Antisense oligonucleotide knockdown of mGlu5 receptor attenuates the antinociceptive tolerance and up-regulated expression of spinal protein kinase C associated with chronic morphine treatment

European Journal of Pharmacology 683 (2012) 78–85

Contents lists available at SciVerse ScienceDirect

European Journal of Pharmacology journal homepage: www.elsevier.com/locate/ejphar

Neuropharmacology and Analgesia

Antisense oligonucleotide knockdown of mGlu5 receptor attenuates the antinociceptive tolerance and up-regulated expression of spinal protein kinase C associated with chronic morphine treatment Tao Xu a, 1, Moxi Chen a, 1, Quanhong Zhou a, Ying Xue a, Li Wang a, Vida J. Bil De Arce b, Xiaoli Zhang a, Wei Jiang a,⁎ a b

Department of Anesthesiology, Shanghai Sixth People's Hospital, Shanghai Jiaotong University, Shanghai 200233, China Wellman Center for Photomedicine, Massachusetts General Hospital, Harvard Medical School, Boston, MA 02114, USA

a r t i c l e

i n f o

Article history: Received 6 November 2011 Received in revised form 15 February 2012 Accepted 26 February 2012 Available online 12 March 2012 Keywords: Morphine Tolerance Metabotropic glutamate receptor 5 (mGlu5 receptor) Protein kinase C (PKC) Intrathecal administration

a b s t r a c t Spinal metabotropic glutamate receptor 5 (mGlu5 receptor) is known to influence the development of intrathecal morphine antinociceptive tolerance. However, the signaling mechanisms remain unknown. We carried out intrathecal administration of an antisense oligodeoxynucleotide (ODN), which results in reduced expression of spinal mGlu5 receptor, to determine its effects on morphine tolerance and spinal protein kinase C (PKC) expression. Rats were treated intrathecally with saline, morphine, mGlu5 receptor antisense ODN or mGlu5 receptor mismatched ODN. Behavioral tests were used to test the thermal and mechanical pain thresholds. Eight days later, rats were sacrificed and spinal cords were harvested to assess the expression of spinal PKC (α, γ and ε) by Western blotting and real-time polymerase chain reaction (PCR). Compared to control, intrathecal mGlu5 receptor antisense ODN resulted in a ~ 53.9% reduction of spinal mGlu5 receptor after 8 days treatment. The mGlu5 receptor antisense ODN prevented the development of morphine tolerance. Expression of spinal PKC (α, γ and ε) was up-regulated at the mRNA and protein levels during the development of tolerance. Meanwhile, antisense ODN but not mismatched ODN reduced the spinal dorsal horn levels of PKC (α, γ and ε) which had been up-regulated after morphine exposure. We conclude that mGlu5 receptor participates in the development of morphine tolerance. Expression of spinal PKC (α, γ and ε) at the mRNA and protein levels increased during morphine tolerance. Antisense ODN of mGlu5 receptor prevented the tolerance and inhibited the altered expression of spinal PKC (α, γ and ε) during the development of tolerance. © 2012 Elsevier B.V. All rights reserved.

1. Introduction Opioids such as morphine remain a good choice for treating acute and chronic pain in clinical cases. The side-effects of opioids include sedation, respiratory depression, constipation, and a strong sense of euphoria. Long-term opioid exposure results in tolerance, hyperalgesia and dependence. A main limitation to their long-term use is the development of physiological tolerance. Many mechanisms have been investigated, such as opioid receptor downregulation (Law et al., 1983), desensitization (Nestler, 1996), uncoupling from the cyclic adenosine monophosphate pathway, interaction among opioid receptors and endogenous anti-opioid systems like the excitatory glutamatergic neurotransmitter system (Waldhoer et al., 2004). Despite

⁎ Corresponding author at: Department of Anesthesiology, Shanghai Sixth People's Hospital Affiliated to Shanghai Jiaotong University, 600 Yishan Rd, Shanghai 200233 China. Tel.: + 86 21 64369181 58328; fax: + 86 21 64369181 58330. E-mail address: [email protected] (W. Jiang). 1 These authors contributed equally to this work. 0014-2999/$ – see front matter © 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.ejphar.2012.02.046

considerable study focused on opioid tolerance, its exact mechanisms remain unknown. The roles of the glutamate receptors N-methyl-D-aspartate receptor (NMDA receptor) and mGlu5 receptor have been investigated broadly in morphine tolerance. Trujillo and Akil found that dizocilpine (MK-801), an antagonist of the NMDA receptor, prevents the development of morphine tolerance (Trujillo and Akil, 1991). Co-administration of an NMDA receptor antagonist with morphine potentiates the antinociceptive actions of morphine (Fischer et al., 2005) and inhibits the development of tolerance to antinociception. Mao and colleagues found that an antagonist of the NMDA receptor could prevent morphine tolerance and dependence (Manning et al., 1996), and increases the analgesic potency (Price et al., 2000). Mao et al. also demonstrated that chronic morphine down-regulates spinal glutamate transporters while MK-801, an antagonist of the NMDA receptor, blocks this downregulation (Mao et al., 2002). Recently, many studies have demonstrated the roles of spinal excitatory amino-acid receptors in the development of morphine tolerance. Recently, studies indicated that mGluR Ι (mGluR1 and mGlu5 receptor) might contribute to the development of morphine

T. Xu et al. / European Journal of Pharmacology 683 (2012) 78–85

analgesic tolerance (Gabra et al., 2008; Kozela et al., 2003; Mao et al., 1995; Nestler, 1996; Palucha et al., 2004). Antisense oligonucleotide knockdown of spinal mGluR1 was shown to attenuate morphineinduced tolerance (Sharif et al., 2002). Kozela et al. found that 2methyl-6-(phenylethynyl)-pyridine hydrochloride (MPEP), an antagonist of mGlu5 receptor, inhibits the development of morphine tolerance through phospholipase C (PLC), which stimulates phosphatidylinositol (PI) hydrolysis during this process (Kozela et al., 2003). Moreover, mGluR Ι antagonists reverse the development of morphine-induced tolerance, which might contribute to the prevention of persistent activation of the phosphatidylinositol cascade (Smith et al., 2004). The increased expression and immunoreactivity of spinal mGlu5 receptor following chronic morphine exposure might lead to enhanced neuronal excitability and synaptic transmission in the dorsal horn, which in turn suppresses the morphine-induced antinociception in mice (Narita et al., 2005). Increased expression of neural cell adhesion molecule was found in the dorsal horn after repeated morphine stimulation, highly overlaps with mGlu5 receptor, and stimulates the enhanced excitatory synaptic transmission, which in turn suppresses the morphine-induced antinociception (Suzuki et al., 2006). In previous research, we demonstrated that the mGlu5 receptor antagonist MPEP attenuates morphine tolerance while the agonist 2-chloro-5-hydroxyphenylglycine (CHPG) does the opposite (Xu et al., 2007). The expression of spinal nitric oxide synthase (NOS) is significantly up-regulated after prolonged morphine treatment, and this is inhibited by MPEP (Xu et al., 2008). Group Ι mGluR activation leads to Gαq or Gα11 subunit binding to the C2 domain of the PLCβ1, β3 and β4 isoforms and subsequent increases in phosphatidylinositol 4, 5bisphosphate (PIP2) turnover. Their activation increases intracellular calcium levels by inducing calcium release from intracellular stores which in turn stimulates PKC activation (Dhami and Ferguson, 2006). This led to the hypothesis that the activation of mGlu5 receptor may stimulate an increased concentration of intracellular calcium and activation of PKC after the appearance of tolerance to morphineinduced antinociception. Here, we investigated how mGlu5 receptor is involved in the development of spinal morphine tolerance and quantified the altered expression of PKC in rat spinal cord after chronic morphine exposure. 2. Materials and methods 2.1. Experimental animals Fifty-two adult male Sprague–Dawley rats (Fudan University Medical Animal Center, Shanghai, China) weighing 280–320 g were used. Rats were initially group-housed and then individually with water and food available ad libitum after intrathecal catheterization. The animal room was artificially illuminated from 07:00 to 19:00. The protocol followed the NIH Guide for the Care and Use of Laboratory Animals (NIH Publications No. 80-23, revised 1996) and was approved by the Animal Use and Care Committee of the School of Medicine, Shanghai Jiaotong University. All efforts were made to minimize animal suffering and to reduce the number of animals used.

79

The mismatched ODN had the sequence (5′-C(s)A(s)GCTTACGTGTCATGATGCTCAG(s)T(s)-3′). Fig. 1 presents the timeline of the ODN or saline injection schedules. The intrathecal injections on days 1 through 5 were twice a day (09:00 and 17:00) in 5 μl saline (n= 24; saline group and morphine group) or the same volume containing 30 nM antisense or mismatched ODN of mGlu5 receptor (n= 14 each in antisense and mismatched ODN groups). On days 6 to 8, 15 μg morphine per rat was added twice a day in the antisense ODN, mismatched ODN, and morphine groups (n= 10 in each group). The same volume of saline was injected in the saline group (n= 10). The twice daily injection of saline or ODN continued on days 6 to 8 (Fig. 1). The drug given was blind to the person who carried out the behavioral tests. 2.3. Behavioral tests The tail-flick test and hot plate test were used to assess the thermal pain threshold, while an analgesia meter (37215, Ugo Basile, Italy) was used to determine withdrawal threshold. 2.3.1. Thermal pain threshold test The warm-water tail-flick apparatus was controlled by a thermostatic regulator (Shanghai Thermo-stat Factory Co., Ltd., Shanghai, China) and the hot-plate test was performed on a Hot/Cold-Plate (35100, Ugo Basile, Italy). The test temperature was maintained at 52.5 ± 0.5 °C. The nociceptive endpoints were the characteristic withdrawal of the tail from warm water in the tail-flick assay, and the rat jumping or lifting its hindlimb from the surface of the hot-plate. A 10-s cut-off for the tail-flick test and a 60-s cut-off for the hot-plate test were set to prevent tissue damage. Individual measurements were repeated three times at 15-min intervals, and the mean value was calculated. 2.4. Mechanical pain threshold test Paw pressure thresholds were registered with a paw-pressure analgesia meter for the Randall–Selitto test (37215, Ugo Basile, Italy). The paws were placed on the meter, and the intensity of stimulation was increased from low to high at a linear rate of 10 g with a cut-off of 250 g to avoid tissue injury. A response was recorded when rats reacted by flinching or paw lifting. Three separate tests at 15-min intervals were performed for each rat, and the mean value was calculated. All assessments were made twice daily, 30 min after drug injection. The basal latency was measured prior to all treatments. 2.5. Real-time quantitative PCR of spinal mGlu5 receptor, PKCα, PKCγ and PKCε Real-time PCR was used to investigate the expression of spinal mGlu5 receptor, PKCα, PKCγ and PKCε mRNA.

2.2. Surgical handling and drug treatment

2.5.1. Primer design and preparation Primers for spinal mGlu5 receptor, PKCα, PKCγ and PKCε were prepared. Gene-specific oligonucleotides were designed from the sequences in the GenBank database using Primer Express software

After anesthesia with pentobarbital (50 mg/kg, intraperitoneal), an intrathecal PE-10 catheter (Becton Dickinson, USA) was implanted according to a previously described method (Storkson et al., 1996). To confirm the catheterization, 10 μl 2% lidocaine was injected through the catheter on the next day. Rats showing immediate hindlimb paralysis were considered to have successful placement. Then, they were left to recover for 3 days before experiments. Rats showing neurological deficits were excluded from the study. The antisense ODN of mGlu5 receptor was a 25-mer phosphodiester ODN (5′-C(s)A(s)CTGTGGCACTGAGGCTGACTGA(s)A(s)-3′).

Fig. 1. Timelines of the experimental design of the spinal mGlu5 receptor mRNA study and the intrathecal morphine antinociceptive tolerance study.

80

T. Xu et al. / European Journal of Pharmacology 683 (2012) 78–85

(Perkin-Elmer, Boston, MA, USA). The specificity of primers and probes was confirmed by homology search. A probe sequence was chosen to span the junction of two adjoining exons to avoid the detection of any contaminating genomic DNA. The sequences of primers and probes are shown in Table 1. All the primers and probes were synthesized by ShineGene Biotechnology Co. Ltd. (Shanghai, China).

conjugated goat anti-rabbit IgG (1:5000 dilution, #7074, Cell Signaling) for 1 h at RT. Finally, proteins were detected by electrochemiluminescence reagents (Pierce Biotechnology, Inc., Rockford, IL, USA) and visualized by exposure to Kodak film. The density was quantified by densitometric scanning. 2.7. Statistical analysis

2.5.2. Tissue collection and cDNA preparation On day 9, four rats from each group (saline, antisense ODN and mismatch ODN groups from days 1 to 5, and saline, morphine, antisense ODN plus morphine and mismatch ODN plus morphine groups from days 6 to 8) were sacrificed by intraperitoneal injection of pentobarbital (50 mg.kg − 1) followed by rapid intra-cardiac infusion with ice-cold saline containing heparin, and then the lumbar spinal cords were harvested. Total spinal RNA from 4 rats in each group was prepared using Trizol (Gibco) according to the protocol provided by the manufacturer. RNA (5 μl) was treated with a reaction mixture containing 10 μl 2×reverse transcription buffer (Shinegene, Shanghai, China), 1 μl oligo (dT) primers, 1 μl RT-mix (Shinegene: containing RNAse-free DNAse and RNasin ribonuclease inhibitor,) and 3 μl DEPC water (Sigma, USA). The RNA reverse transcription cDNA synthesis conditions were: 25 °C 10 min, 42 °C 60 min, 85 °C 5 min. 2.5.3. Real-time PCR After reverse transcription, 1 μl cDNA from each sample was placed in a 50 μl reaction volume containing Sybr Green Ι (Shinegene) and 30 pmol forward and reverse primer mix. The cycling reactions were performed using the 2000 Sequence Detection System (FTC2000, Funglyn Biotech Inc., Toronto, Canada). The cycling reaction conditions were: 4 min at 94 °C, 20 s at 94 °C, 30 s at 60 °C, 30 s at 72 °C. After cycling 35 times, the Sybr green signals were detected at 72 °C. 2.6. Western blot The spinal cord samples (~ 100 mg) from six rats each group were placed in 200 μl RIPA buffer containing 50 mmol/l Tris–HCl, pH 7.4, 150 mmol/l NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate, 1 mmol/l sodium orthovanadate, 1 mmol/l sodium fluoride, 5 mmol/l EDTA, and 10 μg/ml leupeptin. After adding 1 mmol/l PMSF, the mixtures were homogenized on ice for 30 min and centrifuged at 12,000 g for 10 min at 4 °C for Western blotting. After assaying the protein concentration with the BCA method, proteins were denatured in 5× sample-loading buffer and boiled for 5 min. Equivalent amounts of protein (50 μg) were loaded on 10% SDS polyacrylamide gel containing 2.5 ml acryl, 1.875 ml of 1.5 M Tris-base (pH 8.8), 3.125 ml ddH2O, 31.25 μl APS and 10 μl TEMED. Electrophoresis was conducted at 25 mA constant current for each gel. After that, the proteins were electro-transferred (80 V, 2 h) to PVDF membranes. The membranes were blocked with 5% non-fat milk in Tris-buffered saline (TBS) for 2 h at RT and incubated with antibodies overnight at 4 °C. Anti-GAPDH (#2118, Cell Signaling, USA) and anti-PKCα (#2056, Cell Signaling) were diluted 1:1000; antiPKCγ (71558, Abcam, USA) was diluted 1:2000; anti-mGlu5 receptor (#06-451, Upstate, USA) was diluted 1:750; and anti-PKCε (Cell Signaling) was diluted 1:800. The membranes were washed with TBS containing 1% Tween and incubated with horseradish peroxidase-

The antinociceptive response data were calculated by: Maximum Percentage Effect (MPE) % = (Response Latency − Baseline Latency) / (Cut-off Latency − Baseline Latency). SAS (version 8.01; SAS Institute, Cary, NC, USA) was used to calculate the results. Two-way analysis of variance (ANOVA) followed by post-hoc Dunnett's test was used for analysis. One-way ANOVA was used to analyze the results of PCR and Western blot. All data are expressed as mean± S.E.M. P b 0.05 was considered statistically significant. 3. Results 3.1. Inhibitory effect of mGlu5 receptor antisense ODN on intrathecal morphine-induced antinociceptive tolerance in tail-flick and hot-plate tests Morphine had significant antinociceptive effects on day 6 in both the tail-flick and hot-plate tests (morphine vs saline group, P b 0.01; Fig. 2A and B). However, morphine treatment over 3 days led to the full development of antinociceptive tolerance, as shown by no difference between the saline and morphine groups on day 9 (Fig. 2A and B). Meanwhile, the although the antisense OND group showed a downward trend of MPE%, and the acute antinociceptive effect of morphine on day 6 was not affected, it showed significantly decreased development of nociceptive tolerance after chronic morphine treatment from day 7 on (after a total of 3 morphine injections for the tail-flick and hot-plate tests; P b 0.01 vs saline group). Furthermore, as the tail-flick and hot-plate tests showed, the antinociceptive effects of morphine were more powerful in the antisense ODN group than in the morphine group on days 7 and 8 (P b 0.01 vs morphine group). Mismatch ODN injections had no effect on the antinociceptive effect of acute morphine treatment on day 6, and furthermore did not affect the development of morphine-induced antinociceptive tolerance (P> 0.05 vs morphine group). These results demonstrated that the development of antinociceptive tolerance after long-term morphine treatment was attenuated after knockdown of spinal mGlu5 receptor with antisense ODN in thermal threshold behavioral tests. 3.2. Effect of intrathecal mGlu5 receptor antisense ODN and morphine administration on mechanical nociceptive threshold The Randall–Selitto test showed that morphine generated a robust analgesic effect in the morphine, antisense ODN and mismatched ODN groups when morphine was administered intrathecally for the first time on day 6 (P b 0.01 vs saline group, Fig. 2C). After 3 consecutive days of morphine treatment, the analgesic effect decreased in the morphine and mismatched ODN groups, suggesting the induction of tolerance to morphine-induced antinociception (P> 0.05 vs saline group, Fig. 2C). Intrathecal pre-treatment with mGlu5 receptor antisense

Table 1 Sequences of primers. Gene

Forward primers

Reverse primers

GeneID

mGluR5 PKCα PKCγ PKCε β-actin

5′-TGTTTGCCTGCCTCGGTC-3′ 5′-CGTGCTCCTGTATGAGATGCTA-3′ 5′-GAAAGGCAGTTTTGGGAAGG-3′ 5′-GCGAAGCCCCTAAGACAAT-3′ 5′-CCCATCTATGAGGGTTACGC-3′

5′-GCAATACGGTTGGTCTTGGTTA-3′ 5′-CACTTTGGGCTTGAATGGC-3′ 5′-ATCACAAAATACAGGCGGTCC-3′ 5′-CACCCCAGATGAAATCCCTAC-3′ 5′-TTTAATGTCACGCACGATTTC-3′

24418 24680 24681 29340 42475962

T. Xu et al. / European Journal of Pharmacology 683 (2012) 78–85

Fig. 2. Suppression of the development of tolerance to morphine-induced antinociceptive effects by pretreatment with mGlu5 receptor antisense ODN in (A) tail-flick test, (B) hot-plate test and (C) Randall–Selitto test. Morphine produced antinociceptive effects in the morphine, antisense ODN and mismatched ODN groups when morphine was administered intrathecally for the first time on day 6. After 3 days of morphine treatment, the morphine group developed tolerance to the antinociceptive effects. The antinociceptive effects were more powerful in the antisense ODN group than in the morphine group from day 7 to 8 and antinociceptive tolerance did not appear in the antisense ODN group as shown in both the thermal and mechanical threshold tests. The mismatched ODN group showed no such effect. The analgesic effect of morphine was lost since tolerance to morphine-induced antinociception appeared on day 8 after 3 days of morphine exposure. Intrathecal saline showed no analgesic effect. ⁎P b 0.05, ⁎⁎P b 0.01 vs corresponding time points in saline group. #P b 0.05, ##P b 0.01 vs corresponding time points in morphine group.

ODN prevented the loss of morphine-induced antinociception (Pb 0.01 vs saline group, Fig. 2C) and showed a powerful analgesic effect compared with the morphine group on days 7 and 8 (P b 0.05 and b0.01, Fig. 2C). mGlu5 receptor mismatched ODN had no inhibitory effect on the loss of morphine analgesia and morphine antinociceptive tolerance on day 8 (P> 0.05 vs saline and morphine groups, Fig. 2C). 3.3. Quantification of mGlu5 receptor mRNA on day 5 or protein on day 8 of treatment To evaluate the knockdown effect of antisense ODN on mGlu5 receptor, real-time PCR was carried out to measure the mRNA level of mGlu5 receptor in the lumbar spinal cord on day 5 (Fig. 3A). Compared with the saline group, the antisense ODN group showed a reduction in mGlu5 receptor mRNA of ~48.2% after 5 days of intrathecal pre-

81

Fig. 3. Effect of mGlu5 receptor antisense ODN on spinal mGlu5 receptor expression and spinal mGlu5 receptor protein expression during chronic intrathecal morphineinduced antinociceptive tolerance. (A) Intrathecal pre-treatment with mGlu5 receptor antisense ODN effectively reduced spinal mGlu5 receptor mRNA. (B and C) Spinal mGluR protein expression was up-regulated after consecutive morphine treatment in the morphine group. mGlu5 receptor antisense ODN strongly inhibited the upregulated spinal mGlu5 receptor protein expression and decreased the spinal mGlu5 receptor protein expression in the antisense ODN group. Increased expression of spinal mGlu5 receptor protein also appeared in the group treated with mGlu5 receptor mismatched ODN. ⁎P b 0.05 vs saline treatment, #P b 0.05 vs morphine group.

treatment with mGlu5 receptor antisense ODN (Pb 0.05 vs saline group, Fig. 3A), but the mismatched ODN had no such effect (P> 0.05 vs saline group, Fig. 3A). In a previous study, we found that an antagonist of mGlu5 receptor suppresses the loss of morphine-induced antinociception and concluded that mGlu5 receptor activation is enhanced during the development of morphine tolerance (Xu et al., 2007). To determine the expression of spinal mGlu5 receptor protein after 8 days of treatment, Western blotting was used. Chronic morphine treatment increased the expression of spinal mGlu5 receptor protein in the morphine group (Pb 0.05 vs saline group, Fig. 3B and C). Pre-treatment

82

T. Xu et al. / European Journal of Pharmacology 683 (2012) 78–85

with mGlu5 receptor antisense ODN inhibited this morphine-induced up-regulation of spinal mGlu5 receptor protein (P b 0.05 vs morphine group, Fig. 3B and C). The protein level of spinal mGlu5 receptor in the antisense ODN group was decreased (Pb 0.05 vs saline group, Fig. 3B and C), but not in the mismatched ODN group (P> 0.05, vs saline group). 3.4. Altered expression of spinal PKCα, PKCγ and PKCε mRNA during the development of tolerance to morphine-induced antinociception Chronic morphine exposure increased the expression of spinal PKCα, PKCγ and PKCε mRNA in the morphine group (P b 0.05 vs saline group, Fig. 4A, B and C). Knockdown of spinal mGlu5 receptor by pretreatment with antisense ODN prevented their up-regulation (P> 0.05 vs saline group, P b 0.05 vs morphine group, Fig. 4A, B and C). Intrathecal administration of mGlu5 receptor mismatched ODN did not inhibit the expression of spinal PKCα, PKCγ and PKCε mRNA, and this was increased at the mRNA level after chronic morphine treatment (P > 0.05 vs morphine group, P b 0.05 vs saline group, Fig. 4A, B and C). 3.5. mGlu5 receptor antisense ODN inhibition of increased expression of spinal PKCα, PKCγ and PKCε protein during intrathecal morphine-induced antinociceptive tolerance Here, the inhibitory effect of mGlu5 receptor antisense ODN on the expression of PKC proteins in rats chronically treated with morphine was explored. The expression of spinal PKCα, PKCγ and PKCε protein was up-regulated in both the morphine and mismatched ODN groups on day 9 (P b 0.05 vs saline group, Fig. 5A–F). Furthermore, the upregulation was suppressed after pre-administration of mGlu5 receptor antisense ODN (P b 0.05 vs morphine group) and did not differ from the saline group (Fig. 5A–F). On the contrary, the expression of PKCα, PKCγ and PKCε was increased in the mismatched ODN group (P b 0.05 vs saline group, Fig. 5A–F), and this was not inhibited by pre-treatment with mGlu5 receptor mismatched ODN. Apparently, the levels of PKCα and PKCγ in the antisense ODN group were lower than in the saline group, but the difference was not statistically significant. Expression of spinal PKCε protein was a little higher, but not different from the control group (P > 0.05 vs saline group). 4. Discussion Consistent with other studies, the present study demonstrated that knockdown of spinal mGlu5 receptor by intrathecal preadministration of mGlu5 receptor antisense ODN suppressed the expression of mGlu5 receptor both at the mRNA and protein levels (Catania et al., 2001; Dorri et al., 1997). Here, we showed for the first time that knockdown of spinal mGlu5 receptor with antisense ODN inhibited the development of tolerance to long-term intrathecal morphine-induced antinociception. Intrathecal pre-treatment with mGlu5 receptor antisense ODN effectively led to a 48.2% reduction of spinal mGlu5 receptor mRNA after 5 days of treatment and a 53.9% reduction after 8 days. Behavioral experiments showed that intrathecal mGlu5 receptor antisense ODN significantly attenuated the development of tolerance after long-term morphine treatment. On the last day of continuous intrathecal morphine treatment, thermal and mechanical pain thresholds in the antisense ODN group were higher than those in the saline group, which showed that analgesic effects of morphine remained and tolerance to morphine-induced antinociception did not appear in the antisense ODN group. Although the antisense OND group showed a downward trend of MPE%, as there was a lower pain threshold from the first to the last morphine injection in the antisense group, this might be due to the incomplete knockdown of spinal mGlu5 receptor. However, the MPE% of mechanical and thermal thresholds in the morphine and morphine plus

Fig. 4. Expression of spinal PKCα, PKCγ and PKCε mRNA after intrathecal morphine and mGlu5 receptor ODN treatment. The mRNA expression of PKCα (A), PKCγ (B) and PKCε (C) was significantly up-regulated in the morphine group during consecutive chronic morphine exposure. The increased expression of PKCα, PKCγ and PKCε mRNA was inhibited by knockdown of spinal mGlu5 receptor by intrathecal pre-treatment with mGlu5 receptor antisense ODN. Up-regulated expression of spinal PKCα, PKCγ and PKCε mRNA was also seen in the mismatched ODN group after chronic morphine exposure. ⁎P b 0.05 vs saline group, #P b 0.05 vs morphine group.

mismatched ODN groups did not differ from the saline group, which means that the analgesic effect of morphine disappeared and tolerance to morphine-induced antinociception or morphine inducedhyperalgesia developed after chronic morphine exposure in these two groups. And following the 2nd day after intrathecal administration of morphine, morphine appeared to have a better antinociceptive

T. Xu et al. / European Journal of Pharmacology 683 (2012) 78–85

83

Fig. 5. Effect of intrathecal mGlu5 receptor ODN on spinal PKCα, PKCγ and PKCε protein expression during the development of spinal morphine-induced antinociceptive tolerance. (A and B) Spinal PKCα protein was up-regulated in the morphine group during repeated intrathecal morphine treatment. Intrathecal pretreatment with mGlu5 receptor antisense ODN prevented the over-expression of spinal PKCα protein after chronic morphine administration. The same alteration of spinal PKCα protein as the morphine group was seen in mGlu5 receptor mismatched ODN pre-treated rats after consecutive morphine exposure. (C and D) Like PKCα, PKCγ protein was also increased during the morphine-induced antinociceptive tolerance. Intrathecal mGlu5 receptor antisense ODN, but not mGlu5 receptor mismatched ODN, inhibited this up-regulation during chronic treatment with spinal morphine. (E and F) Knockdown of spinal mGlu5 receptor with antisense ODN prevented the increased expression of spinal PKCε protein. Spinal PKCε protein expression in the morphine and mismatched ODN groups was higher than in the mGlu5 receptor antisense group. ⁎P b0.05 vs saline group, P b 0.05 vs morphine group.

effect in the antisense ODN group than in the morphine group. It seems that intrathecal injection of mGlu5 receptor antisense ODN may effectively delay the occurrence of morphine antinociceptive tolerance, and potentiate its analgesic effect. In previous studies, we demonstrated that inhibition of spinal mGlu5 receptor prevents the development of tolerance to spinal morphine-induced antinociception (Xu et al., 2007, 2008) and here we confirmed these results by knockdown of spinal mGlu5 receptor with antisense ODN. Like many other studies, our results verify that antagonists of mGlu5 receptor inhibit the development of tolerance

to morphine-induced antinociception (Gabra et al., 2008; Kozela et al., 2003; Narita et al., 2005) and have a synergistic effect when co-administered with morphine by potentiating morphine-induced acute antinociception (Osikowicz et al., 2008). Smith et al. found that the mGlu5 receptor antagonist MPEP reverses the antinociceptive tolerance at a certain level (Smith et al., 2004). According to previous studies, mGlu5 receptor also contributes to the process of morphine withdrawal (Palucha et al., 2004; Rasmussen et al., 2005). Herzig et al. demonstrated that mGlu5 receptor is involved in the modulation of spontaneous and cocaine-induced locomotion, state-dependent

84

T. Xu et al. / European Journal of Pharmacology 683 (2012) 78–85

learning and morphine-CPP expression (Herzig and Schmidt, 2004). Whereas, Popik and Wróbel confirmed that morphine-conditioned reward is inhibited by MPEP, the mGlu5 receptor antagonist (Popik and Wrobel, 2002). mGlu5 receptor might be activated during the development of morphine antinociceptive tolerance as we discussed in previous studies. Suzuki et al. suggested that repeated stimulation of μopioid receptors increases the expression of mGlu5 receptor and leads to enhanced excitatory synaptic transmission in the dorsal horn of the spinal cord, which in turn suppresses morphine-induced antinociception (Suzuki et al., 2006). Narita et al. also demonstrated that repeated treatment with morphine significantly increases the level of mGlu5 receptor immunoreactivity in the dorsal horn of the mouse spinal cord and increased mGlu5 receptor is predominantly expressed in neurons and sparsely expressed in the processes of astrocytes following repeated treatment with morphine, which implies that repeated morphine treatment leads to enhanced neuronal excitability and synaptic transmission in the dorsal horn and suppresses morphine-induced antinociception (Narita et al., 2005). Here, we demonstrated that mGlu5 receptor expression was up-regulated at the protein level in the spinal cord after long-term intrathecal morphine treatment in rats. We also verified that the increased expression of spinal mGlu5 receptor was inhibited by knockdown of spinal mGlu5 receptor with antisense ODN, which prevented the development of tolerance to repeated morphineinduced antinociception during a long period of spinal morphine exposure. However, the details of how mGlu5 receptor influences the development of morphine-induced antinociceptive tolerance remain unknown. Aoki et al. showed that the activation of mGlu5 receptor linked to increased levels of the PKCγ isoform in the mouse limbic forebrain is implicated in the development of the rewarding effect of morphine (Aoki et al., 2004). PKC plays an important role in the process of tolerance to morphine-induced antinociception. Many studies demonstrated that the activity and expression of PKC in the spinal cord of rats are upregulated after continuous spinal morphine treatment (GranadosSoto et al., 2000; Mao et al., 1995), with higher activity in vivo (Narita et al., 2005). Smith et al. reported that antagonists of PKCα, PKCγ and PKCε totally reverse morphine antinociceptive tolerance in mice (Smith et al., 2007). Bailey et al. showed that inhibition of PKC (mainly PKCα) affects the occurrence of tolerance to morphineinduced antinociception by reducing the desensitization of μ-opioid receptors (Bailey et al., 2009). In this study, we confirmed the increased expression of spinal PKC (PKCα, PKCγ and PKCε) during the development of morphine antinociceptive tolerance. The expression of PKCα, PKCγ and PKCε at the mRNA and protein levels in the morphine alone and mismatched ODN plus morphine groups were significantly higher than in the saline group, suggesting that the activity of PKCα, PKCγ and PKCε were markedly up-regulated when tolerance to morphine-induced antinociception occurred during a long period of spinal morphine exposure. However, knockdown of mGlu5 receptor with intrathecal antisense ODN inhibited the up-regulated expression of spinal PKCα, PKCγ and PKCε in the antisense ODN plus morphine group, which revealed the absence of tolerance to morphine-induced antinociception. Here, we determined that PKCα, PKCγ and PKCε were significantly up-regulated after chronic morphine exposure, and this was suppressed by pre- and co-treatment with antisense ODN of mGlu5 receptor. These data support a role for the activation of spinal mGlu5 receptor during the development of morphine antinociceptive tolerance after chronic intrathecal morphine treatment. It appears that activation of the NMDA receptor and mGlu5 receptor mediate the activity of nNOS via changes in intracellular Ca 2+ concentration during chronic morphine infusion. This might in turn result in an enhanced release of intracellular Ca 2+ and activation of PKC. Knockdown of mGlu5 receptor might reduce the flux of Ca 2+ and activation of PKC so as to preserve the analgesia and inhibit the development of tolerance to morphine-induced antinociception. Our study suggests that antisense ODN of mGlu5 receptor may prevent the process of chronic

morphine antinociceptive tolerance through a PKC pathway and maintain the acute morphine efficacy. 5. Conclusions This work supports the idea that mGlu5 receptor contributes to the development of tolerance to repeated morphine-induced antinociception. Spinal PKCα, PKCγ and PKCε were up-regulated during the development of tolerance to morphine-induced antinociceptive effects after chronic intrathecal morphine exposure. Knockdown of spinal mGlu5 receptor with antisense ODN prevented the development of spinal morphine antinociceptive tolerance, maintained the acute morphine efficacy and inhibited the up-regulated expression of spinal PKCα, PKCγ and PKCε which result from long term chronic morphine exposure. Here, we showed for the first time that knockdown of mGlu5 receptor with antisense ODN significantly prevents morphine tolerance and stops PKC from up-regulating after chronic morphine exposure. Further studies need to explore the exact mechanism of how mGlu5 receptor regulates the morphine antinociceptive tolerance. Additional studies may focus on the detailed molecular chain, such as G-protein, in order to determine the exact mechanism. Statement of conflicts of interest None. Acknowledgements This work was supported by grants from the National Natural Science Foundation of China (30972850), the Ph.D. Programs Foundation of the Ministry of Education of China (200802480074), and a Youth Fund project to T. Xu from Shanghai Health Bureau (2009Y040). References Aoki, T., Narita, M., Shibasaki, M., Suzuki, T., 2004. Metabotropic glutamate receptor 5 localized in the limbic forebrain is critical for the development of morphineinduced rewarding effect in mice. Eur. J. Neurosci. 20, 1633–1638. Bailey, C.P., Llorente, J., Gabra, B.H., Smith, F.L., Dewey, W.L., Kelly, E., Henderson, G., 2009. Role of protein kinase C and mu-opioid receptor (MOPr) desensitization in tolerance to morphine in rat locus coeruleus neurons. Eur. J. Neurosci. 29, 307–318. Catania, M.V., Bellomo, M., Di Giorgi-Gerevini, V., Seminara, G., Giuffrida, R., Romeo, R., De Blasi, A., Nicoletti, F., 2001. Endogenous activation of group-I metabotropic glutamate receptors is required for differentiation and survival of cerebellar Purkinje cells. J. Neurosci. 21, 7664–7673. Dhami, G.K., Ferguson, S.S., 2006. Regulation of metabotropic glutamate receptor signaling, desensitization and endocytosis. Pharmacol. Ther. 111, 260–271. Dorri, F., Hampson, D.R., Baskys, A., Wojtowicz, J.M., 1997. Down-regulation of mGluR5 by antisense deoxynucleotides alters pharmacological responses to applications of ACPD in the rat hippocampus. Exp. Neurol. 147, 48–54. Fischer, B.D., Carrigan, K.A., Dykstra, L.A., 2005. Effects of N-methyl-D-aspartate receptor antagonists on acute morphine-induced and l-methadone-induced antinociception in mice. J. Pain 6, 425–433. Gabra, B.H., Smith, F.L., Navarro, H.A., Carroll, F.I., Dewey, W.L., 2008. mGluR5 antagonists that block calcium mobilization in vitro also reverse (S)-3,5-DHPG-induced hyperalgesia and morphine antinociceptive tolerance in vivo. Brain Res. 1187, 58–66. Granados-Soto, V., Kalcheva, I., Hua, X., Newton, A., Yaksh, T.L., 2000. Spinal PKC activity and expression: role in tolerance produced by continuous spinal morphine infusion. Pain 85, 395–404. Herzig, V., Schmidt, W.J., 2004. Effects of MPEP on locomotion, sensitization and conditioned reward induced by cocaine or morphine. Neuropharmacology 47, 973–984. Kozela, E., Pilc, A., Popik, P., 2003. Inhibitory effects of MPEP, an mGluR5 antagonist, and memantine, an N-methyl-D-aspartate receptor antagonist, on morphine antinociceptive tolerance in mice. Psychopharmacology (Berl) 165, 245–251. Law, P.Y., Hom, D.S., Loh, H.H., 1983. Opiate receptor down-regulation and desensitization in neuroblastoma X glioma NG108-15 hybrid cells are two separate cellular adaptation processes. Mol. Pharmacol. 24, 413–424. Manning, B.H., Mao, J., Frenk, H., Price, D.D., Mayer, D.J., 1996. Continuous coadministration of dextromethorphan or MK-801 with morphine: attenuation of morphine dependence and naloxone-reversible attenuation of morphine tolerance. Pain 67, 79–88. Mao, J., Price, D.D., Phillips, L.L., Lu, J., Mayer, D.J., 1995. Increases in protein kinase C gamma immunoreactivity in the spinal cord of rats associated with tolerance to the analgesic effects of morphine. Brain Res. 677, 257–267.

T. Xu et al. / European Journal of Pharmacology 683 (2012) 78–85 Mao, J., Sung, B., Ji, R.R., Lim, G., 2002. Chronic morphine induces downregulation of spinal glutamate transporters: implications in morphine tolerance and abnormal pain sensitivity. J. Neurosci. 22, 8312–8323. Narita, M., Suzuki, M., Niikura, K., Nakamura, A., Miyatake, M., Aoki, T., Yajima, Y., Suzuki, T., 2005. Involvement of spinal metabotropic glutamate receptor 5 in the development of tolerance to morphine-induced antinociception. J. Neurochem. 94, 1297–1305. Nestler, E.J., 1996. Under siege: the brain on opiates. Neuron 16, 897–900. Osikowicz, M., Mika, J., Makuch, W., Przewlocka, B., 2008. Glutamate receptor ligands attenuate allodynia and hyperalgesia and potentiate morphine effects in a mouse model of neuropathic pain. Pain 139, 117–126. Palucha, A., Branski, P., Pilc, A., 2004. Selective mGlu5 receptor antagonist MTEP attenuates naloxone-induced morphine withdrawal symptoms. Pol. J. Pharmacol. 56, 863–866. Popik, P., Wrobel, M., 2002. Morphine conditioned reward is inhibited by MPEP, the mGluR5 antagonist. Neuropharmacology 43, 1210–1217. Price, D.D., Mayer, D.J., Mao, J., Caruso, F.S., 2000. NMDA-receptor antagonists and opioid receptor interactions as related to analgesia and tolerance. J. Pain Symptom Manage 19, S7–S11. Rasmussen, K., Martin, H., Berger, J.E., Seager, M.A., 2005. The mGlu5 receptor antagonists MPEP and MTEP attenuate behavioral signs of morphine withdrawal and morphine-withdrawal-induced activation of locus coeruleus neurons in rats. Neuropharmacology 48, 173–180. Sharif, R.N., Osborne, M., Coderre, T.J., Fundytus, M.E., 2002. Attenuation of morphine tolerance after antisense oligonucleotide knock-down of spinal mGluR1. Br. J. Pharmacol. 136, 865–872.

85

Smith, F.L., Smith, P.A., Dewey, W.L., Javed, R.R., 2004. Effects of mGlu1 and mGlu 5 metabotropic glutamate antagonists to reverse morphine tolerance in mice. Eur. J. Pharmacol. 492, 137–142. Smith, F.L., Gabra, B.H., Smith, P.A., Redwood, M.C., Dewey, W.L., 2007. Determination of the role of conventional, novel and atypical PKC isoforms in the expression of morphine tolerance in mice. Pain 127, 129–139. Storkson, R.V., Kjorsvik, A., Tjolsen, A., Hole, K., 1996. Lumbar catheterization of the spinal subarachnoid space in the rat. J. Neurosci. Methods 65, 167–172. Suzuki, M., Narita, M., Niikura, K., Suzuki, T., 2006. Chronic morphine treatment increases the expression of the neural cell adhesion molecule in the dorsal horn of the mouse spinal cord. Neurosci. Lett. 399, 202–205. Trujillo, K.A., Akil, H., 1991. Inhibition of morphine tolerance and dependence by the NMDA receptor antagonist MK-801. Science 251, 85–87. Waldhoer, M., Bartlett, S.E., Whistler, J.L., 2004. Opioid receptors. Annu. Rev. Biochem. 73, 953–990. Xu, T., Jiang, W., Du, D., Xu, Y., Hu, Q., Shen, Q., 2007. Role of spinal metabotropic glutamate receptor subtype 5 in the development of tolerance to morphine-induced antinociception in rat. Neurosci. Lett. 420, 155–159. Xu, T., Jiang, W., Du, D., Xu, Y., Zhou, Q., Pan, X., Lou, Y., Xu, L., Ma, K., 2008. Inhibition of MPEP on the development of morphine antinociceptive tolerance and the biosynthesis of neuronal nitric oxide synthase in rat spinal cord. Neurosci. Lett. 436, 214–218.