- Email: [email protected]
Apigenin suppresses mouse peritoneal fibrosis by down-regulating miR34a expression
Biomedicine & Pharmacotherapy 106 (2018) 373–380
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Apigenin suppresses mouse peritoneal fibrosis by down-regulating miR34a expression
T
Yiming Zhanga,b,1, Qiaoling Suna,1, Xiang Lib, Xiaofen Mab, Yang Lib, Zhanfeng Jiaob, ⁎ Xiang-Dong Yanga, a b
Department of Nephrology, Qilu Hospital, Shandong University, Jinan, Shandong, 250012, China Department of Nephrology, Affiliated Hospital of Jining Medical University, Jining, Shandong, 272029, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Key words Apigenin microRNA Peritoneal fibrosis Mouse mesothelial peritoneal cells High glucose Apoptosis
Peritoneal fibrosis is a severe side-effect of chronic peritoneal dialysis in patients with end-stage renal disease, but not enough effective therapeutic drugs are currently available in clinics. The aim of this study was to evaluate the effects of apigenin and miRNA on the progression of peritoneal fibrosis. We treated isolated mouse mesothelial peritoneal cells (MMCs) with high glucose (HG), to induce fibrosis. We used qRT-PCR and Western blotting to measure the expressions of multiple epithelial-mesenchymal transition (EMT) biomarkers, like Ecadherin, transcription termination factor (TTF), N-cadherin and vimentin, as well as several apoptosis and autophagy biomarkers. We determined the IC50 of apigenin on MMC fibrosis. We also used qRT-PCR to assess the expressions of miRNAs in MMC fibrosis. In addition, we by used the CCK8 assay, Hoechest staining and flow cytometry, to measure cell viability and proliferation rates. We successfully induced fibrosis using high glucose (HG) treatment in MMCs. This was further validated by the observed changes in E-cadherin, TTF, N-cadherin and vimentin expression levels. We also observed highly elevated expression levels of miR34a during HG-induced MMC fibrosis. Apigenin treatment induced a significant decrease in miR34a expression levels in HG-treated MMCs. Moreover, both apigenin treatment and miR34a depletion, as well as their combination, significantly promoted proliferation and suppressed apoptosis of MMCs treated with high glucose. This was accompanied with a corresponding alteration in expressions of EMT, apoptosis and autophagy biomarkers. In summary, apigenin effectively inhibits mouse mesothelial peritoneal cell fibrosis induced by high glucose, and this is, at least partially mediated by the suppression of miR34a expression.
1. Introduction Peritoneal dialysis (PD), a form of renal replacement therapy, is an effective method for treating patients with end-stage renal diseases, like acute and chronic renal failure, and acute drug and poison intoxication [1]. However, long-term use of peritoneal dialysis is greatly limited because of peritoneal fibrosis caused by the glucose added in the bioincompatible peritoneal dialysis solutions (PDF) [2]. Chronic exposure to glucose-containing bioincompatible peritoneal dialysis solutions usually leads to histological alterations in peritoneum, such as the loss of mesothelial cell monolayer, excessive extracellular matrix deposition and angiogenesis [3,4]. It is thus, clinically imperative to prevent peritoneal fibrosis during peritoneal dialysis. MicroRNAs (miRNAs) are small non-coding RNA molecules, that regulate various physiological and pathological processes by modulating post-transcriptional gene expression [5,6]. Interestingly, ⁎
1
miRNAs are also important players in development of multiple fibrosisrelated diseases [7]. One recent study showed the miRNA-221/222 family exhibits anti-myocardial fibrosis activity in pressure-overloaded hearts, where their expression is suppressed [8]. In addition, miR-34a in alveolar type II epithelial cells regulates transforming growth factor (TGF)-β1 and bleomycin-induced epithelial-mesenchymal transition, which is an important mediator of pulmonary fibrosis [9]. Another miRNA, miR-351, was also recently shown to promote schistosomiasisinduced hepatic fibrosis by targeting the vitamin D receptor (VDR), which acts as an antagonist of the Mothers against decapentaplegic homolog (SMAD) signaling pathway [10]. Furthermore, miR144 and miR16 were found to be involved in human fibrotic liver and native cystic fibrosis, respectively [11,12]. More importantly, miRNAs have also been shown to be associated with peritoneal fibrosis [13], but their specific roles and the underlying mechanisms remain largely unknown. Besides adding to the limited knowledge, an urgent need exists for
Corresponding author at: Department of Nephrology, Qilu Hospital, Shandong University, No 107,Wenhuaxi Road, Lixia District, Jinan, Shandong,China. E-mail address: [email protected] (X.-D. Yang). These authors contributed equally to this work.
https://doi.org/10.1016/j.biopha.2018.06.138 Received 19 April 2018; Received in revised form 20 June 2018; Accepted 25 June 2018 0753-3322/ © 2018 Published by Elsevier Masson SAS.
Biomedicine & Pharmacotherapy 106 (2018) 373–380
Y. Zhang et al.
effective preventive and therapeutic treatments for peritoneal fibrosis. Apigenin, a plant-derived secondary metabolite usually present in glycosylated form, is a major dietary flavonoid synthesized in a number of plant species such as celery, parsley, thyme, chamomile, onions, and even plant-derived beverages like tea, wine and beer [14,15]. The clinical studies suggest that apigenin has the potential to treat multiple diseases such as human cancers and neurodegenerative diseases (NNDs) [14,16,7]. For instance, apigenin inhibits the growth and proliferation of human head and neck squamous carcinoma cells by promoting the G2/M cell cycle arrest and enhancing reactive oxygen species (ROS) levels [17]. Moreover, apigenin has been shown to exhibit anti-tumorigenic effects in various other human cancer types including breast cancer, prostate cancer, colorectal cancer, pancreatic cancer, skin cancer, liver cancer, cervical and ovarian cancer [14,17,18,15]. Apigenin also exerts anti-inflammatory and immunomodulatory effects on autoimmune myocarditis [19]. More importantly, apigenin also showed promising therapeutic effects in a number of fibrosis-related diseases. For instance, apigenin treatment in rats revealed that strategically released apigenin from the polymeric carrier significantly inhibited progression of idiopathic pulmonary fibrosis by regulating expression of fibrosis-related cytokines [20]. A recent transcriptome-based analysis showed that apigenin is an effective anti-fibrotic agent in hepatic stellate cells, by potentially mediating the activation of a secreted adipocytokine complement C1q tumor necrosis factor-related protein 2 (C1QTNF2) [21]. In addition, apigenin was also reported to have general inhibitory roles on other fibrosis-related diseases such as renal fibrosis and pancreatic fibrosis [22,23]. However, the roles of apigenin in regulating progression of peritoneal fibrosis have not been previously addressed. In the present study, we isolated mouse mesothelial peritoneal cells (MMCs) and induced fibrosis by treating with high glucose (HG), followed by analyzing the inhibitory role of apigenin on the fibrotic transformation in MMCs. Also, the expression levels of miR34a and the anti-fibrotic effects of miRNA inhibitors were further tested in MMCs. Our results provide a strong basis for the application of apigenin and miRNA-related strategies in the treatment of peritoneal fibrosis.
gentamicin, 120 mg/l benzylpenicillin and 2.5 mg/l amphotericin at 37 °C in a humidified culture chamber supplied with 5% CO2. The culture medium was changed every three days until cells were confluent. Then, cells were washed with PBS buffer, digested with 0.007% EDTA solution containing 0.02% trypsin at 37 °C for 5 min, followed by addition of fresh medium for a new round of culture or subsequent analysis. The apigenin used for cell treatment was purchased from the Merck company (CAS: 520-36-5; Cat. No: 42,251), with a purity of over 99% by high performance liquid chromatography assay. For analysis of miR34a in MMC fibrosis, mouse mesothelial peritoneal cells were cultured in medium containing specific miRNA inhibitors against miR34a, provided by the TEHE-PNA company (Hangzhou, China). 2.3. Quantitative RT-PCR RNA extraction from cultured cells was performed using Trizol solution (Cat.#9109; Takara), according to the manufacturer’s instructions. Approximately 4.0 μg RNA from each sample was used for cDNA synthesis using the Bestar™ qPCR RT kit(Cat. #2220; DBI), according to the manufacturer’s instructions. Finally, relative mRNA levels were measured by PCR using DBI Bestar®SybrGreen qPCR master Mix (Cat. #2043; DBI) following the manufacturer’s instructions. β-actin was used as the internal standard, and at least three biological replicates were performed for statistical analysis of mRNA levels. The sequences of primer pairs used in this study are listed in Table 1. 2.4. Western blotting Total protein was extracted from samples using M-PER™ Mammalian Protein Extraction Reagent (Thermo Fisher Scientific) as per the manufacturer’s instructions, separated by 10% SDS-PAGE, and transferred onto PVDF membrane. After being incubated with 5% lipidfree milk solution for 2 h, the PVDF membrane with cell proteins was then incubated with primary and secondary antibodies, and finally developed with Amersham ECL Select™ detection system (Amersham™) for analysis of protein levels. Primary antibodies used in this study are listed as follows: anti-E-Cadherin antibody (Cat.# ab15148; Abcam); anti-TTF1 antibody (Cat.# A01477; Biocompare); anti-N-cadherin antibody (Cat.# ab18203; Abcam); anti-vimemtin antibody (Cat.#RV202; Abcam); anti-Bcl 2 antibody (Cat.#GTX27973; GeneTex); anti-LC3B antibodies (Cat. #ab51520; Abcam); anti-P62 antibodies (Cat. #GTX28112; GeneTex); anti-GAPDH antibody (Cat.# ab9484; Abcam).
2. Material and methods 2.1. Isolation of mouse mesothelial peritoneal cells The isolation of mouse mesothelial peritoneal cells from the mouse peritoneal cavity in vivo was carried out, as previously described to minimize lymphocyte and macrophage contamination [24]. Briefly, 8week-old Balb/c mice, provided by the Beijing Vital River Laboratory Animal Technology, were used for mesothelial peritoneal cell isolation. After euthanizing with methoxyflurane, peritoneal cavities of the mice were surgically exposed and immediately washed with injection and removal of 10 ml PBS buffer, followed by injection of 10 ml 0.25% trypsin solution containing 0.02% EDTA solution, into the mice peritoneums. Then, the animal bodies were kept at 37℃ for 15 min, and PBS buffer was applied to keep the external peritoneal cavity moist, accompanied with periodical massaging to aid cell detachment. The trypsin solution was collected using needle and syringe, and fetal calf serum (FCS)-containing culture medium was again injected into the peritoneal cavity. After the peritoneal cavity was opened, the peritoneal walls were washed with culture medium. Cell-containing medium was then centrifuged for 5 min at 250 g for collection of detached cells, which were then resuspended with new culture medium and cultured for subsequent analysis.
2.5. Cell counting Kit-8 (CCK8) assay Mouse mesothelial peritoneal cells were seeded in 96-well plates and cultured at 37℃ for 4 h, and then mixed with either specified apigenin or miRNA inhibitors. After treatment for the specified time, about 10 μl CCK8 solution (MedChem Express) was added into each well, followed by incubation for another 1–4 h at 37℃. Finally, absorbance at 450 nm (OD450) was measured using a spectrophotometer, for comparison of the viabilities and proliferation rates of mouse mesothelial peritoneal cells. At least three biological replicates were performed for statistical analysis of MMC viability and proliferation rates. 2.6. Cell apoptosis assay Hoechest staining was carried out using the Hoechst Staining Kit (Cat. #C0003) provided by the Beyotime company (Jiangsu, China), according to the manufacturer’s instructions. For flow cytometry analysis, approximately 104 cells cultured in medium were washed twice with PBS solution, digested with 1 ml 0.25% trypsin solution, and resuspended in fresh medium. After centrifuge at 1000 rpm for 5 min, cell pellets were resuspended in 200 μl annexin V/7-AAD solution and incubated for 15 min in the dark. The ratio of apoptotic cells were analyzed using flow cytometry.
2.2. Cell culture and treatment Isolated mouse mesothelial peritoneal cells (MMCs) were cultured in RPMI 1640 medium supplemented with 15% FCS, L-glutamine, hydrocortisone, insulin, transferrin, selenium, 20 mM HEPES, 4 mg/l 374
Biomedicine & Pharmacotherapy 106 (2018) 373–380
Y. Zhang et al.
Table 1 Primers used for relative mRNA level analysis by qRT-PCR. Gene
Sequence (5’-3’)
β-actin F β-actin R E-cadherin F E-cadherin R N-cadherin F N-cadherin R Vimentin F Vimentin R TTF F TTF R All R Mir34a RT Mir34a F Mir449b RT Mir449b F Mir351 RT Mir351 F Mir144 RT Mir144 F Mir-16 RT Mir-16 F U6 F U6 R
CATTGCTGACAGGATGCAGA CTGCTGGAAGGTGGACAGTGA GTTGTTGTCACAGACCCCAC TTCCTGACCCACACCAAAGT TACAGCGCAGTCTTACCGAA GCTTCTCACAGCATACACCG GGAGTCAAACGAGTACCGGA GTGACGAGCCATCTCTTCCT AGTCGCCCTCAAGTTCTCTC CTTCCACCTCCACCCAAGAT CTCAACTGGTGTCGTGGA CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACAACCAG ACACTCCAGCTGGGTGGCAGTGTCTTAGCTGG CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGCCAGCTA ACACTCCAGCTGGGAGGCAGTGTTGTTAGC CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCAGGCTCA ACACTCCAGCTGGGTCCCTGAGGAGCCCTTTGAG CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACTTACAGT ACACTCCAGCTGGGGGATATCATCATATACT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCGCCAATAT ACACTCCAGCTGGGTAGCAGCACGTAAATAT CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT
peritoneal cells. For subsequent analyses, we treated cells with 75 mM glucose for 48 h, so as to produce significant mesothelial peritoneal cell fibrosis.
2.7. Immunofluorescence staining MMCs were fixed in 4% paraformaldehyde at RT for 15 min, permeabilized with 0.25% Triton X-100 for 10 min, washed for 5 min with PBS 3 times, incubated with 5% bovine serum albumin for 0.5 h, and incubated with the anti-E-cadherin antibodies overnight at 4 °C in a humidified atmosphere. The next day, MMCs were washed 3 times with PBS for 5 min, incubated with FITC-conjugated secondary antibodies at RT for 1 h, and then stained with DAPI for 1 min. Fluorescence microscopy was performed for analysis of biomarker expression. At least three biological repeats were performed.
3.2. The half maximal inhibitory concentration of apigenin on MMCs To analyze the effects of apigenin on peritoneal fibrosis, isolated mouse mesothelial peritoneal cells were treated with 1, 2, 4, 8 and 16 μM apigenin for 24 h. The Cell Counting Kit-8 (CCK8) assay showed that the viability of mouse mesothelial peritoneal cells was inhibited by apigenin in a dose-dependent manner (Fig. 2). To investigate this further, we determined that the IC50 (half maximal inhibitory concentration) of apigenin on mouse mesothelial peritoneal cell viability was 4.98 μM, as shown in Fig. 2. Thus, 1.0 μM apigenin, which is lower than its IC50 value, was used in subsequent experiments.
2.8. Statistical analysis Data from at least three independent biological replicates were analyzed for statistical significance analysis, using the SPSS 18.0 software package in this study. Significant differences were defined by a two-sided P value of < 0.05.
3.3. Apigenin regulates MMC proliferation and apoptosis during fibrosis via miRNAs To assess the roles of miRNAs in regulating peritoneal fibrosis, we measured the expression levels of five miRNAs, miR34a, miR499b, miR351, miR144 and miR16 in mouse mesothelial peritoneal cells cultured with high glucose, by quantitative RT-PCR assay. We observed that expression levels of four of the five miRNAs in mouse mesothelial peritoneal cells, were significantly increased by treatment with high glucose (Fig. 3A). The drastic alterations in miRNA expression levels induced by high glucose treatment, suggest a role for miRNAs in the development of peritoneal fibrosis. As shown in Fig. 3A, the expression levels of miR34a showed the most significant increase induced by high glucose. This indicates a potential regulatory function in mouse mesothelial peritoneal cell fibrosis. Strikingly, we found that apigenin treatment induced a drastic decrease in miR34a expression levels in mesothelial peritoneal cells cultured with high glucose (Fig. 3B), suggesting that apigenin is important in regulating miRNA expression. We next studied the effects of apigenin and a miRNA inhibitor against miR34a, on mesothelial peritoneal cell fibrosis induced by highglucose. By CCK assay, we found that the proliferation rates of mouse mesothelial peritoneal cells were remarkably lowered during the fibrosis progression induced by high glucose (Fig. 3C). More importantly, MMC proliferation rates during fibrosis were greatly elevated by treatment with miRNA inhibitors, directly revealing the pro-fibrotic
3. Results 3.1. Induction of mouse mesothelial peritoneal cell fibrosis To investigate the role of miRNAs in peritoneal fibrosis and to study the potential therapeutic effects of apigenin, we isolated mesothelial peritoneal cells from peritoneal cavities of the mice, as described above (Fig. 1A). The majority of MMCs were pleomorphic, often with a polygon shape, which is typical of mesothelial peritoneal cells. Then, cells were cultured with specific medium containing 0, 50 and 75 mM glucose to induce fibrosis. Considering the significant roles of epithelialmesenchymal transition in the pathology of fibrosis, we evaluated four specific biomarkers of this pathway by qRT-PCR and Western blotting (Fig. 1B and 1C). The mRNA and protein levels of E-cadherin and transcription termination factor (TTF) were reduced after treatment with high glucose (HG) in mouse mesothelial peritoneal cells in a dosedependent manner, while levels of N-cadherin and Vimentin increased (Fig. 1B and C). We also measured changes in expression of EMT biomarkers induced by HG treatment for 0, 12, 24 and 48 h, by qRT-PCR and Western blotting (Fig. 1D and E). We observed a drastically altered change in EMT biomarker expression levels, confirming that high glucose treatment successfully induced fibrosis in murine mesothelial 375
Biomedicine & Pharmacotherapy 106 (2018) 373–380
Y. Zhang et al.
Fig. 1. Mouse mesothelial peritoneal cell isolation and fibrosis induction. (A) Mesothelial peritoneal cells isolated from mouse peritoneal cavity. (B, C) EMT biomarker expression in mouse mesothelial peritoneal cells induced by distinct HG levels. Quantitative RT-PCR (B) and Western blotting (C) were performed to detect mRNA and protein levels, respectively. (D, E) EMT biomarker expressions in mouse mesothelial peritoneal cells induced for different times. Quantitative RT-PCR (D) and Western blotting (E) were performed to detect mRNA and protein levels, respectively. GAPDH was used as the internal standard. MMC: mouse mesothelial peritoneal cell; HG: high glucose; TTF: transcription termination factor; GAPDH: glyceraldehyde-3-phosphate dehydrogenase. ** indicates P < 0.01.
staining and flow cytochemistry. We observed that a great portion of mouse mesothelial peritoneal cells during fibrosis induced by high glucose were undergoing apoptosis, while treatment with either miRNA inhibitor or apigenin significantly reduced the ratios of apoptotic mouse mesothelial peritoneal cells (Fig. 3D). The inhibitory roles of miRNA inhibitor and apigenin on high-glucose-induced mouse mesothelial peritoneal cell apoptosis were additionally verified by flow cytometry
effects of miR34a in mouse mesothelial peritoneal cells (Fig. 3C). Similarly, treatment with apigenin also increased the MMC proliferation rate in mouse mesothelial peritoneal cell fibrosis induced by high glucose, and the combined treatment of apigenin and miRNA inhibitors resulted in an even higher increase in cell proliferation rates, validating the anti-fibrotic effects of apigenin during peritoneal fibrosis (Fig. 3C). For further evidence, we explored the apoptosis of MMC by Hoechest 376
Biomedicine & Pharmacotherapy 106 (2018) 373–380
Y. Zhang et al.
fibrosis, caused by peritoneal dialysis in renal patients, has been greatly limited by a poor understanding of its pathological mechanisms. The abnormal alteration in expressions of several biomarkers in peritoneal mesothelial cells is associated with peritoneal fibrosis in humans and other animals [25–27]. Hence, peritoneal mesothelial cells are considered an important cellular model for the analysis of fibrosis pathology and underlying mechanisms [24,28]. Consistent with previous reports showing that glucose in the dialysis solution is responsible for peritoneal fibrosis during dialysis treatment [2,29], cellular fibrosis model with high doses of glucose have been established, for analysis of fibrosis in the peritoneum and other organs [30,31]. In the present study, we isolated peritoneal mesothelial cells from peritoneal cavities in mice, followed by the induction of peritoneal mesothelial cell fibrosis by culturing with high glucose. The significant changes in expression levels of multiple EMT biomarkers in peritoneal mesothelial cells verified the successful establishment of high glucose-treated mouse peritoneal mesothelial cells, as a model for investigation of peritoneal fibrosis. Our experimental design can be applied to characterize key players involved in fibrosis progression, as well as in the development of novel therapeutic agents for clinical treatment. Natural products and active components from traditional herbal medicine have been demonstrated to have inhibitory effects against many types of pathological fibrosis [32]. For instance, Helioxanthin derived from Heliopsishelianthoides, Wogonin found in Scutellariabaicalensis, Curcumin found in ginger and a variety of other natural plant metabolites are reported to inhibit progression of liver fibrosis though various molecular mechanisms [32]. Specifically, Curcumin inhibits carbon tetrachloride (CCl4)-induced rat liver fibrosis by suppressing proangiogenic factors associated with cannabinoid receptors, inhibits extracellular matrix (ECM) expression and collagen deposition, and elevates procollagenase-3 (MMP-13) and glutathione contents in serum [33–35]. Dioscin, a natural plant steroid saponin, protects against fructose-induced renal fibrosis and damages by modulating the transforming growth factor β (TGF-β)/Smad pathway and other signaling cascades [36]. Although a multitude of studies have convincingly demonstrated the application of natural products in inhibiting fibrosis progression in various organs, few candidates have been shown to effectively treat peritoneal fibrosis. We used cellular peritoneal fibrosis induced by high glucose, and determined the IC50 of apigenin on mouse peritoneal mesothelial cells. We further showed that apigenin significantly promotes mouse peritoneal mesothelial cell proliferation and suppresses apoptosis during fibrosis induced by high glucose. Our results identified apigenin as a novel inhibitory agent for treatment of peritoneal fibrosis, further confirming the prevalent anti-fibrotic function of this plant metabolite. In consideration of the large number of natural components from plants and other species with anti-fibrotic effect, it should be noted that their potential applications for peritoneal fibrosis treatment also warrant further study. Besides natural metabolites, modulation of microRNA function is considered a promising strategy to treat various human diseases. As mentioned above, microRNA and related epigenetic regulation are important mediating mechanisms underlying the development of fibrosis in various organs [37–39]. For insights into the pathological roles of microRNAs during peritoneal fibrosis progression, we analzyed the expression levels of five major miRNAs, shown to be associated with fibrosis, in mouse peritoneal mesothelial cell fibrosis induced by high glucose. We found a significant increase in expression levels of four microRNAs during mesothelial cell fibrosis. Suppression of the expression of these miRNAs via specific miRNA inhibitors revealed an increase in the proliferation and apoptosis rates during mouse peritoneal mesothelial cell fibrosis, similar to the anti-fibrotic effects observed with apigenin. As further support, the combined treatment with apigenin and miR34a led to even more significant changes in cell proliferation and apoptosis. Autophagy is an important cellular process that promotes peritoneal fibrosis in long-term peritoneal dialysis [40]. We observed significant alterations in the expressions of major autophagy
Fig. 2. Half maximal inhibitory concentration (IC50) of apigenin on MMCs. Mouse mesothelial peritoneal cells isolated from mouse peritoneal cavity were cultured in specific medium containing 0, 1, 2, 4, 8 and 16 mM apigenin for 24 h, and the viability of mouse mesothelial peritoneal cells was determined by the CCK8 assay. MMC: mouse mesothelial peritoneal cells; Api: apigenin; IC50: half maximal inhibitory concentration;
(Fig. 3E). Furthermore, the combination of apigenin and the miRNA34a inhibitor induced significantly stronger inhibitory effects on mesothelial peritoneal cell apoptosis (Fig. 3D and E). These results strongly support the association of miRNA expression with peritoneal fibrosis progression, and validate the anti-fibrotic effects of apigenin. 3.4. EMT, apoptosis and autophagy biomarkers in MMC fibrosis inhibition by a miRNA inhibitor and apigenin For more insights into the molecular mechanisms of the anti-fibrotic effects of miRNA inhibitor and apigenin, the expression of several EMT biomarkers, as well as key genes associated with cell apoptosis and autophagy, were analyzed in mouse mesothelial peritoneal cells. First, we observed that the expression levels of E-cadherin and TTF were markedly increased in high glucose-treated mouse mesothelial peritoneal cells by both a miRNA inhibitor and apigenin (Fig. 4A). In contrast, the expression levels of N-cadherin and vimentin were significantly repressed by miRNA or apigenin treatment during mouse mesothelial peritoneal cell fibrosis (Fig. 4A). Also, the alteration in the expression levels of the EMT biomarkers E-cadherin, N-cadherin, TTF and vimentin were further confirmed by immunofluorescence, which is consistent with our Western blotting results (Fig. 4B). These data suggested that the inhibition of mouse mesothelial peritoneal cell fibrosis by the miRNA inhibitor or apigenin might be mediated by modulating EMT progression. Moreover, the expression levels of B-cell lymphoma-2 (Bcl2) were also suppressed by the miRNA inhibitor or apigenin in mouse mesothelial peritoneal cells with high-glucose-induced fibrosis (Fig. 4C). We observed similar changes in expression levels of the autophagy biomarkers, microtubule-associated protein 1 light chain-3B (LC3B) and P62 in mouse mesothelial peritoneal cells treated with the miRNA inhibitor and apigenin (Fig. 4C). Similar to changes in cell proliferation and apoptosis described above, the combined treatment with apigenin and a miRNA34 inhibitor produced significantly higher changes in the expression levels of EMT, apoptosis and autophagy biomarkers (Fig. 4A-C). Taken together, the significantly altered expressions of the above biomarkers further support our hypothesis that miRNAs and apigenin regulate mouse mesothelial peritoneal cell EMT progression, apoptosis and even autophagy, and are associated with the inhibition of peritoneal fibrosis. 4. Discussion Development of novel effective preventive methods for peritoneal 377
Biomedicine & Pharmacotherapy 106 (2018) 373–380
Y. Zhang et al.
Fig. 3. Proliferation and apoptosis of MMCs in fibrosis regulated by apigenin and miR34a inhibitors. (A) Expression levels of miR34a, miR499b, miR351, miR144 and miR16 in mouse mesothelial peritoneal cells cultured in medium containing 75 mM glucose for 48 h were determined by quantitative RT-PCR assay. (B) Expression of miR34a in mouse mesothelial peritoneal cells treated with 1.0 μM apigenin. (C) Proliferation rates of mesothelial peritoneal cells treated with high glucose with combination of miRNA inhibitors and 1.0 μM apigenin. CCK8 assay was performed to evaluate MMC proliferation rates. (D, E) Apoptosis of mesothelial peritoneal cells treated with high glucose with combination of miRNA inhibitors and 1.0 μM apigenin. Hoechest staining (D) and flow cytometry (E) were carried out to analyze apoptosis of MMCs. The specific miRNA inhibitor against miR34a was used to suppress its expression. MMC: mouse mesothelial peritoneal cell; HG: high glucose; NC: negative control; Api: apigenin; FC: flow cytometry; NS: non-significant difference; ** indicates P < 0.01.
378
Biomedicine & Pharmacotherapy 106 (2018) 373–380
Y. Zhang et al.
Fig. 4. Biomarker expression during MMC fibrosis induced by high glucose. (A) Expression of EMT biomarkers in mesothelial peritoneal cells treated with high glucose with combination of miRNA inhibitors and 1.0 μM apigenin. (B) Immunofluorescence staining of EMT biomarkers in mesothelial peritoneal cells treated with miRNA inhibitors and 1.0 μM apigenin. Magnification ×200 was applied. (C) Protein levels of apoptosis and autophagy biomarkers in mesothelial peritoneal cells treated with high glucose with combination of miRNA inhibitors and 1.0 μM apigenin. Western blotting assay was performed to analyze protein abundance using specific antibodies. MMC: mouse mesothelial peritoneal cell; HG: high glucose; NC: negative control; Api: apigenin; TTF：Transcription termination factor; Bcl-2: B-cell lymphoma-2; LC3B: microtubule-associated protein 1 light chain3B; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; 379
Biomedicine & Pharmacotherapy 106 (2018) 373–380
Y. Zhang et al.
biomarkers in cells treated with apigenin and the miRNA34a inhibitor. These findings suggest a significant role for microRNAs in peritoneal fibrosis pathology, and also provides a substantial basis for the development of novel treatments for peritoneal fibrosis using specific microRNA inhibitors. We do acknowledge, however that our study has a few limitations. A large-scale transcriptomic analysis of microRNA profiles in response to fibrosis induction by high glucose and apigenin treatment might provide a more comprehensive understanding of the implication of microRNAs in peritoneal fibrosis progression. Also, it will offer large numbers of candidates for the development of peritoneal fibrosis treatments based on regulation of functional microRNA expression, and the combined regulation of multiple microRNA expression might produce better anti-fibrotic effects. In addition, cellular models are different from the conditions that exist in peritoneal fibrosis patients. Therefore, the significant anti-fibrotic roles of both apigenin and microRNA depletion should be further tested using animal models before it is considered for clinical experiments.
[13] [14] [15] [16] [17]
[18]
[19]
[20]
[21]
5. Conclusions [22]
In summary, we established a cellular model of peritoneal fibrosis using isolated mouse peritoneal mesothelial cells by high glucose. The effects of both plant metabolite apigenin and miRNA inhibitor on inhibiting peritoneal fibrosis progression were confirmed by reduced expression changes in cell proliferation and apoptosis, in combination with significantly reduced biomarker expressions. Our results provided a basis for application of apigenin and microRNA inhibitors for treatment of peritoneal fibrosis induced by chronic peritoneal dialysis.
[23]
[24] [25]
[26]
Conflict of interest
[27]
The authors declare no conflict of interest. [28]
Acknowledgements [29]
This work was supported by Shandong University. [30]
References
[31] [1] J.A. Stein, Peritoneal dialysis and epithelial-to-mesenchymal transition, N. Engl. J. Med. 348 (2003) 2037–2039. [2] H. Ha, H.B. Lee, Effect of high glucose on peritoneal mesothelial cell biology, Perit. Dial. Int. J. Int. Soc. Perit. Dial. 20 (Suppl 2) (2000) S15. [3] J.D. Williams, K.J. Craig, N. Topley, et al., Morphologic changes in the peritoneal membrane of patients with renal disease, J. Am. Soc. Nephrol. Jasn 13 (2002) 470. [4] M.A. Mateijsen, A.V.D. Wal, P.M. Hendriks, et al., Vascular and interstitial changes in the peritoneum of CAPD patients with peritoneal sclerosis, Perit. Dial. Int. J. Int. Soc. Perit. Dial. 19 (1999) 517. [5] G.A. Calin, C.M. Croce, MicroRNA signatures in human cancers, Nat. Rev. Cancer 6 (2006) 857–866. [6] P. Landgraf, M. Rusu, R. Sheridan, et al., A mammalian microRNA expression atlas based on small RNA library sequencing, Cell 129 (2007) 1401–1414. [7] D. Tang, K. Chen, L. Huang, et al., Pharmacokinetic properties and drug interactions of apigenin, a natural flavone, Expert Opin. Drug. Metab. Toxicol. 13 (2017) 1–8. [8] R. Verjans, T. Peters, F.J. Beaumont, et al., MicroRNA-221/222 family counteracts myocardial fibrosis in pressure overload-induced heart failure, Hypertension 71 (2017) 280–288 Epub ahead of print. [9] M. Takano, C. Nekomoto, M. Kawami, et al., Role of miR-34a in TGF-β1- and druginduced epithelial-mesenchymal transition in alveolar type II epithelial cells, J Pharm. Sci. 106 (2017) 5. [10] X. He, Y. Sun, N. Lei, et al., MicroRNA-351 promotes schistosomiasis-induced hepatic fibrosis by targeting the vitamin D receptor, Proc. Natl. Acad. Sci. U. S. A. 115 (2018) 6. [11] P. Kumar, S. Bhattacharyya, K.W. Peters, et al., miR-16 rescues F508del-CFTR function in native cystic fibrosis epithelial cells, Gene Ther. 22 (2015) 908. [12] Z. Liu, Y. Jian, Y. Rong, et al., miR-144 regulates transforming growth factor-β1
[32] [33]
[34] [35]
[36]
[37] [38] [39] [40]
380
iduced hepatic stellate cell activation in human fibrotic liver, Int. J. Clin. Exp. Pathol. 8 (2015) 3994. J.W. Yu, W.J. Duan, X.R. Huang, et al., MicroRNA-29b inhibits peritoneal fibrosis in a mouse model of peritoneal dialysis, Lab. Invest. 94 (2014) 978–990. J. Madunić, I.V. Madunić, G. Gajski, et al., Apigenin: a dietary flavonoid with diverse anticancer properties, Cancer Lett. 413 (2018) 11–22. Z. Yue, Z. Jie, Y. Li, et al., Natural polyphenols for prevention and treatment of cancer, Nutrients 8 (2016). S.F. Nabavi, H. Khan, G. D’Onofrio, et al., Apigenin as neuroprotective agent: of mice and men, Pharmacol. Res. 22 (2016) 515. L.P. Chan, T.H. Chou, H.Y. Ding, et al., Apigenin induces apoptosis via tumor necrosis factor receptor- and Bcl-2-mediated pathway and enhances susceptibility of head and neck squamous cell carcinoma to 5-fluorouracil and cisplatin, Biochim. Biophys. Acta 1820 (2012) 1081. M.R. Coombs, M.E. Harrison, D.W. Hoskin, Apigenin inhibits the inducible expression of programmed death ligand 1 by human and mouse mammary carcinoma cells, Cancer Lett. 380 (2016) 424–433. S. Zhang, X. Liu, C. Sun, et al., Apigenin attenuates experimental autoimmune myocarditis by modulating Th1/Th2 cytokine balance in mice, Inflammation 39 (2016) 678–686. Y.Z. Guan, J. Li, X.W. Zhang, et al., Effectiveness of repetitive transcranial magnetic stimulation (rTMS) after acute stroke: a one-year longitudinal randomized trial, Cns Neurosci. Ther. 23 (2017) 940–946. D.F. Hicks, N. Goossens, A. Blasgarcía, et al., Transcriptome-based repurposing of apigenin as a potential anti-fibrotic agent targeting hepatic stellate cells, Sci. Rep. 7 (2017) 42563. A.A. Mrazek, X. Wang, C. Ding, et al., Design, synthesis, and characterization of novel apigenin analogues that suppress pancreatic stellate cell proliferation in vitro and associated pancreatic fibrosis in vivo, Bioorg. Med. Chem. 22 (2014) 3393. X. Wei, P. Gao, Y. Pu, et al., Activation of TRPV4 by dietary apigenin antagonizes renal fibrosis in deoxycorticosterone acetate (DOCA) salt-induced hypertension, Clin. Sci. 131 (2017) 567. J. Bot, D. Whitaker, J. Vivian, et al., Culturing mouse peritoneal mesothelial cells, Pathol. Res. Pract 199 (2003) 341–344. S.D.V. An, R.G. Tilton, S. Mortier, et al., Myofibroblast transdifferentiation of mesothelial cells is mediated by RAGE and contributes to peritoneal fibrosis in uraemia, Nephrol. Dial. Transpl. 21 (2006) 2549–2555. S. Kitamura, N. Horimoto, K. Tsuji, et al., The selection of peritoneal mesothelial cells is important for cell therapy to prevent peritoneal fibrosis, Tissue Eng. Part A 20 (2014) 529. T. Tsukada, S. Fushida, S. Harada, et al., The role of human peritoneal mesothelial cells in the fibrosis and progression of gastric cancer, Int. J. Oncol. 41 (2012) 476–482. H.S. Shin, J. Ko, D.A. Kim, et al., Metformin ameliorates the phenotype transition of peritoneal mesothelial cells and peritoneal fibrosis via a modulation of oxidative stress, Sci. Rep. 7 (2017) 5690. S. Jing, Y. Kezhou, Z. Hong, et al., Effect of renin-angiotensin system inhibitors on prevention of peritoneal fibrosis in peritoneal dialysis patients, Nephrology 15 (2010) 27–32. W. Hu, Z. Jiang, Y. Zhang, et al., Characterization of infiltrating macrophages in high glucose-induced peritoneal fibrosis in rats, Mol. Med. Reports 6 (2012) 93. J. Li, S.S. Lim, J.Y. Lee, et al., Purple corn anthocyanins dampened high-glucoseinduced mesangial fibrosis and inflammation: possible renoprotective role in diabetic nephropathy ╢┐ﻕ┐╢ ﻕ┐╢ﻕ, J. Nutr. Biochem. 23 (2012) 320–331. S.R. Chen, X.P. Chen, J.J. Lu, et al., Potent natural products and herbal medicines for treating liver fibrosis, Chin. Med. 10 (2015) 7. G. Shuang, D. Xiaoxu, W. Xin, et al., Curcumin attenuates arsenic-induced hepatic injuries and oxidative stress in experimental mice through activation of Nrf2 pathway, promotion of arsenic methylation and urinary excretion, Food Chem. Toxicol. 59 (2013) 739–747. L. Vera-Ramirez, P. Pérez-Lopez, A. Varela-Lopez, et al., Curcumin and liver disease, Biofactors 39 (2013) 88–100. Z. Zhang, Y. Guo, S. Zhang, et al., Curcumin modulates cannabinoid receptors in liver fibrosis in vivo and inhibits extracellular matrix expression in hepatic stellate cells by suppressing cannabinoid receptor type-1 in vitro, Eur. J. Pharmacol. 721 (2013) 133. Y. Qiao, L. Xu, X. Tao, et al., Protective effects of dioscin against fructose-induced renal damage via adjusting Sirt3-mediated oxidative stress, fibrosis, lipid metabolism and inflammation, Toxicol. Lett. 284 (2017) 37. Y. Li, J. Zhang, Y. Lei, et al., MicroRNA-21 in skin fibrosis: potential for diagnosis and treatment, Mol. Diagn. Ther. (2017) 1–10. E. Moransalvador, J. Mann, Epigenetics and liver fibrosis, Cell. Mol. Gastroenterol. Hepatol. 4 (2017) 125–134. A. Wojciechowska, A. Braniewska, K. Kozar-Kamińska, MicroRNA in cardiovascular biology and disease, Adv. Clin. Exp. Med. 26 (2017) 865–874. J. Wu, C. Xing, L. Zhang, et al., Autophagy promotes fibrosis and apoptosis in the peritoneum during long-term peritoneal dialysis, J. Cell. Mol. Med. 22 (2017) 1190–1201.
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Apigenin suppresses mouse peritoneal fibrosis by down-regulating miR34a expression
T
Yiming Zhanga,b,1, Qiaoling Suna,1, Xiang Lib, Xiaofen Mab, Yang Lib, Zhanfeng Jiaob, ⁎ Xiang-Dong Yanga, a b
Department of Nephrology, Qilu Hospital, Shandong University, Jinan, Shandong, 250012, China Department of Nephrology, Affiliated Hospital of Jining Medical University, Jining, Shandong, 272029, China
A R T I C LE I N FO
A B S T R A C T
Keywords: Key words Apigenin microRNA Peritoneal fibrosis Mouse mesothelial peritoneal cells High glucose Apoptosis
Peritoneal fibrosis is a severe side-effect of chronic peritoneal dialysis in patients with end-stage renal disease, but not enough effective therapeutic drugs are currently available in clinics. The aim of this study was to evaluate the effects of apigenin and miRNA on the progression of peritoneal fibrosis. We treated isolated mouse mesothelial peritoneal cells (MMCs) with high glucose (HG), to induce fibrosis. We used qRT-PCR and Western blotting to measure the expressions of multiple epithelial-mesenchymal transition (EMT) biomarkers, like Ecadherin, transcription termination factor (TTF), N-cadherin and vimentin, as well as several apoptosis and autophagy biomarkers. We determined the IC50 of apigenin on MMC fibrosis. We also used qRT-PCR to assess the expressions of miRNAs in MMC fibrosis. In addition, we by used the CCK8 assay, Hoechest staining and flow cytometry, to measure cell viability and proliferation rates. We successfully induced fibrosis using high glucose (HG) treatment in MMCs. This was further validated by the observed changes in E-cadherin, TTF, N-cadherin and vimentin expression levels. We also observed highly elevated expression levels of miR34a during HG-induced MMC fibrosis. Apigenin treatment induced a significant decrease in miR34a expression levels in HG-treated MMCs. Moreover, both apigenin treatment and miR34a depletion, as well as their combination, significantly promoted proliferation and suppressed apoptosis of MMCs treated with high glucose. This was accompanied with a corresponding alteration in expressions of EMT, apoptosis and autophagy biomarkers. In summary, apigenin effectively inhibits mouse mesothelial peritoneal cell fibrosis induced by high glucose, and this is, at least partially mediated by the suppression of miR34a expression.
1. Introduction Peritoneal dialysis (PD), a form of renal replacement therapy, is an effective method for treating patients with end-stage renal diseases, like acute and chronic renal failure, and acute drug and poison intoxication [1]. However, long-term use of peritoneal dialysis is greatly limited because of peritoneal fibrosis caused by the glucose added in the bioincompatible peritoneal dialysis solutions (PDF) [2]. Chronic exposure to glucose-containing bioincompatible peritoneal dialysis solutions usually leads to histological alterations in peritoneum, such as the loss of mesothelial cell monolayer, excessive extracellular matrix deposition and angiogenesis [3,4]. It is thus, clinically imperative to prevent peritoneal fibrosis during peritoneal dialysis. MicroRNAs (miRNAs) are small non-coding RNA molecules, that regulate various physiological and pathological processes by modulating post-transcriptional gene expression [5,6]. Interestingly, ⁎
1
miRNAs are also important players in development of multiple fibrosisrelated diseases [7]. One recent study showed the miRNA-221/222 family exhibits anti-myocardial fibrosis activity in pressure-overloaded hearts, where their expression is suppressed [8]. In addition, miR-34a in alveolar type II epithelial cells regulates transforming growth factor (TGF)-β1 and bleomycin-induced epithelial-mesenchymal transition, which is an important mediator of pulmonary fibrosis [9]. Another miRNA, miR-351, was also recently shown to promote schistosomiasisinduced hepatic fibrosis by targeting the vitamin D receptor (VDR), which acts as an antagonist of the Mothers against decapentaplegic homolog (SMAD) signaling pathway [10]. Furthermore, miR144 and miR16 were found to be involved in human fibrotic liver and native cystic fibrosis, respectively [11,12]. More importantly, miRNAs have also been shown to be associated with peritoneal fibrosis [13], but their specific roles and the underlying mechanisms remain largely unknown. Besides adding to the limited knowledge, an urgent need exists for
Corresponding author at: Department of Nephrology, Qilu Hospital, Shandong University, No 107,Wenhuaxi Road, Lixia District, Jinan, Shandong,China. E-mail address: [email protected] (X.-D. Yang). These authors contributed equally to this work.
https://doi.org/10.1016/j.biopha.2018.06.138 Received 19 April 2018; Received in revised form 20 June 2018; Accepted 25 June 2018 0753-3322/ © 2018 Published by Elsevier Masson SAS.
Biomedicine & Pharmacotherapy 106 (2018) 373–380
Y. Zhang et al.
effective preventive and therapeutic treatments for peritoneal fibrosis. Apigenin, a plant-derived secondary metabolite usually present in glycosylated form, is a major dietary flavonoid synthesized in a number of plant species such as celery, parsley, thyme, chamomile, onions, and even plant-derived beverages like tea, wine and beer [14,15]. The clinical studies suggest that apigenin has the potential to treat multiple diseases such as human cancers and neurodegenerative diseases (NNDs) [14,16,7]. For instance, apigenin inhibits the growth and proliferation of human head and neck squamous carcinoma cells by promoting the G2/M cell cycle arrest and enhancing reactive oxygen species (ROS) levels [17]. Moreover, apigenin has been shown to exhibit anti-tumorigenic effects in various other human cancer types including breast cancer, prostate cancer, colorectal cancer, pancreatic cancer, skin cancer, liver cancer, cervical and ovarian cancer [14,17,18,15]. Apigenin also exerts anti-inflammatory and immunomodulatory effects on autoimmune myocarditis [19]. More importantly, apigenin also showed promising therapeutic effects in a number of fibrosis-related diseases. For instance, apigenin treatment in rats revealed that strategically released apigenin from the polymeric carrier significantly inhibited progression of idiopathic pulmonary fibrosis by regulating expression of fibrosis-related cytokines [20]. A recent transcriptome-based analysis showed that apigenin is an effective anti-fibrotic agent in hepatic stellate cells, by potentially mediating the activation of a secreted adipocytokine complement C1q tumor necrosis factor-related protein 2 (C1QTNF2) [21]. In addition, apigenin was also reported to have general inhibitory roles on other fibrosis-related diseases such as renal fibrosis and pancreatic fibrosis [22,23]. However, the roles of apigenin in regulating progression of peritoneal fibrosis have not been previously addressed. In the present study, we isolated mouse mesothelial peritoneal cells (MMCs) and induced fibrosis by treating with high glucose (HG), followed by analyzing the inhibitory role of apigenin on the fibrotic transformation in MMCs. Also, the expression levels of miR34a and the anti-fibrotic effects of miRNA inhibitors were further tested in MMCs. Our results provide a strong basis for the application of apigenin and miRNA-related strategies in the treatment of peritoneal fibrosis.
gentamicin, 120 mg/l benzylpenicillin and 2.5 mg/l amphotericin at 37 °C in a humidified culture chamber supplied with 5% CO2. The culture medium was changed every three days until cells were confluent. Then, cells were washed with PBS buffer, digested with 0.007% EDTA solution containing 0.02% trypsin at 37 °C for 5 min, followed by addition of fresh medium for a new round of culture or subsequent analysis. The apigenin used for cell treatment was purchased from the Merck company (CAS: 520-36-5; Cat. No: 42,251), with a purity of over 99% by high performance liquid chromatography assay. For analysis of miR34a in MMC fibrosis, mouse mesothelial peritoneal cells were cultured in medium containing specific miRNA inhibitors against miR34a, provided by the TEHE-PNA company (Hangzhou, China). 2.3. Quantitative RT-PCR RNA extraction from cultured cells was performed using Trizol solution (Cat.#9109; Takara), according to the manufacturer’s instructions. Approximately 4.0 μg RNA from each sample was used for cDNA synthesis using the Bestar™ qPCR RT kit(Cat. #2220; DBI), according to the manufacturer’s instructions. Finally, relative mRNA levels were measured by PCR using DBI Bestar®SybrGreen qPCR master Mix (Cat. #2043; DBI) following the manufacturer’s instructions. β-actin was used as the internal standard, and at least three biological replicates were performed for statistical analysis of mRNA levels. The sequences of primer pairs used in this study are listed in Table 1. 2.4. Western blotting Total protein was extracted from samples using M-PER™ Mammalian Protein Extraction Reagent (Thermo Fisher Scientific) as per the manufacturer’s instructions, separated by 10% SDS-PAGE, and transferred onto PVDF membrane. After being incubated with 5% lipidfree milk solution for 2 h, the PVDF membrane with cell proteins was then incubated with primary and secondary antibodies, and finally developed with Amersham ECL Select™ detection system (Amersham™) for analysis of protein levels. Primary antibodies used in this study are listed as follows: anti-E-Cadherin antibody (Cat.# ab15148; Abcam); anti-TTF1 antibody (Cat.# A01477; Biocompare); anti-N-cadherin antibody (Cat.# ab18203; Abcam); anti-vimemtin antibody (Cat.#RV202; Abcam); anti-Bcl 2 antibody (Cat.#GTX27973; GeneTex); anti-LC3B antibodies (Cat. #ab51520; Abcam); anti-P62 antibodies (Cat. #GTX28112; GeneTex); anti-GAPDH antibody (Cat.# ab9484; Abcam).
2. Material and methods 2.1. Isolation of mouse mesothelial peritoneal cells The isolation of mouse mesothelial peritoneal cells from the mouse peritoneal cavity in vivo was carried out, as previously described to minimize lymphocyte and macrophage contamination [24]. Briefly, 8week-old Balb/c mice, provided by the Beijing Vital River Laboratory Animal Technology, were used for mesothelial peritoneal cell isolation. After euthanizing with methoxyflurane, peritoneal cavities of the mice were surgically exposed and immediately washed with injection and removal of 10 ml PBS buffer, followed by injection of 10 ml 0.25% trypsin solution containing 0.02% EDTA solution, into the mice peritoneums. Then, the animal bodies were kept at 37℃ for 15 min, and PBS buffer was applied to keep the external peritoneal cavity moist, accompanied with periodical massaging to aid cell detachment. The trypsin solution was collected using needle and syringe, and fetal calf serum (FCS)-containing culture medium was again injected into the peritoneal cavity. After the peritoneal cavity was opened, the peritoneal walls were washed with culture medium. Cell-containing medium was then centrifuged for 5 min at 250 g for collection of detached cells, which were then resuspended with new culture medium and cultured for subsequent analysis.
2.5. Cell counting Kit-8 (CCK8) assay Mouse mesothelial peritoneal cells were seeded in 96-well plates and cultured at 37℃ for 4 h, and then mixed with either specified apigenin or miRNA inhibitors. After treatment for the specified time, about 10 μl CCK8 solution (MedChem Express) was added into each well, followed by incubation for another 1–4 h at 37℃. Finally, absorbance at 450 nm (OD450) was measured using a spectrophotometer, for comparison of the viabilities and proliferation rates of mouse mesothelial peritoneal cells. At least three biological replicates were performed for statistical analysis of MMC viability and proliferation rates. 2.6. Cell apoptosis assay Hoechest staining was carried out using the Hoechst Staining Kit (Cat. #C0003) provided by the Beyotime company (Jiangsu, China), according to the manufacturer’s instructions. For flow cytometry analysis, approximately 104 cells cultured in medium were washed twice with PBS solution, digested with 1 ml 0.25% trypsin solution, and resuspended in fresh medium. After centrifuge at 1000 rpm for 5 min, cell pellets were resuspended in 200 μl annexin V/7-AAD solution and incubated for 15 min in the dark. The ratio of apoptotic cells were analyzed using flow cytometry.
2.2. Cell culture and treatment Isolated mouse mesothelial peritoneal cells (MMCs) were cultured in RPMI 1640 medium supplemented with 15% FCS, L-glutamine, hydrocortisone, insulin, transferrin, selenium, 20 mM HEPES, 4 mg/l 374
Biomedicine & Pharmacotherapy 106 (2018) 373–380
Y. Zhang et al.
Table 1 Primers used for relative mRNA level analysis by qRT-PCR. Gene
Sequence (5’-3’)
β-actin F β-actin R E-cadherin F E-cadherin R N-cadherin F N-cadherin R Vimentin F Vimentin R TTF F TTF R All R Mir34a RT Mir34a F Mir449b RT Mir449b F Mir351 RT Mir351 F Mir144 RT Mir144 F Mir-16 RT Mir-16 F U6 F U6 R
CATTGCTGACAGGATGCAGA CTGCTGGAAGGTGGACAGTGA GTTGTTGTCACAGACCCCAC TTCCTGACCCACACCAAAGT TACAGCGCAGTCTTACCGAA GCTTCTCACAGCATACACCG GGAGTCAAACGAGTACCGGA GTGACGAGCCATCTCTTCCT AGTCGCCCTCAAGTTCTCTC CTTCCACCTCCACCCAAGAT CTCAACTGGTGTCGTGGA CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACAACCAG ACACTCCAGCTGGGTGGCAGTGTCTTAGCTGG CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGGCCAGCTA ACACTCCAGCTGGGAGGCAGTGTTGTTAGC CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCAGGCTCA ACACTCCAGCTGGGTCCCTGAGGAGCCCTTTGAG CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACTTACAGT ACACTCCAGCTGGGGGATATCATCATATACT CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGCGCCAATAT ACACTCCAGCTGGGTAGCAGCACGTAAATAT CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT
peritoneal cells. For subsequent analyses, we treated cells with 75 mM glucose for 48 h, so as to produce significant mesothelial peritoneal cell fibrosis.
2.7. Immunofluorescence staining MMCs were fixed in 4% paraformaldehyde at RT for 15 min, permeabilized with 0.25% Triton X-100 for 10 min, washed for 5 min with PBS 3 times, incubated with 5% bovine serum albumin for 0.5 h, and incubated with the anti-E-cadherin antibodies overnight at 4 °C in a humidified atmosphere. The next day, MMCs were washed 3 times with PBS for 5 min, incubated with FITC-conjugated secondary antibodies at RT for 1 h, and then stained with DAPI for 1 min. Fluorescence microscopy was performed for analysis of biomarker expression. At least three biological repeats were performed.
3.2. The half maximal inhibitory concentration of apigenin on MMCs To analyze the effects of apigenin on peritoneal fibrosis, isolated mouse mesothelial peritoneal cells were treated with 1, 2, 4, 8 and 16 μM apigenin for 24 h. The Cell Counting Kit-8 (CCK8) assay showed that the viability of mouse mesothelial peritoneal cells was inhibited by apigenin in a dose-dependent manner (Fig. 2). To investigate this further, we determined that the IC50 (half maximal inhibitory concentration) of apigenin on mouse mesothelial peritoneal cell viability was 4.98 μM, as shown in Fig. 2. Thus, 1.0 μM apigenin, which is lower than its IC50 value, was used in subsequent experiments.
2.8. Statistical analysis Data from at least three independent biological replicates were analyzed for statistical significance analysis, using the SPSS 18.0 software package in this study. Significant differences were defined by a two-sided P value of < 0.05.
3.3. Apigenin regulates MMC proliferation and apoptosis during fibrosis via miRNAs To assess the roles of miRNAs in regulating peritoneal fibrosis, we measured the expression levels of five miRNAs, miR34a, miR499b, miR351, miR144 and miR16 in mouse mesothelial peritoneal cells cultured with high glucose, by quantitative RT-PCR assay. We observed that expression levels of four of the five miRNAs in mouse mesothelial peritoneal cells, were significantly increased by treatment with high glucose (Fig. 3A). The drastic alterations in miRNA expression levels induced by high glucose treatment, suggest a role for miRNAs in the development of peritoneal fibrosis. As shown in Fig. 3A, the expression levels of miR34a showed the most significant increase induced by high glucose. This indicates a potential regulatory function in mouse mesothelial peritoneal cell fibrosis. Strikingly, we found that apigenin treatment induced a drastic decrease in miR34a expression levels in mesothelial peritoneal cells cultured with high glucose (Fig. 3B), suggesting that apigenin is important in regulating miRNA expression. We next studied the effects of apigenin and a miRNA inhibitor against miR34a, on mesothelial peritoneal cell fibrosis induced by highglucose. By CCK assay, we found that the proliferation rates of mouse mesothelial peritoneal cells were remarkably lowered during the fibrosis progression induced by high glucose (Fig. 3C). More importantly, MMC proliferation rates during fibrosis were greatly elevated by treatment with miRNA inhibitors, directly revealing the pro-fibrotic
3. Results 3.1. Induction of mouse mesothelial peritoneal cell fibrosis To investigate the role of miRNAs in peritoneal fibrosis and to study the potential therapeutic effects of apigenin, we isolated mesothelial peritoneal cells from peritoneal cavities of the mice, as described above (Fig. 1A). The majority of MMCs were pleomorphic, often with a polygon shape, which is typical of mesothelial peritoneal cells. Then, cells were cultured with specific medium containing 0, 50 and 75 mM glucose to induce fibrosis. Considering the significant roles of epithelialmesenchymal transition in the pathology of fibrosis, we evaluated four specific biomarkers of this pathway by qRT-PCR and Western blotting (Fig. 1B and 1C). The mRNA and protein levels of E-cadherin and transcription termination factor (TTF) were reduced after treatment with high glucose (HG) in mouse mesothelial peritoneal cells in a dosedependent manner, while levels of N-cadherin and Vimentin increased (Fig. 1B and C). We also measured changes in expression of EMT biomarkers induced by HG treatment for 0, 12, 24 and 48 h, by qRT-PCR and Western blotting (Fig. 1D and E). We observed a drastically altered change in EMT biomarker expression levels, confirming that high glucose treatment successfully induced fibrosis in murine mesothelial 375
Biomedicine & Pharmacotherapy 106 (2018) 373–380
Y. Zhang et al.
Fig. 1. Mouse mesothelial peritoneal cell isolation and fibrosis induction. (A) Mesothelial peritoneal cells isolated from mouse peritoneal cavity. (B, C) EMT biomarker expression in mouse mesothelial peritoneal cells induced by distinct HG levels. Quantitative RT-PCR (B) and Western blotting (C) were performed to detect mRNA and protein levels, respectively. (D, E) EMT biomarker expressions in mouse mesothelial peritoneal cells induced for different times. Quantitative RT-PCR (D) and Western blotting (E) were performed to detect mRNA and protein levels, respectively. GAPDH was used as the internal standard. MMC: mouse mesothelial peritoneal cell; HG: high glucose; TTF: transcription termination factor; GAPDH: glyceraldehyde-3-phosphate dehydrogenase. ** indicates P < 0.01.
staining and flow cytochemistry. We observed that a great portion of mouse mesothelial peritoneal cells during fibrosis induced by high glucose were undergoing apoptosis, while treatment with either miRNA inhibitor or apigenin significantly reduced the ratios of apoptotic mouse mesothelial peritoneal cells (Fig. 3D). The inhibitory roles of miRNA inhibitor and apigenin on high-glucose-induced mouse mesothelial peritoneal cell apoptosis were additionally verified by flow cytometry
effects of miR34a in mouse mesothelial peritoneal cells (Fig. 3C). Similarly, treatment with apigenin also increased the MMC proliferation rate in mouse mesothelial peritoneal cell fibrosis induced by high glucose, and the combined treatment of apigenin and miRNA inhibitors resulted in an even higher increase in cell proliferation rates, validating the anti-fibrotic effects of apigenin during peritoneal fibrosis (Fig. 3C). For further evidence, we explored the apoptosis of MMC by Hoechest 376
Biomedicine & Pharmacotherapy 106 (2018) 373–380
Y. Zhang et al.
fibrosis, caused by peritoneal dialysis in renal patients, has been greatly limited by a poor understanding of its pathological mechanisms. The abnormal alteration in expressions of several biomarkers in peritoneal mesothelial cells is associated with peritoneal fibrosis in humans and other animals [25–27]. Hence, peritoneal mesothelial cells are considered an important cellular model for the analysis of fibrosis pathology and underlying mechanisms [24,28]. Consistent with previous reports showing that glucose in the dialysis solution is responsible for peritoneal fibrosis during dialysis treatment [2,29], cellular fibrosis model with high doses of glucose have been established, for analysis of fibrosis in the peritoneum and other organs [30,31]. In the present study, we isolated peritoneal mesothelial cells from peritoneal cavities in mice, followed by the induction of peritoneal mesothelial cell fibrosis by culturing with high glucose. The significant changes in expression levels of multiple EMT biomarkers in peritoneal mesothelial cells verified the successful establishment of high glucose-treated mouse peritoneal mesothelial cells, as a model for investigation of peritoneal fibrosis. Our experimental design can be applied to characterize key players involved in fibrosis progression, as well as in the development of novel therapeutic agents for clinical treatment. Natural products and active components from traditional herbal medicine have been demonstrated to have inhibitory effects against many types of pathological fibrosis [32]. For instance, Helioxanthin derived from Heliopsishelianthoides, Wogonin found in Scutellariabaicalensis, Curcumin found in ginger and a variety of other natural plant metabolites are reported to inhibit progression of liver fibrosis though various molecular mechanisms [32]. Specifically, Curcumin inhibits carbon tetrachloride (CCl4)-induced rat liver fibrosis by suppressing proangiogenic factors associated with cannabinoid receptors, inhibits extracellular matrix (ECM) expression and collagen deposition, and elevates procollagenase-3 (MMP-13) and glutathione contents in serum [33–35]. Dioscin, a natural plant steroid saponin, protects against fructose-induced renal fibrosis and damages by modulating the transforming growth factor β (TGF-β)/Smad pathway and other signaling cascades [36]. Although a multitude of studies have convincingly demonstrated the application of natural products in inhibiting fibrosis progression in various organs, few candidates have been shown to effectively treat peritoneal fibrosis. We used cellular peritoneal fibrosis induced by high glucose, and determined the IC50 of apigenin on mouse peritoneal mesothelial cells. We further showed that apigenin significantly promotes mouse peritoneal mesothelial cell proliferation and suppresses apoptosis during fibrosis induced by high glucose. Our results identified apigenin as a novel inhibitory agent for treatment of peritoneal fibrosis, further confirming the prevalent anti-fibrotic function of this plant metabolite. In consideration of the large number of natural components from plants and other species with anti-fibrotic effect, it should be noted that their potential applications for peritoneal fibrosis treatment also warrant further study. Besides natural metabolites, modulation of microRNA function is considered a promising strategy to treat various human diseases. As mentioned above, microRNA and related epigenetic regulation are important mediating mechanisms underlying the development of fibrosis in various organs [37–39]. For insights into the pathological roles of microRNAs during peritoneal fibrosis progression, we analzyed the expression levels of five major miRNAs, shown to be associated with fibrosis, in mouse peritoneal mesothelial cell fibrosis induced by high glucose. We found a significant increase in expression levels of four microRNAs during mesothelial cell fibrosis. Suppression of the expression of these miRNAs via specific miRNA inhibitors revealed an increase in the proliferation and apoptosis rates during mouse peritoneal mesothelial cell fibrosis, similar to the anti-fibrotic effects observed with apigenin. As further support, the combined treatment with apigenin and miR34a led to even more significant changes in cell proliferation and apoptosis. Autophagy is an important cellular process that promotes peritoneal fibrosis in long-term peritoneal dialysis [40]. We observed significant alterations in the expressions of major autophagy
Fig. 2. Half maximal inhibitory concentration (IC50) of apigenin on MMCs. Mouse mesothelial peritoneal cells isolated from mouse peritoneal cavity were cultured in specific medium containing 0, 1, 2, 4, 8 and 16 mM apigenin for 24 h, and the viability of mouse mesothelial peritoneal cells was determined by the CCK8 assay. MMC: mouse mesothelial peritoneal cells; Api: apigenin; IC50: half maximal inhibitory concentration;
(Fig. 3E). Furthermore, the combination of apigenin and the miRNA34a inhibitor induced significantly stronger inhibitory effects on mesothelial peritoneal cell apoptosis (Fig. 3D and E). These results strongly support the association of miRNA expression with peritoneal fibrosis progression, and validate the anti-fibrotic effects of apigenin. 3.4. EMT, apoptosis and autophagy biomarkers in MMC fibrosis inhibition by a miRNA inhibitor and apigenin For more insights into the molecular mechanisms of the anti-fibrotic effects of miRNA inhibitor and apigenin, the expression of several EMT biomarkers, as well as key genes associated with cell apoptosis and autophagy, were analyzed in mouse mesothelial peritoneal cells. First, we observed that the expression levels of E-cadherin and TTF were markedly increased in high glucose-treated mouse mesothelial peritoneal cells by both a miRNA inhibitor and apigenin (Fig. 4A). In contrast, the expression levels of N-cadherin and vimentin were significantly repressed by miRNA or apigenin treatment during mouse mesothelial peritoneal cell fibrosis (Fig. 4A). Also, the alteration in the expression levels of the EMT biomarkers E-cadherin, N-cadherin, TTF and vimentin were further confirmed by immunofluorescence, which is consistent with our Western blotting results (Fig. 4B). These data suggested that the inhibition of mouse mesothelial peritoneal cell fibrosis by the miRNA inhibitor or apigenin might be mediated by modulating EMT progression. Moreover, the expression levels of B-cell lymphoma-2 (Bcl2) were also suppressed by the miRNA inhibitor or apigenin in mouse mesothelial peritoneal cells with high-glucose-induced fibrosis (Fig. 4C). We observed similar changes in expression levels of the autophagy biomarkers, microtubule-associated protein 1 light chain-3B (LC3B) and P62 in mouse mesothelial peritoneal cells treated with the miRNA inhibitor and apigenin (Fig. 4C). Similar to changes in cell proliferation and apoptosis described above, the combined treatment with apigenin and a miRNA34 inhibitor produced significantly higher changes in the expression levels of EMT, apoptosis and autophagy biomarkers (Fig. 4A-C). Taken together, the significantly altered expressions of the above biomarkers further support our hypothesis that miRNAs and apigenin regulate mouse mesothelial peritoneal cell EMT progression, apoptosis and even autophagy, and are associated with the inhibition of peritoneal fibrosis. 4. Discussion Development of novel effective preventive methods for peritoneal 377
Biomedicine & Pharmacotherapy 106 (2018) 373–380
Y. Zhang et al.
Fig. 3. Proliferation and apoptosis of MMCs in fibrosis regulated by apigenin and miR34a inhibitors. (A) Expression levels of miR34a, miR499b, miR351, miR144 and miR16 in mouse mesothelial peritoneal cells cultured in medium containing 75 mM glucose for 48 h were determined by quantitative RT-PCR assay. (B) Expression of miR34a in mouse mesothelial peritoneal cells treated with 1.0 μM apigenin. (C) Proliferation rates of mesothelial peritoneal cells treated with high glucose with combination of miRNA inhibitors and 1.0 μM apigenin. CCK8 assay was performed to evaluate MMC proliferation rates. (D, E) Apoptosis of mesothelial peritoneal cells treated with high glucose with combination of miRNA inhibitors and 1.0 μM apigenin. Hoechest staining (D) and flow cytometry (E) were carried out to analyze apoptosis of MMCs. The specific miRNA inhibitor against miR34a was used to suppress its expression. MMC: mouse mesothelial peritoneal cell; HG: high glucose; NC: negative control; Api: apigenin; FC: flow cytometry; NS: non-significant difference; ** indicates P < 0.01.
378
Biomedicine & Pharmacotherapy 106 (2018) 373–380
Y. Zhang et al.
Fig. 4. Biomarker expression during MMC fibrosis induced by high glucose. (A) Expression of EMT biomarkers in mesothelial peritoneal cells treated with high glucose with combination of miRNA inhibitors and 1.0 μM apigenin. (B) Immunofluorescence staining of EMT biomarkers in mesothelial peritoneal cells treated with miRNA inhibitors and 1.0 μM apigenin. Magnification ×200 was applied. (C) Protein levels of apoptosis and autophagy biomarkers in mesothelial peritoneal cells treated with high glucose with combination of miRNA inhibitors and 1.0 μM apigenin. Western blotting assay was performed to analyze protein abundance using specific antibodies. MMC: mouse mesothelial peritoneal cell; HG: high glucose; NC: negative control; Api: apigenin; TTF：Transcription termination factor; Bcl-2: B-cell lymphoma-2; LC3B: microtubule-associated protein 1 light chain3B; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; 379
Biomedicine & Pharmacotherapy 106 (2018) 373–380
Y. Zhang et al.
biomarkers in cells treated with apigenin and the miRNA34a inhibitor. These findings suggest a significant role for microRNAs in peritoneal fibrosis pathology, and also provides a substantial basis for the development of novel treatments for peritoneal fibrosis using specific microRNA inhibitors. We do acknowledge, however that our study has a few limitations. A large-scale transcriptomic analysis of microRNA profiles in response to fibrosis induction by high glucose and apigenin treatment might provide a more comprehensive understanding of the implication of microRNAs in peritoneal fibrosis progression. Also, it will offer large numbers of candidates for the development of peritoneal fibrosis treatments based on regulation of functional microRNA expression, and the combined regulation of multiple microRNA expression might produce better anti-fibrotic effects. In addition, cellular models are different from the conditions that exist in peritoneal fibrosis patients. Therefore, the significant anti-fibrotic roles of both apigenin and microRNA depletion should be further tested using animal models before it is considered for clinical experiments.
[13] [14] [15] [16] [17]
[18]
[19]
[20]
[21]
5. Conclusions [22]
In summary, we established a cellular model of peritoneal fibrosis using isolated mouse peritoneal mesothelial cells by high glucose. The effects of both plant metabolite apigenin and miRNA inhibitor on inhibiting peritoneal fibrosis progression were confirmed by reduced expression changes in cell proliferation and apoptosis, in combination with significantly reduced biomarker expressions. Our results provided a basis for application of apigenin and microRNA inhibitors for treatment of peritoneal fibrosis induced by chronic peritoneal dialysis.
[23]
[24] [25]
[26]
Conflict of interest
[27]
The authors declare no conflict of interest. [28]
Acknowledgements [29]
This work was supported by Shandong University. [30]
References
[31] [1] J.A. Stein, Peritoneal dialysis and epithelial-to-mesenchymal transition, N. Engl. J. Med. 348 (2003) 2037–2039. [2] H. Ha, H.B. Lee, Effect of high glucose on peritoneal mesothelial cell biology, Perit. Dial. Int. J. Int. Soc. Perit. Dial. 20 (Suppl 2) (2000) S15. [3] J.D. Williams, K.J. Craig, N. Topley, et al., Morphologic changes in the peritoneal membrane of patients with renal disease, J. Am. Soc. Nephrol. Jasn 13 (2002) 470. [4] M.A. Mateijsen, A.V.D. Wal, P.M. Hendriks, et al., Vascular and interstitial changes in the peritoneum of CAPD patients with peritoneal sclerosis, Perit. Dial. Int. J. Int. Soc. Perit. Dial. 19 (1999) 517. [5] G.A. Calin, C.M. Croce, MicroRNA signatures in human cancers, Nat. Rev. Cancer 6 (2006) 857–866. [6] P. Landgraf, M. Rusu, R. Sheridan, et al., A mammalian microRNA expression atlas based on small RNA library sequencing, Cell 129 (2007) 1401–1414. [7] D. Tang, K. Chen, L. Huang, et al., Pharmacokinetic properties and drug interactions of apigenin, a natural flavone, Expert Opin. Drug. Metab. Toxicol. 13 (2017) 1–8. [8] R. Verjans, T. Peters, F.J. Beaumont, et al., MicroRNA-221/222 family counteracts myocardial fibrosis in pressure overload-induced heart failure, Hypertension 71 (2017) 280–288 Epub ahead of print. [9] M. Takano, C. Nekomoto, M. Kawami, et al., Role of miR-34a in TGF-β1- and druginduced epithelial-mesenchymal transition in alveolar type II epithelial cells, J Pharm. Sci. 106 (2017) 5. [10] X. He, Y. Sun, N. Lei, et al., MicroRNA-351 promotes schistosomiasis-induced hepatic fibrosis by targeting the vitamin D receptor, Proc. Natl. Acad. Sci. U. S. A. 115 (2018) 6. [11] P. Kumar, S. Bhattacharyya, K.W. Peters, et al., miR-16 rescues F508del-CFTR function in native cystic fibrosis epithelial cells, Gene Ther. 22 (2015) 908. [12] Z. Liu, Y. Jian, Y. Rong, et al., miR-144 regulates transforming growth factor-β1
[32] [33]
[34] [35]
[36]
[37] [38] [39] [40]
380
iduced hepatic stellate cell activation in human fibrotic liver, Int. J. Clin. Exp. Pathol. 8 (2015) 3994. J.W. Yu, W.J. Duan, X.R. Huang, et al., MicroRNA-29b inhibits peritoneal fibrosis in a mouse model of peritoneal dialysis, Lab. Invest. 94 (2014) 978–990. J. Madunić, I.V. Madunić, G. Gajski, et al., Apigenin: a dietary flavonoid with diverse anticancer properties, Cancer Lett. 413 (2018) 11–22. Z. Yue, Z. Jie, Y. Li, et al., Natural polyphenols for prevention and treatment of cancer, Nutrients 8 (2016). S.F. Nabavi, H. Khan, G. D’Onofrio, et al., Apigenin as neuroprotective agent: of mice and men, Pharmacol. Res. 22 (2016) 515. L.P. Chan, T.H. Chou, H.Y. Ding, et al., Apigenin induces apoptosis via tumor necrosis factor receptor- and Bcl-2-mediated pathway and enhances susceptibility of head and neck squamous cell carcinoma to 5-fluorouracil and cisplatin, Biochim. Biophys. Acta 1820 (2012) 1081. M.R. Coombs, M.E. Harrison, D.W. Hoskin, Apigenin inhibits the inducible expression of programmed death ligand 1 by human and mouse mammary carcinoma cells, Cancer Lett. 380 (2016) 424–433. S. Zhang, X. Liu, C. Sun, et al., Apigenin attenuates experimental autoimmune myocarditis by modulating Th1/Th2 cytokine balance in mice, Inflammation 39 (2016) 678–686. Y.Z. Guan, J. Li, X.W. Zhang, et al., Effectiveness of repetitive transcranial magnetic stimulation (rTMS) after acute stroke: a one-year longitudinal randomized trial, Cns Neurosci. Ther. 23 (2017) 940–946. D.F. Hicks, N. Goossens, A. Blasgarcía, et al., Transcriptome-based repurposing of apigenin as a potential anti-fibrotic agent targeting hepatic stellate cells, Sci. Rep. 7 (2017) 42563. A.A. Mrazek, X. Wang, C. Ding, et al., Design, synthesis, and characterization of novel apigenin analogues that suppress pancreatic stellate cell proliferation in vitro and associated pancreatic fibrosis in vivo, Bioorg. Med. Chem. 22 (2014) 3393. X. Wei, P. Gao, Y. Pu, et al., Activation of TRPV4 by dietary apigenin antagonizes renal fibrosis in deoxycorticosterone acetate (DOCA) salt-induced hypertension, Clin. Sci. 131 (2017) 567. J. Bot, D. Whitaker, J. Vivian, et al., Culturing mouse peritoneal mesothelial cells, Pathol. Res. Pract 199 (2003) 341–344. S.D.V. An, R.G. Tilton, S. Mortier, et al., Myofibroblast transdifferentiation of mesothelial cells is mediated by RAGE and contributes to peritoneal fibrosis in uraemia, Nephrol. Dial. Transpl. 21 (2006) 2549–2555. S. Kitamura, N. Horimoto, K. Tsuji, et al., The selection of peritoneal mesothelial cells is important for cell therapy to prevent peritoneal fibrosis, Tissue Eng. Part A 20 (2014) 529. T. Tsukada, S. Fushida, S. Harada, et al., The role of human peritoneal mesothelial cells in the fibrosis and progression of gastric cancer, Int. J. Oncol. 41 (2012) 476–482. H.S. Shin, J. Ko, D.A. Kim, et al., Metformin ameliorates the phenotype transition of peritoneal mesothelial cells and peritoneal fibrosis via a modulation of oxidative stress, Sci. Rep. 7 (2017) 5690. S. Jing, Y. Kezhou, Z. Hong, et al., Effect of renin-angiotensin system inhibitors on prevention of peritoneal fibrosis in peritoneal dialysis patients, Nephrology 15 (2010) 27–32. W. Hu, Z. Jiang, Y. Zhang, et al., Characterization of infiltrating macrophages in high glucose-induced peritoneal fibrosis in rats, Mol. Med. Reports 6 (2012) 93. J. Li, S.S. Lim, J.Y. Lee, et al., Purple corn anthocyanins dampened high-glucoseinduced mesangial fibrosis and inflammation: possible renoprotective role in diabetic nephropathy ╢┐ﻕ┐╢ ﻕ┐╢ﻕ, J. Nutr. Biochem. 23 (2012) 320–331. S.R. Chen, X.P. Chen, J.J. Lu, et al., Potent natural products and herbal medicines for treating liver fibrosis, Chin. Med. 10 (2015) 7. G. Shuang, D. Xiaoxu, W. Xin, et al., Curcumin attenuates arsenic-induced hepatic injuries and oxidative stress in experimental mice through activation of Nrf2 pathway, promotion of arsenic methylation and urinary excretion, Food Chem. Toxicol. 59 (2013) 739–747. L. Vera-Ramirez, P. Pérez-Lopez, A. Varela-Lopez, et al., Curcumin and liver disease, Biofactors 39 (2013) 88–100. Z. Zhang, Y. Guo, S. Zhang, et al., Curcumin modulates cannabinoid receptors in liver fibrosis in vivo and inhibits extracellular matrix expression in hepatic stellate cells by suppressing cannabinoid receptor type-1 in vitro, Eur. J. Pharmacol. 721 (2013) 133. Y. Qiao, L. Xu, X. Tao, et al., Protective effects of dioscin against fructose-induced renal damage via adjusting Sirt3-mediated oxidative stress, fibrosis, lipid metabolism and inflammation, Toxicol. Lett. 284 (2017) 37. Y. Li, J. Zhang, Y. Lei, et al., MicroRNA-21 in skin fibrosis: potential for diagnosis and treatment, Mol. Diagn. Ther. (2017) 1–10. E. Moransalvador, J. Mann, Epigenetics and liver fibrosis, Cell. Mol. Gastroenterol. Hepatol. 4 (2017) 125–134. A. Wojciechowska, A. Braniewska, K. Kozar-Kamińska, MicroRNA in cardiovascular biology and disease, Adv. Clin. Exp. Med. 26 (2017) 865–874. J. Wu, C. Xing, L. Zhang, et al., Autophagy promotes fibrosis and apoptosis in the peritoneum during long-term peritoneal dialysis, J. Cell. Mol. Med. 22 (2017) 1190–1201.