Antisense oligodeoxynucleotides to c-jun inhibits proliferation of transformed NIH 3T3 cells induced by E5a of HPV-11

CANCER LETTERS Cancer

Letters

85 (1994) 119-123

Antisense oligodeoxynucleotides to c-jun inhibits proliferation of transformed NIH 3T3 cells induced by E5a of HPV-11 Show-Li Chen, Lo-Ti Tsao, Yeou-Ping Tsao* Department of Microbiology and Immunology National Defense Medical Center, Taipei, Taiwan, ROC Received

1 I July 1994; accepted

21 July 1994

Abstract

ESa of HPV-11 is a transforming oncogene. Previously, we had shown that the ESa gene is required only for the c-jun might be involved in the maintenance of transformation. In this study, we exposed E5a transformed NIH 3T3 cells to antisense oligodeoxynucleotides complementary to the 24 nucleotides corresponding to the translation initiation site of the c-jun gene, and examined the effects of this treatment on cell proliferation. Results show that antisense c-jun oligodeoxynucleotides could repress c-jun production and inhibit cell proliferation in E5a transformed cells.

initiation of transformation;

Keywords:

HPV-11; ESa oncoprotein;

c-jun;

Antisense oligonucleotides

1. Introduction

HPV- 11 is generally associated with benign proliferative lesions that infrequently lead to cancer [7]. The predominant viral transcript of HPV-11 in genital condyloma and respiratory papillomata potentially encodes ElE4, E5a and E5b proteins [5,10]. ESa of HPV-11 can induce foci formation, anchorage independent growth and tumorigenesis in nude mice in NIH 3T3 cells [6,19]. It has anchorage independent growth in C 127 cells [6] and in immortalized human epidermal keratinocytes * Corresponding

author.

0304-3835/94/$07.00 0 1994 Elsevier Science Ireland SSDI 0304-3835(94)03507-F

[19]. Previously, we showed that the E5a gene of HPV-11 is required only for initiation of transformation, c-&n might play a role for the maintenance of transformation [S]. In addition, we also showed that E5a constitutively activates the expression of protooncogene c-jun by transcriptional regulation through the AP-1 binding site in the cjun promoter [9]. Therefore, we propose that the constitutive activation of c-jun in E5a transformed cells may play an important role in the maintenance of transformation. c-&n is a nuclear oncogene and belongs to the immediate early genes in signal transduction that are involved in regulation of cell growth [ 171. The

Ltd. All rights reserved

120

S.-L. Chen et ul. / Cuncrr Lrtt. 85 (1994) 119-123

@n gene can be induced by external growth stimuli such as EGF and PDGF, and by tumor promoter TPA [16]. The c-jun protein is a major component of the transcription factor AP- 1. AP- 1 is believed to regulate the transcription of a set of genes important for cell growth and differentiation. c-jun proteins can form homodimers or heterodimers with proteins of the fos family (c-fos, fosB, fra-I and fra-2) [ 121. These dimers bind to the TPA responsive element (TRE) present in the promoters of various genes, thereby regulating their expression. TRE has been found in the c-&z gene promoter itself, and it is thought that c-&n positively regulates its own expression via this TRE [l]. Antisense oligodeoxynucleotides and oligonucleotide analogs have been successfully used as modulators of gene expression and are considered to be powerful tools for biomedical research as well as potential chemotherapeutic agents [ 15,181. The antisense oligomers are usually designed to interfere with translation or splicing of mRNA, and thus inhibit protein synthesis from the RNA. Using this strategy, the biological function of specific protein, for example: G protein, calmodulin, c-myc and c-myb were studied [ 11,13,20]. We hypothesized that the c-jun gene may play an important role in the maintenance of transformation induced by E5a. To directly determine the role of c-jun in the maintenance of E5a transformed cells, we exposed E5a transformed NIH 3T3 cells to antisense oligodeoxynucleotides complementary to the 24 nucleotides corresponding to the translation initiation site of the c-jun gene, and examined the effects of this treatment on cell proliferation. The results show that antisense c-&n oligonucleotides could inhibit cell proliferation in the E5a transformed cells. 2. Materials and methods 2.1. Oligodeoxyttucleo tides design The 24-mer oligodeoxynucleotides corresponding to the translation initiation site of the c-jun gene were synthesized, stabilized by addition of thiosulfate groups, purified by high-performance liquid chromatography (Oligos Etc., Wilsonville, OR). The oligonucleotides had the following sequences: c-jun antisense (AS), 5 ‘TCATAGAACGGTCCGTCA-

CTTCAC3 ’ ; c-&n sense (S), 5 ‘GTGAAGTGACGGACCGTTCTATGA3 ’ . 2.2. Cell culture The transformed NIH 3T3 cells (NESal) by HPV11 E5a [ 191gene were maintained in DMEM containing 10% fetal calf serum. Cells were routinely split 1:6 to grow. 2.3. Proliferation assay The same number of NESal cells were cultured in 96-well plates. At 24 h before confluency, the medium was removed and the sense (S), antisense (AS) c-jun oligodeoxynucleotides added in DMEM to a final appropriate concentration. After incubation at 37°C for 30 min, fetal calf serum was added to 10% and the incubation continued for up to 24 h, with 15 kBq of tritiated thymidine (13H]thymidine; specific activity, 2 kBq/mmole) being present during the last 8 h. After this culture period, cells were harvested, and [3H]thymidine uptake was measured in a liquid scintillation counter. 2.4. Immunoblot Cellular proteins were extracted in sodium dodecyl sulfate-polyacrylamide gel electrophoresis loading buffer. After being boiled for 10 min, about 120 pg each of crude protein lysate was separated by sodium dodecyl-polyacrylamide gel electrophoresis, Western transferred to nitrocellulose, reacted with rabbit polyclonal anti-c-jun serum (Oncogene Science, Uniondale, NY), and visualized by goat anti-rabbit immunoglobulin G and Western BlueTM stabilized for alkaline phosphatase (Promega, Madison, WI). 3. Results and discussion 3. I. Inhibition of transformed cell proliferation Since c-jun gene may play an important role in the maintenance of transformation in E5a transformed cells, it was of interest to see whether inhibition of c_iun expression could reduce the rate of cell proliferation. NESal cells are E5a transformed fibroblasts and have been characterized previously [19]. They were exposed for 24 h to cjun antisense or sense oligodeoxynucleotides at various concentrations. Cell growth rate was com-

S.-L. Chrn ct ul. / Cuncer Let!. X5 (1994)

pared with untreated cells. Fig. 1 is a dose-response histogram showing that 5 PM of antisense and sense oligomers did not lead to significant inhibition of cell growth. The lo-PM or 20-PM antisense oligomer inhibited cell proliferation more significantly than sense oligomer at the corresponding concentration. However, at 40 PM concentration, both exhibited non-specific cytotoxicity. The inhibitory effect of antisense oligonucleotides on the proliferation of E5a transformed cells was also demonstrated with a time course observation. Cells were treated with oligonucleotides at a concentration of 10 FM and cell proliferation inhibition was assayed at 6, 12, 18 and 24 h later. Fig. 2 shows that proliferation began at 6 h, and reached the maximal inhibition at 12 h. In cells exposed to sense oligodeoxynucleotides the labeling index remained constant, at about the same level as cells without oligonucleotides treatment. Similarly, it was reported that the half-lives of a oligodeoxynucleotides in various biological fluids and sera have been shown to be in the range 7-19 h [4]. 3.2. Inhibition of c-jun protein expression We quantitated the production of the c-jun protein in cells treated with 10 PM antisense oligodeoxynucleotides for 24 h. Treating NESal cells with antisense oligodeoxynucleotides to c-jun abolished the steady-state production of c-jun (Fig. 3; compare lane 2 for antisense oligomers with lane 1 for

g

1001

E

40 -

2

20 -

z

oP

0 AS q S

I,

5

-

10 Oligomers

20

40

(p MI

Fig. 1. Concentration dependency of c-jun antisense and sense oligodeoxynucleotides on the growth inhibition of NESal cells. Cells were exposed for I day with c-jun antisense or sense oligomers at various concentrations. The percentage of growth inhibition was obtained by comparing the growth ofcells treated with antisense or sense oligomers with that untreated cells. Data represent the average value * SD. from three separate experiments

119-123

12 AS

0 c

100

.s 2

80

‘Z .e

HS

60

$ P h E

20 40 ]A_ ’

n 6

-

[T 12

18

24

Hour of treatment Fig. 2. Time dependency of c-jun antisense and sense oligodeoxynucletides on the growth inhibition of NESal cells.

control). Oligodeoxynucleotides sense to c-jun, in contrast, failed to alter the steady-state production of the c-jun protein (Fig. 3; compare lane 3 for sense oligomers with lane 1 for control). The results of the present investigation, employing antisense c-jun to identify the role of c_iun in the maintenance of E5a transformed cells, demonstrate that inhibiting the expression of c-jun protein can inhibit cell proliferation in E5a transformed cells. Although there are several potential mechanisms that could account for these effects, the most likely one is that antisense c-jun specifically binds to the targeted complementary sequences of c-jun message and that the resulting duplex formation leads to a specific decrease of c-jun mRNA translation [2]. This conclusion is based on the fact that sense oligomer had no inhibitory effects on proliferation, and expression of c-jun protein was completely reduced by antisense oligomer, but not by sense oligomers. Using antisense oligomer strategy, the biological function of several protooncogene products related to cell growth regulation have been demonstrated. For example, exposure of cells to antisense RNA to c-fos inhibits cell proliferation [ 141. Heikkila et al. [ 131reported that human lymphocytes exposed to a 15-mer antisense oligodeoxynucleotide to c-myc do not enter the S phase after mitogen stimulation. Similar reports found that an antisense oligodeoxynucleotide to c-myc inhibited cell proliferation in smooth muscle cells [2] and induced differentiation in HL-60 cells [21].

122

S-L.

Ckn

Y 8

Cl ul. / C‘unwr LCll. 8s Il994)

KDa

-

76

-56 I”

J,,‘” I

119-123

in E5a transformed cells [9]. In this study, we move one step further to demonstrate the inhibitory effect of antisense oligonucleotides of c-jun on the proliferation of NESal cells. This result indicates the involvement of c-jun in the maintenance of high proliferation rate in E5a transformed cells. However, as only 40% of thymidine incorporation is inhibited by antisense c-&n treatment (Fig. I), we suspect that there are other mechanisms involved in maintaining high proliferation rate on E5a transformed cells. We are in the process of identifying such mechanisms. Acknowledgements

,\,

‘-r_.-

We are grateful to MS Chen Yi-Liang for her assistance. This research was supported by National Science Council (NSC-8304 12-BO16-54), Taipei, Taiwan, ROC.

”

-30

1

2

3

Fig 3. Effects of antisense oligomer to c-jun protein expression in NESal cells by Western blot assay.

Previously, we demonstrated that ESa is required for the initiation but not the maintenance of transformation [8]. The highly proliferative state of transformed cells can be maintained by stimulation of cell growth. Cell growth rate is known to be stimulated by increased production of growth stimulators such as transforming growth factor-o, and by activation of proto-oncogenes such as c-jun, c-fos. In fact, we found the constitutive activation of c-&n

References Angel. P. and Karin, M. (1991) The role of Jun. Fos and the AP-I complex in cell-proliferation and transformation. B&him. Biophys. Acta, 1072, 129-157. 121Biro, S., Fu, Y.M., Yu, Z.X. and Epstein, SE. (1993) Inhibitory effects of antisense oligodeoxynucleotides targeting c-myc mRNA on smooth muscle cell proliferation and migration. Prof. Natl. Acad. Sci. USA, 90, 654-658. I31 Busam, K.J.. Robert, A.B. and Spom, M.B. (1992) Inhibition of mitogen-induced c-Jos expression in melanoma cells by retinoic acid involves the serum response element. J. Biol. Chem., 267, 19971- 19977. I41 Campbell, J.M., Bacon. T.A. and Wickstrom. E. (1990) Oligodeoxynucleoside phosphorothioate stability in subcellular extracts, cuture media. sera and cerebrospinal fluid. J. Biochem. Biophys. Methods 20, 259-267. I51 Chen. S.L. and Mounts, P. (1989) Detection by antibody probes of human papillomavirus type 6 ES proteins in respiratory papillomata. J. Med. Viral., 29, 273-283. I61 Chen, S.L. and Mounts, P. (1990) Transforming activity of E5a protein of human papillomavirus type 6 in NIH 3T3 cells and Cl27 cells. J. Virol., 64, 3226-3233. [71 Chen, S.L., Han,C.P.,Tsao, Y.P., Lee, J.W. andYin,C.S. (1993) Identification and typing of human papillomavirus in cervical cancers in Taiwan. Cancer 72, 1939-1945. 181 Chen,S.L.,Tsao, Y.P., Lee, J.W., Liu, H.S., Yang, C.M. and Tsao, L.T. (1994) E5a gene of human papillomavirus type I I is required for initiation but not maintenance of transformation in NIH 3T3 cells, J. Gen. Viral.. 75, 1953-1960. 191 Chen, S.L., Yang, C.M. and Tsao. Y .P. Induction of cjun protooncogene expression and transcription factor AP-

S.-L. Chen et al. /Cancer

I activity by the E5a oncoprotein of human papillomavirus type I I. (in press). [lo] Chow, L.T., Nasseri, MS., Wolinsky, M. and Broker, T.R. (1987) Human papillomavirus type 6 and 1I mRNAs from genital condyloma acuminata. J. Viro!., 61, 2581-2588. [I !] Gewirtz, A.M. and Calabretta, B. (1988) A c-myb antisense oligodeoxynucleotide inhibits normal human hematopoisis in vitro. Science, 242, 1303-1306. [12] Halazonetis, T.D., Georgopoulos. K., Greenberg, M.E. and Leder, P. (1988) c-jun dimerizes with itself and with c-j&, forming complexes of different DNA binding affinities. Cell, 55, 917-924. [13] Heikkila, R., Schwab, G., Wickstrom, E., Loke, S.L., Pluznik, D.H., Watt, R. and Neckers, L.M. (1987) A c-myc antisense oligodeoxynucleotide inhibits entry into S phase but not progress from Ge to Gt. Nature, 328, 445-449. (141 Holt, J.T., Render, R.L. and Nienhuis, A.W. (1988) An oligomer complementary to c-myc mRNA inhibits proliferation of HL-60 promyelocytic cells and induces differentiation. Mol. Cell Bio!., 8. 963-973. [IS] Kro!, A.R., Mol. J.N. and Stuitze, A.R. (1988) Modulation of eukaryotic gene expression by complementary to calmodulin mRNA alter behavioral responses in paramecium. BioTechnology, 6, 958-967.

Let!. 82 (1994)

119-123

123

[16] Ryder, K. and Nathans, D. (1988) Induction of protccogene c-jun by serum growth-factors. Proc. Nat! Acad. Sci. USA, 85, 8464-8467. [!7] Ryseck, R.P., Hirai, S.I., Janiv, M. and Bravo, R. (1988) Transcriptional activation of jun during the Gs/G, transition in mouse tibroblasts. Nature (London), 334, 535-537. [I81 Stein, C.A. and Cohen, J.S. (1988) Oligodeoxyribonucleotides as inhibitors of gene expression: a review. Cancer Res.. 48, 2659-2668. [I91 Tsa0.Y.P.. Chu,T.Y.,Chen,T.M.. Yang, Y.F. andchen, S.L. (1994) The effects of E5a and E7 genes of human papillomavirus type I I on immortalized human epiderma! keratinocytes and NIH 3T3 cells. Arch. Virol. (in press). (201 Wang, H.Y., Watkins, D.C. and Malbon, C.C. (1992) Antisense oligodeoxynucleotides to Gs protein o-subunit sequence accelerate differentiation of !ibroblasts to adipocytes. Nature, 334-337. [21] Wickstrom, E.L., Bacon, T.A., Gonzalez. A., Freeman, D.L., Lyman, G.H. and Wickstrom, E. (1988) Human promyelocytic leukemia HL-60 cell proliferation and c-myc protein expression are inhibited by an antisense pentadecadeoxynucleotide targeted against c-myc mRNA. Proc. Nat! Acad. Sci. USA, 85. 1028-1032.