- Email: [email protected]
Antisense RNA mediated protection from white spot syndrome virus (WSSV) infection in Pacific white shrimp Litopenaeus vannamei
Aquaculture 435 (2015) 306–309
Contents lists available at ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aqua-online
Antisense RNA mediated protection from white spot syndrome virus (WSSV) infection in Pacific white shrimp Litopenaeus vannamei Dharnappa Sannejal Akhila a, Madhu K. Mani a, Praveen Rai a,1, Kelly Condon b, Leigh Owens b, Indrani Karunasagar a,⁎ a b
Department of Fisheries Microbiology, UNESCO-MIRCEN for Marine Biotechnology, Karnataka Veterinary, Animal and Fisheries Sciences University, College of Fisheries, Mangalore 575002, India Microbiology and Immunology, School of Veterinary and Biomedical Sciences, 1 Solander Drive, James Cook University, Townsville 4811, Queensland, Australia
a r t i c l e
i n f o
Article history: Received 27 June 2014 Received in revised form 24 September 2014 Accepted 4 October 2014 Available online 12 October 2014 Keywords: Litopenaeus vannamei WSSV Antisense VP39 wsv477
a b s t r a c t Antisense (AS) plasmid constructs were used to target genes VP28, VP39 and wsv477 of white spot syndrome virus (WSSV) in the Pacific white shrimp Litopenaeus vannamei, and subsequent protection from the virus was investigated. PCR amplified products of the targeted viral ORFs were cloned downstream in antisense orientation (3′–5′) into a plasmid vector having elongation factor 1α (EF1α) promoter. Shrimp were injected with the AS plasmids intramuscularly followed by a challenge with WSSV. The AS plasmids administered individually (pEF-VP28, pEF-VP39 and pEF-wsv477) and in combinations (pEF-VP28 + VP39, pEF-VP28 + wsv477, pEFVP39 + wsv477) provided significant protection to the L. vannamei against WSSV. Mortality began in the positive and promoter control groups on day three of viral challenge and reached 100% by day nine. The shrimp injected with AS plasmid of VP28, VP39 and wsv477 showed survival rate of 50%, 60% and 90% respectively, in comparison with the control groups at 9 days post infection (dpi). The AS constructs targeting the early regulatory gene wsv477 produced statistically superior protection against WSSV, both alone and in combination as pEFVP28 + wsv477 and pEF-VP39 + wsv477. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Shrimp aquaculture is vital because it provides high quality protein for human consumption and boosts nutritional security in developing countries via generation of employment amongst the poor/low income strata (FAO, 2010). Though shrimp are susceptible to infection by various pathogens, viruses pose the largest threat to shrimp farming (Lightner, 1999). White spot syndrome virus (WSSV) remains to date the most dreaded pathogen for the shrimp aquaculture industry worldwide since its emergence in 1992 (Escobedo-Bonilla, 2011). WSSV is an enveloped, non-occluded, bacilliform virus with a tail-like appendage at one end (Durand et al., 1996; Wongteerasupaya et al., 1995). The viral genome is a circular double-stranded DNA of approximately 300 kb with about 185 open reading frames (van Hulten et al., 2001) comprising both structural and envelope proteins (Syed Musthaq and Kwang, 2011). WSSV has a broad host range including several penaeid shrimp species, Caribbean shrimp, lobsters, crayfish, crabs and aquatic insects
⁎ Corresponding author at: UNESCO-MIRCEN for Medical and Marine Biotechnology, Nitte University Centre for Science Education and Research (NUCSER), Nitte University, Mangalore 575018, India. Tel.: +91 824 2204490; fax: +91 824 2204162. E-mail address: [email protected] (I. Karunasagar). 1 Present address: UNESCO-MIRCEN for Medical and Marine Biotechnology, Nitte University Centre for Science Education and Research (NUCSER), Nitte University, Mangalore 575018, India.
http://dx.doi.org/10.1016/j.aquaculture.2014.10.005 0044-8486/© 2014 Elsevier B.V. All rights reserved.
(Otta et al., 1999; Hossain et al., 2001; Escobedo-Bonilla et al., 2008; Mohan, 2012; Pradeep et al., 2012). Mortality can reach 100% mortality within 3–10 days after onset of clinical signs (Karunasagar et al., 1997). Even though invertebrates do not possess a defence system like that seen in vertebrate immunology, a “quasi-immune response” was reported in Penaeus japonicus, pointing to the existence of primitive immune memory in shrimp (Venegas et al., 2000). Another hypothesis, “the viral accommodation” theory, conceptualizes that many invertebrates, including crustaceans, possess tolerance which involves specific memory to prevent viral triggered apoptosis, and this tolerance can occur at all life stages of a host species (Flegel, 2007). These concepts have led to the application of different strategies to protect animals from WSSV, ranging from delivery of envelope proteins and recombinant proteins to small interfering RNA (siRNA), double stranded RNA (dsRNA) and long-hairpin RNA (lhRNA) (Choi et al., 2011; Krishnan et al., 2009; Sarathi et al., 2010; Yumiao et al., 2013; Zhu and Zhang, 2012). RNAi has been used to determine the function of various genes of shrimp that are involved in viral infection. Escobedo-Bonilla (2011) summarized the role of different shrimp proteins in antiviral immunity brought about by RNAi silencing mechanisms such as toll-like receptor (Labreuche et al., 2009), Rab7-like proteins that participate in virus entry (Wu and Zhang, 2007), caspase-3 protein involved in apoptosis (Rijiravanich et al., 2008) and proPO activity (Charoensapsri et al., 2009). The use of antisense constructs under the control of a constitutive promoter for combating WSSV infection in Penaeus monodon was
D.S. Akhila et al. / Aquaculture 435 (2015) 306–309
recently reported by Ahanger et al. (2014), who observed that it could elicit good protection in WSSV challenged shrimp. Viral envelope and coat proteins are ideal targets for vaccination studies as they are the first to interact with the host cell and play vital roles in entry and multiplication of the virus inside the host (Chazal and Gerlier, 2003; Chiu and Chang, 2002). A preliminary study to investigate the protective effect of delivering different antisense constructs encoding envelope proteins VP28 and VP39, and wsv477 to shrimp infected with WSSV was undertaken. The ORF 421 encodes the most prominent coat protein, VP28, which is involved in the systemic infection of WSSV (van Hulten et al., 2001). This protein has been extensively studied as a candidate for vaccination to protect shrimp against WSSV infection. Another envelope protein, VP39, was identified as an integument protein (Tsai et al., 2006) and wsv477 was reported as an early gene with GTP-binding activity (Han et al., 2007). There is little information on the use of VP39 and wsv477 as vaccine candidates for protecting against WSSV infection in shrimp. This study shows the efficiency of antisense plasmid constructs VP39 and wsv477 in comparison to the extensively studied VP28 against WSSV infection in the Pacific white shrimp Litopenaeus vannamei. 2. Materials and methods 2.1. Collection and maintenance of experimental shrimp Healthy L. vannamei (8–10 g body weight) were collected from an aquaculture farm near Mangalore, Karnataka. The shrimp were maintained in 1000 l fibreglass tanks in natural seawater (salinity range of 20–25 ppt) at ambient temperature (27–30 °C) with aeration and were fed with commercial pelleted feed (CP aqua, Chennai). Temperature, pH, salinity, and dissolved oxygen were recorded on daily basis. The shrimp were healthy and confirmed negative for WSSV by PCR (Otta et al., 2003).
307
35 cycles were carried out at the respective annealing temperature for 30 s (Table 1). The resulting PCR product was electrophoresed in 1.5% agarose gel, double digested with the respective restriction enzymes and cloned in pDrive vector (Qiagen) in antisense orientation (3′–5′ direction), downstream to EF1α promoter. The recombinant vector was transformed into competent Escherichia coli DH5α cells by heat shock at 42 °C for 90 s and plated on Luria–Bertani (LB) agar containing ampicillin (100 μg/ml). The colonies were screened the following day by subjecting the clones to PCR using gene specific primers. The plasmids extracted from the positive clones were designated pEF-VP28, pEFVP39, pEF-wsv477, pEF-VP28 + VP39, pEF-VP28 + wsv477 and pEFVP39 + wsv477. 2.3. Preparation of viral inoculum WSSV infected P. monodon with prominent white spots were collected from shrimp farms and the virus extracted according to Du et al. (2007) with slight modification. Briefly, gill tissues from infected P. monodon were homogenized in TN buffer (0.2 M Tris–HCl, 0.4 M NaCl, pH 7.4), followed by centrifugation at 5000 ×g for 20 min. The supernatant was filtered through a 0.45 μm filter and stored at −80 °C for further use. Quantitative real time PCR was performed to calculate the virus copies in the stock using the standard curve. The real time PCR assay was carried out with SYBR Green PCR Master Mix (Roche), 2.5 pm of each primer, and 1 μl of the diluted viral DNA sample as template. Amplification was performed with the following programme: 2 min for uracil N-glycosylase (UNG) activation at 50 °C and activation of the AmpliTaq for 10 min at 95 °C, 40 cycles of 15 s at 95 °C, 45 s at 55 °C, and an extension of 72 °C for 30 s. All samples were run in triplicate with a non-template negative control. With an optimal PCR mixture, the WSSV quantity in the viral inoculum contained an average of 7.5 × 108 copies per microlitre (data not shown). 2.4. Delivery of antisense (AS) constructs and WSSV challenge
2.2. Genomic DNA extraction and synthesis of antisense plasmid constructs The genomic DNA from the WSSV infected L. vannamei collected from an infected farm in Kundapur was extracted according to Otta et al. (2003) with some modification. Briefly, haemolymph was collected from the shrimp using a tuberculin syringe containing anticoagulant (0.5 M EDTA), and centrifuged at 5000 × g for 10 min at 4 °C. The resulting haemocyte pellet was treated with lysis buffer (10 mM Tris– HCl, 1 mM EDTA, 0.1 M NaCl), and incubated for 3 h at 50 °C with 20% SDS and proteinase K (final concentration of 1% and 100 μg/ml, respectively). This was followed by phenol–chloroform extraction and the DNA was precipitated with 3 M sodium acetate. After washing with 70% ethanol followed by centrifugation, the DNA pellet was allowed to air dry and dissolved in TE buffer (10 mM Tris–HCl, 1 mM EDTA, and pH 8.0). The DNA was quantified and ascertained for purity in a NanoDrop 1000 spectrophotometer (Thermo Scientific) and stored at 4 °C until further use. The complete open reading frames of VP28, VP39 and wsv477 were amplified from the extracted genomic DNA using forward and reverse primers carrying specific restriction sites (Table 1). PCR reactions were carried out in 30 μl volumes, using 1 μl of 100 ng template DNA, and
Shrimp were divided with 10 animals in each experimental group. The experimental shrimp were injected intramuscularly in the third abdominal segment with a single dose of 10 μg of the AS construct (~1 μg/g body weight of the shrimp) using a tuberculin syringe. Additionally, a group of animals were injected with plasmid constructs having only the promoter, pEF, which served as a promoter control. Shrimp that serve as positive and negative controls were injected with 100 μl of sterile saline. All shrimp were challenged with 100 μl of a known concentration of WSSV inoculum (2 × 104 copies) after 48 h of AS administration, whereas the negative control groups were injected with same volume of sterile saline. The shrimp were monitored daily for mortality. 2.5. Statistics The protection conferred was represented as relative percentage survival (RPS, [1 − (mortality in vaccinated group / mortality in control group)] × 100) (Amend, 1981). Survival curve statistical analysis was applied to all groups using the Statistical Package for the Social Sciences (SPSS) version 21. The levels of P b 0.05 applied to the Wilcoxon Gehan statistic were considered significantly different.
Table 1 Primers used for PCR amplification of WSSV genes. WSSV ORF
Primer sequence (5′–3′)
Restriction enzyme
Annealing temperature (°C)
Amplicon size (bp)
Reference
VP28
F- ATGGATCTTTCTTTCACTCTTTC R- TTACTCGGTCTCAGTGCCAGAG F- ATGTCGTCTAACGGAGATGA R- CTAAAAAACAAACAGATTG F- CCCTCACAGGGAAGAGTTCA R- CCATCCACTTGGTTGCAGTA
Sal I EcoRI XbaI HindIII ApaI AvrII
60
615
AF227911
47
852
AY884234
55
477
AF332093
VP39 wsv477
308
D.S. Akhila et al. / Aquaculture 435 (2015) 306–309
3. Results The effect of individual antisense constructs against the three regions of WSSV (VP28, VP39 and wsv477) was administered intramuscularly to each L. vannamei and the protection they offered against WSSV is presented as a time–mortality relationship (Fig. 1). The WSSV positive control and promoter control group (pEF) began dying at 4 days post-vaccination (dpv) with a cumulative mortality of 100% by 9 dpv, and these groups were statistically identical (G = 0.095, P N 0.05). Amongst the three antisense constructs administered, pEFwsv477 showed the highest survival with 90% surviving at 9 dpv and was statistically better than pEF-VP28 (G = 5.10, P b 0.05), but not pEF-VP39 (G = 1.33, P N 0.05). Both pEF-VP28 and pEF-VP39 started dying at 7 dpv. The pEF-VP28 group showed 50% survival, whereas 60% survival was seen on 9 dpv in animals injected with pEF-VP39. Mortality in groups pEF-VP28 and pEF-VP39 reached 100% at 11 and 12 dpv, respectively, and these groups were statistically identical (G = 0.71, P N 0.05). The negative control group showed no mortality. The protective effect of different combinations of antisense constructs against WSSV in L. vannamei was also studied by intramuscular injection followed by challenge after 48 h of vaccination and the resulting time–mortality relationship is shown in Fig. 2. The antisense combination construct pEF-VP39 + wsv477 produced the highest survival of 50% after 13 dpv compared to combination constructs pEFVP28 +VP39 and pEF-VP28 + wsv477, but was only statistically better than pEF-VP28 + VP39 (G = 8.59, P b 0.01). Forty percent of experimental shrimp (pEF-VP39 + wsv477) survived until the end of the 21 day experiment, but it should be noted that all shrimp died by 23 dpv. Relative percent survival of 50 was obtained for pEF-VP28 + VP39 and pEF-VP28 + wsv477 at 10 and 12 dpv, respectively. Across all constructs, those that contained wsv477 either alone or in combination were statistically superior. Total RNA from haemolymph of shrimp injected with empty plasmid vector with and without EF promoter (pEF) was extracted and firststrand of cDNA was generated by reverse transcriptase and PCR performed with promoter specific primer, to determine the expression level of EF promoter in the mRNA. Amplification of EF promoter gene (320 bp) was observed in shrimp injected with plasmid vector having EF promoter (data not shown) which did not provide any significant protection. On the contrary, it followed the same pattern of mortality as in the positive control (Figs. 1 & 2).
4. Discussion A protective effect was observed after delivering antisense constructs individually and in combination against WSSV to Pacific white shrimp L. vannamei. The AS constructs, under the control of EF1α promoter, targeted the envelope proteins VP28, VP39 and a functional protein wsv477. Antisense RNA is a well-established antiviral strategy
Fig. 1. Effect of antisense constructs on survival of WSSV challenged shrimp, L. vannamei. pEF-shrimp injected with EF1α promoter construct (promoter control); positive control — shrimp without antisense construct but challenged with WSSV; negative control — shrimp untreated and unchallenged.
Fig. 2. Effect of different combinations of antisense constructs on survival of WSSV challenged shrimp, L. vannamei. pEF-shrimp injected with EF1α promoter construct (promoter control); positive control — shrimp without antisense construct but challenged with WSSV; negative control — shrimp untreated and unchallenged.
based on the recognition of a specific target in a highly sequencespecific manner to down-regulate target gene expression or to combat viral replication (Lu and Sun, 2005). They reported the application of an antisense construct under the control of shrimp-β-actin promoter targeting Taura syndrome virus (TSV) provided substantial protection to shrimp from infection. The protective effect most likely reflects the sequence-specific degradation of viral transcripts, which are predicted to form dsRNA duplexes in the presence of the antisense RNA (Ahlquist, 2002; Tang et al., 2002), and are targeted by dsRNA-specific nucleases (Dalmay et al., 2000; Mourrain et al., 2000). La Fauce and Owens (2013) used antisense plasmid constructs in live bacterial cells to orally deliver short interfering RNA against the shrimp virus Penaeus merguiensis densovirus, a strain of hepatopancreatic parvovirus, in a cricket model. Later, Ahanger et al. (2014) reported the effect of antisense constructs against WSSV infection in P. monodon both in vivo and in vitro. They used antisense RNA constructs against WSSV ORFs (VP24, VP28, thymidylate synthase and ribonucleotide reductase-2) under the control of constitutive host promoters such as histone3 and penaeidin, and found substantial protection from WSSV infection both in haemocyte cell cultures (derived from P. monodon and Scylla serrata) and experimental P. monodon. Previous studies have shown the envelope protein VP28 to be the most abundant and involved in the systemic infection caused by WSSV (van Hulten et al., 2001). The envelope proteins are the main candidate vaccination molecules because they are the first to interact with the host defence system to stimulate a protective immune response, and are involved in virion morphogenesis and eliciting antiviral mechanisms in the host (Chang et al., 2008; Reske et al., 2007). Ahanger et al. (2014) studied the effect of antisense constructs targeting VP28 gene of WSSV in P. monodon and reported 90% survival of the animals. The results are in agreement with previous studies wherein VP28 was observed to be highly immunogenic and hence a potential vaccine candidate against WSSV infection (Kulkarni et al., 2013; Yumiao et al., 2013). However, it should be noted that all shrimp exposed to WSSV eventually died in our experiments and the relative short time frame of the cited experiments above masks the eventual fate of their experimental animals perhaps leading to an over enthusiastic conclusion. The promising results of our work stem from the novel region coding for VP39 and wsv477 for vaccination against WSSV in crustaceans. These genes had not been considered or trialled prior to this study. The early regulatory gene wsv477 has an ORF of 624 bp encoding a protein of 208 amino acids and contains a presumptive ATP/GTP-binding motif (Han et al., 2007). Early genes mainly encode enzymes required for viral DNA synthesis and a number of proteins that can regulate the expression of late genes (Sanchez-Paz, 2010). In our study, the antisense constructs targeting the wsv477 gene were statistically superior for protection, both alone and in combination as pEF-VP28 + wsv477 and pEF-VP39 + wsv477. There was also a protective effect observed with antisense pEF-VP39, which was statistically similar to pEFwsv477 alone. The vp39 gene is 852 bp long and encodes 283 amino acids. Temporal analysis of vp39 gene expression showed it to be
D.S. Akhila et al. / Aquaculture 435 (2015) 306–309
expressed after 12 h of viral infection, and its presence was observed in both virions and the viral envelop (Zhu et al., 2006). While 90% protection by the antisense construct in P. monodon was reported by Ahanger et al. (2014) with the challenge dose of 1 × 103 WSSV, in our study on L. vannamei, 60% protection at day 9 was registered with a challenge dose of 2 × 104 copies. There may be a link between the protections offered versus the WSSV challenge dose. Variation in the shrimp species used for the experiment may also be a contributing factor. 5. Conclusion The protection conferred by antisense plasmid constructs targeting genes VP28, VP39 and wsv477 of WSSV was studied in Pacific white shrimp, L. vannamei. The AS plasmids, both individually and in combination, offered protection to the L. vannamei against WSSV. The promising results of our work hinge on the novel region coding for VP39 and wsv477, since the AS construct against wsv477 gene was statistically superior for protection, alone and in combination (pEF-VP28 + wsv477 and pEF-VP39 + wsv477). Also, the protective efficacy of antisense pEF-VP39 was statistically similar to pEF-wsv477 alone. The AS plasmid construct is known to integrate or self replicate inside the host where the promoter transcribes the downstream gene segment (3′–5′ orientation) to form single stranded mRNA complementary to the transcript of gene of interest (in the host). This antisense mRNA transcript would bind to the complementary mRNA, thus blocking the target gene expression. The advantage of the AS plasmid vector construct is the ease of production, purification and administration to the animal by injection. Although these results clearly demonstrate the potential of AS constructs to protect against WSSV infection, field trials must be performed to validate the performance of the treatment. Acknowledgements The authors are grateful for the financial support provided through the Australia–India Strategic Research Fund (BT/Indo-Aus/05/19/2010 and BF050090) for carrying out the research on shrimp viruses. References Ahanger, S., Sandaka, S., Ananad, D., Mani, M.K., Kondadhasula, R., Reddy, C.S., Marappan, M., Valappil, R.K., Majumdar, K.C., Mishra, R.K., 2014. Protection of shrimp Penaeus monodon from WSSV infection using antisense constructs. Mar. Biotechnol. 16, 63–73. Ahlquist, P., 2002. RNA-dependent RNA polymerases, viruses, and RNA silencing. Science 296, 1270–1273. Amend, D.F., 1981. Potency testing of fish vaccines. Dev. Biol. Stand. 49, 447–454. Chang, Y.S., Liu, W.J., Chou, T.L., Lee, Y.T., Lee, T.L., Huang, W.T., Kou, G.H., Lo, C.F., 2008. Characterization of white spot syndrome virus envelope protein VP51A and its interaction with viral tegument protein VP26. J. Virol. 82, 12555–12564. Charoensapsri, W., Amparyup, P., Hirono, I., Aoki, T., Tassanakajon, A., 2009. Gene silencing of a prophenoloxidase activating enzyme in the shrimp, Penaeus monodon, increases susceptibility to Vibrio harveyi infection. Dev. Comp. Immunol. 33, 811–820. Chazal, N., Gerlier, D., 2003. Virus entry, assembly, budding, and membrane rafts. Microbiol. Mol. Biol. Rev. 67, 226–237. Chiu, W.L., Chang, W., 2002. Vaccinia virus J1R protein: a viral membrane protein that is essential for virion morphogenesis. J. Virol. 76, 9575–9587. Choi, Mi Ran, Yeong, Jin Kim, Jang, Ji-Suk, Kim, Sung-Koo, 2011. Transcriptional analysis for oral vaccination of recombinant viral proteins against white spot syndrome virus (WSSV) in Litopenaeus vannamei. J. Microbiol. Biotechnol. 21, 170–175. Dalmay, T., Hamilton, A., Rudd, S., Angell, S., Baulcombe, D.C., 2000. An RNA-dependent RNA polymerase gene in Arabidopsis is required for post-transcriptional gene silencing mediated by a transgene but not by a virus. Cell 101, 543–553. Du, H., Linglin, Fu, Xu, Yaxiang, Kil, Zongsu, Xu, Zirong, 2007. Improvement in a simple method for isolating white spot syndrome virus (WSSV) from the crayfish Procambarus clarkii. Aquaculture 262, 532–534. Durand, S., Lightner, D.V., Nunan, L.M., Redman, R.M., Mari, J., Bonami, J.R., 1996. Application of gene probes as diagnostic tools for white spot baculovirus of penaeid shrimp. Dis. Aquat. Org. 27, 59–66. Escobedo-Bonilla, C.M., 2011. Application of RNA interference (RNAi) against viral infections in shrimp: a review. J. Antivir. Antiretrovir. S9 http://dx.doi.org/10.4172/jaa. S9-001. Escobedo-Bonilla, C.M., Alday-sanza, V., Ville, M., Sorgeloos, P., Pensaert, M.B., Nauwynck, H.J., 2008. A review on the morphology, molecular characterization, mophogenesis and pathogenesis of White spot syndrome virus. J. Fish Dis. 31, 1–18.
309
FAO, 2010. The State of World Fisheries and Aquaculture. FAO, Rome, p. 197. Flegel, T.W., 2007. Update on viral accommodation, a model for host−viral interaction in shrimp and other arthropods. Dev. Comp. Immunol. 31, 217–231. Han, F., Xu, J., Zhang, X., 2007. Characterization of an early gene (wsv477) from shrimp white spot syndrome virus (WSSV). Virus Genes 34, 193–198. Hossain, M.S., Chakraborty, A., Joseph, B., Otta, S.K., Karunasagar, I., Karunasagar, I., 2001. Detection of new hosts for white spot syndrome virus of shrimp using nested polymerase chain reaction. Aquaculture 198, 1–11. Karunasagar, I., Otta, S.K., Karunasagar, I., 1997. Histopathological and bacteriological study of white spot syndrome of Penaeus monodon along the west coast of India. Aquaculture 153, 9–13. Krishnan, P., Babu, P.G., Saravanan, S., Rajendran, K.V., Chaudhari, A., 2009. DNA constructs expressing long-hairpin RNA (lhRNA) protect Penaeus monodon against white spot syndrome virus. Vaccine 27, 3849–3855. Kulkarni, A., Rombout, J.H.W.M., Singh, I.S.B., Sudheer, N.S., Vlak, J.M., Caipang, C.M.A., Brinchmann, M.F., Kiron, V., 2013. Truncated VP28 as oral vaccine candidate against WSSV infection in shrimp: an uptake and processing study in the midgut of Penaeus monodon. Fish Shellfish Immunol. 34, 159–166. La Fauce, K., Owens, L., 2013. Suppression of Penaeus merguiensis densovirus following oral delivery of live bacteria expressing dsRNA in the house cricket (Acheta domesticus) model. J. Invertebr. Pathol. 112, 162–165. Labreuche, Y., O'Leary, N.A., de la Vega, E., Veloso, A., Gross, P.S., Chapman, R.W., Browdy, C.L., Warr, G.W., 2009. Lack of evidence for Litopenaeus vannamei Toll receptor (lToll) involvement in activation of sequence-independent antiviral immunity in shrimp. Dev. Comp. Immunol. 33, 806–810. Lightner, D.V., 1999. The penaeid shrimp viruses TSV, IHHND, WSSV, and YHV. J. Appl. Aquac. 9, 27–52. Lu, Y., Sun, P.S., 2005. Viral resistance in shrimp that express an antisense Taura syndrome virus coat protein gene. Antiviral Res. 67, 141–146. Mohan, S.A., 2012. Development of Molecular Based Diagnostics for Simultaneous Detection of Viruses of CrustaceansPhD thesis Karnataka Veterinary, Animal and Fisheries Sciences University, India. Mourrain, P., Beclin, C., Elmagan, T., Feuerbach, F., Godon, C., Morel, J.B., Jouette, D., Lacombe, A.M., Nikic, S., Picault, N., Remoue, K., Sanial, M., Vo, T.A., Vaucheret, H., 2000. Arabidopsis SGS2 and SGS3 genes are required for posttranscriptional gene silencing and natural virus resistance. Cell 101, 533–542. Otta, S.K., Shubha, G., Joseph, B., Chakraborthy, A., Karunasagar, I., Karunasagar, I., 1999. Polymerase chain reaction (PCR) detection of white spot syndrome virus (WSSV) in cultured and wild crustaceans in India. Dis. Aquat. Org. 38, 67–70. Otta, S.K., Karunasagar, I., Karunasagar, I., 2003. Detection of monodon baculovirus and white spot syndrome virus in apparently healthy Penaeus monodon postlarvae from India by polymerase chain reaction. Aquaculture 220, 59–67. Pradeep, B., Rai, P., Mohan, S.A., Shekhar, M.S., Karunasagar, I., 2012. Biology, host range, pathogenesis and diagnosis of white spot syndrome virus. Indian J Virol. 23, 161–174. Reske, A., Pollara, G., Krummenacher, C., Chain, B.M., Katz, D.R., 2007. Understanding HSV1 entry glycoproteins. Rev. Med. Virol. 17, 205–215. Rijiravanich, A., Browdy, C.L., Withyachumnarnkul, B., 2008. Knocking down caspase-3 by RNAi reduces mortality in Pacific white shrimp Penaeus (Litopenaeus) vannamei challenged with a low dose of white-spot syndrome virus. Fish Shellfish Immunol. 24, 308–313. Sanchez-Paz, A., 2010. White spot syndrome virus: an overview on an emergent concern. Vet. Res. 41, 43. Sarathi, M., Simon, M.C., Venkatesan, C., Thomas, J., Ravi, M., Madan, N., Thiyagarajan, S., Sahul Hameed, A.S., 2010. Efficacy of bacterially expressed dsRNA specific to different structural genes of white spot syndrome virus (WSSV) in protection of shrimp from WSSV infection. J. Fish Dis. 33, 603–607. Syed Musthaq, S., Kwang, J., 2011. Oral vaccination of baculovirus-expressed VP28 displays enhanced protection against white spot syndrome virus in Penaeus monodon. PLoS ONE 6, e26428. http://dx.doi.org/10.1371/journal.pone.0026428. Tang, W., Luo, X.Y., Sanmuels, V., 2002. Gene silencing: double-stranded RNA mediated mRNA degradation and gene inactivation. Cell Res. 11, 181–186. Tsai, J.M., Wang, H.C., Leu, J.H., Wang, A.H., Zhuang, Y., Walker, P.J., Kou, G.H., Lo, C.F., 2006. Identification of the nucleocapsid, tegument, and envelope proteins of the shrimp white spot syndrome virus virion. J. Virol. 80, 3021–3029. van Hulten, M.C.W., Witteveldt, J., Peters, S., Kloosterboer, N., Tarchini, R., Fiers, M., Sandbrink, H., Lankhorst, R.K., Vlak, J.M., 2001. The white spot syndrome virus DNA genome sequence. J. Virol. 286, 7–22. Venegas, C.A., Nonaka, L., Mushiake, K., Nishizawa, T., Muroga, K., 2000. Quasi-immune response of Penaeus japonicus to penaeid rod-shaped DNA virus (PRDV). Dis. Aquat. Org. 42, 83–89. Wongteerasupaya, C., Vickers, J.E., Sriurairatanas, Nash, G.L., Alarajamorn, A., Boonsaeng, V., 1995. A non-occluded, systemic baculovirus that occurs in cells of ectodermal and mesodermal origin and causes high mortality in the black tiger prawn Penaeus monodon. Dis. Aquat. Org. 21, 69–77. Wu, W., Zhang, X., 2007. Characterization of a Rab GTPase up-regulated in the shrimp Peneaus japonicus by virus infection. Fish Shellfish Immunol. 23, 438–445. Yumiao, S., Fuhua, L., Yanhong, C., Jianhai, X., 2013. Enhanced resistance of marine shrimp Exopalamon carincauda Holthuis to WSSV by injecting live VP28-recombinant bacteria. Acta Oceanol. Sin. 32, 52–58. Zhu, F., Zhang, X., 2012. Protection of shrimp against white spot syndrome virus (WSSV) with β-1,3- D -glucan-encapsulated vp28-siRNA particles. Mar. Biotechnol. 14, 63–68. Zhu, Y.B., Li, H.Y., Yang, F., 2006. Identification of an envelope protein (VP39) gene from shrimp white spot syndrome virus. Arch. Virol. 151, 71–82.
Contents lists available at ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aqua-online
Antisense RNA mediated protection from white spot syndrome virus (WSSV) infection in Pacific white shrimp Litopenaeus vannamei Dharnappa Sannejal Akhila a, Madhu K. Mani a, Praveen Rai a,1, Kelly Condon b, Leigh Owens b, Indrani Karunasagar a,⁎ a b
Department of Fisheries Microbiology, UNESCO-MIRCEN for Marine Biotechnology, Karnataka Veterinary, Animal and Fisheries Sciences University, College of Fisheries, Mangalore 575002, India Microbiology and Immunology, School of Veterinary and Biomedical Sciences, 1 Solander Drive, James Cook University, Townsville 4811, Queensland, Australia
a r t i c l e
i n f o
Article history: Received 27 June 2014 Received in revised form 24 September 2014 Accepted 4 October 2014 Available online 12 October 2014 Keywords: Litopenaeus vannamei WSSV Antisense VP39 wsv477
a b s t r a c t Antisense (AS) plasmid constructs were used to target genes VP28, VP39 and wsv477 of white spot syndrome virus (WSSV) in the Pacific white shrimp Litopenaeus vannamei, and subsequent protection from the virus was investigated. PCR amplified products of the targeted viral ORFs were cloned downstream in antisense orientation (3′–5′) into a plasmid vector having elongation factor 1α (EF1α) promoter. Shrimp were injected with the AS plasmids intramuscularly followed by a challenge with WSSV. The AS plasmids administered individually (pEF-VP28, pEF-VP39 and pEF-wsv477) and in combinations (pEF-VP28 + VP39, pEF-VP28 + wsv477, pEFVP39 + wsv477) provided significant protection to the L. vannamei against WSSV. Mortality began in the positive and promoter control groups on day three of viral challenge and reached 100% by day nine. The shrimp injected with AS plasmid of VP28, VP39 and wsv477 showed survival rate of 50%, 60% and 90% respectively, in comparison with the control groups at 9 days post infection (dpi). The AS constructs targeting the early regulatory gene wsv477 produced statistically superior protection against WSSV, both alone and in combination as pEFVP28 + wsv477 and pEF-VP39 + wsv477. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Shrimp aquaculture is vital because it provides high quality protein for human consumption and boosts nutritional security in developing countries via generation of employment amongst the poor/low income strata (FAO, 2010). Though shrimp are susceptible to infection by various pathogens, viruses pose the largest threat to shrimp farming (Lightner, 1999). White spot syndrome virus (WSSV) remains to date the most dreaded pathogen for the shrimp aquaculture industry worldwide since its emergence in 1992 (Escobedo-Bonilla, 2011). WSSV is an enveloped, non-occluded, bacilliform virus with a tail-like appendage at one end (Durand et al., 1996; Wongteerasupaya et al., 1995). The viral genome is a circular double-stranded DNA of approximately 300 kb with about 185 open reading frames (van Hulten et al., 2001) comprising both structural and envelope proteins (Syed Musthaq and Kwang, 2011). WSSV has a broad host range including several penaeid shrimp species, Caribbean shrimp, lobsters, crayfish, crabs and aquatic insects
⁎ Corresponding author at: UNESCO-MIRCEN for Medical and Marine Biotechnology, Nitte University Centre for Science Education and Research (NUCSER), Nitte University, Mangalore 575018, India. Tel.: +91 824 2204490; fax: +91 824 2204162. E-mail address: [email protected] (I. Karunasagar). 1 Present address: UNESCO-MIRCEN for Medical and Marine Biotechnology, Nitte University Centre for Science Education and Research (NUCSER), Nitte University, Mangalore 575018, India.
http://dx.doi.org/10.1016/j.aquaculture.2014.10.005 0044-8486/© 2014 Elsevier B.V. All rights reserved.
(Otta et al., 1999; Hossain et al., 2001; Escobedo-Bonilla et al., 2008; Mohan, 2012; Pradeep et al., 2012). Mortality can reach 100% mortality within 3–10 days after onset of clinical signs (Karunasagar et al., 1997). Even though invertebrates do not possess a defence system like that seen in vertebrate immunology, a “quasi-immune response” was reported in Penaeus japonicus, pointing to the existence of primitive immune memory in shrimp (Venegas et al., 2000). Another hypothesis, “the viral accommodation” theory, conceptualizes that many invertebrates, including crustaceans, possess tolerance which involves specific memory to prevent viral triggered apoptosis, and this tolerance can occur at all life stages of a host species (Flegel, 2007). These concepts have led to the application of different strategies to protect animals from WSSV, ranging from delivery of envelope proteins and recombinant proteins to small interfering RNA (siRNA), double stranded RNA (dsRNA) and long-hairpin RNA (lhRNA) (Choi et al., 2011; Krishnan et al., 2009; Sarathi et al., 2010; Yumiao et al., 2013; Zhu and Zhang, 2012). RNAi has been used to determine the function of various genes of shrimp that are involved in viral infection. Escobedo-Bonilla (2011) summarized the role of different shrimp proteins in antiviral immunity brought about by RNAi silencing mechanisms such as toll-like receptor (Labreuche et al., 2009), Rab7-like proteins that participate in virus entry (Wu and Zhang, 2007), caspase-3 protein involved in apoptosis (Rijiravanich et al., 2008) and proPO activity (Charoensapsri et al., 2009). The use of antisense constructs under the control of a constitutive promoter for combating WSSV infection in Penaeus monodon was
D.S. Akhila et al. / Aquaculture 435 (2015) 306–309
recently reported by Ahanger et al. (2014), who observed that it could elicit good protection in WSSV challenged shrimp. Viral envelope and coat proteins are ideal targets for vaccination studies as they are the first to interact with the host cell and play vital roles in entry and multiplication of the virus inside the host (Chazal and Gerlier, 2003; Chiu and Chang, 2002). A preliminary study to investigate the protective effect of delivering different antisense constructs encoding envelope proteins VP28 and VP39, and wsv477 to shrimp infected with WSSV was undertaken. The ORF 421 encodes the most prominent coat protein, VP28, which is involved in the systemic infection of WSSV (van Hulten et al., 2001). This protein has been extensively studied as a candidate for vaccination to protect shrimp against WSSV infection. Another envelope protein, VP39, was identified as an integument protein (Tsai et al., 2006) and wsv477 was reported as an early gene with GTP-binding activity (Han et al., 2007). There is little information on the use of VP39 and wsv477 as vaccine candidates for protecting against WSSV infection in shrimp. This study shows the efficiency of antisense plasmid constructs VP39 and wsv477 in comparison to the extensively studied VP28 against WSSV infection in the Pacific white shrimp Litopenaeus vannamei. 2. Materials and methods 2.1. Collection and maintenance of experimental shrimp Healthy L. vannamei (8–10 g body weight) were collected from an aquaculture farm near Mangalore, Karnataka. The shrimp were maintained in 1000 l fibreglass tanks in natural seawater (salinity range of 20–25 ppt) at ambient temperature (27–30 °C) with aeration and were fed with commercial pelleted feed (CP aqua, Chennai). Temperature, pH, salinity, and dissolved oxygen were recorded on daily basis. The shrimp were healthy and confirmed negative for WSSV by PCR (Otta et al., 2003).
307
35 cycles were carried out at the respective annealing temperature for 30 s (Table 1). The resulting PCR product was electrophoresed in 1.5% agarose gel, double digested with the respective restriction enzymes and cloned in pDrive vector (Qiagen) in antisense orientation (3′–5′ direction), downstream to EF1α promoter. The recombinant vector was transformed into competent Escherichia coli DH5α cells by heat shock at 42 °C for 90 s and plated on Luria–Bertani (LB) agar containing ampicillin (100 μg/ml). The colonies were screened the following day by subjecting the clones to PCR using gene specific primers. The plasmids extracted from the positive clones were designated pEF-VP28, pEFVP39, pEF-wsv477, pEF-VP28 + VP39, pEF-VP28 + wsv477 and pEFVP39 + wsv477. 2.3. Preparation of viral inoculum WSSV infected P. monodon with prominent white spots were collected from shrimp farms and the virus extracted according to Du et al. (2007) with slight modification. Briefly, gill tissues from infected P. monodon were homogenized in TN buffer (0.2 M Tris–HCl, 0.4 M NaCl, pH 7.4), followed by centrifugation at 5000 ×g for 20 min. The supernatant was filtered through a 0.45 μm filter and stored at −80 °C for further use. Quantitative real time PCR was performed to calculate the virus copies in the stock using the standard curve. The real time PCR assay was carried out with SYBR Green PCR Master Mix (Roche), 2.5 pm of each primer, and 1 μl of the diluted viral DNA sample as template. Amplification was performed with the following programme: 2 min for uracil N-glycosylase (UNG) activation at 50 °C and activation of the AmpliTaq for 10 min at 95 °C, 40 cycles of 15 s at 95 °C, 45 s at 55 °C, and an extension of 72 °C for 30 s. All samples were run in triplicate with a non-template negative control. With an optimal PCR mixture, the WSSV quantity in the viral inoculum contained an average of 7.5 × 108 copies per microlitre (data not shown). 2.4. Delivery of antisense (AS) constructs and WSSV challenge
2.2. Genomic DNA extraction and synthesis of antisense plasmid constructs The genomic DNA from the WSSV infected L. vannamei collected from an infected farm in Kundapur was extracted according to Otta et al. (2003) with some modification. Briefly, haemolymph was collected from the shrimp using a tuberculin syringe containing anticoagulant (0.5 M EDTA), and centrifuged at 5000 × g for 10 min at 4 °C. The resulting haemocyte pellet was treated with lysis buffer (10 mM Tris– HCl, 1 mM EDTA, 0.1 M NaCl), and incubated for 3 h at 50 °C with 20% SDS and proteinase K (final concentration of 1% and 100 μg/ml, respectively). This was followed by phenol–chloroform extraction and the DNA was precipitated with 3 M sodium acetate. After washing with 70% ethanol followed by centrifugation, the DNA pellet was allowed to air dry and dissolved in TE buffer (10 mM Tris–HCl, 1 mM EDTA, and pH 8.0). The DNA was quantified and ascertained for purity in a NanoDrop 1000 spectrophotometer (Thermo Scientific) and stored at 4 °C until further use. The complete open reading frames of VP28, VP39 and wsv477 were amplified from the extracted genomic DNA using forward and reverse primers carrying specific restriction sites (Table 1). PCR reactions were carried out in 30 μl volumes, using 1 μl of 100 ng template DNA, and
Shrimp were divided with 10 animals in each experimental group. The experimental shrimp were injected intramuscularly in the third abdominal segment with a single dose of 10 μg of the AS construct (~1 μg/g body weight of the shrimp) using a tuberculin syringe. Additionally, a group of animals were injected with plasmid constructs having only the promoter, pEF, which served as a promoter control. Shrimp that serve as positive and negative controls were injected with 100 μl of sterile saline. All shrimp were challenged with 100 μl of a known concentration of WSSV inoculum (2 × 104 copies) after 48 h of AS administration, whereas the negative control groups were injected with same volume of sterile saline. The shrimp were monitored daily for mortality. 2.5. Statistics The protection conferred was represented as relative percentage survival (RPS, [1 − (mortality in vaccinated group / mortality in control group)] × 100) (Amend, 1981). Survival curve statistical analysis was applied to all groups using the Statistical Package for the Social Sciences (SPSS) version 21. The levels of P b 0.05 applied to the Wilcoxon Gehan statistic were considered significantly different.
Table 1 Primers used for PCR amplification of WSSV genes. WSSV ORF
Primer sequence (5′–3′)
Restriction enzyme
Annealing temperature (°C)
Amplicon size (bp)
Reference
VP28
F- ATGGATCTTTCTTTCACTCTTTC R- TTACTCGGTCTCAGTGCCAGAG F- ATGTCGTCTAACGGAGATGA R- CTAAAAAACAAACAGATTG F- CCCTCACAGGGAAGAGTTCA R- CCATCCACTTGGTTGCAGTA
Sal I EcoRI XbaI HindIII ApaI AvrII
60
615
AF227911
47
852
AY884234
55
477
AF332093
VP39 wsv477
308
D.S. Akhila et al. / Aquaculture 435 (2015) 306–309
3. Results The effect of individual antisense constructs against the three regions of WSSV (VP28, VP39 and wsv477) was administered intramuscularly to each L. vannamei and the protection they offered against WSSV is presented as a time–mortality relationship (Fig. 1). The WSSV positive control and promoter control group (pEF) began dying at 4 days post-vaccination (dpv) with a cumulative mortality of 100% by 9 dpv, and these groups were statistically identical (G = 0.095, P N 0.05). Amongst the three antisense constructs administered, pEFwsv477 showed the highest survival with 90% surviving at 9 dpv and was statistically better than pEF-VP28 (G = 5.10, P b 0.05), but not pEF-VP39 (G = 1.33, P N 0.05). Both pEF-VP28 and pEF-VP39 started dying at 7 dpv. The pEF-VP28 group showed 50% survival, whereas 60% survival was seen on 9 dpv in animals injected with pEF-VP39. Mortality in groups pEF-VP28 and pEF-VP39 reached 100% at 11 and 12 dpv, respectively, and these groups were statistically identical (G = 0.71, P N 0.05). The negative control group showed no mortality. The protective effect of different combinations of antisense constructs against WSSV in L. vannamei was also studied by intramuscular injection followed by challenge after 48 h of vaccination and the resulting time–mortality relationship is shown in Fig. 2. The antisense combination construct pEF-VP39 + wsv477 produced the highest survival of 50% after 13 dpv compared to combination constructs pEFVP28 +VP39 and pEF-VP28 + wsv477, but was only statistically better than pEF-VP28 + VP39 (G = 8.59, P b 0.01). Forty percent of experimental shrimp (pEF-VP39 + wsv477) survived until the end of the 21 day experiment, but it should be noted that all shrimp died by 23 dpv. Relative percent survival of 50 was obtained for pEF-VP28 + VP39 and pEF-VP28 + wsv477 at 10 and 12 dpv, respectively. Across all constructs, those that contained wsv477 either alone or in combination were statistically superior. Total RNA from haemolymph of shrimp injected with empty plasmid vector with and without EF promoter (pEF) was extracted and firststrand of cDNA was generated by reverse transcriptase and PCR performed with promoter specific primer, to determine the expression level of EF promoter in the mRNA. Amplification of EF promoter gene (320 bp) was observed in shrimp injected with plasmid vector having EF promoter (data not shown) which did not provide any significant protection. On the contrary, it followed the same pattern of mortality as in the positive control (Figs. 1 & 2).
4. Discussion A protective effect was observed after delivering antisense constructs individually and in combination against WSSV to Pacific white shrimp L. vannamei. The AS constructs, under the control of EF1α promoter, targeted the envelope proteins VP28, VP39 and a functional protein wsv477. Antisense RNA is a well-established antiviral strategy
Fig. 1. Effect of antisense constructs on survival of WSSV challenged shrimp, L. vannamei. pEF-shrimp injected with EF1α promoter construct (promoter control); positive control — shrimp without antisense construct but challenged with WSSV; negative control — shrimp untreated and unchallenged.
Fig. 2. Effect of different combinations of antisense constructs on survival of WSSV challenged shrimp, L. vannamei. pEF-shrimp injected with EF1α promoter construct (promoter control); positive control — shrimp without antisense construct but challenged with WSSV; negative control — shrimp untreated and unchallenged.
based on the recognition of a specific target in a highly sequencespecific manner to down-regulate target gene expression or to combat viral replication (Lu and Sun, 2005). They reported the application of an antisense construct under the control of shrimp-β-actin promoter targeting Taura syndrome virus (TSV) provided substantial protection to shrimp from infection. The protective effect most likely reflects the sequence-specific degradation of viral transcripts, which are predicted to form dsRNA duplexes in the presence of the antisense RNA (Ahlquist, 2002; Tang et al., 2002), and are targeted by dsRNA-specific nucleases (Dalmay et al., 2000; Mourrain et al., 2000). La Fauce and Owens (2013) used antisense plasmid constructs in live bacterial cells to orally deliver short interfering RNA against the shrimp virus Penaeus merguiensis densovirus, a strain of hepatopancreatic parvovirus, in a cricket model. Later, Ahanger et al. (2014) reported the effect of antisense constructs against WSSV infection in P. monodon both in vivo and in vitro. They used antisense RNA constructs against WSSV ORFs (VP24, VP28, thymidylate synthase and ribonucleotide reductase-2) under the control of constitutive host promoters such as histone3 and penaeidin, and found substantial protection from WSSV infection both in haemocyte cell cultures (derived from P. monodon and Scylla serrata) and experimental P. monodon. Previous studies have shown the envelope protein VP28 to be the most abundant and involved in the systemic infection caused by WSSV (van Hulten et al., 2001). The envelope proteins are the main candidate vaccination molecules because they are the first to interact with the host defence system to stimulate a protective immune response, and are involved in virion morphogenesis and eliciting antiviral mechanisms in the host (Chang et al., 2008; Reske et al., 2007). Ahanger et al. (2014) studied the effect of antisense constructs targeting VP28 gene of WSSV in P. monodon and reported 90% survival of the animals. The results are in agreement with previous studies wherein VP28 was observed to be highly immunogenic and hence a potential vaccine candidate against WSSV infection (Kulkarni et al., 2013; Yumiao et al., 2013). However, it should be noted that all shrimp exposed to WSSV eventually died in our experiments and the relative short time frame of the cited experiments above masks the eventual fate of their experimental animals perhaps leading to an over enthusiastic conclusion. The promising results of our work stem from the novel region coding for VP39 and wsv477 for vaccination against WSSV in crustaceans. These genes had not been considered or trialled prior to this study. The early regulatory gene wsv477 has an ORF of 624 bp encoding a protein of 208 amino acids and contains a presumptive ATP/GTP-binding motif (Han et al., 2007). Early genes mainly encode enzymes required for viral DNA synthesis and a number of proteins that can regulate the expression of late genes (Sanchez-Paz, 2010). In our study, the antisense constructs targeting the wsv477 gene were statistically superior for protection, both alone and in combination as pEF-VP28 + wsv477 and pEF-VP39 + wsv477. There was also a protective effect observed with antisense pEF-VP39, which was statistically similar to pEFwsv477 alone. The vp39 gene is 852 bp long and encodes 283 amino acids. Temporal analysis of vp39 gene expression showed it to be
D.S. Akhila et al. / Aquaculture 435 (2015) 306–309
expressed after 12 h of viral infection, and its presence was observed in both virions and the viral envelop (Zhu et al., 2006). While 90% protection by the antisense construct in P. monodon was reported by Ahanger et al. (2014) with the challenge dose of 1 × 103 WSSV, in our study on L. vannamei, 60% protection at day 9 was registered with a challenge dose of 2 × 104 copies. There may be a link between the protections offered versus the WSSV challenge dose. Variation in the shrimp species used for the experiment may also be a contributing factor. 5. Conclusion The protection conferred by antisense plasmid constructs targeting genes VP28, VP39 and wsv477 of WSSV was studied in Pacific white shrimp, L. vannamei. The AS plasmids, both individually and in combination, offered protection to the L. vannamei against WSSV. The promising results of our work hinge on the novel region coding for VP39 and wsv477, since the AS construct against wsv477 gene was statistically superior for protection, alone and in combination (pEF-VP28 + wsv477 and pEF-VP39 + wsv477). Also, the protective efficacy of antisense pEF-VP39 was statistically similar to pEF-wsv477 alone. The AS plasmid construct is known to integrate or self replicate inside the host where the promoter transcribes the downstream gene segment (3′–5′ orientation) to form single stranded mRNA complementary to the transcript of gene of interest (in the host). This antisense mRNA transcript would bind to the complementary mRNA, thus blocking the target gene expression. The advantage of the AS plasmid vector construct is the ease of production, purification and administration to the animal by injection. Although these results clearly demonstrate the potential of AS constructs to protect against WSSV infection, field trials must be performed to validate the performance of the treatment. Acknowledgements The authors are grateful for the financial support provided through the Australia–India Strategic Research Fund (BT/Indo-Aus/05/19/2010 and BF050090) for carrying out the research on shrimp viruses. References Ahanger, S., Sandaka, S., Ananad, D., Mani, M.K., Kondadhasula, R., Reddy, C.S., Marappan, M., Valappil, R.K., Majumdar, K.C., Mishra, R.K., 2014. Protection of shrimp Penaeus monodon from WSSV infection using antisense constructs. Mar. Biotechnol. 16, 63–73. Ahlquist, P., 2002. RNA-dependent RNA polymerases, viruses, and RNA silencing. Science 296, 1270–1273. Amend, D.F., 1981. Potency testing of fish vaccines. Dev. Biol. Stand. 49, 447–454. Chang, Y.S., Liu, W.J., Chou, T.L., Lee, Y.T., Lee, T.L., Huang, W.T., Kou, G.H., Lo, C.F., 2008. Characterization of white spot syndrome virus envelope protein VP51A and its interaction with viral tegument protein VP26. J. Virol. 82, 12555–12564. Charoensapsri, W., Amparyup, P., Hirono, I., Aoki, T., Tassanakajon, A., 2009. Gene silencing of a prophenoloxidase activating enzyme in the shrimp, Penaeus monodon, increases susceptibility to Vibrio harveyi infection. Dev. Comp. Immunol. 33, 811–820. Chazal, N., Gerlier, D., 2003. Virus entry, assembly, budding, and membrane rafts. Microbiol. Mol. Biol. Rev. 67, 226–237. Chiu, W.L., Chang, W., 2002. Vaccinia virus J1R protein: a viral membrane protein that is essential for virion morphogenesis. J. Virol. 76, 9575–9587. Choi, Mi Ran, Yeong, Jin Kim, Jang, Ji-Suk, Kim, Sung-Koo, 2011. Transcriptional analysis for oral vaccination of recombinant viral proteins against white spot syndrome virus (WSSV) in Litopenaeus vannamei. J. Microbiol. Biotechnol. 21, 170–175. Dalmay, T., Hamilton, A., Rudd, S., Angell, S., Baulcombe, D.C., 2000. An RNA-dependent RNA polymerase gene in Arabidopsis is required for post-transcriptional gene silencing mediated by a transgene but not by a virus. Cell 101, 543–553. Du, H., Linglin, Fu, Xu, Yaxiang, Kil, Zongsu, Xu, Zirong, 2007. Improvement in a simple method for isolating white spot syndrome virus (WSSV) from the crayfish Procambarus clarkii. Aquaculture 262, 532–534. Durand, S., Lightner, D.V., Nunan, L.M., Redman, R.M., Mari, J., Bonami, J.R., 1996. Application of gene probes as diagnostic tools for white spot baculovirus of penaeid shrimp. Dis. Aquat. Org. 27, 59–66. Escobedo-Bonilla, C.M., 2011. Application of RNA interference (RNAi) against viral infections in shrimp: a review. J. Antivir. Antiretrovir. S9 http://dx.doi.org/10.4172/jaa. S9-001. Escobedo-Bonilla, C.M., Alday-sanza, V., Ville, M., Sorgeloos, P., Pensaert, M.B., Nauwynck, H.J., 2008. A review on the morphology, molecular characterization, mophogenesis and pathogenesis of White spot syndrome virus. J. Fish Dis. 31, 1–18.
309
FAO, 2010. The State of World Fisheries and Aquaculture. FAO, Rome, p. 197. Flegel, T.W., 2007. Update on viral accommodation, a model for host−viral interaction in shrimp and other arthropods. Dev. Comp. Immunol. 31, 217–231. Han, F., Xu, J., Zhang, X., 2007. Characterization of an early gene (wsv477) from shrimp white spot syndrome virus (WSSV). Virus Genes 34, 193–198. Hossain, M.S., Chakraborty, A., Joseph, B., Otta, S.K., Karunasagar, I., Karunasagar, I., 2001. Detection of new hosts for white spot syndrome virus of shrimp using nested polymerase chain reaction. Aquaculture 198, 1–11. Karunasagar, I., Otta, S.K., Karunasagar, I., 1997. Histopathological and bacteriological study of white spot syndrome of Penaeus monodon along the west coast of India. Aquaculture 153, 9–13. Krishnan, P., Babu, P.G., Saravanan, S., Rajendran, K.V., Chaudhari, A., 2009. DNA constructs expressing long-hairpin RNA (lhRNA) protect Penaeus monodon against white spot syndrome virus. Vaccine 27, 3849–3855. Kulkarni, A., Rombout, J.H.W.M., Singh, I.S.B., Sudheer, N.S., Vlak, J.M., Caipang, C.M.A., Brinchmann, M.F., Kiron, V., 2013. Truncated VP28 as oral vaccine candidate against WSSV infection in shrimp: an uptake and processing study in the midgut of Penaeus monodon. Fish Shellfish Immunol. 34, 159–166. La Fauce, K., Owens, L., 2013. Suppression of Penaeus merguiensis densovirus following oral delivery of live bacteria expressing dsRNA in the house cricket (Acheta domesticus) model. J. Invertebr. Pathol. 112, 162–165. Labreuche, Y., O'Leary, N.A., de la Vega, E., Veloso, A., Gross, P.S., Chapman, R.W., Browdy, C.L., Warr, G.W., 2009. Lack of evidence for Litopenaeus vannamei Toll receptor (lToll) involvement in activation of sequence-independent antiviral immunity in shrimp. Dev. Comp. Immunol. 33, 806–810. Lightner, D.V., 1999. The penaeid shrimp viruses TSV, IHHND, WSSV, and YHV. J. Appl. Aquac. 9, 27–52. Lu, Y., Sun, P.S., 2005. Viral resistance in shrimp that express an antisense Taura syndrome virus coat protein gene. Antiviral Res. 67, 141–146. Mohan, S.A., 2012. Development of Molecular Based Diagnostics for Simultaneous Detection of Viruses of CrustaceansPhD thesis Karnataka Veterinary, Animal and Fisheries Sciences University, India. Mourrain, P., Beclin, C., Elmagan, T., Feuerbach, F., Godon, C., Morel, J.B., Jouette, D., Lacombe, A.M., Nikic, S., Picault, N., Remoue, K., Sanial, M., Vo, T.A., Vaucheret, H., 2000. Arabidopsis SGS2 and SGS3 genes are required for posttranscriptional gene silencing and natural virus resistance. Cell 101, 533–542. Otta, S.K., Shubha, G., Joseph, B., Chakraborthy, A., Karunasagar, I., Karunasagar, I., 1999. Polymerase chain reaction (PCR) detection of white spot syndrome virus (WSSV) in cultured and wild crustaceans in India. Dis. Aquat. Org. 38, 67–70. Otta, S.K., Karunasagar, I., Karunasagar, I., 2003. Detection of monodon baculovirus and white spot syndrome virus in apparently healthy Penaeus monodon postlarvae from India by polymerase chain reaction. Aquaculture 220, 59–67. Pradeep, B., Rai, P., Mohan, S.A., Shekhar, M.S., Karunasagar, I., 2012. Biology, host range, pathogenesis and diagnosis of white spot syndrome virus. Indian J Virol. 23, 161–174. Reske, A., Pollara, G., Krummenacher, C., Chain, B.M., Katz, D.R., 2007. Understanding HSV1 entry glycoproteins. Rev. Med. Virol. 17, 205–215. Rijiravanich, A., Browdy, C.L., Withyachumnarnkul, B., 2008. Knocking down caspase-3 by RNAi reduces mortality in Pacific white shrimp Penaeus (Litopenaeus) vannamei challenged with a low dose of white-spot syndrome virus. Fish Shellfish Immunol. 24, 308–313. Sanchez-Paz, A., 2010. White spot syndrome virus: an overview on an emergent concern. Vet. Res. 41, 43. Sarathi, M., Simon, M.C., Venkatesan, C., Thomas, J., Ravi, M., Madan, N., Thiyagarajan, S., Sahul Hameed, A.S., 2010. Efficacy of bacterially expressed dsRNA specific to different structural genes of white spot syndrome virus (WSSV) in protection of shrimp from WSSV infection. J. Fish Dis. 33, 603–607. Syed Musthaq, S., Kwang, J., 2011. Oral vaccination of baculovirus-expressed VP28 displays enhanced protection against white spot syndrome virus in Penaeus monodon. PLoS ONE 6, e26428. http://dx.doi.org/10.1371/journal.pone.0026428. Tang, W., Luo, X.Y., Sanmuels, V., 2002. Gene silencing: double-stranded RNA mediated mRNA degradation and gene inactivation. Cell Res. 11, 181–186. Tsai, J.M., Wang, H.C., Leu, J.H., Wang, A.H., Zhuang, Y., Walker, P.J., Kou, G.H., Lo, C.F., 2006. Identification of the nucleocapsid, tegument, and envelope proteins of the shrimp white spot syndrome virus virion. J. Virol. 80, 3021–3029. van Hulten, M.C.W., Witteveldt, J., Peters, S., Kloosterboer, N., Tarchini, R., Fiers, M., Sandbrink, H., Lankhorst, R.K., Vlak, J.M., 2001. The white spot syndrome virus DNA genome sequence. J. Virol. 286, 7–22. Venegas, C.A., Nonaka, L., Mushiake, K., Nishizawa, T., Muroga, K., 2000. Quasi-immune response of Penaeus japonicus to penaeid rod-shaped DNA virus (PRDV). Dis. Aquat. Org. 42, 83–89. Wongteerasupaya, C., Vickers, J.E., Sriurairatanas, Nash, G.L., Alarajamorn, A., Boonsaeng, V., 1995. A non-occluded, systemic baculovirus that occurs in cells of ectodermal and mesodermal origin and causes high mortality in the black tiger prawn Penaeus monodon. Dis. Aquat. Org. 21, 69–77. Wu, W., Zhang, X., 2007. Characterization of a Rab GTPase up-regulated in the shrimp Peneaus japonicus by virus infection. Fish Shellfish Immunol. 23, 438–445. Yumiao, S., Fuhua, L., Yanhong, C., Jianhai, X., 2013. Enhanced resistance of marine shrimp Exopalamon carincauda Holthuis to WSSV by injecting live VP28-recombinant bacteria. Acta Oceanol. Sin. 32, 52–58. Zhu, F., Zhang, X., 2012. Protection of shrimp against white spot syndrome virus (WSSV) with β-1,3- D -glucan-encapsulated vp28-siRNA particles. Mar. Biotechnol. 14, 63–68. Zhu, Y.B., Li, H.Y., Yang, F., 2006. Identification of an envelope protein (VP39) gene from shrimp white spot syndrome virus. Arch. Virol. 151, 71–82.