Apicidin down-regulates human papillomavirus type 16 E6 and E7 transcripts and proteins in SiHa cervical cancer cells

Available online at www.sciencedirect.com

Cancer Letters 272 (2008) 53–60 www.elsevier.com/locate/canlet

Apicidin down-regulates human papillomavirus type 16 E6 and E7 transcripts and proteins in SiHa cervical cancer cells Michał W. Łuczak, Paweł P. Jagodzinski * Poznan´ University of Medical Sciences, Department of Biochemistry and Molecular Biology, 6 Swiecickiego Street, 60-781 Poznan´, Poland Received 24 February 2008; received in revised form 24 February 2008; accepted 30 June 2008

Abstract Virtually all cervical cancer morbidities are associated with genital skin or mucosa cell infection with human papillomavirus (HPV). The HPV oncogenic proteins E6 and E7 are able to inactivate p53 and Rb proteins, which results in malignant transformation. Employing quantitative real-time PCR and Western blot analysis, we observed that apicidin histone deacetylase (HDAC) inhibitor significantly reduced HPV16-E6 and -E7 transcripts and protein levels in SiHa cervical cancer cells. Moreover, we found that apicidin lowered HPV16-E6 and -E7 transcript stability and significantly decreased these transcripts’ half-life from approximately 5 h to 2 h and from 6 h to 3 h, respectively. Our results from experiments with protein biosynthesis inhibitor suggest the involvement of an RNase and/or mRNA stabilization protein in HPV16-E6 and -E7 transcript stabilization. Since the HPV type 16 is associated with most cervical cancer incidence and HDAC inhibitors are being tested in anticancer clinical trials, our observations may have clinical significance. Ó 2008 Elsevier Ireland Ltd. All rights reserved. Keywords: Apicidin; Signaling molecules; Histone deacetylase; Cervical cancer cells

1. Introduction Cervical cancer is the most common malignant disease of the female reproductive organs, with an approximate morbidity of 500,000 women per year, of whom 80% live in developing countries [1]. Virtually all cervical cancers are associated with genital skin or mucosa cell infection with human papillomavirus (HPV) [2]. HPVs are small, non-enveloped viruses with an approximately 8-kb circular genome * Corresponding author. Tel.: +48 618546519; fax: +48 618546510. E-mail address: [email protected] (P.P. Jagodzinski).

encoding two structural proteins, L1 and L2, and several nonstructural proteins, E1, E2, E4, E5, E6, and E7 [3]. The E1 and E2 proteins are involved in viral replication and transcription. E4 helps release the virus from host cells. The E5 protein potentiates viral gene expression and enhances the malignant transformation properties of E6 and E7, which are major transforming proteins of HPV infected cells [3–8]. According to DNA sequences of the L1, E6, and E7 genes, more than 100 genotypes of HPV have been detected [9–13]. Based on the ability of HPV to induce malignant transformation, the HPV types were divided into low-risk and high-risk viruses. The

0304-3835/$ - see front matter Ó 2008 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.canlet.2008.06.030

54

M.W. Łuczak, P.P. Jagodzinski / Cancer Letters 272 (2008) 53–60

HPV types 16 and 18 belong to the high-risk group, to which belong HPV types that are considered the primary causal agent in morbidity of cervical cancer [14– 16]. HPV type 16 accounts for over 50% of cervical cancer morbidity, whereas HPV type 18 was found in 20% cases of cervical cancers [14]. The HPV16 and 18 oncogenic proteins E6 and E7 are able to cause immortalization of the infected cells [17–19]. HPV-E6 associates with ubiquitin–protein ligase E6-AP and subsequently interacts with p53, resulting in its degradation in the proteasome [20]. This shortens the half-life of p53 and reduces its concentration in cancer cells compared to normal epithelial cells [21]. Moreover, E6 also increases the telomerase activity above its critical point, thus induce immortality of the cells [22,23]. The HPV-E7 protein interacts with retinoblastoma protein (Rb) and releases transcription factor E2F, which induces expression of genes involved in cell proliferation [24,25]. Epigenetic alteration is considered the heritable and reversible changes in gene expression patterns that do not correspond to the DNA sequence [26,27]. These changes include cytosine methylation in cytosine and guanine dinucleotide (CpG) islands and covalent histone modifications, which modulate the expression of numerous genes [26]. A low degree of methylation of CpG residues in the regulatory sequences of DNA and a high level of histone acetylation correlate with the transcriptional activity of certain genes [26,27]. Histone acetylation is conducted by acetyltransferases, but their deacetylation is carried out by histone deacetylases (HDACs) [28]. It has been reported that hypermethylation of promoters in patients with cervical carcinoma diminishes or silences the expression of tumor suppressor genes encoding proteins involved in virtually all cancer pathways or cell functions [16]. Moreover, the methylation state of the HPV genome in its regulatory region may also modulate the viral life cycle, infection progress, and viral oncoprotein production in cervical carcinoma [29]. Apicidin is an inhibitor of HDAC and accounts for the in vitro high acetylation level of histones, which correlates with an increase of various genes transcription [30–32]. However, the eventual effect of HDAC inhibitors on numerous transcript and protein contents in cells should be determined experimentally [33–35]. We therefore decided to investigate the effect of apicidin on HPV16-E6 and -E7 transcript and protein levels in SiHa cervical cancer cells expressing HPV type 16.

2. Materials and methods 2.1. Antibodies and reagents Goat polyclonal (Gp) anti-HPV16-E6 antibody (Ab) (N-17), Gp anti-HPV16-E7 Ab (N-21), donkey anti-goat horseradish peroxidase (HRP)-conjugated Ab, anti-actin HRP-conjugated Ab (clone I-19), and anti-polymerase II (Pol II) – rabbit polyclonal Ab (H-224) were provided from Santa Cruz Biotechnology (Santa Cruz, CA). Apicidin, actinomycin D, and cycloheximide were purchased from Sigma– Aldrich Co. (St. Louis, MO). 2.2. Cell culture and apicidin treatment and cell viability assay SiHa cervical cancer cells expressing the HPV type 16 virus were obtained from the American Type Culture Collection (Rockville, MD) and maintained in DMEM Gibco-BRL (Grand Island, NY) containing 10% heat-inactivated fetal bovine serum (FCS), 2 mM glutamine, 100 mg/mL streptomycin, and 100 U/mL penicillin in tissue culture flasks. SiHa cells were placed 1  106 cells per flask and incubated for 0, 6, 12, 18, 24, and 36 h either without or in the presence of apicidin at a concentration of 2 lg/mL. After incubation, the cells were immediately used for total protein and RNA isolation. Cell viability was determined by a Trypan blue dye exclusion assay. Cells (0.5  106/well) in 24-well plates were incubated overnight, then the medium was changed to new medium either with or without apicidin, keeping the same cells in the same type of medium, at a concentration of 2 lg/mL, and incubated for 0, 6, 12, 18, 24, 36, 48, and 80 h. After incubation, each cell suspension was mixed with an equal volume of 0.3% Trypan blue aqueous solution Sigma–Aldrich Co. (St. Louis, MO). Cells were observed under a microscope, and viable cells counted on hemocytometer. Cell viability (%) was calculated using the formula: cell viability (%) = (number of viable cells/number of total cells) 100 (Fig. 2). 2.3. Reverse-transcription and real-time quantitative PCR (RQ-PCR) analysis of HPV16-E6 and HPV16-E7 transcripts Total RNA was isolated according to the method of Chomczynski and Sacchi [36]. RNA integrity was confirmed by denaturing agarose gel electrophore-

M.W. Łuczak, P.P. Jagodzinski / Cancer Letters 272 (2008) 53–60

sis, and the concentration was quantified by measuring the optical density (OD) at 260 nm. RNA samples were treated with DNase I and reversetranscribed into cDNA using oligo-(dT) primers. RQ-PCR was conducted in a Light Cycler realtime PCR detection system Roche Diagnostics GmbH (Mannheim, Germany) using SYBRÒ Green I as detection dye, and target cDNA was quantified using relative quantification method. The quantity of HPV16-E6 and HPV16-E7 transcripts in each sample was standardized by ACTB or GAPDH transcript levels [37] (Table 1). For amplification, 2 lL of total (20 lL) cDNA solution was added to 18 lL of QuantiTectÒ SYBERÒ Green PCR Master Mix from QIAGEN GmbH (Hilden, Germany) and primers for HPV16-E6 and HPV16-E7 transcripts (Table 1). Since the amplification efficiency of target and reference genes differed, quantification of copy number of these genes was, respectively, derived from a different standard curve for target and references genes. One RNA sample of each preparation was processed without RT-reaction to provide a negative control in subsequent PCR. RQ-PCR results were expressed as mRNA copy number per 1 lg of total RNA. 2.4. Sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and Western blotting analysis SiHa cells cultured in the absence or in the presence of apicidin (2 lg/mL) were treated in lysis RIPA buffer. Next, 30 lg of protein were resuspended in sample buffer and separated on 12% Tris–glycine gel using SDS–PAGE. Gel proteins were transferred to nitrocellulose, which was blocked with 5% milk in Tris-buffered saline/Tween. Immunodetection was performed with Gp antiHPV16-E6 Ab (N-17) and Gp anti- and HPV16E7 Ab (N-21), followed by incubation with donkey anti-goat HRP-conjugated Ab, respectively. The

55

membranes were also incubated with anti-actin HRP-conjugated Ab (clone I-19) to ensure equal protein loading of the lanes. Bands were revealed using SuperSignal West Femto Maximum Sensitivity Substrate Pierce (Rockford, IL) and Hyperfilm ECL Amersham (Piscataway, NJ). 2.5. Measurement of HPV16-E6 and HPV16-E7 mRNAs stability Cells were treated for 4 h with apicidin (2 lg/mL) and then blocked with 5 lg/mL actinomycin D. Cells were harvested at 0, 2, 4, and 8 h post-actinomycin D treatment. Total RNA was isolated, treated with DNase I, reverse-transcribed into cDNA, and RQ-PCR analyses of HPV16-E6 and HPV16E7 transcript levels were determined. To investigate the role of protein synthesis in apicidin action, cells were pretreated for 2 h with 10 lg/mL of cycloheximide. Actinomycin D was added after the cells were exposed to apicidin for 4 h. The cells were incubated for a further 8 h under normal culture conditions and harvested for HPV16-E6 and HPV16-E7 transcript level determination. In all these experiments HPV16-E6 and HPV16-E7 transcript levels before actinomycin D treatment was determined as baseline. 2.6. Chromatin immunoprecipitation (ChIP) analysis SiHa cells were cultured in DMEM containing 10% heat-inactivated fetal FCS, 2 mM glutamine, 100 mg/mL streptomycin, and 100 U/mL penicillin either in the absence or in the presence of apicidin at a concentration of 2 lg/mL for 0, 6, 12, 18, 24, and 36 h. Cells were then fixed by the addition of 270 lL of 37% formaldehyde to 10 mL of culture medium for 10 min at 37 °C, and harvested. Chromatin from 1  106 cells was sheared by sonicator and precleared with salmon sperm DNA-saturated protein G sepharose. ChIP assay was performed

Table 1 Oligonucleotide sequences used for RQ-PCR analysis Gene

Sequence (50 –30 direction)

Position

NCBI No.

Product size (bp)

HPV16-E6

GACCCAGAAAGTTACCACAG CATAAATCCCGAAAAGCAAAG GGAGGAGGATGAAATAGATGG TGAGAACAGATGGGGCACAC GCACCACACCTTCTACAATGAGC GGATAGCACAGCCTGGATAGCAAC CTGCACCACCAACTGCTTAG TTCTGGGTGGCAGTGATG

44–66 153–173 99–119 268–287 331–353 473–496 555–574 642–659

NC_001526

130

NC_001526

189

NM_001101

166

NM_002046

105

HPV16-E7 ACTB GAPDH

56

M.W. Łuczak, P.P. Jagodzinski / Cancer Letters 272 (2008) 53–60

using QuikChIPTM (Imgenex Corporation, San Diego, CA, USA) according to the manufacturer’s instructions (http://www.imgenex.com/ get_details.php?catalog_no=30101K). Chromatin was incubated with 2 lg of rabbit polyclonal antiPol II Ab overnight at 4 °C. The input and immunoprecipitated DNA were used as templates for RQPCR carried out by pairs of primers complementary to HPV16-E6 and -E7 DNA (Table 1). According to differences between CT values for input and treated or untreated samples, we determined the percentage of HPV16 sequences bound to Pol II (Table 2). 2.7. Statistical analysis Data groups were analyzed by ANOVA to evaluate if there was significance (P < 0.05) between the groups. For all experimental groups, which satisfied the initial ANOVA criterion, individual comparisons were done with the use of post hoc NewmanKeul’s test with the assumption of two-tailed distribution and two samples with equal variance at the P < 0.05 level. Statistical significance is marked by asterisks in the figures. 3. Results and discussion Inhibitors of HDACs classes I and II can be divided into short-chain fatty acids, hydroxamic acids, epoxyketones, cyclic peptides, benzamides, and hybrid molecule groups [38–40]. Apicidin belongs to the cyclic peptide group of HDAC inhibitors, which primarily exhibit potent anti-protozoal

activity via HDAC inhibition in apicomplexan parasites [41–43]. Our results indicate that apicidin significantly reduces both HPV16-E6 and HPV16-E7 transcript and protein levels in SiHa cells infected with HPV type 16. We observed that 36 h of SiHa cell treatment with apicidin results in a 2- to 4-fold reduction of HPV16-E6 and HPV16-E7 mRNA (Fig. 1A). Western blot analysis revealed that the HPV16-E6 and HPV16-E7 protein levels progressively decreased after 12, 18, 24, and 36 h of incubation with apicidin (Fig. 1B). Moreover, the decrease of HPV16-E6 and HPV16-E7 transcript and protein levels was not associated with either an alteration in cell morphology or significant cytotoxic effect of apicidin on SiHa cells (Fig. 2). However, other HDAC inhibitors such as trichostatin A, sodium butyrate, and valproic acids did not affect HPV16-E6 and HPV16-E7 transcript and protein levels in SiHa cells (results not shown). Binding host cell transcription factors and Pol II to the promoter located upstream of the HPV16-E6 and -E7 open reading frame results in the transcription of E6 and E7 genes as a single bicistronic E6E7 transcript [44–46]. This HPV16 E6E7 pre-mRNA is composed of three exons and two introns, and is subsequently used to generate the transcript for translation of the E6 and E7 proteins [44–46]. In order to evaluate the apicidin effect on HPV16-E6 and -E7 transcription initiation we performed a ChIP assay. We observed no apicidin

Table 2 Effect of apicidin treatment on HPV16 sequence binding to Polymerase II CT values for HPV16-E6 and HPV16-E7 DNA region amplification Incubation time (h)

HPV16-E6 Input Pol II bound Percentage of sequence bound HPV16-E7 Input Pol II bound Percentage of sequence bound

0

6

12

18

24

36

24.65 ± 0.28 32.75 ± 0.24

24.98 ± 0.07 33.02 ± 0.12

24.61 ± 0.11 32.61 ± 0.21

24.93 ± 0.32 32.93 ± 0.22

25.13 ± 0.26 33.11 ± 0.13

24.83 ± 0.14 32.81 ± 0.23

(0.37 ± 0.04)

(0.38 ± 0.01)

(0.39 ± 0.03)

(0.39 ± 0.04)

(0.40 ± 0.02)

(0.39 ± 0.02)

24.37 ± 0.22 32.43 ± 0.18

24.35 ± 0.16 32.43 ± 0.15

24.75 ± 0.10 32.59 ± 0.09

24.83 ± 0.13 32.82 ± 0.11

25.00 ± 0.25 32.97 ± 0.21

24.60 ± 0.51 32.66 ± 0.53

(0.37 ± 0.01)

(0.38 ± 0.03)

(0.44 ± 0.02)

(0.40 ± 0.02)

(0.39 ± 0.01)

(0.37 ± 0.02)

SiHa cells were incubated either without or in the presence of apicidin at a concentration of 2 lg/mL for 6, 12, 18, 24, and 36 h. After incubation, cells were used for ChIP analysis with anti-Pol II Ab. RQ-PCR was carried out by pairs of primers complementary to HPV16E6, -E7 DNA (Table 1). Data expressed either as CT values for input and treated or untreated cells, or as percentage of the HPV16-E6 and -E7 DNA sequences bound to Pol II (data in brackets). Statistical analysis was performed using two-tailed Student’s test. The results represent means ± SE from three independent experiments.

M.W. Łuczak, P.P. Jagodzinski / Cancer Letters 272 (2008) 53–60

57

Fig. 1. Apicidin down-regulates HPV16-E6 and HPV16-E7 transcripts (A) and proteins (B) in SiHa cells. SiHa cells were incubated either without or in the presence of apicidin at a concentration of 2 lg/mL for 6, 12, 18, 24, and 36 h. After incubation, total RNA was isolated and treated with DNase I, quantified, and reverse-transcribed into cDNA. The HPV16-E6 and HPV16-E7 transcript levels were determinated by RQ-PCR analysis of cDNA. The copy number of HPV16-E6 and HPV16-E7 transcripts was standardized against ACTB or GAPDH cDNA levels, and is expressed as a number of copies per lg of total RNA. Each sample was determined in triplicate and results represent means ± SE from three experiments, *P < 0.05. For Western blot analysis, proteins were separated by SDS–PAGE and transferred to a membrane that was then immunoblotted with goat polyclonal anti-HPV16-E6 and anti-HPV16-E7 Abs, followed by incubation with donkey anti-goat HRP-conjugated Ab, and, to equalize protein loading, reblotted with anti-actin HRP-conjugated Ab.

Fig. 2. Effect of apicidin on viability of SiHa cells. In order to determine cell viability, SiHa cells were cultured in medium either in the absence (–*–) or presence (–N–) of apicidin at a concentration of 2 lg/mL, and incubated for 0, 6, 12, 18, 24, 36, 48, and 80 h. After incubation, cell viability was determined by blue dye exclusion assay. All experiments were performed in triplicate (*p < 0.05) and results represent means ± SE from three experiments.

effect to Pol II binding with the HPV16 sequence (Table 2) or the GAPDH promoter (results not shown). Therefore, to determine the apicidin effect and de novo protein biosynthesis effect on HPV16E6 and HPV16-E7 transcripts’ stability, we carried out experiments with actinomycin D and cycloheximide. We observed that apicidin decreased both mRNAs’ stability and reduced this transcript halflife from approximately 5 to 2 h for HPV16-E6 mRNA and from 6 to 3 h for HPV16-E7 (Fig. 3). We also demonstrated that protein synthesis may be essential for apicidin-mediated reduction of HPV16-E6 and E7 mRNA stability (Fig. 4).

Apicidin exhibits anti-proliferative activity for various cancer cell lines via induction of CDK inhibitor p21WAF1/Cip1 expression and subsequent cell arrest at G0–G1 phase [30,47,48]. This HDAC inhibitor also induces apoptosis in K562 cells via the activation of the mitochondrial pathway dependent caspase cascades [49]. Kim et al. [50], using ECV304 human vascular endothelial cells, found that apicidin also displays anti-angiogenic activity and is capable of inhibiting the formation of new blood vessels in vitro [50]. Furthermore, apicidin treatment of human and mouse tumor cells resulted in dramatically decreased HIF-1a protein level and

58

M.W. Łuczak, P.P. Jagodzinski / Cancer Letters 272 (2008) 53–60

Fig. 3. Apicidin induces rapid degradation of HPV16-E6 (A) and HPV16-E7 (B) transcripts. SiHa cells were incubated in absence (–s–) or presence (–d–) of apicidin at a concentration of 2 lg/mL for 5 h, then RNA biosynthesis was stopped by actinomycin D (5 lg/mL). HPV16-E6 and HPV16-E7 transcript levels were determined by reverse-transcription and RQ-PCR analysis at different time points following the addition of actinomycin D. The HPV16-E6 and HPV16-E7 mRNAs stability curves indicate that apicidin treatment significantly (P < 0.005) decreases these transcripts’ stability.

Fig. 4. Apicidin mediated HPV16-E6 (A) and HPV16-E7 (B) transcript destabilization requires protein synthesis. SiHa cells were pretreated for 2 h with the protein synthesis inhibitor cycloheximide (10 lg/mL), apicidin (2 lg/ml), and actinomycin D (5 lg/mL), which were sequentially added. The data are expressed as an average percentage of HPV16-E6 and HPV16-E7 transcript levels from actinomycin D treatment groups relative to their non-actinomycin D controls. Bars, SE; *P < 0.05; left column, a regular decay rate 8 h following RNA biosynthesis was stopped; middle column, apicidin treatment profoundly elevated HPV16-E6 and HPV16-E7 transcript degradation; right column, cycloheximide pretreatment, completely cancelled the effects of apicidin on HPV16-E6 and HPV16-E7 transcripts. Each sample was determined in triplicate and the results represent means ± SE from three experiments.

transcriptional activity of HIF-1a gene [51]. Recently, it has been reported that apicidin downregulates DNA methyltransferase 1 (DNMT1) expression in HeLa cervical cancer cells [52]. The apicidin-mediated decrease of HPV16-E6 and HPV16-E7 mRNA stability suggests that apicidin may either activate an RNase(s) unit(s) responsible for both transcripts’ degradation or stop expression of a protein(s) involved in HPV16-E6 and HPV16-E7 transcript stabilization (Figs. 2 and 3). Transcript destabilization via HDACs inhibitors has been well demonstrated, but the molecular mechanisms of this action remain unclear [33–35,52,53] and require further investigation. Our and other findings suggest that apicidin may exhibit at least a double effect directed against cervical cancer cells. Apicidin, via DNMT1 level reduc-

tion, may reactivate the transcription of methylation-silenced tumor suppressor genes in cancer cells [52]. Significant reduction of HPV16-E6 and HPV16-E7 proteins may remove their oncogenic activity, leading to the restoration of p53 and Rb function in cervical cancer cells. Hypophosphorylated Rb forms an E2F/pRb/HDAC complex, wherein HDAC deacetylates histones as well as lysine residues in the E2F DNA binding domain [54,55]. Deacetylation of E2F reduces its binding to DNA and stops the expression of genes that promote cell proliferation [56,57]. Moreover, we (not shown) and Han et al. [30] observed that apicidin does not alter p53 and Rb transcript levels in SiHa or HeLa cervical cancer cells, respectively [30]. Since, HPV type 16 accounts for over 50% of cervical cancers [14] and HDAC inhibitors are being

M.W. Łuczak, P.P. Jagodzinski / Cancer Letters 272 (2008) 53–60

tested in anti-cancer clinical trials, our observations may be of clinical significance.

[16]

Acknowledgement We acknowledge Margarita Lianeri for her assistance.

[17]

[18]

References [1] D.M. Parkin, F. Bray, J. Ferlay, P. Pisani, Estimating the world cancer burden: globocan 2000, Int. J. Cancer 94 (2001) 153–156. [2] G. Campisi, V. Panzarella, M. Giuliani, C. Lajolo, O. Di Fede, S. Falaschini, C. Di Liberto, C. Scully, L. Lo Muzio, Human papillomavirus: its identity and controversial role in oral oncogenesis, premalignant and malignant lesions, Int. J. Oncol. 30 (2007) 813–823. [3] C.C. Baker, W.C. Phelps, V. Lindgren, M.J. Braun, M.A. Gonda, P.M. Howley, Structural and transcriptional analysis of human papillomavirus type 16 sequences in cervical carcinoma cell lines, J. Virol. 61 (1987) 962–971. [4] A.A. McBride, H. Romanczuk, P.M. Howley, The papillomavirus E2 regulatory proteins, J. Biol. Chem. 266 (1991) 18411–18414. [5] C.M. Chiang, M. Ustav, A. Stenlund, T.F. Ho, T.R. Broker, L.T. Chow, Viral E1 and E2 proteins support replication of homologous and heterologous papillomaviral origins, Proc. Natl. Acad. Sci. USA 89 (1992) 5799–5803. [6] D. DiMaio, D. Mattoon, Mechanisms of cell transformation by papillomavirus E5 proteins, Oncogene 54 (2001) 7866– 7873. [7] T.C. Tsai, S.L. Chen, The biochemical and biological functions of human papillomavirus type 16 E5 protein, Arch. Virol. 148 (2003) 1445–1453. [8] N. Kivi, D. Greco, P. Auvinen, E. Auvinen, Genes involved in cell adhesion cell motility and mitogenic signaling are altered due to HPV 16 E5 protein expression, Oncogene 27 (2008) 2532–2541. [9] H. zur Hausen, Papillomaviruses in human cancers, Proc. Assoc. Am. Phys 111 (6) (1999) 581–587. [10] E.M. de Villiers, C. Fauquet, T.R. Broker, H.U. Bernard, H. zur Hausen, Classification of papillomaviruses, Virology 324 (2004) 17–27. [11] H.U. Bernard, The clinical importance of the nomenclature, evolution and taxonomy of human papillomaviruses, J. Clin. Virol. 32 (2005) S1–S6. [12] A. Molijn, B. Kleter, W. Quint, L.J. van Doorn, Molecular diagnosis of human papillomavirus (HPV) infections, J. Clin. Virol. 32 (2005) S43–S51. [13] H.U. Bernard, I.E. Calleja-Macias, S.T. Dunn, Genome variation of human papillomavirus types: phylogenetic and medical implications, Int. J. Cancer 118 (2006) 1071–1076. [14] J.M. Walboomers, M.V. Jacobs, M.M. Manos, F.X. Bosch, J.A. Kummer, K.V. Shah, P.J. Snijders, J. Peto, C.J. Meijer, N. Mun˜oz, Human papillomavirus is a necessary cause of invasive cervical cancer worldwide, J. Pathol. 189 (1999) 1–3. [15] Y. van der Graaf, A. Molijn, H. Doornewaard, W. Quint, L.J. van Doorn, J. van den Tweel, Human papillomavirus

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

[29]

[30]

59

and the long-term risk of cervical neoplasia, Am. J. Epidemiol. 156 (2002) 158–164. A. Duen˜as-Gonza´lez, M. Lizano, M. Candelaria, L. Cetina, C. Arce, E. Cervera, Epigenetics of cervical cancer. An overview and therapeutic perspectives, Mol. Cancer 25 (2005) 4–38. P. Hawley-Nelson, K.H. Vousden, N.L. Hubbert, D.R. Lowy, J.T. Schiller, HPV16 E6 and E7 proteins cooperate to immortalize human foreskin keratinocytes, EMBO J. 8 (1989) 3905–3910. K. Mu¨nger, P.M. Howley, Human papillomavirus immortalization and transformation functions, Virus Res. 89 (2002) 213–228. R.R. Riley, S. Duensing, T. Brake, K. Mu¨nger, P.F. Lambert, J.M. Arbeit, Dissection of human papillomavirus E6 and E7 function in transgenic mouse models of cervical carcinogenesis, Cancer Res. 63 (2003) 4862–4871. J.M. Huibregtse, M. Scheffner, P.M. Howley, Localization of the E6-AP regions that direct human papillomavirus E6 binding association with p53 and ubiquitination of associated proteins, Mol. Cell. Biol. 13 (1993) 4918–4927. M. Scheffner, J.M. Huibregtse, R.D. Vierstra, P.M. Howley, The HPV-16 E6 and E6-AP complex functions as a ubiquitin–protein ligase in the ubiquitination of p53, Cell 75 (1993) 495–505. A.J. Klingelhutz, S.A. Foster, J.K. McDougall, Telomerase activation by the E6 gene product of human papillomavirus type 16, Nature 280 (1996) 79–82. D.L. Sprague, S.L. Phillips, C.J. Mitchell, K.L. Berger, M. Lace, L.P. Turek, A.J. Klingelhutz, Telomerase activation in cervical keratinocytes containing stably replicating human papillomavirus type 16 episomes, Virology 301 (2002) 247– 254. K.W. Huh, J. DeMasi, H. Ogawa, Y. Nakatani, P.M. Howley, K. Mu¨nger, Association of the human papillomavirus type 16 E7 oncoprotein with the 600-kDa retinoblastoma protein-associated factor, p600, Proc. Natl. Acad. Sci. USA 102 (2005) 11492–11497. K. Huh, X. Zhou, H. Hayakawa, J.Y. Cho, T.A. Libermann, J. Jin, J.W. Harper, K. Munger, Human papillomavirus type 16 E7 oncoprotein associates with the cullin 2 ubiquitin ligase complex, which contributes to degradation of the retinoblastoma tumor suppressor, J. Virol. 81 (2007) 9737– 9747. B. Richardson, R. Yung, Role of DNA methylation in the regulation of cell function, J. Lab. Clin. Med. 134 (1999) 333–340. S. Thiagalingam, K.H. Cheng, H.J. Lee, N. Mineva, A. Thiagalingam, J.F. Ponte, Histone deacetylases: unique players in shaping the epigenetic histone code, Ann. NY Acad. Sci. 983 (983) (2003) 84–100. M.W. Luczak, P.P. Jagodzinski, The role of DNA methylation in cancer development, Folia Histochem. Cytobiol. 44 (2006) 143–154. M. Kalantari, I.E. Calleja-Macias, D. Tewari, B. Hagmar, K. Lie, H.A. Barrera-Saldana, D.J. Wiley, H.U. Bernard, Conserved methylation patterns of human papillomavirus type 16 DNA in asymptomatic infection and cervical neoplasia, J. Virol. 78 (2004) 12762–12772. J.W. Han, S.H. Ahn, S.H. Park, S.Y. Wang, G.U. Bae, D.W. Seo, H.K. Kwon, S. Hong, H.Y. Lee, Y.W. Lee, H.W. Lee, Apicidin, a histone deacetylase inhibitor, inhibits prolifera-

60

[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

[39]

[40]

[41]

[42]

[43]

[44]

M.W. Łuczak, P.P. Jagodzinski / Cancer Letters 272 (2008) 53–60 tion of tumor cells via induction of p21WAF1/Cip1 and gelsolin, Cancer Res. 60 (2000) 6068–6074. S. Kim, J.K. Kang, Y.K. Kim, D.W. Seo, S.H. Ahn, J.C. Lee, C.H. Lee, J.S. You, E.J. Cho, H.W. Lee, J.W. Han, Histone deacetylase inhibitor apicidin induces cyclin E expression through Sp1 sites, Biochem. Biophys. Res. Commun. 342 (2006) 1168–1173. Y.K. Kim, D.W. Seo, D.W. Kang, H.Y. Lee, J.W. Han, S.N. Kim, Involvement of HDAC1 and the PI3K/PKC signaling pathways in NF-jB activation by the HDAC inhibitor apicidin, Biochem. Biophys. Res. Commun. 347 (2006) 1088–1093. R. Januchowski, M. Dabrowski, H. Ofori, P.P. Jagodzinski, Trichostatin A down-regulate DNA methyltransferase 1 in Jurkat T cells, Cancer Lett. 246 (2007) 313–317. R. Januchowski, P.P. Jagodzinski, Trichostatin A downregulates ZAP-70, LAT and SLP-76 content in Jurkat T cells, Int. Immunopharmacol. 7 (2007) 198–204. J.M. Moreira, P. Scheipers, P. Sorensen, The histone deacetylase inhibitor Trichostatin A modulates CD4+ T cell responses, BMC Cancer 3 (2003) 30. P. Chomczynski, N. Sacchi, Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction, Anal. Biochem. 162 (1987) 156–159. A. Radonic´, S. Thulke, I.M. Mackay, O. Landt, W. Siegert, A. Nitsche, Guideline to reference gene selection for quantitative real-time PCR, Biochem. Biophys. Res. Commun. 313 (2004) 856–862. A.J. de Ruijter, A.H. van Gennip, H.N. Caron, S. Kemp, A.B. van Kuilenburg, Histone deacetylases (HDACs): characterization of the classical HDAC family, Biochem. J. 370 (2003) 737–749. D.C. Drummond, C.O. Noble, D.B. Kirpotin, Z. Guo, G.K. Scott, C.C. Benz, Clinical development of histone deacetylase inhibitors as anticancer agents, Annu. Rev. Pharmacol. Toxicol. 45 (2005) 495–528. M.R. Acharya, A. Sparreboom, J. Venitz, W.D. Figg, Rational development of histone deacetylase inhibitors as anticancer agents: a review, Mol. Pharmacol. 68 (2005) 917– 932. S.J. Darkin-Rattray, A.M. Gurnett, R.W. Myers, P.M. Dulski, T.M. Crumley, J.J. Allocco, C. Cannova, P.T. Meinke, S.L. Colletti, M.A. Bednarek, S.B. Singh, M.A. Goetz, A.W. Dombrowski, J.D. Polishook, D.M. Schmatz, Apicidin: a novel antiprotozoal agent that inhibits parasite histone deacetylase, Proc. Natl. Acad. Sci. USA 93 (1996) 13143–13147. S.B. Singh, D.L. Zink, J.M. Liesch, A.W. Dombrowski, S.J. Darkin-Rattray, D.M. Schmatz, M.A. Goetz, Structure, histone deacetylase, and antiprotozoal activities of apicidins B and C, congeners of apicidin with proline and valine substitutions, Org. Lett. 3 (2001) 2815–2818. S.B. Singh, D.L. Zink, J.M. Liesch, R.T. Mosley, A.W. Dombrowski, G.F. Bills, S.J. Darkin-Rattray, D.M. Schmatz, M.A. Goetz, Structure and chemistry of apicidins, a class of novel cyclic tetrapeptides without a terminal a-keto epoxide as inhibitors of histone deacetylase with potent antiprotozoal activities, J. Org. Chem. 67 (2002) 815–825. S. Garcı´a-Vallve´, J.R. Iglesias-Rozas, A. Alonso, I.G. Bravo, Different papillomaviruses have different repertoires of transcription factor binding sites: convergence and divergence in the upstream regulatory region, BMC Evol. Biol. (2006) 6:20.

[45] S. Tang, M. Tao, J.P. McCoy Jr, Z.M. Zheng, The E7 oncoprotein is translated from spliced E6*I transcripts in high-risk human papillomavirus type 16- or type 18-positive cervical cancer cell lines via translation reinitiation, J. Virol. 80 (2006) 4249–4263. [46] N. Sathish, P. Abraham, A. Peedicayil, G. Sridharan, S. John, G. Chandy, Human papillomavirus 16 E6/E7 transcript and E2 gene status in patients with cervical neoplasia, Mol. Diagn. 8 (2004) 57–64. [47] J.W. Han, S.H. Ahn, Y.K. Kim, G.U. Bae, J.W. Yoon, S. Hong, H.Y. Lee, Y.W. Lee, H.W. Lee, Activation of p21 (WAF1/Cip1) transcription through Sp1 sites by histone deacetylase inhibitor apicidin: involvement of protein kinase C, J. Biol. Chem. 276 (2001) 42084–42090. [48] Y.K. Kim, J.W. Han, Y.N. Woo, J.K. Chun, J.Y. Yoo, E. J Cho, S. Hong, H.Y. Lee, Y.W. Lee, H.W. Lee, Expression of p21 (WAF1/Cip1) through Sp1 sites by histone deacetylase inhibitor apicidin requires PI 3-kinase-PKC epsilon signaling pathway, Oncogene 22 (2003) 6023–6031. [49] J.W. Cheong, S.Y. Chong, J.Y. Kim, J.I. Eom, H.K. Jeung, H.Y. Maeng, S.T. Lee, Y.H. Min, Induction of apoptosis by apicidin, a histone deacetylase inhibitor, via the activation of mitochondria-dependent caspase cascades in human BcrAbl-positive leukemia cells, Clin. Cancer Res. 9 (2003) 5018– 5027. [50] S.H. Kim, S. Ahn, J.W. Han, H.W. Lee, H.Y. Lee, Y.W. Lee, M.R. Kim, K.W. Kim, W.B. Kim, S. Hong, Apicidin is a histone deacetylase inhibitor with anti-invasive and antiangiogenic potentials, Biochem. Biophys. Res. Commun. 315 (2004) 964–970. [51] S.H. Kim, J.W. Jeong, J.A. Park, J.W. Lee, J.H. Seo, B.K. Jung, M.K. Bae, K.W. Kim, Regulation of the HIF-1a stability by histone deacetylases, Oncol. Rep. 17 (2007) 647– 651. [52] J.S. You, J.K. Kang, E.K. Lee, J.C. Lee, S.H. Lee, Y.J. Jeon, D.H. Koh, S.H. Ahn, D.W. Seo, H.Y. Lee, E.J. Cho, J.W. Han, Histone deacetylase inhibitor apicidin downregulates DNA methyltransferase 1 expression and induces repressive histone modifications via recruitment of corepressor complex to promoter region in human cervix cancer cells, Oncogene (2007), doi:10.1038/sj.onc.1210776. [53] Y. Xiong, S.C. Dowdy, K.C. Podratz, F. Jin, J.R. Attewell, N.L. Eberhardt, S.W. Jiang, Histone deacetylase inhibitors decrease DNA methyltransferase-3B messenger RNA stability and down-regulate de novo DNA methyltransferase activity in human endometrial cells, Cancer Res. 65 (2005) 2684–2689. [54] T. Takaki, K. Fukasawa, I. Suzuki-Takahashi, H. Hirai, Cdk-mediated phosphorylation of pRB regulates HDAC binding in vitro, Biochem. Biophys. Res. Commun. 316 (2004) 252–255. [55] A. Brehm, E.A. Miska, D.J. McCance, J.L. Reid, A.J. Bannister, T. Kouzarides, Retinoblastoma protein recruits histone deacetylase to repress transcription, Nature 6667 (1998) 597–601. [56] M.A. Martı´nez-Balba´s, U.M. Bauer, S.J. Nielsen, A. Brehm, T. Kouzarides, Regulation of E2F1 activity by acetylation, EMBO J. 19 (2000) 662–671. [57] G. Marzio, C. Wagener, M.I. Gutierrez, P. Cartwright, K. Helin, M. Giacca, E2F family members are differentially regulated by reversible acetylation, J. Biol. Chem. 275 (2000) 10887–10892.