Antiviral activity of ethanol extract of Lophatherum gracile against respiratory syncytial virus infection

Author’s Accepted Manuscript Antiviral activity of ethanol extract of Lophatherum gracile against respiratory syncytial virus infection Li-Feng Chen, Yuan-Lin Zhong, Ding Luo, Zhong Liu, Wei Tang, Wen Cheng, Si Xiong, Yao-Lan Li, Man-Mei Li www.elsevier.com/locate/jep

PII: DOI: Reference:

S0378-8741(17)34681-0 https://doi.org/10.1016/j.jep.2018.10.036 JEP11575

To appear in: Journal of Ethnopharmacology Received date: 25 December 2017 Revised date: 17 October 2018 Accepted date: 26 October 2018 Cite this article as: Li-Feng Chen, Yuan-Lin Zhong, Ding Luo, Zhong Liu, Wei Tang, Wen Cheng, Si Xiong, Yao-Lan Li and Man-Mei Li, Antiviral activity of ethanol extract of Lophatherum gracile against respiratory syncytial virus i n f e c t i o n , Journal of Ethnopharmacology, https://doi.org/10.1016/j.jep.2018.10.036 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Antiviral activity of ethanol extract of Lophatherum gracile against respiratory syncytial virus infection Li-Feng Chen1§, Yuan-Lin Zhong1§, Ding Luo1, Zhong Liu2, Wei Tang1, Wen Cheng1, Si Xiong1, Yao-Lan Li1*, Man-Mei Li1* 1

Institute of Traditional Chinese Medicine and Natural Products, College of Pharmacy,

Jinan University, Guangzhou, Guangdong 510632, China 2

Guangzhou Jinan Biomedicine Research and Development Center, Guangdong Provincial

Key Laboratory of Bioengineering Medicine, College of Life Science and Technology, Jinan University Guangzhou, China.

*Corresponding authors Man-Mei Li, College of Pharmacy, Jinan University, Guangzhou 510632, China, Phone: (86) 20 85221646, Fax: (86) 20 85221559, E-mail: [email protected] Yao-Lan Li, College of Pharmacy, Jinan University, Guangzhou 510632, China Phone: (+86) 20-85221728; Fax: (+86) 20-8522-1559; E-mail: [email protected]

Email addresses: MML:[email protected] LFC: [email protected] YLZ: [email protected] DL: [email protected] ZL: [email protected] WT: [email protected] WC: [email protected] SX: [email protected] YLL: [email protected]

Abstract Ethnopharmacological relevance: Lophatherum gracile, an important medicinal plant, is used traditionally in the treatment of cough associated with lung heat and inflammation. In this study, an ethanol extract of L. gracile (DZY) was shown to inhibit respiratory syncytial virus (RSV) infection and RSV-induced inflammation in vitro and in vivo. These findings provide a strong and powerful support for the traditional use of L. gracile in the treatment of RSV-related diseases. Aim of the study: To determine the anti-RSV activities of DZY and its ingredients, and explore the relationship between RSV infection and inflammation. Materials and Methods: DZY was extracted from L. gracile and its major ingredients were determined by high-performance liquid chromatography (HPLC). RSV-infected HEp-2 and RAW264.7 cell models were established to assess the inhibitory effect of DZY on RSV replication and nitric oxide (NO) production in vitro. Three-week-old BALB/c mice challenged intranasally with RSV were used to establish RSV-infected animal mode. The mice were respectively administered DZY at high-, middle-, and low-dose in different groups. The anti-RSV activity of DZY was evaluated by detecting viral load, lung lesion, CD4+ and CD8+ T cell population, and interleukin (IL)-1β, tumor necrosis factor (TNF)-α, and interferon (IFN)-γ expression in the lung tissue. Results: In HEp-2 cell line, DZY effectively inhibited RSV infection in a dose-dependent manner with IC50 values of 20 μg/mL against RSV (Long strain) and IC50 values of 25 μg/mL against RSV (A2 strain). The anti-RSV activity of DZY was mainly determined by isoorientin, swertiajaponin, 3, 5-di-caffeoylquinic acid, and 3, 4-di-caffeoylquinic acid. Moreover, DZY suppressed NO production induced by RSV in vitro. In vivo, oral administration of DZY significantly reduced the viral load and ameliorated lesions in the lung tissue. A probable antiviral mechanism was mediated by slightly improving the ratio of CD4+/CD8+ T cells and inhibiting the mRNA and protein expression of IL-1β, TNF-α, and IFN-γ. Conclusions: (1) DZY exhibits anti-RSV activities both in vitro and in vivo. (2) RSV infection can trigger a series of inflammatory reactions; thus, ameliorating inflammation is helpful to control the course of disease caused by RSV. These findings provide the

rationale and scientific evidence behind the extensive use of L. gracile in traditional medicine for the treatment of diseases potentially caused by RSV.

Graphical abstract

Keywords: Lophatherum gracile; Respiratory syncytial virus; Inflammation; Antiviral; Traditional Chinese medicine

1. Introduction Human respiratory syncytial virus (RSV), an enveloped RNA virus of the family Paramyxoviridae, is considered the leading cause of lower respiratory tract illnesses, such as bronchitis and pneumonia (Nair et al., 2010). RSV-related lower respiratory tract infection is an important cause of death in young children, with approximately 200,000 cases per year worldwide (Jansen et al., 2007; Nair et al., 2010). Since an organism does not develop lasting immunity to RSV infection, RSV infections reoccur throughout adulthood. Consequently, the elderly and immunosuppressed populations are also at a high risk of RSV infection (Dubovi et al., 1981). Despite the high morbidity and mortality, effective vaccines are not currently available. Ribavirin and palivizumab are two antiviral drugs approved by the U.S. Food and Drug Administration (FDA) for the treatment of severe RSV infection; however, the use of ribavirin is limited owing to its high toxicity concerns (Empey et al., 2010; Storey, 2010; Weisman, 2009). Palivizumab is administered only for immunoprophylaxis in high-risk groups, such as premature babies, because of its high cost (Corsello, 2007; Stewart, 2010). Therefore, there is an urgent need to identify and develop safe and highly effective anti-RSV drugs. The immune system plays a critical role in the pathogenesis of RSV disease (Collins and Graham, 2008; Peebles and Graham, 2005). Experimental evidence (Kurt-Jones et al., 2000) suggests that RSV binds to pattern recognition receptors and activates both innate and adaptive immune responses. In particular, macrophages, dendritic cells (DCs), natural killer (NK) cells, and helper T (Th) cells are involved in the initiation and progression of the disease via production of cytokines and chemokines (Oshansky et al., 2009). Therefore, the suppression of excessive production of inflammatory cytokines may be an effective therapeutic strategy for RSV infections. The stem and leaves of Lophatherum gracile (Gramineae), also named “Dan-Zhu-Ye,” are commonly used in traditional Chinese medicine (TCM) (Naithani et al., 2008). Dan-Zhu-Ye was recorded in the Compendium of Materia Medica and has been used to

treat hydrodipsia, fever, and urinary tract inflammation for thousands of years in China. The herb is also an important ingredient of traditional Chinese prescriptions such as “Health Star (Granules),” which is a commonly used pediatric medication in southern China to clear heat and detoxify. Modern medical studies have shown that Dan-Zhu-Ye and its components possess antipyretic, diuretic, antibacterial, antitumor, and antihyperglycemic activities (Xiao et al., 2002). Our previous study had found that several flavone C-glycosides from L. gracile showed potent antiviral activity against RSV in vitro (Wang et al., 2012). However, the anti-RSV activity of DZY has not yet been investigated. Therefore, in the present study, we aimed to investigate the anti-RSV and anti-inflammatory activities of DZY in vitro and in vivo. The results of this study can provide experimental data for the development of anti-RSV Chinese herbal formula.

2. Materials and Methods 2.1. Plant names Lophatherum gracile (Dan-Zhu-Ye) was purchased in Dongguan city, Guangdong Province, China. A voucher specimen (No. 070415) was deposited at Jinan University, Guangdong, China. L. gracile was authenticated by Prof. Guang-Xiong Zhou (Institute of Traditional Chinese Medicine & Natural Products, Jinan University). 2.2. Preparation of the crude extract of L. gracile (DZY) DZY was prepared according to phytochemistry method (Wang et al., 2012). Briefly, air-dried, powdered stem and leaves of L. gracile (10.0 kg) were extracted with 95 % ethanol (EtOH) (1st: 100 L, 2 h; 2nd: 100 L, 2 h) at a temperature of 80 ℃ under reflux. The combined EtOH solution was concentrated in vacuo to yield a residue (123.7 g). The concentrated extract was dissolved in 10 % EtOH and then passed through a D101 macroporous resin column eluting with EtOH-H2O (10:90, 30:70, v/v, successively, 10 L for each). The 30 % EtOH solution was collected and concentrated under vacuum to obtain a crude extract (DZY, 46.5 g). The extract was reddish brown and stored at -20 ℃. 2.3. High-performance liquid chromatography (HPLC) analysis of DZY HPLC analysis was performed on Agilent-1260 system (Agilent, USA) equipped with an ultraviolet (UV) detector. Chromatographic separation was carried out on a Cosmosil 5

C18-ms-II column (4.6 × 250 mm, 5 μm) at 30 ℃, with an injection volume of 10 μL. DZY was dissolved in 70 % methanol. A gradient elution of solvent A (acetonitrile) and solvent B (0.2 % formic acid) was applied at a flow rate of 1.0 mL/min as follows: 16–22 % A linear gradient from 0 to 30 min. The UV detection wavelength was 330 nm. DZY was analyzed for eight main compounds, which were previously isolated from the stem and leaves of L. gracile. Their structures were identified by UV, infrared (IR), mass spectroscopy (MS), 1H nuclear magnetic resonance (NMR), and 13C NMR spectra. 2.4. Cells and viruses Human laryngeal epidermoid carcinoma (HEp-2, ATCC CCL-23) cells, RSV Long (ATCC VR-26) strain, and RSV A2 (ATCC VR-1540) strain were purchased from Medicinal Virology Institute, Wuhan University, China. The murine macrophage cell lines (RAW264.7) were purchased from American Type Culture Collection (ATCC, Manassas, VA, USA). The cells were cultured in Dulbecco's Modified Eagle Medium (DMEM; Gibco, USA) supplemented with 100 U/mL penicillin and streptomycin, and 10 % fetal bovine serum (FBS, Gibco, USA) at 37 ℃ in 5 % CO2. Virus-infected cells were maintained in DMEM with 100 U/mL penicillin and streptomycin and 2 % FBS. 50 % tissue culture-infective dose (TCID50) measured by CPE assay and plaque forming unit (PFU) measured by plaque assay were used to express virus titer. The RSV strains were stored at -80 ℃ until use. Ribavirin (Sigma, USA) and dexamethasone (Sigma, USA) were used as positive controls in anti-RSV test and anti-inflammatory test induced by RSV, respectively. 2.5. MTT assay HEp-2 cells and RAW264.7 cells were seeded in 96-well plates for 24 h and then treated with different concentrations of DZY (25, 50, 100, 200, and 400 μg/mL). The plates were incubated for 72 h, followed by the addition of 10 μL/well of MTT solution (5 mg/mL, Sigma, USA). The plates were further incubated for 4 h to form formazan crystals. After removing the MTT solution by inverting the plates, 200 μL of dimethyl sulfoxide (DMSO; Sigma, USA) was added to each well to dissolve the formazan crystals. The optical density (OD) values at 570 nm were measured with a microplate reader (Thermo Scientific, Waltham, MA, USA). The 50 % cytotoxicity concentration (CC50) was defined as the concentration reducing 50 % of cell viability, and was calculated by regression analysis of

the dose-response curve generated from the OD values (Mosmann, 1983). 2.6. Cytopathic effect (CPE) reduction assay DZY and DZY-derived compounds were subjected to two-fold serial dilution with medium to different concentrations. The monolayers were inoculated with the mixture of sample dilution and an equal volume of RSV (100 TCID50). The plates were incubated at 37 ℃ in a CO2 incubator for approximately 3–4 days. RSV-induced CPE was observed under a light microscope. By comparing with the virus control, the concentration that reduced 50 % of CPE was estimated from the data plots and was defined as the 50 % inhibitory concentration (IC50) of DZY. The selective index (SI) value was calculated as the ratio of CC50 value and IC50 value (Novoa et al., 2016). 2.7. Nitric oxide (NO) production assay Monolayers of RAW264.7 cells were treated with the mixture containing various concentrations of DZY (50, 100, 200, and 400 μg/mL) and an equal volume of RSV (MOI=1) for 48 h. The supernatant (100 μL) was mixed with the same volume of Griess reagent (100 μL) for 15 min. The absorbance was measured with a microplate reader at 540 nm. The concentration of NO was calculated by using a calibration curve established with 0.78–100 μM NaNO2. The inhibition of NO (%) was calculated as follows: [(mean concentration of NO in virus control) − (mean concentration of NO in DZY)]/(mean concentration of NO in virus control) ×100 % (Zhuang et al., 2017). 2.8. Animals Male Kunming mice (SPF, 13–15 g, certified No. SCXK [Guangdong] 2008-0022) purchased from Guangdong Medical Laboratory Animal Center (Guangzhou, China) were used to evaluate the acute toxicity of DZY in vivo. Male BALB/c mice (3-week-old, SPF grade, certified No. SCXK [Guangdong] 2008-0002) purchased from Guangdong Medical Laboratory Animal Center (Guangzhou, China) were used to evaluate the anti-RSV activity of DZY in vivo. All experimental mice were kept in an air-conditioned, pathogen-free room (temperature of 24 ± 2 ℃). A 12 h light-dark cycle was maintained with lights on from 07:00 to 19:00. The mice were housed individually, fed a conventional balanced diet and sterile water. All animal experiments were conducted in accordance with the guidelines (publication number 85-23, revised 1996) set by the National Institutes of Health and the

U.S. Department of Agriculture, and were approved by the local animal ethics committee of Jinan University. 2.9. Acute toxicity assay After five days of adaptation, Kunming mice were treated with a two-fold serial dilution of DZY (starting from the concentration of 5000 mg/kg/d). They were observed at least once a day after the treatment for vital signs, death, body weight, food and water consumption, and behavior. Dead mice were autopsied and examined macroscopically for any pathological changes. After 20 days of continuous observation, all mice were sacrificed and observed anatomically and histologically (Li et al., 2013). 2.10. Experimental design in vivo BALB/c mice were randomized into eight groups: normal control, virus control (virus only), positive control (virus + 50 mg/kg/d ribavirin), single drug group (2000 mg/kg/d DZY only), and different concentrations of DZY group (virus + 250, 500, 1000, and 2000 mg/kg/d DZY). DZY groups and single drug group received DZY by oral gavage for 4 days. The positive control group received ribavirin at a dose of 50 mg/kg/d, while the other two control groups only received normal saline. Each group contained 10–12 mice. The mice were lightly anesthetized with diethyl ether, and then intranasally challenged with RSV Long strain on day 4. The control and single drug groups were sham-infected with an equal volume of medium. DZY or normal saline were continuously treated by intragastric administration for 5 days. The mice were sacrificed, and the lungs were removed in a sterile condition, weighed, and divided into five pieces for related experiments (Xu et al., 2015). 2.11. Plaque assay The lung tissues were homogenized with medium and centrifuged at 1500 g for 10 min to discard the cell debris. Then, the supernatant was diluted with medium and added to HEp-2 cell monolayers in 24-well plates. After 2 h of incubation in 5 % CO2 at 37 ℃, the supernatant was removed, and the covering medium containing 6 % agarose was then overlaid on the cells. After coagulation of agarose, the maintenance medium was added and the plates were further incubated for 4–5 days for plaque formation. Next, the cells were fixed with 10 % formalin overnight and stained with crystal violet (1 % W/V) for 30 min. The number of RSV-induced plaques was counted to calculate PFU (Kong et al., 2005).

2.12. Histopathology assay To study the histological changes in lung issues of RSV-infected mice, the lung tissues were fixed in 4 % buffered formalin, embedded in paraffin wax, and stained with Hematoxylin and eosin (H&E). Multiple sections from each tissue were observed and analyzed under a light microscope (Fremond et al., 2007). 2.13. Flow cytometry assay (FCM) Lung tissues were homogenized with phosphate buffered saline (PBS), and the samples were filtered through a 70-μm nylon mesh twice. Red blood cells in the suspension were then lysed with lysis buffer, and the remaining cells were washed and collected. Fluorochrome-conjugated monoclonal antibodies (Ebioscience, San Diego, CA, USA) against mouse CD3 (anti-mouse CD3-APC), CD4 (anti-mouse CD4-FITC), and CD8 (anti-mouse CD8-PE) were used for determining the subset of lymphocytes. Immunofluorescent staining was measured using FACSCalibur (Becton-Dickinson, San Jose, CA, USA) (Lee et al., 2012). 2.14. FQ-PCR assay The mRNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA), quantified, and reverse transcribed to cDNA. The primer pairs are shown in Table 1. DNA was amplified using the SYBR green PCR master mix (Takara, Japan) in a Light Cycler 480 (Roche, CA, USA). The relative gene expression levels were normalized to GADPH expression using the formula: (ΔCT = CTTarget - CTGAPDH), and then further normalized to the control (ΔΔCT = ΔCT - CTControl). The fold change in expression was then obtained as 2^(−ΔΔCT) (Chen et al., 2015). Table 1 Primer sequences of IL-1β, IFN-γ, TNF-α, and GAPDH mRNA Genes

Forward primer (5′–3′)

Reverse primer (5′–3′)

IL-1β

GAAATGCCACCTTTTGACAGTG

TGGATGCTCTCATCAGGACAG

IFN-γ

ATGAACGCTACACACTGCATC

CCATCCTTTTGCCAGTTCCTC

TNF-α

AGCCCACGTCGTAGCAAACCACCAA

AACACCCATTCCCTTCACAGAGCAAT

GAPDH

AGGTCGGTGTGAACGGATTTG

TGTAGACCATGTAGTTGAGGTCA

2.15. Luminex assay

Lung tissues were homogenized with lysis buffer (Millipore, Watford, UK), and tissue debris was pelleted by centrifugation at 15000 g for 20 min at 4 ℃. The protein concentration in the supernatant was detected by the Bradford assay (Thermo Scientific, America). Beads (25 μL) and 25 μL samples (12.5 μg protein of each cell lysate) were added to the plate and incubated at 4 ℃ overnight. The content in the well was removed and washed with wash buffer twice. Then, detection antibodies were added and the plate was incubated at 25 ℃ for 1 h on a shaker followed by the addition of 25 μL streptavidin-phycoerythrin per well. After washing, 150 μL drive fluid was added, and the plates were read with a Luminex 200 system (Millipore). The concentration of each cytokine was calculated by a calibration curve. The detection limit for each cytokine was pg/mL (Xu et al., 2015). 2.16. Statistical analysis The results were expressed as mean ± standard deviation (S.D.). Statistical analysis was performed using Graphpad Prism 5.0 by one-way ANOVA with Bonferroni's corrections. P < 0.05, P < 0.01, or P < 0.001 was considered statistically significant.

3. Results 3.1. HPLC analysis of DZY HPLC analysis of DZY was performed, and eight peaks were detected and identified by comparing their individual peak retention times with those of reference substances (Fig. 1). The peaks corresponded to isoorientin, swertiajaponin, piceatannol-3'-O-β-Dglucopyranoside, p-Coumaric acid, piceid, rhaponticin, 3, 5-di-caffeoylquinic acid and 3, 4-di-caffeoylquinic acid, respectively. 3.2. Anti-RSV activities of DZY and its main components The toxicities and antiviral activities of DZY and its main components were determined by MTT assay and CPE reduction assay, respectively. As shown in Table 2, the CC50 of DZY and its main components in HEp-2 cells was more than 200 or 400 μg/mL, respectively. All of them showed a lower toxicity than ribavirin. The IC50 of DZY and its main components against RSV was tested, and the results indicated that DZY exhibited potential antiviral activity and its effect did not show any difference between the Long and

A2 strains. However, the anti-RSV activity of DZY was slightly lower than that of ribavirin. The IC50 of 3, 4-di-caffeoylquinic acid, 3, 5-di-caffeoylquinic acid, isoorientin, and swertiajaponin ranged from 1.8 to 6.3 μg/mL, which was basically consistent with our previous reports (Li et al., 2005; Wang et al., 2012). Therefore, we presumed that the anti-RSV activity of DZY is mainly determined by isoorientin, swertiajaponin, 3, 5-di-caffeoylquinic acid, and 3, 4-di-caffeoylquinic acid. Table 2 Anti-RSV activities of DZY and its main components in HEp-2 cells Cytotoxicity

Anti-RSV (Long strain)

Anti-RSV (A2 strain)

Compounds CC50a (μg/mL)

IC50b (μg/mL)

SIc

IC50 (μg/mL)

SI

DZY

>200.0

20.0 ± 1.6

>10.0

25.0 ± 2.1

>8.0

Isoorientin

430.0 ± 49.2

3.1 ± 0.2

138.7

3.1 ± 0.2

138.7

Swertiajaponin

245.5 ± 23.3

6.3 ± 3.2

39.0

6.3 ± 3.2

39.0

>400.0

100.0 ± 10.6

> 4.0

100.0 ± 11.3

>4.0

p-Coumaric acid

>400.0

-d

-

-

-

Piceid

>400.0

-

-

-

-

Rhaponticin

>400.0

60.0 ± 5.3

> 6.7

60.0 ± 3.6

> 6.7

>200.0

2.5 ± 2.7

>80.0

2.2 ± 1.2

>90.9

>200.0

2.0 ± 3.0

>100.0

1.8 ± 0.7

>111.1

30.3 ± 4.9

1.6 ± 1.0

18.9

1.6 ± 1.0

18.9

Piceatannol-3'-O-βD-glucopyranoside

3,5-di-caffeoylquinic acid 3,4-di-caffeoylquinic acid Ribavirine

a) CC50, 50% cytotoxic concentration, was estimated by MTT assay; b) IC 50, 50% inhibitory concentration, was assessed by CPE reduction assay; c) SI value was calculated by CC50/IC50; d) no antiviral activity; e) Ribavirin was used as the positive control. 3.3. Effect of DZY on RSV-induced NO production The CC50 of DZY in RAW264.7 cells was more than 400 μg/mL. In addition, NO production assay indicated that DZY could significantly inhibit NO release induced by RSV

infection in RAW264.7 cells (Fig. 2A; P < 0.001). The IC50 value of DZY was 79.0 μg/mL, and its inhibitory activity was dose-dependent. At concentrations above 100 μg/mL, the anti-inflammatory activity of DZY was better than that of the positive control dexamethasone (Fig. 2A and B). Hence, the above findings suggested that DZY possessed anti-inflammatory effect. 3.4. Acute toxicity of DZY The acute toxicity of DZY was first evaluated in Kunming mice. DZY was found to be non-toxic up to a concentration of 5000 mg/kg. The mice did not show any symptoms associated with toxicity, such as nostril breathing blockage, convulsion, diarrhea, and death, during the whole experiment. The weight gains of mice were not different between the DZY treatment group and control group (Table 3), indicating that DZY had no side effects on mice growth. All the mice were sacrificed 20 days after treatment, and most of the organs including the heart, liver, kidney, spleen, and intestine were anatomized. No abnormal phenomenon, such as swelling and bleeding, was found. The LD50 of DZY was determined to be above 5000 mg/kg. Therefore, the lower doses (2000, 1000, 500, and 250 mg/kg) of the extract were used in mice for testing the anti-RSV activity in vivo. Table 3 Body weight changes in Kunming mice Weight changea (g)

Dosage (mg/mL)

First day

Last day

Weight gain

5000

19.4 ± 0.5

32.1 ± 0.3***

12.7

2500

20.3 ± 1.4

33.9 ± 3.8***

13.6

1250

19.4 ± 0.6

32.9 ± 2.3***

13.5

625

20.3 ± 2.0

36.3 ± 4.2***

16

312.5

19.7 ± 1.2

37.8 ± 3.8***

18.1

156.3

19.2 ± 0.9

33.8 ± 3.4***

14.6

78.1

20.4 ± 0.8

34.9 ± 2.6***

14.5

39.1

19.2 ± 0.7

32.8 ± 5.2***

13.6

19.5

20.3 ± 0.9

30.7 ± 3.0***

10.4

9.8

19.6 ± 0.8

29.7 ± 2.5***

10.2

Control

20.3 ± 1.0

33.5 ± 1.1***

13.2

a) The weight change represents the difference between the weight of mice on the last day and that on the first day. The results are expressed as mean ± SD from three parallel experiments. ***P < 0.001 was compared with the weight on the first day. 3.5. Effect of DZY on RSV replication in vivo The measurement of viral load was conducted using a plaque assay. As shown in Fig. 3, the viral loads of DZY (250, 500, 1000, and 2000 mg/kg/d)-treated groups were 2.95 ± 0.04, 2.89 ± 0.04, 2.68 ± 0.07, and 2.49 ± 0.11 PFU/g (Log10), respectively, showing a significant reduction (P < 0.001) in a dose-dependent manner compared with that of the viral group (2.99 ± 0.03 PFU/g Log10). At a concentration of 2000 mg/mL, the inhibitory effect of DZY on virus replication was comparable to that of ribavirin. 3.6. Effect of DZY on RSV-induced inflammation in the lung tissue Lung index was used to assess the histological changes in the lung tissue. RSV infection could result in pulmonary inflammation, edema, and change in lung index. As shown in Fig. 4A, the lung index in RSV-infected mice (1.53 ± 0.09) was significantly (P < 0.001) higher than that in the control group (0.86 ± 0.03), indicating that the model was successful in inducing pneumonia in mice. DZY markedly (P < 0.001) reduced the lung index (1.40 ± 0.04, 1.37 ± 0.05, 1.38 ± 0.06, and 1.34 ± 0.05, respectively), but the effect was slightly weaker than ribavirin. H&E staining was used to assess the localization and extent of cell infiltration in the lung tissue. RSV infection resulted in the accumulation of inflammatory cells in the bronchioles, blood vessels, and alveolar space (Fig. 4B). In contrast, the mice in the DZY-treated groups did not show high inflammation in the airways, blood vessels, and interstitial spaces after RSV infection. The improved lung histopathology in the presence of DZY treatment confirmed the preventive effect of DZY on RSV-induced inflammation. 3.7. Effect of DZY on CD4 + and CD8+ T cell populations in the lung tissue CD3+ CD4+ T cells (abbreviated as CD4+ T cells) are described as helper T lymphocytes; CD3+ CD8+ T cells (abbreviated as CD8+ T cells) are described as cytotoxic T lymphocytes. Under normal circumstances, the ratio of CD4+/CD8+ T cells in vivo is relatively stable. After a virus infection, the immune responses are activated. CD8+ T cells

increase abnormally, resulting in a decrease in the ratio of CD4+/CD8+ T cells. However, CD8+ T cells, while clearing the virus, promote the release of large amounts of cytokines and cause inflammation. The CD4+ and CD8+ T cell populations were determined in the lung tissue after RSV infection. As shown in Table 4, the percentage of CD8+ T cells increased, whereas the percentage of CD4+ T cells decreased correspondingly in the lung tissue owing to virus infection. Thus, the ratio of CD4+/CD8+ T cells shifted from 5.07 ± 0.92 to 0.61 ± 0.09. These results indicated that immune cells were recruited to the lung tissue in RSV-infected mice, and CD8+ T cell generation was particularly enhanced. Regardless of the dose, the number of CD8+ T cells in the lung tissue was not significantly reduced by DZY; however, the ratio of CD4+/CD8+ T cells was slightly improved (P < 0.01). Table 4 Changes in CD3+CD4+CD8+ (%) in the lungs Dose Groups

CD3+ (%)

CD3+CD4+ (%)

CD3+CD8+ (%)

CD4+/ CD8+

( mg/kg/d ) Control group

-

79.18 ± 3.68

52.20 ± 4.40

11.03 ± 2.24

5.07 ± 0.92

Virus group

-

67.62 ± 6.62

21.33 ± 2.57

32.03 ± 3.11

0.61 ± 0.09###

250

67.48 ± 3.09

22.30 ± 3.97

29.16 ± 2.44

0.79 ± 0.08**

500

65.37 ± 4.08

31.49 ± 9.74

31.76 ± 3.68

0.78 ± 0.05**

1000

68.77 ± 4.79

20.44 ± 3.97

30.77 ± 4.41

0.64 ± 0.09

2000

70.49 ± 3.84

20.09 ± 5.01

31.90 ± 5.19

0.76 ± 0.09*

DZY

2000

79.24 ± 3.72

33.28 ± 9.77

9.43 ± 8.01

4.38 ± 2.67

Virus+Ribavirin

50

67.28 ± 2.99

31.72 ± 8.89

15.96 ± 4.38

2.18 ± 0.32***

Virus + DZY

The results are expressed as mean ± SD from three parallel experiments. ###P < 0.001 compared with the control group. *P < 0.01;**P < 0.01; ***P < 0.001 compared with the viral control group. 3.8. Effect of DZY on pulmonary cytokine production To investigate the function of DZY on inflammation induced by RSV further, the pulmonary cytokine production was determined by Luminex assay and FQ-PCR in the lung tissues. The mRNA and protein expression levels of interleukin (IL)-1β and tumor necrosis factor (TNF)-α in the virus group significantly increased (P < 0.001) compared with that in

the control group. The expression levels of IL-1β and TNF-α decreased significantly (Fig. 5A and B; P < 0.001) following DZY treatment. The production of interferon gamma (IFN-γ) in the RSV-infected group was 2667.2 pg/mL. DZY also attenuated the level of IFN-γ secretion and presented a significant difference (Fig. 5C; P < 0.001). However, these effects were not as good as ribavirin.

4. Discussion In this study, we aimed to explore whether DZY and its ingredients had anti-RSV activities and the relationship between RSV infection and inflammation. It was found that DZY significantly inhibited RSV infection and NO production induced by RSV in vitro. An RSV-infected mouse model was established to validate the anti-RSV activity of DZY further. The results showed that DZY did not exhibit toxicity in mice up to a concentration of 5000 mg/kg. DZY significantly reduced viral load in pulmonary tissue, indicating that the process of virus infection was suppressed. Moreover, DZY decreased the lung index and relieved lung lesion via significant reduction of inflammatory factors, such as IL-1β, TNF-α, and IFN-γ. Therefore, we presumed that DZY exhibited dual efficacy in the treatment of RSV infection. The anti-RSV activity of DZY in vivo was consistent with that in vitro. The chemical constituents and pharmacological activities of L. gracile have been studied extensively. Flavonoids are the main and characteristic components of L. gracile and may be responsible for its antiviral activities (Goncalves et al., 2001; Tang et al., 2015; Wang et al., 2012; Zhang et al., 2009). HPLC analysis of DZY in this study indicated that DZY

comprised

8

main

components,

piceatannol-3'-O-β-D-glucopyranoside,

including

p-Coumaric

acid,

isoorientin, piceid,

swertiajaponin, rhaponticin,

3,

4-di-caffeoylquinic acid, and 3, 5-di-caffeoylquinic acid. Previous studies showed that flavonoids from Matteuccia struthiopteris exerted significant antiviral activity against H1N1 influenza virus (H1N1) by inhibiting neuraminidase (Li et al., 2015). Flavonoids also exhibited inhibitory activities against NS2B-NS3 protease of ZIKA virus (Lim et al., 2017). Selected

medicinal

plants

containing

flavonoids

showed

significant

anti-inflammatory activity (Diaz et al., 2012). Isoorientin, a flavonoid, possessed potent antiviral activity in vitro and in vivo (Abd-Alla et al., 2012; Zhu et al., 2015) and

ameliorated lipopolysaccharide-induced inflammation (Lee et al., 2014; Yuan et al., 2014). Isoorientin and swertiajaponin possessed anti-RSV activities in vitro (Wang et al., 2012). Caffeoylquinic acid from Schefflera heptaphylla markedly inhibited RSV infection (Li et al., 2005).

The

two

dicaffeoylquinic

acids

extracted

from

Youngia

japonica,

3,

4-di-caffeoylquinic acid and 3, 5-di-caffeoylquinic acid, also had potential anti-RSV effects in vitro (Ooi et al., 2006). Moreover, 3, 4-di-caffeoylquinic acid could act against influenza A virus (IAV) by increasing TNF-related apoptosis-inducing ligand (TRAIL) (Takemura et al., 2012). 3, 5-di-caffeoylquinic acid was not only found to be active against the herpesviruses HSV-1 and HSV-2 (Alvarez et al., 2011), but also had anti-inflammatory activities in RAW 264.7 cells (Hong et al., 2015). In the present study, it was observed that flavonoids (isoorientin and swertiajaponin) and caffeoylquinic acids (3, 4-di-caffeoylquinic acid and 3, 5-di-caffeoylquinic acid) had a significant inhibitory effect on RSV infection, and these findings were consistent with those of previous studies. Therefore, the anti-RSV activity

of

DZY

was

mainly

determined

by

isoorientin,

swertiajaponin,

3,

5-di-caffeoylquinic acid, and 3, 4-di-caffeoylquinic acid. Several researches (Segovia et al., 2012; Xu et al., 2015) have reported that the damage induced by RSV to an organism results not only from the direct pathogenicity of the virus, but also from virus-induced inflammatory response. When RSV infects an organism, it activates the immune system to trigger immune response. Appropriate immune responses of an organism can effectively remove the virus without damaging its own tissues (Hall, 2001; McNamara and Smyth, 2002). However, once the immune balance is destroyed, local or systemic inflammatory response is evoked (Cook et al., 2004). The inflammation induced by RSV exacerbates the condition and ultimately causes bronchiolitis and pneumonia. Therefore, it is equally important to inhibit the infection and alleviate the inflammatory reaction. In the present study, histopathology assay indicated that DZY significantly inhibited RSV-induced inflammation in the lung tissue. The mRNA and protein expression of TNF-α and IL-1β in the lung tissues were detected by FQ-PCR Assay and Luminex assay to validate the anti-inflammatory activity of DZY further. The data revealed that oral administration of DZY could significantly inhibit the expression of TNF-α and IL-1β when compared with the virus control group. Besides the innate immune

response to virus infection, adaptive immune response is activated. T cells are an important component of the adaptive immune system and play a key role in the inhibition of viral infection (Collins and Graham, 2008). The proportion of CD4+/CD8+ T cells in an organism decreases significantly when a virus induces inflammation. Among these cells, CD8+ T cells, which are cytotoxic T cells, are mainly responsible for the removal of target cells through the release of perforin or induction of apoptosis via upregulation of FasL (Lowin et al., 1994; Srikiatkhachorn and Braciale, 1997). However, excessive amounts of CD8+ T cells can cause tissue damage while clearing the virus. The increase in CD8+ T cells aggravated inflammation and therefore, marked cytotoxicity is observed. Our results showed that DZY had little effect on the number of CD8+ T cells and could slightly increase the ratio of CD4+/CD8+ T cells and maintain the balance between CD4+ cells and CD8+ cells. An increase in the proportion of CD4+ T cells and CD8+ T cells indicated that DZY ameliorated the inflammatory process. In addition, it has been reported that CD4+ T cells differentiate into Th1 cells following stimulation by external signals, such as viruses (Braciale, 2005; Gonzalez et al., 2012; Hale et al., 2013). Th1 cells mainly produce IFN-γ and IL-2 (Mosmann and Sad, 1996). IFN-γ is considered the major pro-inflammatory cytokine, and its overexpression leads to inflammation and tissue destruction. In the present study, DZY significantly inhibited the expression of IFN-γ, which was probably associated with inhibition of Th1 response. We hypothesized that DZY would be able to dampen RSV-induced inflammatory response by inhibiting IFN-γ secretion. Thus, it could be suggested that the anti-inflammatory activity of DZY was achieved by modulating both innate and adaptive immune responses. In conclusion, our results indicated that RSV triggered a series of inflammatory reactions when it infected the organism, while DZY could inhibit RSV infection and RSV-induced inflammatory reaction with low toxicity both in vitro and in vivo. This function was correlated with the regulation of TNF-α and IL-1β expression, increase in ratio of CD4+/CD8+ T cells, as well as suppression of expression of IFN-γ derived from Th1 cells in the adaptive immune system. These findings provide the rationale and scientific evidence behind the extensive use of L. gracile in traditional medicine for the treatment of diseases potentially caused by RSV. However, the exact mechanism underlying

the anti-RSV activity of DZY is not clear. Therefore, DZY needs to be further studied and may be developed as a drug for the treatment of RSV infection.

Author Contributions §

Li-Feng Chen and Yuan-Lin Zhong contributed equally to this study. Man-Mei Li and

Yao-Lan Li conceived and designed the study; Li-Feng Chen, Yuan-Lin Zhong, Zhong Liu, Wei Tang, Si Xiong performed the biological experiments and collected the data; Wen Cheng and Ding Luo performed the chemical experiments and collected the data; Li-Feng Chen, Yuan-Lin Zhong and Man-Mei Li wrote the manuscript; Yao-Lan Li and Man-Mei Li revised the work for intellectual content and context; All the authors read and approved the manuscript.

Competing interests The authors declare that they have no competing interests.

Abbreviations HRSV, Human respiratory syncytial virus; L. gracile, Lophatherum gracile; DZY, ethanol extract of L. gracile; TCM, traditional Chinese medicine; FDA, U.S. Food and Drug Administration; DCs, dendritic cells; NK cells, natural killer cells; Th cells, helper T cells; IC50, 50 % inhibitory concentration; CC50, 50 % cytotoxicity concentration; SI, the selective index; IL-1β, interleukin-1β; TNF-α, tumor necrosis factor-α; IFN-γ, interferon-γ; TCID50, 50 % tissue culture-infective dose; PFU, plaque forming unit; CPE, cytopathic effect; MOI, multiplicity of infection; FBS, fetal bovine serum; DMEM, Dulbecco's modified Eagle's medium; MTT, 3-(4, 5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; HEp-2, human larynx epidermoid carcinoma; FQ-PCR, fluorescence quantitative PCR; NO, nitric oxide; H&E, hematoxylin and eosin; FCM, flow cytometry assay; PBS, phosphate buffered saline; HPLC, high-performance liquid chromatography; CD4+ T cells, helper T lymphocytes; CD8+ T cells, cytotoxic T lymphocytes; UV, ultraviolet; IR, infrared; MS, mass spectroscopy; NMR, nuclear magnetic resonance.

Acknowledgements We are very grateful to the National Natural Science Foundation (No. 81673670, 81473116), Natural Science Foundation of Guangdong Province (No.2017A030313732), Science and Technology Planning Project of Guangdong Province (No. 2016A030303011) and Science and Technology Program of Guangzhou (No.201707010399).

References Abd-Alla, H.I., Abu-Gabal, N.S., Hassan, A.Z., El-Safty, M.M., Shalaby, N.M., 2012. Antiviral activity of Aloe hijazensis against some haemagglutinating viruses infection and its phytoconstituents. Arch. Pharm. Res. 35, 1347-1354. Alvarez, A.L., Habtemariam, S., Juan-Badaturuge, M., Jackson, C., Parra, F., 2011. In vitro anti HSV-1 and HSV-2 activity of Tanacetum vulgare extracts and isolated compounds: an approach to their mechanisms of action. Phytother. Res. 25, 296-301. Braciale, T.J., 2005. Respiratory syncytial virus and T cells: interplay between the virus and the host adaptive immune system. Proc. Am. Thorac. Soc. 2, 141-146. Chen, Z.G., Luo, H., Wang, S.C., Xu, J.Y., Li, J.X., 2015. Antiviral effects of Jinxin oral liquid against respiratory syncytial virus infection in the BALB/c mice model. J. Ethnopharmacol. 162, 287-295. Collins, P.L., Graham, B.S., 2008. Viral and host factors in human respiratory syncytial virus pathogenesis. J. Virol. 82, 2040-2055. Cook, D.N., Pisetsky, D.S., Schwartz, D.A., 2004. Toll-like receptors in the pathogenesis of human disease. Nat. Immunol. 5, 975-979. Corsello, G., 2007. Bronchiolitis: the new American Academy of Pediatrics guidelines. J. Chemother. 19 Suppl. 2, 12-14. Diaz, P., Jeong, S.C., Lee, S., Khoo, C., Koyyalamudi, S.R., 2012. Antioxidant and anti-inflammatory activities of selected medicinal plants and fungi containing phenolic and flavonoid compounds. Chin. Med. 7, 26. Dubovi, E.J., Geratz, J.D., Shaver, S.R., Tidwell, R.R., 1981. Inhibition of respiratory syncytial virus-host cell interactions by mono- and diamidines. Antimicrob. Agents

Chemother. 19, 649-656. Empey, K.M., Peebles, R.S., Jr., Kolls, J.K., 2010. Pharmacologic advances in the treatment and p revention of respiratory syncytial virus. Clin. Infect. Dis. 50, 1258-1267. Fremond, C.M., Togbe, D., Doz, E., Rose, S., Vasseur, V., Maillet, I., Jacobs, M., Ryffel, B., Quesniaux, V.F., 2007. IL-1 receptor-mediated signal is an essential component of MyD88-dependent innate response to Mycobacterium tuberculosis infection. J. Immunol. 179, 1178-1189. Goncalves, J.L., Leitao, S.G., Monache, F.D., Miranda, M.M., Santos, M.G., Romanos, M.T., Wigg, M.D., 2001. In vitro antiviral effect of flavonoid-rich extracts of Vitex polygama (Verbenaceae) against acyclovir-resistant herpes simplex virus type 1. Phytomedicine 8, 477-480. Gonzalez, P.A., Bueno, S.M., Carreno, L.J., Riedel, C.A., Kalergis, A.M., 2012. Respiratory syncytial virus infection and immunity. Rev. Med. Virol. 22, 230-244. Hale, J.S., Youngblood, B., Latner, D.R., Mohammed, A.U., Ye, L., Akondy, R.S., Wu, T., Iyer, S.S., Ahmed, R., 2013. Distinct memory CD4+ T cells with commitment to T follicular helper- and T helper 1-cell lineages are generated after acute viral infection. Immunity 38, 805-817. Hall, C.B., 2001. Respiratory syncytial virus and parainfluenza virus. N. Engl. J. Med. 344, 1917-1928. Hong, S., Joo, T., Jhoo, J.-W., 2015. Antioxidant and anti-inflammatory activities of 3, 5-dicaffeoylquinic acid isolated from Ligularia fischeri leaves. Food Sci. Biotechnol. 24, 257-263. Jansen, A.G., Sanders, E.A., Hoes, A.W., van Loon, A.M., Hak, E., 2007. Influenza- and respiratory syncytial virus-associated mortality and hospitalisations. Eur. Respir. J. 30, 1158-1166. Kong, X., Hellermann, G.R., Patton, G., Kumar, M., Behera, A., Randall, T.S., Zhang, J., Lockey, R.F., Mohapatra, S.S., 2005. An immunocompromised BALB/c mouse model for respiratory syncytial virus infection. Virol. J. 2, 3. Kurt-Jones, E.A., Popova, L., Kwinn, L., Haynes, L.M., Jones, L.P., Tripp, R.A., Walsh, E.E., Freeman, M.W., Golenbock, D.T., Anderson, L.J., Finberg, R.W., 2000. Pattern

recognition receptors TLR4 and CD14 mediate response to respiratory syncytial virus. Nat. Immunol. 1, 398-401. Lee, S., Stokes, K.L., Currier, M.G., Sakamoto, K., Lukacs, N.W., Celis, E., Moore, M.L., 2012. Vaccine-elicited CD8+ T cells protect against respiratory syncytial virus strain A2-line19F-induced pathogenesis in BALB/c mice. J. Virol. 86, 13016-13024. Lee, W., Ku, S.K., Bae, J.S., 2014. Vascular barrier protective effects of orientin and isoorientin in LPS-induced inflammation in vitro and in vivo. Vascul. Pharmacol. 62, 3-14. Li, B., Ni, Y., Zhu, L.J., Wu, F.B., Yan, F., Zhang, X., Yao, X.S., 2015. Flavonoids from Matteuccia struthiopteris and Their Anti-influenza Virus (H1N1) Activity. J. Nat. Prod. 78, 987-995. Li, L., Yu, C.H., Ying, H.Z., Yu, J.M., 2013. Antiviral effects of modified Dingchuan decoction against respiratory syncytial virus infection in vitro and in an immunosuppressive mouse model. J. Ethnopharmacol. 147, 238-244. Lim, H.J., Nguyen, T.T., Kim, N.M., Park, J.S., Jang, T.S., Kim, D., 2017. Inhibitory effect of flavonoids against NS2B-NS3 protease of ZIKA virus and their structure activity relationship. Biotechnol. Lett. 39, 415-421. Li, Y., But, P.P., Ooi, V.E., 2005. Antiviral activity and mode of action of caffeoylquinic acids from Schefflera heptaphylla (L.) Frodin. Antiviral. Res. 68, 1-9. Lowin, B., Hahne, M., Mattmann, C., Tschopp, J., 1994. Cytolytic T-cell cytotoxicity is mediated through perforin and Fas lytic pathways. Nature 370, 650-652. McNamara, P.S., Smyth, R.L., 2002. The pathogenesis of respiratory syncytial virus disease in childhood. Br. Med. Bull. 61, 13-28. Mosmann, T., 1983. Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays. J. Immunol. Methods 65, 55-63. Mosmann, T.R., Sad, S., 1996. The expanding universe of T-cell subsets: Th1, Th2 and more. Immunol. Today 17, 138-146. Nair, H., Nokes, D.J., Gessner, B.D., Dherani, M., Madhi, S.A., Singleton, R.J., O'Brien, K.L., Roca, A., Wright, P.F., Bruce, N., Chandran, A., Theodoratou, E., Sutanto, A., Sedyaningsih, E.R., Ngama, M., Munywoki, P.K., Kartasasmita, C., Simoes, E.A.,

Rudan, I., Weber, M.W., Campbell, H., 2010. Global burden of acute lower respiratory infections due to respiratory syncytial virus in young children: a systematic review and meta-analysis. Lancet. 375, 1545-1555. Naithani, R., Huma, L.C., Holland, L.E., Shukla, D., McCormick, D.L., Mehta, R.G., Moriarty, R.M., 2008. Antiviral activity of phytochemicals: a comprehensive review. Mini. Rev. Med. Chem. 8, 1106-1133. Novoa, B., Romero, A., Alvarez, A.L., Moreira, R., Pereiro, P., Costa, M.M., Dios, S., Estepa, A., Parra, F., Figueras, A., 2016. Antiviral Activity of Myticin C Peptide from Mussel: an Ancient Defense against Herpesviruses. J. Virol. 90, 7692-7702. Ooi, L.S., Wang, H., He, Z., Ooi, V.E., 2006. Antiviral activities of purified compounds from Youngia japonica (L.) DC (Asteraceae, Compositae). J. Ethnopharmacol. 106, 187-191. Oshansky, C.M., Zhang, W., Moore, E., Tripp, R.A., 2009. The host response and molecular pathogenesis associated with respiratory syncytial virus infection. Future Microbiol. 4, 279-297. Peebles, R.S., Jr., Graham, B.S., 2005. Pathogenesis of respiratory syncytial virus infection in the murine model. Proc. Am. Thorac. Soc. 2, 110-115. Segovia, J., Sabbah, A., Mgbemena, V., Tsai, S.Y., Chang, T.H., Berton, M.T., Morris, I.R., Allen, I.C., Ting, J.P., Bose, S., 2012. TLR2/MyD88/NF-kappaB pathway, reactive oxygen species, potassium efflux activates NLRP3/ASC inflammasome during respiratory syncytial virus infection. PLoS One 7, e29695. Srikiatkhachorn, A., Braciale, T.J., 1997. Virus-specific CD8+ T lymphocytes downregulate T helper cell type 2 cytokine secretion and pulmonary eosinophilia during experimental murine respiratory syncytial virus infection. J. Exp. Med. 186, 421-432. Stewart, D.L., 2010. Studies recommending palivizumab restriction have serious deficiencies. J. Manag. Care. Pharm. 16, 509-511; author reply 511-502, discussion 512-504. Storey, S., 2010. Respiratory syncytial virus market. Nat. Rev. Drug Discov. 9, 15-16. Tang, Q., Shao, M., Wang, Y., Zhao, H., Fan, C., Huang, X., Li, Y., Ye, W., 2015. Simultaneous Determination of 10 Bioactive Components of Lophatherum gracile

Brongn by HPLC-DAD. J. Chromatogr. Sci. 53, 963-967. Wang, Y., Chen, M., Zhang, J., Zhang, X.L., Huang, X.J., Wu, X., Zhang, Q.W., Li, Y.L., Ye, W.C., 2012. Flavone C-glycosides from the leaves of Lophatherum gracile and their in vitro antiviral activity. Planta. Med. 78, 46-51. Weisman, L.E., 2009. Respiratory syncytial virus (RSV) prevention and treatment: past, present, and future. Cardiovasc. Hematol. Agents Med. Chem. 7, 223-233. Xiao, P.G., Li, D.P., Yang, S.L., 2002. Modern Chinese Materia Medica. Chemical Industry Press. Xu, J.J., Liu, Z., Tang, W., Wang, G.C., Chung, H.Y., Liu, Q.Y., Zhuang, L., Li, M.M., Li, Y.L., 2015. Tangeretin from Citrus reticulate Inhibits Respiratory Syncytial Virus Replication and Associated Inflammation in Vivo. J. Agric. Food Chem. 63, 9520-9527. Yuan, L., Wu, Y., Ren, X., Liu, Q., Wang, J., Liu, X., 2014. Isoorientin attenuates lipopolysaccharide-induced pro-inflammatory responses through down-regulation of ROS-related MAPK/NF-kappaB signaling pathway in BV-2 microglia. Mol. Cell Biochem. 386, 153-165. Zhang, J., Wang, Y., Zhang, X.-Q., Zhang, Q., Ye, W., 2009. Chemical constituents from the leaves of Lophatherum gracile. Chin. J. Nat. Med. 7, 428-431. Zhuang, L., Chen, L.F., Zhang, Y.B., Liu, Z., Xiao, X.H., Tang, W., Wang, G.C., Song, W.J., Li, Y.L., Li, M.M., 2017. Watsonianone A from Rhodomyrtus tomentosa Fruit Attenuates Respiratory-Syncytial-Virus-Induced Inflammation In Vitro. J. Agric. Food Chem. 65, 3481-3489. Zhu, X.Z., Shen, W.W., Gong, C.Y., Wang, Y., Ye, W.C., Li, Y.L., Li, M.M., 2015. Antiviral activity of isoorientin against respiratory syncytial virus in vitro and in vivo. J. SUMS. 36, 352-359.

Figure Captions Figure 1. HPLC chromatogram of DZY exhibiting eight overlapping peaks. The peaks were

identified

as

follows:

a,

isoorientin;

b,

swertiajaponin;

c,

piceatannol-3'-O-β-D-glucopyranoside; d, p-Coumaric acid; e, piceid; f, rhaponticin; g, 3, 5-di-caffeoylquinic acid, and h, 3, 4-di-caffeoylquinic acid. Figure 2. Anti-inflammatory activity of DZY in vitro. The inhibitory effect of (A) DZY and (B) dexamethasone on RSV-induced NO production. The results are expressed as mean ± SD from three parallel experiments. ***P < 0.001 compared with the control group. Figure 3. (A) Effect of DZY on viral load in the lung tissue of RSV-infected mice. The results are expressed as mean ± SD from three parallel experiments. ***P < 0.001 compared with the control group. Figure 4. (A) Effect of DZY on lung index of mice infected with RSV. (B) The effect of DZY on histopathological changes in the lung tissue of RSV-infected mice (100X). (a) Control group; (b) Viral group; (c) DZY-treated alone group; (d) Ribavirin group; (e) DZY-treated group (250 mg/kg/d); (f) DZY-treated group (500 mg/kg/d); (g) DZY-treated group (1000 mg/kg/d); (h) DZY-treated group (2000 mg/kg/d). The results are expressed as mean ± SD from three parallel experiments. ###P < 0.001 compared with the control group. ***

P < 0.001 compared with the viral control group.

Figure 5. Effect of DZY on mRNA and protein expression of inflammatory factors. (A) IL-1β, (B) TNF-α, and (C) IFN-γ. The results are expressed as mean ± SD from three parallel experiments.

###

P < 0.001 compared with the control group. *P < 0.01; ***P <

0.001 compared with the viral control group.