conclusions In conclusion, the higher tolerance of the Cd-accumulator cultivar L351 to Cd stress is due to the enhancement of the antioxidant defense related to the antioxidant enzymes as well as the GSH–AsA cycle. This suggests that the outcome of the physiological/molecular characterization of the B. napus species in response to Cd stress can reveal the adaptive mechanisms of these plants to Cd stress, which in turn can be used to the development of new strategies to create metal-tolerant, and biofortified plants suitable for the phytoremediation of contaminated sites. Acknowledgements This research was supported by National Key Project of Science and Technology (2008BADA7B03) and National Natural Science Foundation of China (41271275). We are grateful to Dr. Ron Mclaren (Emeritus Professor of Environment Soil Science, Lincoln University) for editing of this manuscript. References Aebi, H., 1984. Catalase in vitro. Method. Enzymol. 105, 121–126. Ahmad, P., Nabi, G., Ashraf, M., 2011. Cadmium-induced oxidative damage in mustard (Brassica juncea L.) plants can be alleviated by salicylic acid. S. Afr. J. Bot. 77, 36–44. Alexieva, V., Sergiev, I., Mapelli, S., Karanov, E., 2001. The effect of drought and ultraviolet radiation on growth and stress markers in pea and wheat. Plant Cell Environ. 24, 1337–1344. Anderson, M.E., 1985. Determination of glutathione and glutathione disulfide in biological samples. Method. Enzymol. 113, 548–555. Anjum, N.A., Ahmad, I., Rodrigues, S.M., Henriques, B., Cruz, N., Coelho, C., Pacheco, M., Duarte, A.C., Pereira, E., 2013. Eriophorum angustifolium and Lolium perenne metabolic adaptations to metals-and metalloids-induced anomalies in the vicinity of a chemical industrial complex. Environ. Sci. Pollut. R 20, 568– 581. Basu, U., Good, A., Taylor, G., 2001. Transgenic Brassica napus plants overexpressing aluminium-induced mitochondrial manganese superoxide dismutase cDNA are resistant to aluminium. Plant Cell Environ. 24. 1278-1269. Beauchamp, C., Fridovich, I., 1971. Superoxide dismutase: improved assays and an assay applicable to acrylamide gels. Anal. Bioch. 44, 276–287. Ben Amor, N., Ben Hamed, K., Debez, A., Grignon, C., Abdelly, C., 2005. Physiological and antioxidant responses of the perennial halophyte (Crithmum maritimum) to salinity. Plant Sci. 168, 889–899. Boominathan, R., Doran, P.M., 2003. Cadmium tolerance and antioxidative defenses in hairy roots of the cadmium hyperaccumulator, Thlaspi caerulescens. Biotechnol. Bioeng. 83, 158–167. Cai, Y., Cao, F., Cheng, W., Zhang, G., Wu, F., 2011. Modulation of exogenous glutathione in phytochelatins and photosynthetic performance against Cd stress in the two rice genotypes differing in Cd tolerance. Biol. Trace Elem. Res. 143, 1159–1173. Chiang, H.-C., Lo, J.-C., Yeh, K.-C., 2006. Genes associated with heavy metal tolerance and accumulation in Zn/Cd hyperaccumulator Arabidopsis halleri: a genomic survey with cDNA microarray. Environ. Sci. Technol. 40, 6792–6798. Cuypers, A., Karen, S., Jos, R., Kelly, O., Els, K., Tony, R., Nele, H., Nathalie, V., Suzy, V.S., Frank, V.B., 2011. The cellular redox state as a modulator in cadmium and copper responses in Arabidopsis thaliana seedlings. J. Plant Physiol. 168, 309– 316. Foyer, C., Dujardyn, M., Lemoine, Y., 1989. Responses of photosynthesis and the xanthophyll and ascorbate–glutathione cycles to changes in irradiance, photoinhibition and recovery. Plant Physiol. Bioch. 27, 751–760.

535

Gallego, S.M., Benavídes, M.P., Tomaro, M.L., 1996. Effect of heavy metal ion excess on sunflower leaves: evidence for involvement of oxidative stress. Plant Sci. 121, 151–159. Halliwell, B., Foyer, C., 1978. Properties and physiological function of a glutathione reductase purified from spinach leaves by affinity chromatography. Planta 139, 9–17. Hasan, S.A., Fariduddin, Q., Ali, B., Hayat, S., Ahmad, A., 2009. Cadmium: toxicity and tolerance in plants. Jin, X., Yang, X., Mahmood, Q., Islam, E., Liu, D., Li, H., 2008. Response of antioxidant enzymes, ascorbate and glutathione metabolism towards cadmium in hyperaccumulator and nonhyperaccumulator ecotypes of Sedum alfredii H. Environ. Toxicol. 23, 517–529. Khan, N., Singh, S., Nazar, R., 2007. Activities of antioxidative enzymes, sulphur assimilation, photosynthetic activity and growth of wheat (Triticum aestivum) cultivars differing in yield potential under cadmium stress. J. Agron. Crop Sci. 193, 435–444. Law, M., Charles, S.A., Halliwell, B., 1983. Glutathione and ascorbic acid in spinach (Spinacia oleracea) chloroplasts. The effect of hydrogen peroxide and of Paraquat. Bioch. J. 210, 899–903. Lee, S.-H., Ahsan, N., Lee, K.-W., Kim, D.-H., Lee, D.-G., Kwak, S.-S., Kwon, S.-Y., Kim, T.-H., Lee, B.-H., 2007. Simultaneous overexpression of both Cu/Zn superoxide dismutase and ascorbate peroxidase in transgenic tall fescue plants confers increased tolerance to a wide range of abiotic stresses. J. Plant Physiol. 164, 1626–1638. Lin, Y.-F., Aarts, M.G., 2012. The molecular mechanism of zinc and cadmium stress response in plants. Cell. Mol. Life Sci. 69, 3187–3206. Meng, H., Hua, S., Shamsi, I.H., Jilani, G., Li, Y., Jiang, L., 2009. Cadmium-induced stress on the seed germination and seedling growth of Brassica napus L., and its alleviation through exogenous plant growth regulators. Plant Growth Regul. 58, 47–59. Mishra, S., Srivastava, S., Tripathi, R., Kumar, R., Seth, C., Gupta, D., 2006. Lead detoxification by coontail (Ceratophyllum demersum L.) involves induction of phytochelatins and antioxidant system in response to its accumulation. Chemosphere 65, 1027–1039. Mittler, R., 2002. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 7, 405–410. Mobin, M., Khan, N.A., 2007. Photosynthetic activity, pigment composition and antioxidative response of two mustard (Brassica juncea) cultivars differing in photosynthetic capacity subjected to cadmium stress. J. Plant Physiol. 164, 601– 610. Mohamed, A.A., Castagna, A., Ranieri, A., Sanità di Toppi, L., 2012. Cadmium tolerance in Brassica juncea roots and shoots is affected by antioxidant status and phytochelatin biosynthesis. Plant Physiol. Bioch. 57, 15–22. Nahakpam, S., Shah, K., 2011. Expression of key antioxidant enzymes under combined effect of heat and cadmium toxicity in growing rice seedlings. Plant Growth Regul. 63, 23–35. Najeeb, U., Jilani, G., Ali, S., Sarwar, M., Xu, L., Zhou, W., 2011. Insights into cadmium induced physiological and ultra-structural disorders in Juncus effusus L. and its remediation through exogenous citric acid. J. Hazard. Mater. 186, 565–574. Nakamura, S.-I., Akiyama, C., Sasaki, T., Hattori, H., Chino, M., 2008. Effect of cadmium on the chemical composition of xylem exudate from oilseed rape plants (Brassica napus L.). Soil Sci. Plant Nutr. 54, 118–127. Nakano, Y., Asada, K., 1987. Purification of ascorbate peroxidase in spinach chloroplasts; its inactivation in ascorbate-depleted medium and reactivation by monodehydroascorbate radical. Plant Cell Physiol. 28, 131–140. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in realtime PCR. Nucleic Acids Res. 29, 45. Ranieri, A., D’urso, G., Nali, C., Lorenzini, G., Soldatini, G., 1996. Ozone stimulates apoplastic antioxidant systems in pumpkin leaves. Physiol. Plantarum 97, 381– 387. Sandalio, L., Dalurzo, H., Gomez, M., Romero-Puertas, M., Del Rio, L., 2001. Cadmium-induced changes in the growth and oxidative metabolism of pea plants. J. Exp. Bot. 52, 2115–2126. Schützendübel, A., Polle, A., 2002. Plant responses to abiotic stresses: heavy metalinduced oxidative stress and protection by mycorrhization. J. Exp. Bot. 53, 1351–1365. Semane, B., Cuypers, A., Smeets, K., Van Belleghem, F., Horemans, N., Schat, H., Vangronsveld, J., 2007. Cadmium responses in Arabidopsis thaliana: glutathione metabolism and antioxidative defence system. Physiol. Plantarum 129, 519– 528. Seth, C.S., 2012. A review on mechanisms of plant tolerance and role of transgenic plants in environmental clean-up. Bot. Rev. 78, 32–62. Shah, K., Kumar, R.G., Verma, S., Dubey, R., 2001. Effect of cadmium on lipid peroxidation, superoxide anion generation and activities of antioxidant enzymes in growing rice seedlings. Plant Sci. 161, 1135–1144. Sharma, S.S., Dietz, K.-J., 2009. The relationship between metal toxicity and cellular redox imbalance. Trends Plant Sci. 14, 43–50. Smeets, K., Ruytinx, J., Semane, B., Van Belleghem, F., Remans, T., Van Sanden, S., Vangronsveld, J., Cuypers, A., 2008. Cadmium-induced transcriptional and enzymatic alterations related to oxidative stress. Environ. Exp. Bot. 63, 1–8. Sun, R.-L., Zhou, Q.-X., Sun, F.-H., Jin, C.-X., 2007. Antioxidative defense and proline/phytochelatin accumulation in a newly discovered Cdhyperaccumulator, Solanum nigrum L. Environ. Exp. Bot. 60, 468–476. Wang, M., Zou, J., Duan, X., Jiang, W., Liu, D., 2007. Cadmium accumulation and its effects on metal uptake in maize (Zea mays L.). Bioresource Technol. 98, 82– 88.

536

Z. Wu et al. / Chemosphere 138 (2015) 526–536

Wang, B., Liu, L., Gao, Y., Chen, J., 2009. Improved phytoremediation of oilseed rape (Brassica napus) by Trichoderma mutant constructed by restriction enzymemediated integration (REMI) in cadmium polluted soil. Chemosphere 74, 1400– 1403. Wójcik, M., Tukiendorf, A., 2011. Glutathione in adaptation of Arabidopsis thaliana to cadmium stress. Biol. Plantarum 55, 125–132.

Wu, S., Hu, C., Tan, Q., Nie, Z., Sun, X., 2014. Effects of molybdenum on water utilization, antioxidative defense system and osmotic-adjustment ability in winter wheat (Triticum aestivum) under drought stress. Plant Physiol. Bioch. 83, 365–374. Wu, Z., Zhao, X., Sun, X., Tan, Q., Tang, Y., Nie, Z., Hu, C., 2015. Xylem transport and gene expression play decisive roles in cadmium accumulation in shoots of two oilseed rape cultivars (Brassica napus). Chemosphere 119, 1217–1223.