Apolipoprotein C-I reduces cholesteryl esters selective uptake from LDL and HDL by binding to HepG2 cells and lipoproteins

Biochimica et Biophysica Acta 1801 (2010) 42–48

Contents lists available at ScienceDirect

Biochimica et Biophysica Acta j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / b b a l i p

Apolipoprotein C-I reduces cholesteryl esters selective uptake from LDL and HDL by binding to HepG2 cells and lipoproteins☆ Veneta Krasteva 1, Mathieu R. Brodeur 2,3, Félix-Labonté Tremblay 2, Louise Falstrault, Louise Brissette ⁎ Département des Sciences Biologiques, Université du Québec à Montréal, C.P. 8888, Succursale Centre-ville, Montréal, Québec, Canada H3C 3P8

a r t i c l e

i n f o

Article history: Received 5 January 2009 Received in revised form 21 August 2009 Accepted 8 September 2009 Available online 15 September 2009 Keywords: High-density lipoprotein Low-density lipoprotein Apolipoprotein C-I Cholesterol ester Selective uptake

a b s t r a c t Plasma cholesterol from low- and high-density lipoproteins (LDL and HDL) are cleared from the circulation by specific receptors that either totally degrade lipoproteins as the LDL receptor or selectively take up their cholesteryl esters (CE) like the scavenger receptor class B type I (SR-BI). The aim of the present study was to define the effect of apoC-I on the uptake of LDL and HDL3 by HepG2 cells. In experiments conducted with exogenously added purified apoC-I, no significant effect was observed on lipoprotein–protein association and degradation; however, LDL- and HDL3-CE selective uptake was significantly reduced in a dose-dependent manner. This study also shows that apoC-I has the ability to associate with HepG2 cells and with LDL and HDL3. Moreover, pre-incubation of HepG2 cells with apoC-I reduces HDL3-CE selective uptake and pre-incubation of LDL and HDL3 with apoC-I decreases their CE selective uptake by HepG2 cells. Thus, apoC-I can accomplish its inhibitory effect on SR-BI activity by either binding to SR-BI or lipoproteins. We conclude that by reducing hepatic lipoprotein-CE selective uptake, apoC-I has an atherogenic character. © 2009 Elsevier B.V. All rights reserved.

1. Introduction In humans, most of plasma cholesterol is transported by lowdensity lipoproteins (LDL) or high-density lipoproteins (HDL). These cholesterol-rich particles are cleared from the circulation through two different receptor-mediated processes. The first involves endocytic internalization and complete degradation of the lipoprotein (holoparticle uptake); the other involves the selective uptake of cholesteryl esters (CE), a process that implies the extraction of CE from the lipoprotein without concomitant degradation of its apolipoproteins. The LDL receptor is a 160 kDa protein responsible for holoparticle uptake of LDL. It is expressed in many tissues and recognizes lipoproteins containing either apolipoprotein (apo) B or apoE (for a review see [1]). The identity of the hepatic receptor mediating HDL endocytosis/degradation has not been clearly defined. The scavenger receptor class B type I (SR-BI) is an 82 kDa protein [2] abundant in liver and steroidogenic organs [3] that was shown in vitro to mediate selective uptake of CE from both HDL [4] and LDL [5]. Moreover, it was shown in vivo by clearance studies that murine SR-BI is the unique receptor responsible for HDL-CE selective uptake [6,7]. Somewhat ☆ This work was supported by the National Research Council of Canada (NSERC) attributed to L. Brissette. ⁎ Corresponding author. Tel.: +1 514 987 3000x4368 or 6592; fax: +1 514 987 4647. E-mail address: [email protected] (L. Brissette). 1 Present address: Laboratory of Chromatin Structure and Stem Cell Biology, Institute for Research in Immunology and Cancer (IRIC), Montreal, QC, Canada. 2 Have contributed equally. 3 Present address: Faculté de Pharmacie, Université de Montréal, Montréal, Québec, Canada H3C 3J7. 1388-1981/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.bbalip.2009.09.001

differently, our work in the mouse showed that SR-BI is responsible for LDL-CE selective uptake in vivo in normal mice [7] but that the cluster of differentiation-36 (CD36) can selectively take up CE from LDL in its absence [8]. Apolipoproteins constitute the protein component of lipoproteins. They play key roles in maintaining lipoprotein structure, regulating the interaction of lipoproteins with cellular receptors, and modulating the activity of key enzymes involved in intravascular lipoprotein metabolism. ApoC-I is the smallest apolipoprotein (57 amino acids; 6.6 kDa). It is found at 6 mg/dl [9] in human plasma and mainly synthesized by the liver [10]. Most of it is found associated with HDL [11]. Many roles have been attributed to apoC-I. Notably, apoC-I was reported as an activator of lecithin cholesterol acyltransferase (LCAT) [12], and as an inhibitor of lipoprotein lipase (LPL) [13] and cholesterol ester transfer protein (CETP) [14]. It also inhibits clearance of VLDL in the mouse [15] and interferes with the binding of β-VLDL with the LDL receptor-related protein (LRP) [16]. ApoC-I was also shown to increase very low density lipoproteins (VLDL) production [17]. Recently, an elegant study [18] conducted in apoC-I deficient or transgenic mice revealed that apoC-I reduces HDL-CE selective uptake and increases the plasma level and size of HDL. Although the results were attributed to an inhibition of SR-BI activity by apoC-I, it remains unknown if apoC-I is inhibitory by associating with SR-BI or with HDL. Our aim was to analyze the effects of apoC-I on lipoprotein uptake in a human cell model. Thus, investigations were conducted with HepG2 cells, a human hepatic parenchymal cell model, either overexpressing human apoC-I or treated with purified human apoCI. As both LDL and HDL are abundant in human blood circulation and

V. Krasteva et al. / Biochimica et Biophysica Acta 1801 (2010) 42–48

no data are available yet on the effect of apoC-I on LDL metabolism, studies were conducted with both classes of lipoproteins. We show that apoC-I inhibits both HDL3- and LDL-CE selective uptake. To define the mechanism by which apoC-I reduces CE-selective uptake, we investigated if 125I-apoC-I binds to HepG2 cells and if it associates with LDL and HDL3. We found that apoC-I has both abilities and that either pre-incubating the cells or the lipoproteins with apoC-I reduces CE-selective uptake activity. 2. Materials and methods 2.1. Materials Human plasma was from BioReclamation (Hicksville, NY). The human hepatoma cell line HepG2 was obtained from the American Type Culture Collection (Rockville, MD). Purified human apoC-I and apoE were purchased from Calbiochem (La Jolla, CA). Glutamin, trypsin, penicillin–streptomycin, Geneticin and the vector pcDNA 3.1 (−) were purchased from Invitrogen Life Technologies (Burlington, Ont.). 1,2-[3H]-cholesteryl oleate ether (50 mCi/mmol) was bought from Amersham Pharmacia Biotech (Laval, Que.) and 125Iodine (as sodium iodide, 100 mCi/mmol) was bought from ICN Canada (Montreal, Que.). Restriction and modification enzymes were all from Amersham Pharmacia Biotech. Rabbit IgG anti-SR-BI was from Novus Biologicals (Littleton, CO) and rabbit IgG anti-LDL receptor from Research Diagnostics, Inc. (Flanders, NJ). 2.2. HepG2 cell culture HepG2 cells were grown in 75 cm2 flasks containing 15 ml of Eagle's Minimal Essential Medium (MEM) supplemented with 10% fetal bovine serum (FBS), 100 units/ml penicillin, 100 μg/ml streptomycin and 4 mM glutamine. Five days prior to the assays, 3.0 × 105 cells were seeded in 3.8 cm2 culture dishes (12-well plates). 2.3. Preparation of HepG2 cell clones expressing higher levels of apoC-I HepG2 cell total RNA was reverse transcribed and apoC-I cDNA was amplified by PCR using a sense primer containing a XhoI cleaving site (5′ GCCCTCGAGCCATGAGGCTCTTCCTGT 3′) and an antisense primer containing a HindIII cleaving site (5′ GTCAAGCTTCAGGTCCTCATGAGTCAATC 3′ ). The PCR product was cut with XhoI and HindIII and cloned into the eukaryotic vector pcDNA3.1 (−) opened with the same enzymes. The construct was amplified in E. coli and sequenced for correctness. HepG2 cells at 70% confluence were transfected with the apoC-I recombinant vector with the help of GeneJuice (Novagen, San Diego, CA). Two hours after, the medium was replaced by a fresh one containing 700 μg/ml of Geneticin and cells were selected for 3 weeks. Cell foci (clones) were then isolated and propagated. The clonal cell lines resemble the native HepG2 cells in appearance and in growth rate. 2.4. Measurement of apoC-I secretion The level of apoC-I was determined from the medium recovered from the plates after 48 h by enzyme-linked immunoabsorbant assay (ELISA) as in Fredenrich et al. [19] and using a goat anti-apoC-I from Biodesign International. 2.5. LDL receptor and SR-BI immunoblotting of HepG2 cell proteins Total cell proteins from all subtypes of HepG2 cells were extracted with 1.4% Triton X-100 [20]. Proteins were separated on 10% reducing SDS-PAGE and blotted on nitrocellulose. The blots were incubated with either an anti-SR-BI antibody (1:5000) or an anti-LDL receptor antibody (1:500) for 90 min at room temperature followed by

43

chemiluminescence detection after incubation with goat anti-rabbit antibody coupled to horseradish peroxidase used at 1:7000 for SR-BI and at 1:2500 for LDL receptor, respectively. 2.6. Preparation and labeling of lipoproteins Human LDL (density 1.025–1.063 g/ml) and HDL3 (density 1.125–1.21 g/ml) were isolated from plasma as described in [21]. This class on HDL was used as it does not contain apoE and therefore cannot interact with the LDL receptor. These lipoproteins were labeled with iodine-125 and in [3H]-cholesteryl oleoyl ether as described previously [21]. 2.7. Lipoprotein cell association and degradation assays Cells were washed twice with 1 ml PBS and incubated with 125Iand 3H-CE labeled LDL or HDL3 (20 μg of protein/ml) for 4 h at 37 °C in a total volume of 250 μl containing 125 μl of MEM [2×] plus 4% bovine serum albumin (BSA), pH 7.4 (total association). Nonspecific association was determined by the addition of 1.5 mg of protein/ml of non-labeled LDL or HDL3. At the end of the incubation, the medium was recovered and precipitated with trichloroacetic acid (TCA) at a final concentration of 12% and degradation was estimated in the TCAsoluble fraction, as described in [21]. For cell association data, cells were solubilized in 1.5 ml of 0.1 N NaOH. Associated 125I-protein was quantified with a Cobra II counter (Canberra-Packard) and associated 3 H-CE was counted with a beta-counter (Wallach-Fisher). Associations of 125I- and 3H-CE-lipoprotein were expressed in micrograms of protein per milligram of cellular protein. Selective uptake was calculated by subtracting the protein association from the CE association. The NaOH fractions were also assayed for protein content to normalize for cell protein. 2.8. Binding of apoC-I to HepG2 cells and to LDL and HDL3 ApoC-I was labeled by the procedure of Bolton and Hunter [22] and the reagent was eliminated by dialysis in Tris buffer saline using a Slide-A-Lyser cassette (Thermo Scientific, Rockford, IL). Specific activity was 2540 cpm/ng. Binding assays of 125I-apoC-I to control HepG2 cells was as for association assay of 125I-labeled lipoproteins with the exception that the concentrations were from 0 to 20 μg/ml, nonspecific binding data was obtained with a concentration of 250 μg/ml of unlabeled apoC-I and the assay was conducted at 4 °C in a medium containing 25 mM HEPES, pH 7.4. Specific binding data were transformed into Scatchard plots [23] from which the dissociation constant (Kd) and the maximal binding capacity (Bmax) were derived. To estimate if free apoC-I associates with LDL and HDL3, 125 I-apoC-I (2.5 μg/ml) was incubated with 20 μg/ml of either LDL or HDL3 in 1 ml MEM for 4 h at 37 °C. Thereafter, the solution was centrifuged in Amicon Ultra-15 tube to remove free 125I-apoC-I and the lipoprotein fraction was subjected to a nondenaturing gradient gel electrophoresis (NDGGE) as in [7]. The gel was dried and exposed on a Kodak film. 2.9. Other methods Protein content was determined by the method of Lowry et al. [24] with BSA as standard. Student's t-test was used to obtain statistical comparison of means. Differences were considered significant at p b 0.05. 3. Results Our overall goal was to define the effect of human apoC-I on LDL and HDL3 metabolism in human HepG2 cells. At first, we analyzed the effect of adding purified apoC-I (0 to 5 μg/ml) to the incubation

44

V. Krasteva et al. / Biochimica et Biophysica Acta 1801 (2010) 42–48

Fig. 1. Association and degradation of LDL and HDL3 in absence or presence of apoC-I in HepG2 cells. 125I-lipoprotein association (A), [3H]CE-lipoprotein association (B), [3H]CElipoprotein association caused by cholesteryl ester selective uptake (C) and 125I-lipoprotein degradation (D) were quantified with 20 μg of protein/ml of radiolabeled lipoproteins incubated with HepG2 cells for 4 h at 37 °C in absence or presence of 2.5 or 5 μg/ml of apoC-I. Results are presented as the % of the value obtained in absence of apoC-I and are shown as the mean ± S.E.M. of four experiments conducted in duplicate. aStatistically different (p b 0.05) from the result obtained with HepG2 cells incubated in absence of purified apoC-I.

medium of normal HepG2 cells. Fig. 1 shows that apoC-I has no effect on lipoprotein–protein association (Fig. 1A) and degradation (Fig. 1D) but induces a dose-dependent reduction in CE association (Fig. 1B) and consequently, of CE selective uptake (Fig. 1C). Indeed, addition of 5 μg/ml apoC-I nearly abolishes CE selective uptake from both lipoproteins. In the past, we have shown that exogenous apoC-II and apoC-III had similar effects [21]. In order to insure that this is not a universal effect of exogenous apolipoproteins added in the assay, we have also analyzed the effect of added apoE on LDL metabolism. Fig. 2B, C shows that apoE has an opposite effect than apoCs on CE uptake and CE selective uptake by HepG2 cells. Indeed, at 5 μg/ml of apoE, LDL-CE uptake is increased by approx. 150% and selective uptake by 350%.

Our goal was then to define the effect of endogenous production of apoC-I by HepG2 cells on cellular uptake and degradation of LDL and HDL3. To produce cells overexpressing apoC-I, HepG2 cells were transfected with a human apoC-I expression vector that we have generated. Fifteen clones were tested for their production levels of apoC-I. Most of them secreted greater quantities of apoC-I than normal HepG2 cells or HepG2 cell clones transfected with the vector alone. For this study we chose the two clones expressing the higher levels. Table 1 shows that these clones express 2.9- and 3.8-fold, respectively the level of apoC-I expressed by HepG2 cells or control cells transfected with the vector without apoC-I cDNA. Accordingly, these clones were named apoC-I 2.9 and apoC-I 3.8. Overall, Fig. 3 shows that LDL and HDL3 metabolism (protein degradation and

Fig. 2. Association and degradation of LDL in absence or presence of apoE in HepG2 cells. 125I-LDL association (A), [3H]CE-LDL (B), [3H]CE-LDL association caused by cholesteryl ester selective uptake (C) and 125I-LDL degradation (D) were quantified with 20 μg of protein/ml of radiolabeled LDL incubated with HepG2 cells for 4 h at 37 °C in absence or presence of 2.5 or 5 μg/ml of apoE. Results are presented as the % of the value obtained in absence of apoE and are shown as the mean ± S.E.M. of two experiments conducted in duplicate. a Statistically different (p b 0.05) from the result obtained with HepG2 cells incubated in absence of purified apoE.

V. Krasteva et al. / Biochimica et Biophysica Acta 1801 (2010) 42–48 Table 1 Secretion levels of apoC-I by HepG2 cells and HepG2 cell clones.

Table 2 SR-BI and LDL receptor levels in HepG2 cells overexpressing or not apoC-I.

ng apoC-I secreted/mg cell protein/48 h HepG2 HepG2 HepG2 HepG2

cells cells + empty vector (Control) cells + apoC-I vector, clone 2.9 cells + apoC-I vector, clone 3.8

44.2 ± 6.3 (4) 46.2 ± 5.7 (5) 132.9 ± 21.6a (5) ↑287.7% 177.1 ± 18.6a (5) ↑383.3%

Secretion levels of apoC-I by HepG2 cells transfected with an expression vector containing or not the apoC-I cDNA were quantified by ELISA. Results are expressed as mean ± S.E.M. of the number of measurements indicated in parentheses. Percentages of increase are calculated from the Control values. a Statistically different (p b 0.05) from the Control.

protein and CE associations) did not differ between cells overexpressing apoC-I and normal HepG2 cells. To understand why overexpression of apoC-I has no impact on CE selective uptake, the levels of LDL receptor and SR-BI in the clones were quantified. As seen in Table 2, the two clones have statistically significant higher levels of SR-BI (in average by 30%) but show no change in their LDL receptor levels. Thus the anticipated reduction in CE selective uptake activity could have been overcome by greater SR-BI levels. Alternatively, it could be that the levels of apoC-I secreted by the cells during the course of the selective uptake assay were not sufficient to significantly affect the metabolism. Therefore, cells (Control and apoC-I 3.8) were left for 48 h in MEM containing no serum and the assays were conducted directly in the culture wells and their medium. Fig. 4B shows that HDL3- and LDL-CE associations were statistically significantly reduced by approx. 30% in apoC-I 3.8 cells compared to control cells. A similar reduction was also attained for CE selective uptake (Fig. 4C); however it did not reach statistical significance. Interestingly, it can be calculated from Table 1 that during 48 h the apoC-I 3.8 cells have generated in the medium a concentration of approx. 1 μg/ml of apoC-I. As we can extrapolate from Fig. 1B that such a concentration of purified apoC-I would have produce a similar reduction in lipoprotein-CE association, this suggests that both sources of apoC-I are equipotent. Finally, we have conducted a series of experiments in order to define how apoC-I inhibits CE-selective uptake activity. Firstly, human

45

HepG2 cells + empty vector (Control) HepG2 cells + apoC-I vector, clone 2.9 HepG2 cells + apoC-I vector, clone 3.8

SR-BI % of control

LDL receptor % of control

100 ± 3.9

100 ± 8.5

137.1 ± 6.8a

103.7 ± 6.0

a

102.5 ± 7.9

122.5 ± 2.1

SR-BI and LDL receptor levels of HepG2 cells transfected with an expression vector containing or not the apoC-I cDNA were quantified by immunoblotting and densitometry. Results are expressed as mean ± S.E.M. of four different measurements. Percentages are calculated from the Control values. a Statistically different (p b 0.05) from the proper Control.

apoC-I was labeled with 125-iodine and used in binding assays with HepG2 cells. Fig. 5 (panels A and B) shows that apoC-I binds specifically to HepG2 cells with a Kd of 33 μg/ml and a Bmax of 226 ng/mg cell protein. The same figure (panel C) also reveals that when added to a solution containing either LDL or HDL3, apoC-I associates with the two classes of lipoproteins. Thus, it can be proposed that the binding of apoC-I to HepG2 cell SR-BI or its incorporation in LDL and HDL3 leads to the reduced CE selective uptake observed. Two experiments were designed in order to discriminate between these two possibilities. Firstly, HepG2 cells were incubated with 5 μg/ml of apoC-I for 1 h, the cells were washed and LDL and HDL3 were tested in association/degradation assays. Fig. 6 (panel A) shows that the association of apoC-I has no effect on LDL metabolism but reduces in average by 25% HDL3-CE association and selective uptake. Using a concentration of apoC-I corresponding to the Kd (33 μg/ml), we obtained essentially the same results (data not shown). Thus, the effect observed with 5 μg/ml of apoC-I appears optimal. Secondly, radiolabeled lipoproteins were pre-incubated with 5 μg/ml of apoC-I for 2 h at 37 °C, free apoC-I was removed and the conditioned lipoproteins were used in association assays. As seen in Fig. 6 (panel B), HepG2 cells are, in average, 44% less efficient for HDL3-CE association and HDL3-CE selective uptake than for control lipoproteins. Similar results were obtained with apoC-I conditioned LDL. Thirdly, both cells and lipoproteins were pre-incubated with

Fig. 3. Association and degradation of LDL and HDL3 in control cells and clones overexpressing apoC-I. 125I-lipoprotein association (A), [3H]CE-lipoprotein association (B), [3H]CElipoprotein association caused by cholesteryl ester selective uptake (C) and 125I-lipoprotein degradation (D) were quantified with 20 μg of protein/ml of radiolabeled lipoproteins incubated with either control cells or apoC-I 2.9 and 3.8 clones for 4 h at 37 °C. Results are presented as the % of the value obtained with control HepG2 cells and are shown as the mean ± S.E.M. of four experiments conducted in duplicate. aStatistically different (p b 0.05) from the result obtained with control HepG2 cells.

46

V. Krasteva et al. / Biochimica et Biophysica Acta 1801 (2010) 42–48

Fig. 4. Association and degradation of LDL and HDL3 determined directly in the 48 h medium of control cells and clone apoC-I 3.8. 125I-lipoprotein association (A), [3H]CE-lipoprotein association (B), [3H]CE-lipoprotein association caused by cholesteryl ester selective uptake (C) and 125I-lipoprotein degradation (D) were quantified with 20 μg of protein/ml of radiolabeled lipoproteins incubated for 4 h at 37 °C directly in the medium of culture wells of either control cells or apoC-I 3.8 clones left for 48 h in MEM containing no serum. Results are presented as the % of the value obtained with control HepG2 cells and are shown as the mean ± S.E.M. of four experiments conducted in duplicate. aStatistically different (p b 0.05) from the result obtained with control HepG2 cells.

5 μg/ml of apoC-I. The results obtained with LDL (panel C) are similar to those generated when only the LDL were pre-incubated with apoCI (panel B). This was expected since pre-incubating the cells with apoC-I had no effect (panel A). Even though differences were not statistically different between the HDL data of panels B and C, preincubating both the cells and HDL with apoC-I (panel C) had a higher inhibitory effect on CE selective uptake than when either the cells (panel A) or the HDL (panel B) had been pre-treated, suggesting an additive effect. Thus apoC-I reduces HDL-CE selective uptake through both HepG2 cell and HDL associations, while it inhibits LDL-CE selective uptake only through LDL association. Finally, a series of experiments was conducted with cells and lipoproteins pre-incubated with a larger concentration of apoC-I, in order to determine if we

could reproduce the much lower levels of LDL- and HDL-CE selective uptake shown in Fig. 1. We found that pre-incubating the cells and lipoproteins with 20 μg/ml of apoC-I reduces HDL- and LDL-CE selective uptake by as much as 72% and 99% (data not shown), respectively, giving inhibition levels resembling those shown in Fig. 1 where a concentration of 5 μg/ml was kept in the medium during the course of the association assay. 4. Discussion Studies beginning in the 1970s reported apoC-I as an inhibitor or activator of various enzymes involved in the metabolism of lipoproteins [12–14]. They also showed that apoC-I inhibits VLDL

Fig. 5. Binding of human 125I-apoC-I to HepG2 cells or to LDL and HDL3. (A) Specific binding of apoC-I to HepG2 cells. 125I-apoC-I (0–20 μg/ml) were incubated at 4 °C for 2 h with HepG2 cells in the absence or presence of 250 μg/ml of unlabeled apoC-I to determine the level of nonspecific binding. The specific binding was calculated by subtracting the nonspecific binding from the total binding data. Results are the mean ± S.E.M. of two experiments conducted in duplicate. (B) Scatchard plots of the specific binding of apoC-I to HepG2 cells. (C) ApoC-I association with LDL and HDL3. 125I-apoC-I (2.5 μg/ml) was incubated with 20 μg/ml of either LDL or HDL3 in 1 ml MEM for 4 h at 37 °C. Free 125I-apoC-I was removed and lipoprotein fractions were subjected to a NDGGE which was dried and exposed on a Kodak film. Lane 1: 5000 cpm of 125I-HDL3 as a marker of migration; Lane 2: 5000 cpm of 125I-LDL as a marker of migration; Lane 3: 25000 cpm of unlabeled HDL3 incubated with 125I-apoC-I; Lane 4: 25,000 cpm of unlabeled LDL incubated with 125I-apoC-I.

V. Krasteva et al. / Biochimica et Biophysica Acta 1801 (2010) 42–48

Fig. 6. Association and degradation of LDL and HDL3 in HepG2 cells pre-incubated with apoC-I or association and degradation of LDL or HDL3 pre-incubated with apoC-I. (A) Pre-incubation of HepG2 cells with apoC-I. Prior the assays, HepG2 cells were incubated without or with 5 μg/ml of apoC-I for 1 h at room temperature, washed and assayed. Results are presented as the % of the value obtained with HepG2 cells preincubated without apoC-I and are shown as the mean ± S.E.M. of three experiments conducted in duplicate. (B) Pre-incubation of LDL and HDL3 with apoC-I. Labeled LDL or HDL3 (20 μg/ml) were pre-incubated without or with apoC-I (5 μg/ml) in MEM for 2 h at 37 °C. Free apoC-I was removed and lipoprotein fractions were assayed for association and degradation in HepG2 cells. Results are presented as the % of the value obtained for labeled LDL or HDL3 pre-incubated without apoC-I and are shown as the mean ± S.E.M. of four experiments conducted in duplicate. (C) Pre-incubation of both cells and lipoproteins with apoC-I as indicated in the descriptions of panels A and B. a Statistically different (p b 0.05) from the result obtained with control HepG2 cells.

clearance [15]. In the last few years, we experience a regain of interest on apoC-I, in part due to available transgenic and knockout models. Thus in relation with atherosclerosis, it was shown that: 1) severe hypertriglyceridemia in human apoC-I transgenic mice is caused by apoC-I-induced inhibition of LPL [25]; 2) apoC-I aggravates atherosclerosis development in apoE-knockout mice [26]; 3) apoC-I knockout mice exhibit hepatic lipid accumulation [27]; 4) apoC-I content of VLDL particles is associated with plaque size in individuals with carotid atherosclerosis [28]. Thus overall most of these studies reveal that apoC-I is atherogenic. Our work and that of de Haan et al. [18] showing that apoC-I impedes HDL-CE selective uptake in hepatic cells from human and mouse species, respectively, add to the atherosclerotic roles of apoC-I since it means that the last step of reverse cholesterol transport is reduced. However, differently from de Haan et al. [18] we have also studied the effect on LDL metabolism and we found that apoC-I does not modify LDL degradation, at least at the concentrations of apoC-I used, or produced by our cells overexpressing apoC-I. Thus in spite of the demonstration that apoC-I inhibits VLDL clearance [15], we have not found evidence for such an effect on

47

LDL that originate from VLDL. However we report that apoC-I reduces CE selective activity towards LDL. Yet we cannot say if this selective uptake pathway is beneficial or not as it appears beneficial by reducing LDL cholesterol levels but may also produce small dense LDL particles that are highly atherogenic. Thus other investigations are required before we know if by reducing LDL-CE selective uptake, apoC-I is or not atherogenic. The issue of the types of apolipoproteins having an effect on CE selective uptake deserves attention. We have shown few years ago that both apoC-II and C-III reduce LDL- and HDL3-CE selective uptake [21]. However clearly this is not a general effect of all apolipoproteins as while assessing the effect of the level of apoE synthesized by HepG2 cells, we have in the past shown that this apolipoprotein favors CE-selective uptake from LDL and HDL3 [29]. Few years later, BultelBrienne et al. [30] have demonstrated that free apoE by binding to SR-BI leads to an increase in CE uptake from both HDL and VLDL in an adrenal cell line. In the present work, we show that purified apoE increases LDL-CE selective uptake by HepG2 cells. It was also expected that the acquisition of apoE by LDL would favor the association/ degradation pathway by the LDLr, as suggested by the study of Choi et al. [31] with CHO cells overexpressing apoE. However, we could not detect a greater degradation of LDL when purified apoE was added to the assay medium. The difference can depend either on the different cells used (types or species) or on the levels of apoE. However, it is clear that apoCs decrease while apoE increases CE selective uptake. As human blood apoCs concentrations are approx. 10-fold higher than the 5 μg/ml concentration in our exogenous assay that almost abolishes CE-selective uptake and so is the concentration of apoE that increases CE-selective uptake, we suggest that the apoCs/apoE ratio could be an indicator of the CE selective uptake activity in vivo. Moreover as the liver synthesizes apoCs and apoE and is by far the most important tissue involved in CE selective uptake, it is tempting to speculate that under certain circumstances liver cells can regulate their own CE selective uptake activity by modulating their rate of apoCs and apoE synthesis/secretion. We showed that apoC-I has the ability to associate with LDL and HDL3. It was expected that apoC-I would associate with HDL since it is known that most of apoC-I is found with HDL [11]. That apoC-I readily associates with LDL was unknown, however it is recognized that LDL contains a small quantity of apoC-I [32]. We have also found that HepG2 cell CE selective uptake activity is lower when LDL and HDL3 are pre-enriched in apoC-I. As we have shown in the past that most of LDL- and HDL3-CE selective uptake by HepG2 cells is due to SR-BI [5], we propose that the apoC-I acquired by the lipoproteins interfere with the ability of these lipoproteins to deliver their CE by the SR-BI pathway by restraining CE departure from lipoproteins. A similar effect was seen in the past with apoA-II enrichment of HDL [33]. Even though apoC-I was never directly demonstrated to be a ligand of SR-BI like its close relative apoC-III [34], since both reduce CE selective uptake activity, it is very likely that apoC-I binds to SR-BI. In accordance, we also found that apoC-I binds to HepG2 cells and reduces CE-selective uptake activity towards HDL3. This effect was not observed for LDL adding to the differences that we have reported in the last years between LDL- and HDL3-CE selective uptakes [35,36]. To explain why a pre-incubation of HepG2 cells with apoC-I diminishes HDL3-CE selective uptake, a competition between apoC-I and HDL3 binding to SR-BI can be proposed. We reject this possibility since cells pre-incubated with apoC-I do not show a lower HDL3–protein association. Alternatively, the reduced CE-selective uptake could originate from a displacement of bound apoC-I from HepG2 cell surface receptors to HDL3 and, as explained above, this could interfere with the ability of HDL3 to deliver their CE. Otherwise, as SR-BI has multiple binding sites [37,38], it is possible that apoC-I and HDL3 bind to different domains on SR-BI, but that apoC-I binding modifies the structure of SR-BI in a way that this receptor looses its CE-selective uptake activity towards HDL3. Since it is known that LDL and HDL do

48

V. Krasteva et al. / Biochimica et Biophysica Acta 1801 (2010) 42–48

not share the same binding domain on SR-BI [37] this can explain why pre-incubating HepG2 cells with apoC-I does not inhibit LDL-CE selective uptake. In conclusion, our work showed that apoC-I impedes CE-selective uptake from both HDL and LDL in a human parenchymal hepatic cell model. Moreover we have provided evidences that apoC-I has the abilities to associate with both the surface of HepG2 cells and with LDL and HDL3 and that the former correlates with the effect on HDL3, while the latter with the reduction of both LDL- and HDL3-CE selective uptake. Thus by reducing HDL-CE selective uptake, apoC-I plays a novel proatherogenic role. Acknowledgements We sincerely thank Dr. Lise Bernier and Hanny Wassef from the Clinical Research Institute of Montreal for the apoC-I ELISA assays and Dr. David Rhainds for valuable comments concerning this work. This work was supported by the National Research Council of Canada (NSERC) attributed to L. Brissette. References [1] J.L. Goldstein, M.S. Brown, R.G. Anderson, D.W. Russell, W.J. Schneider, Receptormediated endocytosis: concepts emerging from the LDL receptor system, Ann. Rev. Cell Biol. 1 (1985) 1–39. [2] S.L. Acton, P.E. Scherer, H.F. Lodish, M. Krieger, Expression cloning of SR-BI, a CD36-related class B scavenger receptor, J. Biol. Chem. 269 (1994) 21003–21009. [3] K.T. Landschulz, R.K. Pathak, A. Rigotti, M. Krieger, H.H. Hobbs, Regulation of scavenger receptor, class B, type I, a high density lipoprotein receptor, in liver and steroidogenic tissues of the rat, J. Clin. Invest. 98 (1996) 984–995. [4] S.L. Acton, A. Rigotti, K.T. Landschulz, S. Xu, H.H. Hobbs, M. Krieger, Identification of scavenger receptor SR-BI as a high density lipoprotein receptor, Science 71 (1996) 518–520. [5] D. Rhainds, M. Brodeur, J. Lapointe, D. Charpentier, L. Falstrault, L. Brissette, The role of human and mouse hepatic scavenger receptor class B type I (SR-BI) in the selective uptake of low density lipoprotein cholesteryl esters, Biochemistry 42 (2003) 7527–7538. [6] R. Out, M. Hoekstra, J.A. Spijkers, J.K. Kruijt, M. van Eck, I.S. Bos, J. Twisk, T.J. van Berkel, Scavenger receptor class B type I is solely responsible for the selective uptake of cholesteryl esters from HDL by the liver and the adrenals in mice, J. Lipid Res. 45 (2004) 2088–2095. [7] M.R. Brodeur, V. Luangrath, G. Bourret, L. Falstrault, L. Brissette, Physiological importance of SR-BI in the in vivo metabolism of human HDL and LDL in male and female mice, J. Lipid Res. 46 (2005) 687–696. [8] V. Luangrath, M.R. Brodeur, D. Rhainds, L. Brissette, Mouse CD36 has opposite effects on LDL and oxidized LDL metabolism in vivo, Arterioscler. Thromb. Vasc. Biol. 28 (2008) 290–295. [9] M.C. Jong, M.H. Hofker, L.M. Havekes, Role of ApoCs in lipoprotein metabolism: functional differences between ApoC1, ApoC2, and ApoC3, Arterioscler. Thromb. Vasc. Biol. 19 (1999) 472–484. [10] M.D. Curry, W.J. McConathy, J.D. Fesmire, P. Alaupovic, Quantitative determination of apolipoproteins C-I and C-II in human plasma by separate electroimmunoassays, Clin. Chem. 27 (1981) 543–548. [11] C.L. Malmendier, J.F. Lontie, G.A. Grutman, C. Delcroix, Metabolism of apolipoprotein C-I in normolipoproteinemic human subjects, Atherosclerosis 62 (1986) 167–172. [12] A.K. Soutar, C.W. Garner, H.N. Baker, J.T. Sparrow, R.L. Jackson, A.M. Gotto, L.C. Smith, Effect of the human plasma apolipoproteins and phosphatidylcholine acyl dinor on the activity of lecithin:cholesterol acyltransferase, Biochemistry 14 (1975) 3057–3064. [13] R.J. Havel, C.J. Fielding, T. Olivecrona, V.G. Shore, P.E. Fielding, T. Egelrud, Cofactor activity of protein components of human very low density lipoproteins in the hydrolysis of triglycerides by lipoprotein lipase from different sources, Biochemistry 12 (1973) 1828–1833. [14] T. Gautier, D. Masson, J.P. de Barros, A. Athias, P. Gambert, D. Aunis, M.H. MetzBoutigue, L. Lagrost, Human apolipoprotein C-I accounts for the ability of plasma high density lipoproteins to inhibit the cholesteryl ester transfer protein activity, J. Biol. Chem. 275 (2000) 37504–37509. [15] M.C. Jong, V.E. Dahlmans, P.J. van Gorp, K.W. van Dijk, M.L. Breuer, M.H. Hofker, L.M. Havekes, In the absence of the low density lipoprotein receptor, human apolipoprotein C1 overexpression in transgenic mice inhibits the hepatic uptake of very low density lipoproteins via a receptor-associated protein-sensitive pathway, J. Clin. Invest. 98 (1996) 2259–2267.

[16] K.H. Weisgraber, R.W. Mahley, R.C. Kowall, J. Herz, J.L. Goldstein, M.S. Brown, Apolipoprotein C-I modulates the interaction of apolipoprotein E with βmigrating very low density lipoproteins (β-VLDL) and inhibits binding of β-VLDL to low density lipoprotein receptor-related protein, J. Biol. Chem. 265 (1990) 22453–22459. [17] M. Westerterp, W. de Haan, J.F. Berbée, L.M. Havekes, P.C. Rensen, Endogenous apoC-I increases hyperlipidemia in apoE-knockout mice by stimulating VLDL production and inhibiting LPL, J. Lipid Res. 47 (2006) 1203–1211. [18] W. de Haan, R. Out, J.F. Berbée, C.C. van der Hoogt, K.W. Dijk, T.J. van Berkel, J.A. Romijn, J. Wouter Jukema, L.M. Havekes, P.C. Rensen, Apolipoprotein CI inhibits scavenger receptor BI and increases plasma HDL levels in vivo, Biochem. Biophys. Res. Commun. 377 (2008) 1294–1298. [19] A. Fredenrich, L.M. Giroux, M. Tremblay, J. Davignon, J.S. Cohn, Plasma lipoprotein distribution of apoC-III in normolipidemic and hypertriglyceridemic subjects: comparison of the apoC-III to apoE ratio in different lipoprotein fractions, J. Lipid Res. 38 (1997) 1421–1432. [20] A. Yoshimura, T. Yoshida, T. Seguchi, M. Waki, M. Ono, M. Kuwano, Low binding capacity and altered O-linked glycosylation of low density lipoprotein receptor in a monensin resistant mutant of Chinese hamster ovary cells, J. Biol. Chem. 262 (1987) 13299–13308. [21] K. Huard, P. Bourgeois, D. Rhainds, L. Falstrault, J.S. Cohn, L. Brissette, Apolipoproteins C-II and C-III inhibit selective uptake of low- and high-density lipoprotein cholesteryl esters in HepG2 cells, Intern. J. Biochem. Cell Biol. 37 (2005) 1308–1318. [22] A.E. Bolton, W.M. Hunter, The labelling of proteins to high specific radioactivities by conjugation to a 125I-containing acylating agent, Biochem. J. 133 (1973) 529–539. [23] G. Scatchard, The attraction of proteins for small molecules and ions, Ann. N.Y. Acad. Sci. 51 (1949) 660–667. [24] O.H. Lowry, N.J. Rosebrough, A. Farr, R.J. Randall, Protein measurement with the Folin phenol reagent, J. Biol. Chem. 193 (1951) 265–275. [25] J.F. Berbée, C.C. van der Hoogt, D. Sundararaman, L.M. Havekes, P.C. Rensen, Severe hypertriglyceridemia in human APOC1 transgenic mice is caused by apoC-Iinduced inhibition of LPL, J. Lipid Res. 46 (2005) 297–306. [26] M. Westerterp, M. Van Eck, W. de Haan, E.H. Offerman, T.J. Van Berkel, L.M. Havekes, P.C. Rensen, Apolipoprotein CI aggravates atherosclerosis development in ApoE-knockout mice despite mediating cholesterol efflux from macrophages, Atherosclerosis 195 (2007) 9–16. [27] T. Gautier, U.J. Tietge, R. Boverhof, F.G. Perton, N. Le Guern, D. Masson, P.C. Rensen, L.M. Havekes, L. Lagrost, F. Kuipers, Hepatic lipid accumulation in apolipoprotein C-I-deficient mice is potentiated by cholesteryl ester transfer protein, J. Lipid Res. 48 (2007) 30–40. [28] A.T. Notø, E.B. Mathiesen, J. Brox, J. Björkegren, J.B. Hansen, The ApoC-I content of VLDL particles is associated with plaque size in persons with carotid atherosclerosis, Lipids 43 (2008) 673–679. [29] D. Charpentier, C. Tremblay, E. Rassart, D. Rhainds, A. Auger, R.W. Milne, L. Brissette, Low- and high-density lipoprotein metabolism in HepG2 cells expressing various levels of apolipoprotein E, Biochemistry 39 (2000) 16084–16091. [30] S. Bultel-Brienne, S. Lestavel, A. Pilon, I. Laffont, A. Tailleux, J.C. Fruchart, G. Siest, V. Clavey, Lipid free apolipoprotein E binds to the class B Type I scavenger receptor I (SR-BI) and enhances cholesteryl ester uptake from lipoproteins, J. Biol. Chem. 277 (2002) 36092–36099. [31] S.T. Choi, M.C. Komaromy, J. Chen, L.G. Fong, A.D. Cooper, Acceleration of uptake of LDL but not chylomicrons or chylomicron remnants by cells that secrete apoE and hepatic lipase, J Lipid Res 35 (1994) 848–859. [32] P. Davidsson, J. Hulthe, B. Fagerberg, B.M. Olsson, C. Hallberg, B. Dahllöf, G.A. Camejo, A proteomic study of the apolipoproteins in LDL subclasses in patients with the metabolic syndrome and type 2 diabetes, J. Lipid Res. 46 (2005) 1999–2006. [33] A. Pilon, O. Briand, S. Lestavel, C. Copin, Z. Majd, J.C. Fruchart, G. Castro, V. Clavey, Apolipoprotein AII enrichment of HDL enhances their affinity for class B type I scavenger receptor but inhibits specific cholesteryl ester uptake, Arterioscler. Thromb. Vasc. Biol. 20 (2000) 1074–1081. [34] S. Xu, M. Laccotripe, X. Huang, A. Rigotti, V.I. Zannis, M. Krieger, Apolipoproteins of HDL can directly mediate binding to the scavenger receptor SR-BI, an HDL receptor that mediates selective lipid uptake, J. Lipid Res. 38 (1997) 1289–1298. [35] D. Rhainds, P. Bourgeois, G. Bourret, K. Huard, L. Falstrault, L. Brissette, Localization and regulation of SR-BI in membrane rafts of HepG2 cells, J. Cell Sci. 117 (2004) 3095–3105. [36] T.Q. Truong, D. Aubin, P. Bourgeois, L. Falstrault, L. Brissette, Opposite effect of caveolin-1 in the metabolism of high-density and low-density lipoproteins, Biochim. Biophys. Acta 1761 (2006) 24–36. [37] X. Gu, R. Lawrence, M. Krieger, Dissociation of the high density lipoprotein and low density lipoprotein binding activities of murine scavenger receptor class B type I (mSR-BI) using retrovirus library-based activity dissection, J. Biol. Chem. 275 (2000) 9120–9130. [38] S.T. Thuahnai, S. Lund-Katz, G.M. Anantharamaiah, D.L. Williams, M.C. Phillips, A quantitative analysis of apolipoprotein binding to SR-BI: multiple binding sites for lipid free and lipid-associated apolipoproteins, J. Lipid Res. 44 (2003) 1132–1142.