Apelin in goldfish (Carassius auratus): Cloning, distribution and role in appetite regulation

Peptides 30 (2009) 1434–1440

Contents lists available at ScienceDirect

Peptides journal homepage: www.elsevier.com/locate/peptides

Apelin in goldfish (Carassius auratus): Cloning, distribution and role in appetite regulation He´le`ne Volkoff *, Jessica L. Wyatt Departments of Biology and Biochemistry, Memorial University of Newfoundland, St. John’s, NL, A1B 3X9 Canada

A R T I C L E I N F O

A B S T R A C T

Article history: Received 30 March 2009 Received in revised form 29 April 2009 Accepted 29 April 2009 Available online 7 May 2009

Apelin is a recently discovered peptide produced by several tissues including brain and adipose tissue. In mammals and zebrafish, apelin regulates cardiovascular functions. Recent evidence in mammals suggest that apelin might also regulate food intake. In this study, we cloned a cDNA encoding apelin and examined apelin mRNA distribution within the brain and in peripheral tissues. We also assessed the effects of fasting on apelin brain mRNA abundance. Apelin mRNA was expressed throughout the brain as well as in several peripheral tissues including brain, spleen, heart and fat. Apelin mRNA abundance in both hypothalamus and telencephalon was significant higher in fasted fish than in fed fish. In order to further characterize apelin in goldfish, we assessed the effects of central (intracerebroventricular, icv) and peripheral (intraperitoneal, ip) injections of apelin-13 on food intake in goldfish. Apelin injected ip at a dose of 100 ng/g or icv at a dose of 10 ng/g induced a significant increase in food intake compared to saline-injected fish. Our results suggest that apelin acts as an orexigenic factor in goldfish. Its widespread distribution in the brain and the periphery also suggests that apelin might have multiple physiological regulating roles in fish. ß 2009 Elsevier Inc. All rights reserved.

Keywords: Apelin Feeding Goldfish Cloning Distribution Food intake RNA expression

1. Introduction Apelin is a recently discovered peptide identified as a ligand for the APJ receptor, a putative receptor protein related to the type 1 angiotensin receptor and a member of the family of seven transmembrane-domain G protein-coupled receptors (GPCRs) [24,26]. In mammals, a 77 amino acids (aa) precursor, preproapelin, gives rise to several forms of apelin, which can be composed of 13–36 aa residues [23,27]. In mammals, apelin is widely expressed in various organs such as the heart, lung, kidney, adipose tissue, gastrointestinal tract and brain [22]. Apelin regulates cardiovascular functions in mammals, including blood pressure and blood flow [25]. It is one of the most potent stimulators of cardiac contractility yet identified, and plays a role in cardiac tissue remodeling [5,18,22]. Apelin also regulates fluid homeostasis and has been shown to affect water intake as well pituitary hormone release [1]. Apelin also appears to be involved the regulation of metabolism and digestive processes. Apelin is up-regulated in obese and hyperinsulinemic humans and mice [3,9] and dysregulation of apelin might be involved in the development of diabetes mellitus and obesity [10,36]. In rodents,

* Corresponding author. Tel.: +1 709 737 2140; fax: +1 709 737 3018. E-mail address: [email protected] (H. Volkoff). 0196-9781/$ – see front matter ß 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.peptides.2009.04.020

apelin and its receptor have been detected in the arcuate and paraventricular nuclei of the hypothalamus, which are involved in the control of feeding behavior and energy expenditure [24,38]. However, the effects of apelin on food intake are unclear, as contradictory results have been reported in rodents. Chronic intracerebroventricular (icv) infusion of apelin-13 increases food intake in mice [46] whereas acute icv administration of apelin-13 either decrease or have no effect on feeding in diet-induced obese rats [6]. Similarly, in rats, night-time and day-time acute icv administration of apelin-12 decreases and stimulates, respectively [33]. In fish, little is known about the structure or function of apelin. In zebrafish, the only fish for which an apelin sequence is available, reduced or excess apelin receptor or apelin function causes deficiencies in cardiac development and function [35,40,48], suggesting an important role of apelin in the development of cardiovascular functions in fish. Nothing is known about the role of apelin in regulating feeding or energy homeostasis in fish. In order to assess the role of apelin in feeding in goldfish, we have cloned a cDNA encoding apelin in goldfish, examined its tissue distribution and assessed the effects of fasting on the brain mRNA abundance of apelin. In order to further characterize apelin in fish, we also performed peripheral and central injections of this peptide, followed by quantification of food intake.

H. Volkoff, J.L. Wyatt / Peptides 30 (2009) 1434–1440

1435

2. Materials and methods

Table 1 Primers used in the cDNA cloning, tissue distribution and qPCR analysis.

2.1. Experimental animals

Primer

Sequence

Degenerate primers dApln-F dApln-R

50 GGTCCAATGGCCTCCACGGAG 30 50 TAGAATGGCATTGGCCCCTTRTG 30

Primers for 30 and 50 RACE 30 RC-Apln1 30 RC-Apln2 50 RC-Apln1 50 RC-Apln2 50 RC-Apln3

50 50 50 50 50

Specific primers for RT- and qPCR Apln-F Apln-R

50 GAGCATAGCAAAGAGCTGGA 30 50 CTCCTCCAGCCAGAAGGTCT 30

Adaptor primers dT-AP AP

50 GGCCACGCGTCGACTAGTAC(T17) 30 50 GGCCACGCGTCGACTAGTAC 30

Primers for internal control EF-F EF-R

50 GAAGAACGTGTCTGTCAAGG 30 50 GTTCAGGATGATGACCTGAG 30

Goldfish ranging from 25 to 50 g in weight were purchased from Ozark Fisheries (Martinsville, IN, USA). Fish were kept under a simulated photoperiod of 16 h light:8 h dark in 65 l tanks, with constantly aerated and filtered water at 20 8C. The sides of the tanks were opaque to minimize external disturbances. Fish were fed a 2% wet body weight (bw) ration once a day (12:00), with commercially prepared 2.5 mm  1 cm cylindrical trout pellets (Corey Aquafeeds, Fredericton, NB, Canada). Fish were acclimated under these standard conditions for a minimum of two weeks before the start of an experiment. Fish in any one given experiment were all at the same reproductive stage (gonadal recrudescent to mature). Both males and females were used. For the fasting experiment, 30 fish were divided into 4 tanks (7–8 fish per tank) and acclimated for one week and fed according to the conditions described previously. After the acclimation period, two tanks continued to be fed while two tanks were fasted for 5 days. After 5 days, 14 fish from each group (6–8 fish per duplicate tank) were sampled. All fish were killed by immersion in 0.05% tricaine methanesulfonate (MS 222) (Syndel Laboratories, Vancouver, British Columbia, Canada) followed by spinal section and tissues sampled. All experiments were carried out in accordance with the principles published in the Canadian Council on Animal Care’s guide to the care and use of experimental animals. 2.2. Cloning and expression studies 2.2.1. RNA extraction For cloning and tissue distribution studies, two fed fish were dissected to obtain samples of brain and peripheral tissues (gill, heart, gut, spleen, liver, kidney, muscle, fat and gonad). For brain tissue distribution, individual brains were further dissected into hypothalamus, telencephalon, optic tectum–thalamus, and posterior brain (including the cerebellum), olfactory bulbs and pituitary according to a previously established brain morphology for goldfish [34]. Tissues were dissected and immediately placed on ice in RNAlater (Qiagen, Mississauga, Ontario, Canada) and stored at 20 8C until RNA extractions were performed. Total RNA was isolated using a trizol/chloroform extraction with Tri-reagent (BioShop, Mississauga, Ontario, Canada) (for cloning and tissue distribution studies and qPCR analyses of whole brain expression) or with a RNAqueous1-4PCR kit (Ambion, Streetsville, Ontario, Canada) (for qPCR analyses of hypothalamus and telencephalon expressions) following the manufacturers’ protocols. Final RNA concentrations were determined by optical density reading at 260 nm using a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies Inc., Wilmington, USA). The quality of RNA samples was assessed by measuring the ratio of sample absorbance at 260 and 280 nm. Only RNA samples with a ratio between 1.8 and 2.1 were used. 2.2.2. Cloning of cDNA Two micrograms of total RNA were reverse transcribed to cDNA, using a QuantiTect Reverse Transcription kit (Qiagen), according to the manufacturer’s protocol. 0.5 mg of cDNA were then submitted to PCR amplifications. A small fragment of the unknown sequence was isolated by performing PCR amplifications using degenerate forward and reverse primers (dApln-F, and -R, Table 1) designed in regions of high identity between zebrafish (Genbank accession number DQ062434) and various mammalian sequences. PCR reactions were carried out in a volume of 25 ml using JumpStart Taq DNA polymerase (Sigma, St. Louis, MO, USA). PCR products

CCCGCCTCTCCCATAAGGGGC 30 CACAAGGGGGCCAATGCCATTCTA 30 CCTCCTCCAGCCACAAGGTC 30 TCTGCCGCAAAGGAGTCCTC 30 TCGCCCACCTCCTCCAGCTC 30

were electrophoresed in a 1% agarose gel, and visualized using an Epichemi Darkroom BioImaging System (UVP, Upland, CA, USA) equipped with a 12-bit cooled camera. Image processing and analysis were performed using LabWorks 4.0 software (UVP). Bands of predicted size were isolated and purified with the GenElute Gel Extraction Kit (Sigma, Oakville, Ontario, Canada), cloned using a pGEM-T easy vector system (Promega, Madison, WI, USA) and sequenced by the MOBIX Lab (McMaster University, Ontario, Canada). In order to isolate the 30 region of apelin, 30 Rapid Amplification of cDNA Ends (30 RACE) was used. Briefly, brain mRNA was subjected to reverse transcription and the cDNA submitted to two rounds of PCRs, using 30 RC-Apln1 and dT-AP, and 30 RC-Apln2 and AP (Table 1). The PCR products were electrophoresed, and the bands of expected size were isolated, purified, cloned, and sequenced as described above. To isolate the 50 portion of the cDNA, 50 RACE was used. The first strand of cDNA was generated from mRNA with reverse transcription reaction with 50 RC-Apln1, purified using a Montage PCR Millipore kit (Bedford, MA, USA) and polyA-tailed using Terminal Deoxynucleotidyl Transferase (Invitrogen, Burlington, Ontario, Canada). The product was then amplified using two rounds of nested PCR using 50 RC-Apln2 and dT-AP and 50 RC-Apln3 and AP. PCR products were then purified, cloned and sequenced as described previously. 2.2.3. Brain and tissue distribution by RT-PCR The distributions of apelin mRNA in different tissues and within the brain were studied by semi-quantitative RT-PCR. Total RNA was isolated and reverse transcribed as described above. PCRs for apelin mRNAs were then conducted with pairs of specific primers, Apln-F and -R (Table 1). Elongation factor 1a (EF1a) was used as an internal control with primer pair, EF-F and -R. Primers were designed based on cloned sequences for apelin (GenBank accession number FJ755698) and EF1a (GenBank accession number AB056104), using Primer 3 software (http://primer3.sourceforge.net) (Table 1). The primers were designed to have similar melting temperatures and to give similar amplicon sizes. PCR reactions were carried out in a volume of 25 ml using the GoTaq1 Green Master Mix (Promega). The PCR cycling conditions for all reactions were 95 8C for 3 min, followed by 30 cycles of 94 8C for 30 s, 57 8C for 30 s, and 72 8C for 45 s and a final elongation step of 72 8C for 3 min PCR products were then electrophoresed and visualized as described above.

1436

H. Volkoff, J.L. Wyatt / Peptides 30 (2009) 1434–1440

2.2.4. Quantitative PCR For quantitative PCR, 1 mg of total RNA from whole brain (excluding medulla and olfactory bulbs), hypothalamus or telencephalon samples were reverse transcribed, diluted 1:2 in water and submitted to a PCR using specific primers (Apln-F and -R, EF-F and -R, Table 1). All PCR reactions were prepared using an epMotion1 5070 automated pipetting system (Eppendorf) in a final volume of 10 ml containing 2 ml of cDNA, 1 mM of each sense and antisense primer, and 5 ml master mix of the QuantiFast SYBR Green PCR Kit (Qiagen). Amplifications were performed using a Mastercycler1 ep realplex 2S system (Eppendorf). Initial validation experiments were conducted to determine optimal primer annealing temperatures. Estimation of the efficiency was performed using the serial dilution method: five dilutions (undiluted, 1:2, 1:4, 1:8, 1:16) of a cDNA sample were amplified using the apelin and EF1a amplicons. Each dilution was analyzed with two replicate PCR reactions. Linear regression parameters (efficiencies and R2) were calculated using the Realplex1.5 software (Eppendorf). Results showed that PCRs were reproducible (R2 > 0.98) and that apelin and EF1a had similar PCR efficiencies (0.92 for apelin and 0.98 for EF1a). For all dilution samples, the gene of interest (apelin) was normalized to the reference gene (EF1a) and expression levels were compared using the relative Ct method using the Realplex1.5 software (see below). Fold expression levels were similar (approximately 1) for all samples, suggesting that quantification was consistent and independent of sample dilution. The specificity of the primer pairs was verified by gel electrophoresis as well as by dissociation curve analysis using the Realplex1.5 software (Eppendorf). Amplicons exhibited a single fragment when electrophoresed on a 1.5% agarose gel and a single peak in dissociation curve analysis. EF1a was used as a reference gene in this method, as it is considered a housekeeping gene and its expression did not differ either among brain regions or among treatments (as seen by similar Ct values). Following the validation experiments, relative quantification experiments were conducted on 96-well plates under the following conditions: 95 8C for 5 min followed by 40 cycles of 95 8C for 15 s, 58 8C for 15 s and 68 8C for 20 s. Samples were analyzed in duplicate, and experiments were repeated at least twice. In all cases, a no template negative control (in which cDNAs were replaced by water) was included. Expression levels were compared using the relative Ct (DDCT) method using the Realplex1.5 software (Eppendorf). Briefly, the average CT of the reference gene (EF1a) was subtracted from the average CT of the gene of interest (apelin) to determine the DCT for each sample. The DCT of the calibrator (brain from a fed, control fish) was then subtracted from the DCT of each of the samples to determine the DDCT. This number was then used to determine the amount of mRNA relative to the calibrator and normalized by EF1a. Data was provided as fold changes in expression relative to the reference gene and compared to a calibrator sample from the control group (fed group), which was arbitrarily set at 1. The average fold of all the control samples was taken and set at 100%. The fasted group was then normalized relative to the control group. These percentage values (100% for the control and other % for the other groups) were then compared statistically. 2.3. Injections and behavioral observations 2.3.1. Intracerebroventricular (icv) injections Brain icv injections were administered following procedures described previously [15,34]. Briefly, following deep anesthesia in MS222, a flap was cut in the roof of the skull using a drill equipped with a circular saw. The flap was then folded to the side, exposing

the brain. 2 ml of test solution (saline, n = 8; apelin-13 at 1 ng/g, n = 5; apelin-13 at 10 ng/g, n = 6) were injected with a 5 ml Hamilton microsyringe into the brain third ventricle, using a specially designed stereotaxic apparatus, according to coordinates (+1.0, M, D 1.2) taken from the stereotaxic atlas of the goldfish brain [34]. Following surgery, the skull flap was secured by surgical thread and tissue adhesive (VetBond, 3 M). Fish were returned to their tanks, and normally recovered from anesthesia within 5– 10 min. 2.3.2. Intraperitoneal (ip) injections Fish were lightly anesthetized in MS222 and 100 ml of test solution (saline, n = 11; apelin-13 at 50 ng/g, n = 5; apelin-13 at 100 ng/g, n = 9) was injected into the peritoneal cavity, caudal to the pelvic fins, using a 26-G needle attached to a 250 ml Hamilton syringe. Fish were then returned to their tanks, and allowed to recover from anesthesia. 2.3.3. Feeding behavior observations For each experiment, two fish were injected at a time and observed for feeding behavior and food consumption. An approximate 4% body weight ration of pellets per fish was administered at 15 min post-injection. Fish were tested in random order in terms of treatment and days. Experiments were carried out at the regular feeding time the fish had been adapted to (12:00). Observations began when fish were offered pellets into the tank. Food consumption was measured by counting the number of pellets eaten by each individual fish per hour, so that n = 1 represents one fish. Food consumption was converted to milligrams of food consumed/wet body weight/time feeding based on the mean pellet weight fed to fish (approximately 50 mg/pellet). Stressed animals occurred only rarely and were easily detected as they displayed characteristic behavioral signs, such as rapid opercular movements and lowering of the fins. These fish were immediately sacrificed and were not taken into consideration in the study. To verify that the injection procedures themselves did not influence feeding, food intake was assessed for unhandled fish as well as for control fish submitted to either anesthesia alone or sham operations, and compared to saline-treated animals. 2.4. Reagents Rat apelin-13 was purchased from American Peptides Company (Sunnyvale, CA, USA). Stock solutions were made in water, aliquoted and stored at 20 8C. Aliquots were subsequently thawed and diluted in fish physiological saline (NaCl 5.9 g/l; KCl 0.25 g/l; CaCl2 0.28 g/l; NaHCO3 2.1 g/l; KH2PO4 1.6 g/l; MgSO47H2O 0.29 g/l; glucose 2.0 g/l [2]) prior to use. Doses were chosen based on previous studies using apelin injections in rats [46]. 2.5. Sequence analysis and statistics DNA and deduced protein sequences were analyzed by the Basic Local Alignment Search Tool (BLAST) available from the National Center for Biotechnology Information (NCBI) website (www.ncbi.nlm.nih.gov). Multiple alignments of amino acid sequences were performed using ClustalW software (www.ebi.ac. uk/clustalw/). Signal peptides were predicted using Signal P 3.0 software (www.cbs.dtu.dk/services/SignalP/). All statistical tests were performed using InStat 3.0 (GraphPad Software, San Diego, CA). Significance was considered at p < 0.05. Data is expressed as mean  SEM. When comparing apelin expressions between fed and fasted fish, all samples are expressed as ratios of specific target gene to EF1a and normalized as a percentage of

H. Volkoff, J.L. Wyatt / Peptides 30 (2009) 1434–1440

1437

Fig. 1. (A) Predicted amino acid sequence for goldfish apelin. Untranslated regions are in small case letters. The putative signal peptide is underlined. Apelin-13 is shaded. The stop codon is indicated by a star (*). Potential polyadenylation sites are in bold letters. (B) Amino acid sequence alignment of goldfish apelin with zebrafish (Genbank accession number DQ062434), Xenopus (Genbank accession number NM_001097924), rat (Genbank accession number NM031612) and human (Genbank accession number NM_017413) apelins.

mRNA levels of fish in the control (fed) group. Relative apelin expressions between fed and fasted fish were compared using Student’s t tests. For food intake data, statistical differences between control and treatment groups were assessed using ANOVAs followed by pair-wise Student–Newman–Keuls multiple comparison tests.

apelin expression was detected in all regions examined as well as in pituitary (Fig. 2A). In the periphery, apelin expression was detected in all tissues examined with apparent higher expression levels in spleen, kidney, brain, gonad, gill and heart (Fig. 2B). 3.2. Effects of fasting on apelin brain expression

3. Results 3.1. Cloning and tissue distribution The goldfish apelin cDNA sequence is a 1175 bp sequence (GenBank accession number FJ755698) that includes a 210 bp 50 UTR and a 734 bp 30 UTR (Fig. 1A). The open reading frame (231 bp) contains 77 amino acids encoding for preproapelin, which contains a 22 amino acids signal peptide (MNVKILTLVIVLVVSLLCSASA). At the amino acid level, goldfish pre-apelin displayed 97% similarity with zebrafish pre-apelin, 43% with Xenopus pre-apelin and 35–38% similarity with mammalian pre-apelin (Fig. 1B). The last 12 amino acids in the C-terminal region (RPRLSHKGPMPF) are conserved between all species. At the nucleotide level, the open reading frame of goldfish apelin displayed 95%, similarities with zebrafish and 15% similarity with both Xenopus and mammalian apelins. Reverse transcription PCR (RT-PCR) was used to amplify apelin in different brain regions as well as several peripheral tissues (Fig. 2). A 104 bp fragment was amplified for apelin and a 108 bp fragment was amplified for the control gene EF-1a. No expression was detected in any negative control samples. Within the brain,

There were no significant differences in apelin whole brain mRNA abundance between fed and fasted fish (Fig. 3, Br). Apelin mRNA abundance levels were higher in fasted fish than in fed fish

Fig. 2. RT-PCR distribution of apelin (108 bp) and EF-1a (104 bp) in different brain regions (A) and peripheral tissues (B) of goldfish. L, ladder; OT, optic tectum/ thalamus; PB, posterior brain/cerebellum; OB, olfactory bulbs and tract; PIT, pituitary; H, hypothalamus; T, telencephalon; ctl: control; sp, spleen; ki, kidney; li, liver; m, muscle; br, brain; gu, gut; go, gonad; gi, gill; h, heart; f: fat.

1438

H. Volkoff, J.L. Wyatt / Peptides 30 (2009) 1434–1440

Fig. 3. Apelin mRNA abundance in whole brain (Br), hypothalamus (H) and telencephalon (T) of fed and fasted goldfish (n = 5–8 fish per group). Expression levels in the fed group were normalized to 100%. Data is presented as mean  SEM. Stars indicate significant differences between the fed and fasted groups.

in both hypothalamus (p = 0.05) and telencephalon (p = 0.0338) (Fig. 3, H and T). 3.3. Effects of ip and icv apelin injections on food intake There were no significant differences in food intake between untreated (7.6  2.4 mg/g) or sham-operated (6.6  1.5 mg/g) fish and saline-injected fish for both icv and ip injections, showing that the injections per se did not affect feeding. Ip injections of apelin at 100 ng/g induced a significant increase in food intake compared to the saline treatment (Fig. 4A). Fish injected ip with apelin at 50 ng/g had a food intake similar to that of saline-injected fish and fish treated with apelin at 100 ng/g (Fig. 4A). Fish injected icv with 10 ng/g had a significant higher food intake than both control saline-injected fish and fish injected with apelin at 1 ng/g (Fig. 4B). Fish injected icv with apelin at 1 ng/g had a food intake similar to that of control fish.

the red pulp of the spleen, and apelin suppresses cytokine production from mouse spleen cells [12], suggesting that apelin regulates immune responses in vertebrates. In fish, the spleen is also involved in the immune response [11], and high expression levels of apelin mRNA in goldfish spleen might indicate that apelin plays a similar role in fish. The presence of apelin mRNA expression

4. Discussion As in all other vertebrates, the goldfish apelin precursor is 77 amino acids long [16,20,28] and contains the C-terminal apelin-13 sequence [(Q/P) RPRLSHKGPMPF], which, with the exception of one amino acid, is fully conserved across species studied to date, suggesting this region is critical for binding and activation of the APJ receptor. In goldfish, apelin mRNA is present throughout the brain as well as in the pituitary and in several peripheral tissues. Our results are consistent with studies in mammals showing that apelin and its receptor are widely expressed in brain and central nervous system [20] as well as the pituitary [39]. Within the mammalian brain, they are highly expressed in the hypothalamus, in particular in the supraoptic and paraventricular nuclei where they are co-localized with vasopressin (AVP) [38] and in the arcuate nucleus, a region involved in the control of feeding behavior and energy expenditure [24,38]. The widespread distribution of apelin in goldfish brain and pituitary and its presence in the hypothalamus suggests that apelin might regulate a number of physiological functions in fish, such as osmoregulation and feeding. In goldfish, apelin mRNA is present in spleen, kidney, liver, muscle, brain, gut, gonad (ovary), gill, heart and fat tissue. In mammals, apelin expression has also been shown to have a widespread peripheral distribution and to be present in several tissues including heart, lung, gonads, kidney, mammary gland, gastric mucosa and adipose tissue [20]. In both mammals [7] and reptiles [8], strong apelin immunoreactivity has been detected in

Fig. 4. Effects of ip (A) and icv (B) injections on food intake of goldfish. Fish were ip injected with either saline (n = 11), apelin-13 at 50 ng/g (n = 5), or apelin-13 at 100 ng/g (n = 9). Fish were icv injected with either saline (n = 8), apelin-13 at 1 ng/g (n = 5), or apelin-13 at 10 ng/g (n = 6). Fish received food 15 min post-injection, and their food intake monitored for 1 h. Data is mean  SEM. Bars with dissimilar superscripts indicate groups that differ significantly.

H. Volkoff, J.L. Wyatt / Peptides 30 (2009) 1434–1440

in goldfish kidney is consistent with studies in rats showing that APJ mRNA is expressed in kidney glomeruli and nephrons [17,32]. Intravenous injections of apelin-17 in rodents have been shown to induce a significant diuresis [17], suggesting that apelin has a role in the regulation of kidney function and fluid homeostasis. However, the exact role of apelin in fluid homeostasis is not clear as administration of apelin to rats have been shown to either decrease [37] or increase [43] water intake. Apelin is expressed in heart and gill of goldfish. Apelin has been shown to regulate cardiovascular functions in both mammals and non-mammalian species [5]. In mammals, apelin and APJ are both expressed in heart and vascular smooth muscle cells [20] and apelin-deficient mice display impaired cardiac contractility [21]. In Xenopus, APJ mRNA is expressed in lungs and heart [29] and in zebrafish, either deficiency or excess apelin impairs gastrulation and heart formation [40,48]. To our knowledge, the presence of apelin has never been documented in fish gills. The strong expression of apelin in gills and heart of goldfish seem to confirm a role for apelin in the regulation of cardiovascular functions in fish. We found relatively high expression levels of apelin in the gonad of goldfish, which might indicate a possible role for apelin in the regulation of reproductive events in fish. In bovine ovaries, both apelin and APJ mRNAS are expressed in thecal cells, where their expression is induced by luteinizing hormone (LH) [41]. Apelin mRNA and protein have also been reported in rat ovary, uterus, mammary gland and testis [20]. Interestingly, in Xenopus, APJ mRNA expression has been reported testis but not in ovary [29]. Because of the widespread distribution of apelin within the brain, we first examined the effects of fasting on the expression of apelin in the whole brain and found no significant differences in brain apelin expression between fed and fasted fish. The lack of effect of fasting on apelin whole brain expression was most probably due to the fact that by using the whole brain, the signal was ‘‘diluted’’ and modest changes in expression could not be detected. We thus further examined the expression of apelin in two brain regions that have been shown to be important areas of regulation of energy homeostasis and feeding in fish, the hypothalamus and the telencephalon [47], and found a significant increase in apelin mRNA abundance in both regions. Little is known about the effects of nutritional status and fasting on apelin gene expression. In humans, high fat diets induce an up-regulation of the hypothalamic expression of the APJ receptor [6] and obese individuals have higher adipose tissue apelin and APJ mRNA abundance than lean individuals. This increase in expression can be reverted to ‘‘normal’’ levels if individuals are submitted to a hypocaloric diet associated with weight reduction [4]. In goldfish, an increase in apelin expression in hypothalamus and telencephalon is consistent with a role of apelin as an orexigenic factor. A fasting-induced up-regulation of mRNA abundance has previously been shown for several appetite stimulators in goldfish. These include NPY [31], orexin [30] and ghrelin [45]. Our results show that both ip and icv injections of apelin-13 increase food intake in goldfish. To our knowledge, this is the first report of an effect of apelin on feeding in a non-mammalian vertebrate. The effective doses are similar to effective doses for other peripheral appetite regulators in goldfish, such as cholecystokinin [14] or amylin [44]. In mammals, the role of apelin in the regulation of appetite remains unclear. Peripherally administered apelin does not appear to affect feeding in rodents as either single intravenous injections of apelin-13 [42] or long-term apelin peripheral treatment (repeated intraperitoneal injections for 14 days) [13] have no effect on food intake. Apelin-13 has been shown to increase food intake when administered chronically by icv infusion in C57BL/6 mice [46], and apelin-12 stimulates feeding in rats following acute icv administration during the day-time [33]. However, other studies have shown that acute icv administration

1439

of apelin-13 decreases food intake in both fed and starved rats [42] and only induce a slight increase in food intake 2–4 h after postinjection in rats [43]. In goldfish, apelin-13 acted as an orexigenic factor, as both peripheral and central injections stimulated feeding. It is noteworthy that fish injected with apelin displayed an increase not only in feeding behavior but also in locomotor activity/ searching behavior, which is consistent with previous reports on increased locomotor activity in icv apelin-13-injected rats [19]. 5. Conclusion In conclusion, we have shown that apelin increases food intake in goldfish when administered either peripherally or centrally and that fasting induces increases in hypothalamic and telencephalic mRNA abundance, suggesting that apelin might be an important regulator of feeding and energy homeostasis in fish. The widespread central and peripheral distribution of apelin mRNA also suggests that this peptide might be involved in the regulation of many diverse physiological functions in fish, including immunity, osmoregulation and reproduction. Acknowledgments This work was supported by a Natural Sciences and Engineering Research Council Discovery (DG) and Research Tools and Instruments (RTI) grants to H.V. We thank Jason Noseworthy and Rowena MacGowan for their assistance in obtaining and maintaining the animals. References [1] Azizi M, Iturrioz X, Blanchard A, Peyrard S, De Mota N, Chartrel N, et al. Reciprocal regulation of plasma apelin and vasopressin by osmotic stimuli. J Am Soc Nephrol 2008;19:1015–24. [2] Burnstock G. Saline for fresh-water fish. J Physiol Biochem 1958;41:35–45. [3] Carpene C, Dray C, Attane C, Valet P, Portillo MP, Churruca I, et al. Expanding role for the apelin/APJ system in physiopathology. J Physiol Biochem 2007;63:359–73. [4] Castan-Laurell I, Vitkova M, Daviaud D, Dray C, Kovacikova M, Kovacova Z, et al. Effect of hypocaloric diet-induced weight loss in obese women on plasma apelin and adipose tissue expression of apelin and APJ. Eur J Endocrinol 2008;158:905–10. [5] Chandrasekaran B, Dar O, McDonagh T. The role of apelin in cardiovascular function and heart failure. Eur J Heart Fail 2008;10:725–32. [6] Clarke KJ, Whitaker KW, Reyes TM. Diminished metabolic responses to centrally-administered apelin-13 in diet-induced obese rats fed a high-fat diet. J Neuroendocrinol 2009;21:83–9. [7] De Falco M, De Luca L, Onori N, Cavallotti I, Artigiano F, Esposito V, et al. Apelin expression in normal human tissues. In Vivo 2002;16:333–6. [8] De Falco M, Fedele V, Russo T, Virgilio F, Sciarrillo R, Leone S, et al. Distribution of apelin, the endogenous ligand of the APJ receptor, in the lizard Podarcis sicula. J Mol Histol 2004;35:521–7. [9] Dray C, Knauf C, Daviaud D, Waget A, Boucher J, Buleon M, et al. Apelin stimulates glucose utilization in normal and obese insulin-resistant mice. Cell Metab 2008;8:437–45. [10] Erdem G, Dogru T, Tasci I, Sonmez A, Tapan S. Low plasma apelin levels in newly diagnosed type 2 diabetes mellitus. Exp Clin Endocrinol Diabetes 2008;116:289–92. [11] Fa¨nge R, Nilsson S. The fish spleen: structure and function. Cell Mol Life Sci (CMLS) 1985;41:152–8. [12] Habata Y, Fujii R, Hosoya M, Fukusumi S, Kawamata Y, Hinuma S, et al. Apelin, the natural ligand of the orphan receptor APJ, is abundantly secreted in the colostrum. Biochim Biophys Acta 1999;1452:25–35. [13] Higuchi K, Masaki T, Gotoh K, Chiba S, Katsuragi I, Tanaka K, et al. Apelin, an APJ receptor ligand, regulates body adiposity and favors the messenger ribonucleic acid expression of uncoupling proteins in mice. Endocrinology 2007;148:2690–7. [14] Himick BA, Peter RE. CCK/gastrin-like immunoreactivity in brain and gut, and CCK suppression of feeding in goldfish. Am J Physiol 1994;267:R841–51. [15] Hoskins LJ, Xu M, Volkoff H. Interactions between gonadotropin-releasing hormone (GnRH) and orexin in the regulation of feeding and reproduction in goldfish (Carassius auratus). Horm Behav 2008;54:379–85. [16] Hosoya M, Kawamata Y, Fukusumi S, Fujii R, Habata Y, Hinuma S, et al. Molecular and functional characteristics of APJ. Tissue distribution of mRNA and interaction with the endogenous ligand apelin. J Biol Chem 2000;275: 21061–7.

1440

H. Volkoff, J.L. Wyatt / Peptides 30 (2009) 1434–1440

[17] Hus-Citharel A, Bouby N, Frugiere A, Bodineau L, Gasc JM, Llorens-Cortes C. Effect of apelin on glomerular hemodynamic function in the rat kidney. Kidney Int 2008;74:486–94. [18] Japp AG, Newby DE. The apelin-APJ system in heart failure: pathophysiologic relevance and therapeutic potential. Biochem Pharmacol 2008;75:1882–92. [19] Jaszberenyi M, Bujdoso E, Telegdy G. Behavioral, neuroendocrine and thermoregulatory actions of apelin-13. Neuroscience 2004;129:811–6. [20] Kawamata Y, Habata Y, Fukusumi S, Hosoya M, Fujii R, Hinuma S, et al. Molecular properties of apelin: tissue distribution and receptor binding. Biochim Biophys Acta 2001;1538:162–71. [21] Kuba K, Zhang L, Imai Y, Arab S, Chen M, Maekawa Y, et al. Impaired heart contractility in Apelin gene-deficient mice associated with aging and pressure overload. Circ Res 2007;101:e32–42. [22] Ladeiras-Lopes R, Ferreira-Martins J, Leite-Moreira AF. The apelinergic system: the role played in human physiology and pathology and potential therapeutic applications. Arq Bras Cardiol 2008;90:343–9. [23] Langelaan DN, Bebbington EM, Reddy T, Rainey JK. Structural insight into Gprotein coupled receptor binding by apelin. Biochemistry 2009;48:537–48. [24] Lee DK, Cheng R, Nguyen T, Fan T, Kariyawasam AP, Liu Y, et al. Characterization of apelin, the ligand for the APJ receptor. J Neurochem 2000;74:34–41. [25] Llorens-Cortes C, Kordon C. Jacques Benoit lecture: the neuroendocrine view of the angiotensin and apelin systems. J Neuroendocrinol 2008;20:279–89. [26] Llorens-Cortes C, Moos F. Opposite potentiality of hypothalamic coexpressed neuropeptides, apelin and vasopressin in maintaining body-fluid homeostasis. Prog Brain Res 2008;170:559–70. [27] Malyszko J, Malyszko JS, Pawlak K, Mysliwiec M. Visfatin and apelin, new adipocytokines, and their relation to endothelial function in patients with chronic renal failure. Adv Med Sci 2008;53:32–6. [28] Medhurst AD, Jennings CA, Robbins MJ, Davis RP, Ellis C, Winborn KY, et al. Pharmacological and immunohistochemical characterization of the APJ receptor and its endogenous ligand apelin. J Neurochem 2003;84:1162–72. [29] Moon MJ, Oh DY, Moon JS, Kim DK, Hwang JI, Lee JY, et al. Cloning and activation of the bullfrog apelin receptor: Gi/o coupling and high affinity for [Pro1]apelin-13. Mol Cell Endocrinol 2007;277:51–60. [30] Nakamachi T, Matsuda K, Maruyama K, Miura T, Uchiyama M, Funahashi H, et al. Regulation by orexin of feeding behaviour and locomotor activity in the goldfish. J Neuroendocrinol 2006;18:290–7. [31] Narnaware YK, Peyon PP, Lin X, Peter RE. Regulation of food intake by neuropeptide Y in goldfish. Am J Physiol Regul Integr Comp Physiol 2000;279:R1025–34. [32] O’Carroll AM, Selby TL, Palkovits M, Lolait SJ. Distribution of mRNA encoding B78/apj, the rat homologue of the human APJ receptor, and its endogenous ligand apelin in brain and peripheral tissues. Biochim Biophys Acta 2000;1492:72–80. [33] O’Shea M, Hansen MJ, Tatemoto K, Morris MJ. Inhibitory effect of apelin-12 on nocturnal food intake in the rat. Nutr Neurosci 2003;6:163–7.

[34] Peter RE, Gill VE. A stereotaxic atlas and technique for forebrain nuclei of the goldfish, Carassius auratus. J Comp Neurol 1975;159:69–102. [35] Quertermous T. Apelin and its g protein-coupled receptor regulate cardiac development as well as cardiac function. Dev Cell 2007;12:319–20. [36] Rayalam S, Della-Fera MA, Krieg PA, Cox CM, Robins A, Baile CA. A putative role for apelin in the etiology of obesity. Biochem Biophys Res Commun 2008;368:815–9. [37] Reaux A, De Mota N, Skultetyova I, Lenkei Z, El Messari S, Gallatz K, et al. Physiological role of a novel neuropeptide, apelin, and its receptor in the rat brain. J Neurochem 2001;77:1085–96. [38] Reaux A, Gallatz K, Palkovits M, Llorens-Cortes C. Distribution of apelinsynthesizing neurons in the adult rat brain. Neuroscience 2002;113: 653–62. [39] Reaux-Le Goazigo A, Alvear-Perez R, Zizzari P, Epelbaum J, Bluet-Pajot MT, Llorens-Cortes C. Cellular localization of apelin and its receptor in the anterior pituitary: evidence for a direct stimulatory action of apelin on ACTH release. Am J Physiol Endocrinol Metab 2007;292:E7–15. [40] Scott IC, Masri B, D’Amico LA, Jin SW, Jungblut B, Wehman AM, et al. The g protein-coupled receptor agtrl1b regulates early development of myocardial progenitors. Dev Cell 2007;12:403–13. [41] Shimizu T, Kosaka N, Murayama C, Tetsuka M, Miyamoto A. Apelin and APJ receptor expression in granulosa and theca cells during different stages of follicular development in the bovine ovary: involvement of apoptosis and hormonal regulation. Anim Reprod Sci 2009. [42] Sunter D, Hewson AK, Dickson SL. Intracerebroventricular injection of apelin13 reduces food intake in the rat. Neurosci Lett 2003;353:1–4. [43] Taheri S, Murphy K, Cohen M, Sujkovic E, Kennedy A, Dhillo W, et al. The effects of centrally administered apelin-13 on food intake, water intake and pituitary hormone release in rats. Biochem Biophys Res Commun 2002;291: 1208–12. [44] Thavanathan R, Volkoff H. Effects of amylin on feeding of goldfish: interactions with CCK. Regul Pept 2006;133:90–6. [45] Unniappan S, Canosa LF, Peter RE. Orexigenic actions of ghrelin in goldfish: feeding-induced changes in brain and gut mRNA expression and serum levels, and responses to central and peripheral injections. Neuroendocrinology 2004;79:100–8. [46] Valle A, Hoggard N, Adams AC, Roca P, Speakman JR. Chronic central administration of apelin-13 over 10 days increases food intake, body weight, locomotor activity and body temperature in C57BL/6 mice. J Neuroendocrinol 2008;20:79–84. [47] Volkoff H, Canosa LF, Unniappan S, Cerda-Reverter JM, Bernier NJ, Kelly SP, et al. Neuropeptides and the control of food intake in fish. Gen Comp Endocrinol 2005;142:3–19. [48] Zeng XX, Wilm TP, Sepich DS, Solnica-Krezel L. Apelin and its receptor control heart field formation during zebrafish gastrulation. Dev Cell 2007;12: 391–402.