- Email: [email protected]
Application of DNA technology to check misrepresentation of animal species in illegally sold meat
Author’s Accepted Manuscript Application of DNA technology to check misrepresentation of animal species in illegally sold meat Subbiah Vaithiyanathan, Mangalathu Rajan Vishnuraj, Godumagadda Narender Reddy, Vivek Vinayak Kulkarni www.elsevier.com/locate/bab
PII: DOI: Reference:
S1878-8181(18)30064-1 https://doi.org/10.1016/j.bcab.2018.10.012 BCAB895
To appear in: Biocatalysis and Agricultural Biotechnology Received date: 20 January 2018 Revised date: 28 July 2018 Accepted date: 16 October 2018 Cite this article as: Subbiah Vaithiyanathan, Mangalathu Rajan Vishnuraj, Godumagadda Narender Reddy and Vivek Vinayak Kulkarni, Application of DNA technology to check misrepresentation of animal species in illegally sold m e a t , Biocatalysis and Agricultural Biotechnology, https://doi.org/10.1016/j.bcab.2018.10.012 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Title Page Application of DNA technology to check misrepresentation of animal species in illegally sold meat Subbiah Vaithiyanathana, *, Mangalathu Rajan Vishnuraja, Godumagadda Narender Reddya and Vivek Vinayak Kulkarnib a
Meat Species Identification Laboratory (MSIL), Indian Council of Agricultural Research-
National Research Centre on Meat, Chengicherla, Hyderabad,500092, Telangana, India. b
Veterinary College and Research Institute- Namakkal, Tamil Nadu Veterinary and Animal
Sciences Institute, Madhavaram milk colony, Chennai, 600051, Tamil Nadu, India.
*
Corresponding author:
Dr. Subbiah Vaithiyanathan Meat Species Identification Laboratory (MSIL) Indian Council of Agricultural Research-National Research Centre on Meat Chengicherla, Hyderabad, 500092, Telangana, India. Email: [email protected] Phone no: 040-29801672 Mobile no: 09573761364, 9447779717 Fax: 040-29804259 ABSTRACT The present study designed in such a way to use DNA technology to accurately detect species origin of meat from samples received in lab from various stakeholders across country, and to empower the law enforcement agencies with scientific evidences. The protocol designed in lab was universal primer amplification that targets 12s rRNA gene and analysing the products 1
through sequencing and restriction fragment length polymorphism (PCR-RFLP), using AluI and/or HhaI, specifically to differentiate between meat from cattle and buffalo. For further confirmation, species specific PCR and for samples identified as cattle, a sex specific PCR were also carried out. Out of 139 samples received, only 113 passed sample reviewremaining were unsuitable for DNA extraction-for further analysis and most of these samples submitted were suspected as female cattle (69), cattle/buffalo (34), buffalo (5), male cattle (4), and one meat product suspected as dog. Out of 112 samples received and analysed to identify the presence of either cattle (male/female) or buffalo, 8 were found to be female cattle (7.14%) and 63 were male cattle (56.25%). 22 samples were found to be buffalo only, 11 samples were admixture of cattle and buffalo, 2 sheep, 1 goat and 2 chicken respectively. Interestingly, 3 samples suspected as female cattle were found to be camel meat and the sample suspected as dog were found to be sheep, on DNA analysis. Therefore, it is concluded that the DNA based molecular techniques applied in this study are suitable to give unambiguous results of meat species identification. Keywords: Food forensics, meat, species, misrepresentation, sex identification, polymerised chain reaction.
1. Introduction India has a huge livestock population comprising various species to adequately cater the need of non-vegetarian consumers in the country. In India, the major contributor of meat for domestic consumption is the commercial broilers (3.8 million tonnes/annum) followed by goat, sheep, pork and other minor food animals respectively. Consumption of meat and meat 2
products in India is growing rapidly due to higher disposable income and rapid urbanization. Indian meat export industry is mainly dominated by buffalo meat and the demand for Indian buffalo meat in international market has sparked a sudden increase. Being a country with diverse geography and religiously and seasonally adaptable food habits, the possibilities of adulterations are various. Another peculiarity of Indian meat industry is that, slaughter of cow and sale of beef is prohibited in several states of India through enactment of law (National Commission on Cattle, 2002). Singh and Neelam (2011), reported that approximately 25-30 % of meat sold in India is adulterated and adulteration will be more in case of comminuted meat products. The high price of animal derived proteins in market make this commodity (meat) highly vulnerable to adulteration. Moreover mislabelling of food products is done to cover up the food fraud committed while making food preparations in the form of ingredient substitution and has been observed globally (Amaral et al., 2017; Kane and Hellberg, 2016; Cawthron et al., 2013; Everstine et al., 2013; Ghovati et al., 2009; Woolfe and Primrose, 2003). The driving force behind any adulteration is the revenue maximization, either by using a low cost ingredient to substitute a more expensive one, or to remove the valued component (Ioannis and Nikolaos 2005). The adulteration of high value commercial meat such as mutton with low value meat such as chicken, pork and beef is done for financial gains which results in high motivation to the trader (Nischella et al., 2016; Mahajan et al., 2011). Once the taxonomic features are removed from the meat, it is difficult to identify the species of the meat visually. Authentication methods can be categorized into the areas where fraud is most likely to occur and lot of researches were already carried out using various biomarkers (like DNA, proteins) to detect the species and sex origin of meat. Analytical methods used in authentication are as diverse as the authentication problems, and include a diverse range of equipment and techniques. In recent past, DNA based molecular methods are being used to identify the unknown meat samples at species level (Verma and Goswami, 2014; Ballin, 2010; Hellberg and Morrissey, 2011). In animals, many PCR methods have been developed to identify the meat species (Matsunaga et al., 2999; Dooley et al., 2004; Dalmasso et al., 2004; Girish et al., 2005; Mahajan et al., 2011). Mostly the mitochondrial DNA is used in the species identification due to the conserved nature of gene sequences (Kocher et al., 1989). High copy number of mtDNA is found in the cells and, it remains intact during food processing thereby minimizing DNA degradation and does not contain any introns (Unseld et al., 1995). The published methods 3
clearly indicate that PCR offers both the desired sensitivity and the specificity for detection of adulteration of meat and meat products. DNA fingerprinting has been successfully used in commercial game meat products (Quinto et al., 2016) and forensic cases related to wild animals (Gupta et al., 2005 & 2011). Being a member country in WTO and under the new food regime of Food Safety and standards act (FSSAI), it is mandatory to develop robust and state of the art techniques to detect such meat adulteration in a cost effective manner. Moreover, ISO has already set up its technical committee (ISO/TC 34/SC 16) to develop methods to analyse the presence of buffalo meat in meat and meat products (ISO/AWI 20147) and to develop multiplex PCR methods (ISO/NP 20148) to detect species origin of meat and meat products. Very little information is available on forensic cases related to meat mislabelling practices in the India which requires a systematic study to find out the malpractices in meat trade. Therefore the objective of this study was to conduct molecular diagnostic test to identify the species on the unknown meat samples provided by other government departments to the meat species identification laboratory (MSIL). 2. Material and Methods A total of 113 samples were analysed by the meat species identification laboratory (MSIL) for various law enforcement agencies of both state and central governments departments and all were meat samples, except the one which was a meat product. The various sample forwarding agencies requested the MSIL to carry out species identification of the samples as per their queries. Out of 113 samples analysed by MSIL, 4 were suspected as male cattle, 5 as buffalo, 34 samples as either cattle or buffalo, 68 as female cattle and one meat product was given suspected as dog meat. The MSIL have given specific lab generated code to maintain the confidentiality of test, for each samples once they are received to the laboratory. As per the standard operating procedure of MSIL, after sample review, the DNA is extracted using spin column method and further the DNA amplified using universal primer that targets 12s rRNA. The amplified product is analysed through both sequencing and restriction fragment length polymorphism (RFLP), using AluI and/or HhaI. For further confirmation of the results, a species specific PCR was carried out (table 1). All the samples received suspected as cattle was analysed through one more PCR for identifying the sex of origin of meat. 2.1. DNA extraction from meat samples 4
DNA extraction from samples received in the laboratory was carried out following the method of Ivanova et al. (2012) with minor modifications. 2.1.1. Composition of reagents Vertebrate lysis buffer (VLB) - 100 mM NaCl, 50 mM Tris-HCl pH 8.0, 10 mM EDTA pH 8.0, 0.5% SDS. Binding buffer (BB) – 6M GuSCN, 20 mM EDTA pH 8.0,10 mM Tris-HCl pH 6.4 and 4% Triton X-100 was pre warmed at 56°C to dissolve. Binding mix (BM) - 50 mL of ethanol (96%) was thoroughly mixed with 50 mL of BB (stable at 20°C for 1 week). Protein wash buffer (PWB) - 70 mL of ethanol (96%) was thoroughly mixed with 26 mL of BB (stable at 20°C for 1 week). Wash buffer (WB) - ethanol (60%), 50 mM NaCl, 10 mm Tris-HCl pH 7.4 and 0.5 mM EDTA pH 8.0 (stored at -20°C). 2.1.2. Method protocol A 100 mg of meat sample was mixed with 200 µl of VLB in the pre-distributed zirconium beads in the 2.0 ml micro tube. The samples were homogenized in homogenizer (Bead bug, USA) for 3 min followed by overnight incubation at 56º C in a water bath. After centrifugation at 5000rpm for 5 min, clear supernatant was collected in a fresh micro tube and gently added 100 µl of BM buffer followed by slight vortex and pipetting it in the spin column (SRL, Mumbai India). They were then centrifuged at 7500rpm for 5 min and discarded and replaced with new collecting tube. Then, 180 µl of PWB added in column and centrifuged at 7500rpm for 2 min and discarded and replaced with new collecting tube. The spin column was washed twice with 300 µl of WB by centrifugation at 14000rpm for 5 min and the centrifugation was repeated one more time. Spin column with collecting tubes were kept at 56º C in a heating block (Major Science, USA) for 30 min to evaporate the residual ethanol. Finally 70 µl of pre warmed nuclease free water added for elution and incubated for 5min at room temperature followed by centrifugation at 7500rpm for 5 min. Once again the eluted DNA were incubated in dry bath at 60º C for 10 min before taking absorbance reading in Nano spectrophotometer (Biospec Nano, Shimadzu, Japan) and using them in PCR assay.
2.2. Polymerase chain reaction (PCR) The primer compositions used for PCR assay in the present study is enlisted in table 1. Each PCR amplification reaction was set up in a volume of 25 μl with 2.5 μl of 10X PCR buffer (100 mM Tris HCl, pH 9.0, 15 mM MgCl2, 500 mM KCl and 0.1 % gelatin), 0.5 μl of 5
10 mM dNTP mix (Invitrogen, Bangalore, India), 0.5 μl each of (20 pmoles) forward and reverse primers (Bioserve Biotechnologies (India) Pvt. Ltd., Hyderabad), 1 U of Platinum Taq DNA polymerase (Invitrogen, Bangalore) and 50 ng of purified DNA. Volume was made up to 25 μl by adding nuclease free water. Conditions on a gradient thermocycler (PEQSTAR, Germany) were as per the published protocol for each primer. 2.3. Restriction fragment length polymorphism PCR amplicons of the mitochondrial 12S r RNA gene were subjected to restriction enzyme digestion with suitable restriction enzymes like AluI and HhaI, as per the procedure of Girish et al. (2005), with minor modifications. Briefly, enzyme-buffer mix was prepared by mixing 2 µl of restriction enzyme with 8 µl of the respective buffer. Reaction mix was prepared by mixing 10 µl PCR products with 2 µl of enzyme buffer mix. Volume was made up to 20 µl with nuclease free water and incubated overnight at 37º C. Digested product was visualized by electrophoresis in 2.5% agarose gel. 2.4. PCR Amplicon sequencing PCR products were sequenced with plus stand using BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies) and an Applied Biosystems 3730xl Genetic Analyser (Life Technologies) at DNA sequencing facility, outsourced at Centre for Cellular and Molecular Biology (CMB), Hyderabad, India, through Bioserve Biotechnologies (India) Pvt Ltd., Hyderabad, India. The sequences obtained were of the mt 12S rRNA gene and they were queried in Gene Bank using the Basic Local Alignment Search Tool (BLAST) (https://blast.ncbi.nlm.nih.gov/Blast.cgi) and the top species matches were recorded. 3. Results and Discussion All the coded samples (samples no: 1 – 113) were analysed through universal mt 12S rRNA PCR assay (Fig. 1) and the PCR products were further analysed by RFLP with AluI and/or HhaI, to differentiate between cattle and buffalo. The results of sequence analysis of universal primers amplified products for forensically important nucleotide sequence (FINS) are discussed in detail in coming sessions. Further, primer pair were used against mitochondrial D loop for species specific identification of cattle and buffalo (Fig. 2). In RFLP analysis and FINS analysis, the mt 12S rRNA PCR assay produced the 456bp amplicons (Fig. 1) in all the samples and in the mt D loop duplex PCR assay produced the 126bp and 226bp (De et al., 2011; Vaithiyanathan and Kulkarni, 2016) amplicons respectively for cattle and buffalo species.
6
In the RFLP analysis, the AluI restriction enzyme digested the amplicons of 456bp produced from the DNA template of cattle resulted into 359bp and 97bp products (Fig. 3) while Hha I restriction enzyme digested the amplicons of 456bp produced from the DNA templates of buffalo resulted into 247bp and 209bp (Mahajan et al., 2011; Girish et al., 2005). And in the present study, we have observed same results pattern for cattle and buffalo meat samples. Further the sex identification of cattle meat was confirmed by TK_S4 & Sat1 PCR assay (Fig. 4) for samples which are found to be cattle positive. Three samples, coded 89, 90 and 91 that doesn’t produced an amplification with mt D-loop PCR (Fig. 2) and variations in regular RFLP pattern in Alu I digestion (Fig. 3), were found to be camel meat on further analysis using sequence blasting and using species specific primers to produce a band of 435bp size (table 1). Similarly, sample 98 that showed a nonspecific product of 200bp with no significance in 12S rRNA PCR were further confirmed as chicken during sequence comparison. Species specific primer pairs were used to detect dog meat (product size of 100bp) (Fig. 5) and sheep (product size of 254bp) and goat meat (product size of 453) (Fig. 6) from various samples analysed in MSIL. Out of 112 samples received and analysed by MSIL to identify the presence of either cattle (male/female) or buffalo, a majority of 63 suspected samples were found as male cattle (56.75%) and 8 samples (7.14%) as female cattle. Further 22 samples (19.64%) were found to be of buffalo origin alone, another 11 samples (9.82%) were found to be an admixture of both cattle and buffalo. Along with this findings, 2 sheep, 2 chicken, 1 goat and 3 camel samples were also identified form 112 samples. The sample which was received suspected as dog meat was found to be of sheep origin in DNA analysis (Fig. 5). This results was confirmed by species specific Cyt b gene primer to specifically detect DNA extracted from dog meat and comparison were made using DNA templates of cattle, buffalo, sheep, goat, pork, chicken and dog. Moreover, we have found that out of the 69 request made by the forwarding agencies for sample analysis suspected as female cattle, 42 were identified as male cattle, 6 as female cattle, 1 as an admixture of both cattle and buffalo, 14 as buffalo alone, 1 as sheep, 3 as camel, 1 as chicken and 1 as goat on DNA analysis. Similarly, out of 34 samples received suspected as either cattle or buffalo, 19 were male cattle, 2 were female cattle, 3 were buffalo, 8 were mixture of cattle and buffalo, 1 sheep and one chicken. The confirmation of these results of species identification were made possible through three specific tests viz. FINS test, species specific mt D loop PCR assay and RFLP analysis 7
to differentiate the cattle and buffalo meat. It was observed that only buffalo meat is confirming to the sample request and concurrence and all other samples were mislabelled. Our results were confirmed through four different molecular methods as already explained, including sex specific amplifications, to give unambiguous results and it appeared from these results that mislabelling of meat/misrepresentation of animal species occur intentionally. Nischella et al. (2016) have reported high incidence of mislabelling of chevon sold in the retail sales units in India. Similarly, Cawthorn et al. (2013) have also reported a high incidence of mislabelling of meat products in South Africa. However, Quinto et al. (2016) have reported less incidence (18.3%) of mislabelling in game meat sold in the USA, whereas Kane and Hellberg (2016) have reported high incidence of mislabelling (35%) in the online specialty meat distributors while it was low (18%) from local butcher followed by sale from supermarket (5.8%). Amaral et al. (2017) have reported undeclared pork species in 54% of the analysed samples and 40% of Halal products with traces of pork using Eva green real time PCR assay. It is now well documented that the species identification of animals can be performed accurately by PCR assay (Verma et al., 2014; Ballin, 2010). Subsequently, the sex identification of meat sample was performed only for cattle meat through TS_K4 &Sat1 analysis. The TK_S4 and Sat1 PCR assay produced 538bp amplicons in both cattle male and female and 300bp only in cattle male (Khamlor et al., 2015). It was observed that 92% of the sample were cattle male and only 8% was cattle female, among the samples analysed by MSIL. Similarly, Gokulakrishnan et al. (2012) reported that SRY PCR assay can produce 182 bp amplicons in the cattle male and the amelogenin PCR assay can produce 313 bp in both cattle male and female and 250bp only in cattle male. 3.1. Sequencing results All the samples were analysed for species identification through FINS based methods using the amplicon sequence of universal mt 12S rRNA gene primer and the alignments were compared in NCBI BLAST. The sequences were of high quality, with an average consensus length of 449 ± 8 bp, with a gap of 0-1%. All the samples showed genetic matches > 96% to species-level entries in nucleotide BLAST analysis with Bos indicus/tarurus or Bubalus bubalis or Ovis aries or Capra hircus or Gallus gallus or Camelus dromedarius or Canis familiaris. Further, the cattle and buffalo meat samples were also confirmed in the species specific mt D loop PCR assay and the RFLP analysis. However, there was one sample with mixed DNA of both cattle and buffalo which could not be done through this mt D loop method and sequence analysis alone. Girish et al., (2004) have reported the FINS analysis 8
method for species confirmation using the mt 12S rRNA amplicons. Girish et al., (2004) have also suggested that admixed meat DNA with amplicons of different species may lead to ambiguous sequence results. Hellberg and Morrissey (Hellberg et al., 2011) have suggested that DNA barcoding method is not capable of identifying multiple species in the same product. 4. Conclusions Meat species identification is considered important because of food frauds committed by the unscrupulous meat traders/food processors. At present scenario, DNA based methods such as PCR assay and PCR-RFLP techniques are the most preferred for meat species identification because DNA based methods provide sensitivity, accuracy, repeatability and reproducibility. It can be concluded that the molecular methods used in this study like, mt 12S rRNA PCR assay, FINS analysis, mt D loop/cyt b duplex species specific PCR assay, RFLP analysis and sex specific PCR assay are the best suitable analytical techniques for meat species identification to provide unambiguous results to various law enforcement agencies. These analytical techniques can also be deployed by the food testing laboratories to detect the mislabelling of commercial meat samples sold in the retail market as well as in export meat samples, so that reporting/controlling/managing of food frauds and other economically motivated adulterations (EMA) can be accomplished. References Amaral, J.S., Santos, G., Oliveira, M.P., Mafra, I., 2017. Quantitative detection of pork meat by EvaGreen real-time PCR to assess the authenticity of processed meat products. Food Control. 72, 53-61 Ballin, N.S., 2010. Authentication of meat and meat products. Meat Sci. 86, 577–587. Cawthorn, D.M., Steinman, H.A., Hoffman, L.C., 2013. A high incidence of species substitution and mislabelling detected in meat products sold in South Africa. Food Control. 32, 440˗449. Dalmasso, A., Fontanella, E., Piatti, P., Civer, T., Rosati, S., Bottero, M.T., 2004. A multiplex PCR assay for the identification of animal species in feedstuffs. Mol. Cell Probes. 18, 81–87. De, S., Brahma, B., Polley, S., Mukherjee, A., Banerjee, D., Gohaina, M., Singh, K.P., Singh, R., Datta, R.K., Goswami, S.L., 2011. Simplex and duplex PCR assays for species specific identification of cattle and buffalo milk and cheese. Food Control. 22, 690-696.
9
Dooley, J.J., Paine, K.E., Garrett, S.D., Brown, H.M., 2004. Detection of meat species using TaqMan real-time PCR assays. Meat Sci. 68, 431-438. Everstine, K., Spink, J., Kennedy, S., 2013. Economically motivated adulteration (EMA) of food: Common characteristics of EMA incidents. J. Food Protect. 76, 723-735. Ghovvati, S., Nassiri, M.R., Mirhoseini, S.Z., Heravi Moussavi, A., Javadmanesh, A., 2009. Fraud identification in industrial meat products by multiplex PCR assay. Food Control. 20, 696–699. Girish, P.S., Anjaneyulu, A.S.R., Viswas, K.N., Anand, M., Rajkumar, N., Shivakumar, B.M., Sharma, B., 2004. Sequence analysis of mitochondrial 12S rRNA gene can identify meat species. Meat Sci. 66, 551-556. Girish, P.S., Anjaneyulu, A.S.R., Viswas, K.N., Shivakumar, B.M., Anand, M., Patel, M., Sharma, B., 2005. Meat species identification by Polymerase chain reaction – restriction fragment length polymorphism (PCR-RFLP) of mitochondrial 12S rRNA gene. Meat Sci. 70, 107-112. Gokulakrishnan, P., Kumar, R.R., Sharma, B.D., Mendiratta, S.K., Sharma, D., 2012. A duplex PCR assay for sex determination of cattle meat by simultaneous amplification of SRY, AMELX and AMELY Genes. Food Biotechnol. 26, 75-84. Gupta, S.K., Bhagavatula, J., Thangaraj, K., Singh, L., 2011. Establishing the identity of the massacred tigress in a case of wildlife crime. Forensic Sci. Int.-Gen. 5, 74-75. Gupta, S.K., Verma, S.K., Singh, L., 2005. Molecular insight into a wildlife crime: the case of a peafowl slaughter. Forensic Sci. Int. 154, 214–217 Hellberg, R.S.R., Morrissey, M.T., 2011. Advances in DNA-based techniques for the detection of seafood species substitution on the commercial market. J. Lab. Autom. 16, 308-21. Ioannis, S.A., Nikolaos, E.T., 2005. Implementation of quality control methods in conjunction with chemometrics toward authentication of dairy products. Crit. Rev. Food Sci. Nutr. 45, 231–249. Ivanova, N.V., Clare, E.L., Borisenko, A.L., 2012. DNA Barcoding in Mammals In: W. John Kress and David L. Erickson (eds.), DNA Barcodes: Methods and Protocols, Methods in Molecular Biology, Springer Science+Business Media, LLC. 858, 154-181. Kane, D.E., Hellberg, R.S., 2016. Identification of species in ground meat products sold on the US commercial market using DNA-based methods. Food Control. 59, 158-163.
10
Khamlor,
T.,
Pongpiachan,
P.,
Parnpai,
R.,
Punyawai,
K.,
Sangsritavong,
S.,
Chokesajjawatee, N., 2015. Bovine embryo sex determination by multiplex loopmediated isothermal amplification. Theriogenology. 83, 891–896. Kocher, T.D., Thomas, W.K., Meyer, A., Edwards, S.V., Paabo, S., Villablanca, F.X., Wilson, A.C., 1989. Dynamics of mitochondrial DNA sequence evolution in animals. Proc. Nat. Acad. Sci. 86, 6196-6200. Mahajan, M.V., Gadekar, Y.P., Dighe, V.D., Kokane, R.D., Bannalikar, A.S., 2011. Molecular detection of meat animal species targeting MT 12S rRNA gene Meat Sci. 88, 23-27. Matsunaga, T., Chikuni, K., Tanabe, R., Muoya, S., Shibata, K., Yamada, J., Shinmura, Y.A., 1999. Quick and simple method for the identification of meat species and meat products by PCR assay. Meat Sci. 51, 143–148. National Commission on Cattle Report. 2002. Department of Animal Husbandry & Dairying. Ministry of Agriculture, Government of India. Nischella, S., Vaithiyanathan, S., Ashok, V., Kalyani, P., 2016. Detection of mutton and chevon by PCR assay using Cyt B gene primers. In: Proc of 7 th Indian meat science association (IMSA) conference held on November 10-12 at GADVASU, Ludhiana, India. pp 311. Quinto, C.A., Tinoco, R., Hellberg, R.S., 2016. DNA barcoding reveals mislabeling of game meat species on the U.S. commercial market. Food Control. 59, 386-392. Rahman, M.M., Ali, M.E., Hamid, S.B.A., Mustafa, S., Hashim, U., Hanapi, U.K., 2014. Polymerase chain reaction assay targeting cytochrome b gene for the detection of dog meat adulteration in meatball formulation. Meat Sci. 97, 404-409. Singh, V.P., and Neelam, S., 2011. Meat species specifications to ensure the quality of meatA review. Int. J. Meat Sci. 1 (1), 15-26. 2011. Unseld, M., Beyermann, B., Brandt, P., Hiesel, R., 1995. Identification of the species of origin of highly processed meat products by mitochondrial DNA sequences. PCR Meth. Appl. 4, 241-243. Vaithiyanathan, S., Kulkarni, V.V., 2016. Species identification of cattle and buffalo fat through PCR assay. J. Food Sci. Technol. 53, 2077–2082. Verma, S.K., Goswami, G.K,. 2014. DNA evidence: Current perspective and future challenges in India. Forensic Sci. Int. 2014, 241:183-189.
11
Woolfe, M., Primrose, S., 2003. Food forensics: using DNA technology to combat misdescription and fraud. Trends Biotechnol. 22, 222-226.
Fig. 1: Agarose gel electrophoresis picture of universal mitochondrial 12S r RNA gene amplification of DNA isolated from coded samples (PCR band size: 456bp). (89-104 represents coded samples analysed in MSIL; C and B represents positive cattle and buffalo DNA, NC: negative control).
Fig. 2: Agarose gel electrophoresis picture of mt D-loop duplex PCR amplification of DNA isolated from coded samples (PCR band size: 126bp for cattle and 226bp for buffalo). (89-104 represents coded samples analysed in MSIL; C and B represents positive cattle and buffalo DNA, NC: negative control). 12
Fig.
3a
Fig. 3b
Fig. 3a&3b: Agarose gel electrophoresis picture of RFLP pattern from 12S rRNA amplified products of DNA isolated from coded samples using Alu I and Hha I. (PCR band size: 359 & 97bp for cattle during Alu I digestion 247 & 209bp for buffalo during Hha I digestion). (89-104 represents coded samples analysed in MSIL; C and B represents positive cattle and buffalo DNA, UD: undigested control).
Fig. 4: Agarose gel electrophoresis picture of TS_4 & SAT-I gene PCR amplification of DNA isolated from coded samples (TS_4 amplification produced 300bp band only in male cattle and SAT-I produced bovine specific band size 538bp in both sexes). 13
(92, 93, 95, 100, 101, 102 represents coded samples analysed in MSIL; CF and CM represents positive cattle female and cattle male DNA, NC: negative control).
Fig. 5: Amplification of mitochondrial cyt b gene primer (dog specific) by the known and unknown samples (dog specific product size is 100bp). (L=DNA ladder; A83, A84 = DNA from the sample received by MSIL, C=cattle; B=buffalo; S=sheep, G=Goat, Ch=Chicken, P=Pork, D=dog, NC = negative control
Fig. 6: Amplification of mitochondrial cyt b duplex PCR (sheep and goat specific) by the known and unknown samples (sheep specific product size is 254bp and goat specific is 453bp). (L=DNA ladder; A109 = DNA from the sample received by MSIL, C=cattle; B=buffalo; S=sheep, G=Goat, NC = negative control).
14
Table 1: Details of sequence and product size of various primer pairs used by meat species identification laboratory (MSIL) to identify species origin of meat and meat products.
Primer
Composition 5’
3’
mt 12S
Forward-5′-CAACTGGGATTAGATACC CCACTAT-3′
rRNA
Reverse-5′-GAGGGTGACGGGCGGTGTGT-3’
mt D loop
TK_S4
Target species
Product size
Universal
456 bp
Forward-5’-ACTAGATCACGAGCT TGATCACCATGC-3′
Common
Reverse-5’-GTTATGTGTGAGCATGGGCTGATTGGA-3′
Buffalo
226 bp
Reverse-5’-ATGCCTGGTAAAATTCATTAAATAGCG -3′
Cattle
126 bp
Forward: 5’-CTCAGCAAAGCACACCAGAC-3’
Cattle male
300bp
Reverse: 5’-GAACTTTCAAGCAGCTGAGGC-3’ Sat1
Forward- 5’-TTTACCTTAGAACAAACCGAGGCAC-3’
only in male bovine-specific
Reverse- 5’-TACGGAAAGGAAAGATGACCTGACC-3’ mt Cyt b
Forward-5’-CCTTACTAGGAGTATGCTTG-3’
538bp in both sex
Dog specific
100bp
Forward-5’-TGGGTGACTGATGAAAAAG-3’
mt Cyt b
mt Cyt b
Forward- 5’- TATTGGCACAAACCTAGTCG -3’
Common
Reverse- 5’- TGAGGATGAGGATTAGTAGG -3’
Sheep
254bp
Reverse- 5’- GTGTGGAGGAAGGGTACAAG -3’
Goat
453bp
Forward: 5’- AGCTTTCATGGGCTACGTCC C-3’
Camel specific
435 bp
Reverse: 5’- TCCGGCTTGATATGTGGTGG -3’
15
PII: DOI: Reference:
S1878-8181(18)30064-1 https://doi.org/10.1016/j.bcab.2018.10.012 BCAB895
To appear in: Biocatalysis and Agricultural Biotechnology Received date: 20 January 2018 Revised date: 28 July 2018 Accepted date: 16 October 2018 Cite this article as: Subbiah Vaithiyanathan, Mangalathu Rajan Vishnuraj, Godumagadda Narender Reddy and Vivek Vinayak Kulkarni, Application of DNA technology to check misrepresentation of animal species in illegally sold m e a t , Biocatalysis and Agricultural Biotechnology, https://doi.org/10.1016/j.bcab.2018.10.012 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Title Page Application of DNA technology to check misrepresentation of animal species in illegally sold meat Subbiah Vaithiyanathana, *, Mangalathu Rajan Vishnuraja, Godumagadda Narender Reddya and Vivek Vinayak Kulkarnib a
Meat Species Identification Laboratory (MSIL), Indian Council of Agricultural Research-
National Research Centre on Meat, Chengicherla, Hyderabad,500092, Telangana, India. b
Veterinary College and Research Institute- Namakkal, Tamil Nadu Veterinary and Animal
Sciences Institute, Madhavaram milk colony, Chennai, 600051, Tamil Nadu, India.
*
Corresponding author:
Dr. Subbiah Vaithiyanathan Meat Species Identification Laboratory (MSIL) Indian Council of Agricultural Research-National Research Centre on Meat Chengicherla, Hyderabad, 500092, Telangana, India. Email: [email protected] Phone no: 040-29801672 Mobile no: 09573761364, 9447779717 Fax: 040-29804259 ABSTRACT The present study designed in such a way to use DNA technology to accurately detect species origin of meat from samples received in lab from various stakeholders across country, and to empower the law enforcement agencies with scientific evidences. The protocol designed in lab was universal primer amplification that targets 12s rRNA gene and analysing the products 1
through sequencing and restriction fragment length polymorphism (PCR-RFLP), using AluI and/or HhaI, specifically to differentiate between meat from cattle and buffalo. For further confirmation, species specific PCR and for samples identified as cattle, a sex specific PCR were also carried out. Out of 139 samples received, only 113 passed sample reviewremaining were unsuitable for DNA extraction-for further analysis and most of these samples submitted were suspected as female cattle (69), cattle/buffalo (34), buffalo (5), male cattle (4), and one meat product suspected as dog. Out of 112 samples received and analysed to identify the presence of either cattle (male/female) or buffalo, 8 were found to be female cattle (7.14%) and 63 were male cattle (56.25%). 22 samples were found to be buffalo only, 11 samples were admixture of cattle and buffalo, 2 sheep, 1 goat and 2 chicken respectively. Interestingly, 3 samples suspected as female cattle were found to be camel meat and the sample suspected as dog were found to be sheep, on DNA analysis. Therefore, it is concluded that the DNA based molecular techniques applied in this study are suitable to give unambiguous results of meat species identification. Keywords: Food forensics, meat, species, misrepresentation, sex identification, polymerised chain reaction.
1. Introduction India has a huge livestock population comprising various species to adequately cater the need of non-vegetarian consumers in the country. In India, the major contributor of meat for domestic consumption is the commercial broilers (3.8 million tonnes/annum) followed by goat, sheep, pork and other minor food animals respectively. Consumption of meat and meat 2
products in India is growing rapidly due to higher disposable income and rapid urbanization. Indian meat export industry is mainly dominated by buffalo meat and the demand for Indian buffalo meat in international market has sparked a sudden increase. Being a country with diverse geography and religiously and seasonally adaptable food habits, the possibilities of adulterations are various. Another peculiarity of Indian meat industry is that, slaughter of cow and sale of beef is prohibited in several states of India through enactment of law (National Commission on Cattle, 2002). Singh and Neelam (2011), reported that approximately 25-30 % of meat sold in India is adulterated and adulteration will be more in case of comminuted meat products. The high price of animal derived proteins in market make this commodity (meat) highly vulnerable to adulteration. Moreover mislabelling of food products is done to cover up the food fraud committed while making food preparations in the form of ingredient substitution and has been observed globally (Amaral et al., 2017; Kane and Hellberg, 2016; Cawthron et al., 2013; Everstine et al., 2013; Ghovati et al., 2009; Woolfe and Primrose, 2003). The driving force behind any adulteration is the revenue maximization, either by using a low cost ingredient to substitute a more expensive one, or to remove the valued component (Ioannis and Nikolaos 2005). The adulteration of high value commercial meat such as mutton with low value meat such as chicken, pork and beef is done for financial gains which results in high motivation to the trader (Nischella et al., 2016; Mahajan et al., 2011). Once the taxonomic features are removed from the meat, it is difficult to identify the species of the meat visually. Authentication methods can be categorized into the areas where fraud is most likely to occur and lot of researches were already carried out using various biomarkers (like DNA, proteins) to detect the species and sex origin of meat. Analytical methods used in authentication are as diverse as the authentication problems, and include a diverse range of equipment and techniques. In recent past, DNA based molecular methods are being used to identify the unknown meat samples at species level (Verma and Goswami, 2014; Ballin, 2010; Hellberg and Morrissey, 2011). In animals, many PCR methods have been developed to identify the meat species (Matsunaga et al., 2999; Dooley et al., 2004; Dalmasso et al., 2004; Girish et al., 2005; Mahajan et al., 2011). Mostly the mitochondrial DNA is used in the species identification due to the conserved nature of gene sequences (Kocher et al., 1989). High copy number of mtDNA is found in the cells and, it remains intact during food processing thereby minimizing DNA degradation and does not contain any introns (Unseld et al., 1995). The published methods 3
clearly indicate that PCR offers both the desired sensitivity and the specificity for detection of adulteration of meat and meat products. DNA fingerprinting has been successfully used in commercial game meat products (Quinto et al., 2016) and forensic cases related to wild animals (Gupta et al., 2005 & 2011). Being a member country in WTO and under the new food regime of Food Safety and standards act (FSSAI), it is mandatory to develop robust and state of the art techniques to detect such meat adulteration in a cost effective manner. Moreover, ISO has already set up its technical committee (ISO/TC 34/SC 16) to develop methods to analyse the presence of buffalo meat in meat and meat products (ISO/AWI 20147) and to develop multiplex PCR methods (ISO/NP 20148) to detect species origin of meat and meat products. Very little information is available on forensic cases related to meat mislabelling practices in the India which requires a systematic study to find out the malpractices in meat trade. Therefore the objective of this study was to conduct molecular diagnostic test to identify the species on the unknown meat samples provided by other government departments to the meat species identification laboratory (MSIL). 2. Material and Methods A total of 113 samples were analysed by the meat species identification laboratory (MSIL) for various law enforcement agencies of both state and central governments departments and all were meat samples, except the one which was a meat product. The various sample forwarding agencies requested the MSIL to carry out species identification of the samples as per their queries. Out of 113 samples analysed by MSIL, 4 were suspected as male cattle, 5 as buffalo, 34 samples as either cattle or buffalo, 68 as female cattle and one meat product was given suspected as dog meat. The MSIL have given specific lab generated code to maintain the confidentiality of test, for each samples once they are received to the laboratory. As per the standard operating procedure of MSIL, after sample review, the DNA is extracted using spin column method and further the DNA amplified using universal primer that targets 12s rRNA. The amplified product is analysed through both sequencing and restriction fragment length polymorphism (RFLP), using AluI and/or HhaI. For further confirmation of the results, a species specific PCR was carried out (table 1). All the samples received suspected as cattle was analysed through one more PCR for identifying the sex of origin of meat. 2.1. DNA extraction from meat samples 4
DNA extraction from samples received in the laboratory was carried out following the method of Ivanova et al. (2012) with minor modifications. 2.1.1. Composition of reagents Vertebrate lysis buffer (VLB) - 100 mM NaCl, 50 mM Tris-HCl pH 8.0, 10 mM EDTA pH 8.0, 0.5% SDS. Binding buffer (BB) – 6M GuSCN, 20 mM EDTA pH 8.0,10 mM Tris-HCl pH 6.4 and 4% Triton X-100 was pre warmed at 56°C to dissolve. Binding mix (BM) - 50 mL of ethanol (96%) was thoroughly mixed with 50 mL of BB (stable at 20°C for 1 week). Protein wash buffer (PWB) - 70 mL of ethanol (96%) was thoroughly mixed with 26 mL of BB (stable at 20°C for 1 week). Wash buffer (WB) - ethanol (60%), 50 mM NaCl, 10 mm Tris-HCl pH 7.4 and 0.5 mM EDTA pH 8.0 (stored at -20°C). 2.1.2. Method protocol A 100 mg of meat sample was mixed with 200 µl of VLB in the pre-distributed zirconium beads in the 2.0 ml micro tube. The samples were homogenized in homogenizer (Bead bug, USA) for 3 min followed by overnight incubation at 56º C in a water bath. After centrifugation at 5000rpm for 5 min, clear supernatant was collected in a fresh micro tube and gently added 100 µl of BM buffer followed by slight vortex and pipetting it in the spin column (SRL, Mumbai India). They were then centrifuged at 7500rpm for 5 min and discarded and replaced with new collecting tube. Then, 180 µl of PWB added in column and centrifuged at 7500rpm for 2 min and discarded and replaced with new collecting tube. The spin column was washed twice with 300 µl of WB by centrifugation at 14000rpm for 5 min and the centrifugation was repeated one more time. Spin column with collecting tubes were kept at 56º C in a heating block (Major Science, USA) for 30 min to evaporate the residual ethanol. Finally 70 µl of pre warmed nuclease free water added for elution and incubated for 5min at room temperature followed by centrifugation at 7500rpm for 5 min. Once again the eluted DNA were incubated in dry bath at 60º C for 10 min before taking absorbance reading in Nano spectrophotometer (Biospec Nano, Shimadzu, Japan) and using them in PCR assay.
2.2. Polymerase chain reaction (PCR) The primer compositions used for PCR assay in the present study is enlisted in table 1. Each PCR amplification reaction was set up in a volume of 25 μl with 2.5 μl of 10X PCR buffer (100 mM Tris HCl, pH 9.0, 15 mM MgCl2, 500 mM KCl and 0.1 % gelatin), 0.5 μl of 5
10 mM dNTP mix (Invitrogen, Bangalore, India), 0.5 μl each of (20 pmoles) forward and reverse primers (Bioserve Biotechnologies (India) Pvt. Ltd., Hyderabad), 1 U of Platinum Taq DNA polymerase (Invitrogen, Bangalore) and 50 ng of purified DNA. Volume was made up to 25 μl by adding nuclease free water. Conditions on a gradient thermocycler (PEQSTAR, Germany) were as per the published protocol for each primer. 2.3. Restriction fragment length polymorphism PCR amplicons of the mitochondrial 12S r RNA gene were subjected to restriction enzyme digestion with suitable restriction enzymes like AluI and HhaI, as per the procedure of Girish et al. (2005), with minor modifications. Briefly, enzyme-buffer mix was prepared by mixing 2 µl of restriction enzyme with 8 µl of the respective buffer. Reaction mix was prepared by mixing 10 µl PCR products with 2 µl of enzyme buffer mix. Volume was made up to 20 µl with nuclease free water and incubated overnight at 37º C. Digested product was visualized by electrophoresis in 2.5% agarose gel. 2.4. PCR Amplicon sequencing PCR products were sequenced with plus stand using BigDye Terminator v3.1 Cycle Sequencing Kit (Life Technologies) and an Applied Biosystems 3730xl Genetic Analyser (Life Technologies) at DNA sequencing facility, outsourced at Centre for Cellular and Molecular Biology (CMB), Hyderabad, India, through Bioserve Biotechnologies (India) Pvt Ltd., Hyderabad, India. The sequences obtained were of the mt 12S rRNA gene and they were queried in Gene Bank using the Basic Local Alignment Search Tool (BLAST) (https://blast.ncbi.nlm.nih.gov/Blast.cgi) and the top species matches were recorded. 3. Results and Discussion All the coded samples (samples no: 1 – 113) were analysed through universal mt 12S rRNA PCR assay (Fig. 1) and the PCR products were further analysed by RFLP with AluI and/or HhaI, to differentiate between cattle and buffalo. The results of sequence analysis of universal primers amplified products for forensically important nucleotide sequence (FINS) are discussed in detail in coming sessions. Further, primer pair were used against mitochondrial D loop for species specific identification of cattle and buffalo (Fig. 2). In RFLP analysis and FINS analysis, the mt 12S rRNA PCR assay produced the 456bp amplicons (Fig. 1) in all the samples and in the mt D loop duplex PCR assay produced the 126bp and 226bp (De et al., 2011; Vaithiyanathan and Kulkarni, 2016) amplicons respectively for cattle and buffalo species.
6
In the RFLP analysis, the AluI restriction enzyme digested the amplicons of 456bp produced from the DNA template of cattle resulted into 359bp and 97bp products (Fig. 3) while Hha I restriction enzyme digested the amplicons of 456bp produced from the DNA templates of buffalo resulted into 247bp and 209bp (Mahajan et al., 2011; Girish et al., 2005). And in the present study, we have observed same results pattern for cattle and buffalo meat samples. Further the sex identification of cattle meat was confirmed by TK_S4 & Sat1 PCR assay (Fig. 4) for samples which are found to be cattle positive. Three samples, coded 89, 90 and 91 that doesn’t produced an amplification with mt D-loop PCR (Fig. 2) and variations in regular RFLP pattern in Alu I digestion (Fig. 3), were found to be camel meat on further analysis using sequence blasting and using species specific primers to produce a band of 435bp size (table 1). Similarly, sample 98 that showed a nonspecific product of 200bp with no significance in 12S rRNA PCR were further confirmed as chicken during sequence comparison. Species specific primer pairs were used to detect dog meat (product size of 100bp) (Fig. 5) and sheep (product size of 254bp) and goat meat (product size of 453) (Fig. 6) from various samples analysed in MSIL. Out of 112 samples received and analysed by MSIL to identify the presence of either cattle (male/female) or buffalo, a majority of 63 suspected samples were found as male cattle (56.75%) and 8 samples (7.14%) as female cattle. Further 22 samples (19.64%) were found to be of buffalo origin alone, another 11 samples (9.82%) were found to be an admixture of both cattle and buffalo. Along with this findings, 2 sheep, 2 chicken, 1 goat and 3 camel samples were also identified form 112 samples. The sample which was received suspected as dog meat was found to be of sheep origin in DNA analysis (Fig. 5). This results was confirmed by species specific Cyt b gene primer to specifically detect DNA extracted from dog meat and comparison were made using DNA templates of cattle, buffalo, sheep, goat, pork, chicken and dog. Moreover, we have found that out of the 69 request made by the forwarding agencies for sample analysis suspected as female cattle, 42 were identified as male cattle, 6 as female cattle, 1 as an admixture of both cattle and buffalo, 14 as buffalo alone, 1 as sheep, 3 as camel, 1 as chicken and 1 as goat on DNA analysis. Similarly, out of 34 samples received suspected as either cattle or buffalo, 19 were male cattle, 2 were female cattle, 3 were buffalo, 8 were mixture of cattle and buffalo, 1 sheep and one chicken. The confirmation of these results of species identification were made possible through three specific tests viz. FINS test, species specific mt D loop PCR assay and RFLP analysis 7
to differentiate the cattle and buffalo meat. It was observed that only buffalo meat is confirming to the sample request and concurrence and all other samples were mislabelled. Our results were confirmed through four different molecular methods as already explained, including sex specific amplifications, to give unambiguous results and it appeared from these results that mislabelling of meat/misrepresentation of animal species occur intentionally. Nischella et al. (2016) have reported high incidence of mislabelling of chevon sold in the retail sales units in India. Similarly, Cawthorn et al. (2013) have also reported a high incidence of mislabelling of meat products in South Africa. However, Quinto et al. (2016) have reported less incidence (18.3%) of mislabelling in game meat sold in the USA, whereas Kane and Hellberg (2016) have reported high incidence of mislabelling (35%) in the online specialty meat distributors while it was low (18%) from local butcher followed by sale from supermarket (5.8%). Amaral et al. (2017) have reported undeclared pork species in 54% of the analysed samples and 40% of Halal products with traces of pork using Eva green real time PCR assay. It is now well documented that the species identification of animals can be performed accurately by PCR assay (Verma et al., 2014; Ballin, 2010). Subsequently, the sex identification of meat sample was performed only for cattle meat through TS_K4 &Sat1 analysis. The TK_S4 and Sat1 PCR assay produced 538bp amplicons in both cattle male and female and 300bp only in cattle male (Khamlor et al., 2015). It was observed that 92% of the sample were cattle male and only 8% was cattle female, among the samples analysed by MSIL. Similarly, Gokulakrishnan et al. (2012) reported that SRY PCR assay can produce 182 bp amplicons in the cattle male and the amelogenin PCR assay can produce 313 bp in both cattle male and female and 250bp only in cattle male. 3.1. Sequencing results All the samples were analysed for species identification through FINS based methods using the amplicon sequence of universal mt 12S rRNA gene primer and the alignments were compared in NCBI BLAST. The sequences were of high quality, with an average consensus length of 449 ± 8 bp, with a gap of 0-1%. All the samples showed genetic matches > 96% to species-level entries in nucleotide BLAST analysis with Bos indicus/tarurus or Bubalus bubalis or Ovis aries or Capra hircus or Gallus gallus or Camelus dromedarius or Canis familiaris. Further, the cattle and buffalo meat samples were also confirmed in the species specific mt D loop PCR assay and the RFLP analysis. However, there was one sample with mixed DNA of both cattle and buffalo which could not be done through this mt D loop method and sequence analysis alone. Girish et al., (2004) have reported the FINS analysis 8
method for species confirmation using the mt 12S rRNA amplicons. Girish et al., (2004) have also suggested that admixed meat DNA with amplicons of different species may lead to ambiguous sequence results. Hellberg and Morrissey (Hellberg et al., 2011) have suggested that DNA barcoding method is not capable of identifying multiple species in the same product. 4. Conclusions Meat species identification is considered important because of food frauds committed by the unscrupulous meat traders/food processors. At present scenario, DNA based methods such as PCR assay and PCR-RFLP techniques are the most preferred for meat species identification because DNA based methods provide sensitivity, accuracy, repeatability and reproducibility. It can be concluded that the molecular methods used in this study like, mt 12S rRNA PCR assay, FINS analysis, mt D loop/cyt b duplex species specific PCR assay, RFLP analysis and sex specific PCR assay are the best suitable analytical techniques for meat species identification to provide unambiguous results to various law enforcement agencies. These analytical techniques can also be deployed by the food testing laboratories to detect the mislabelling of commercial meat samples sold in the retail market as well as in export meat samples, so that reporting/controlling/managing of food frauds and other economically motivated adulterations (EMA) can be accomplished. References Amaral, J.S., Santos, G., Oliveira, M.P., Mafra, I., 2017. Quantitative detection of pork meat by EvaGreen real-time PCR to assess the authenticity of processed meat products. Food Control. 72, 53-61 Ballin, N.S., 2010. Authentication of meat and meat products. Meat Sci. 86, 577–587. Cawthorn, D.M., Steinman, H.A., Hoffman, L.C., 2013. A high incidence of species substitution and mislabelling detected in meat products sold in South Africa. Food Control. 32, 440˗449. Dalmasso, A., Fontanella, E., Piatti, P., Civer, T., Rosati, S., Bottero, M.T., 2004. A multiplex PCR assay for the identification of animal species in feedstuffs. Mol. Cell Probes. 18, 81–87. De, S., Brahma, B., Polley, S., Mukherjee, A., Banerjee, D., Gohaina, M., Singh, K.P., Singh, R., Datta, R.K., Goswami, S.L., 2011. Simplex and duplex PCR assays for species specific identification of cattle and buffalo milk and cheese. Food Control. 22, 690-696.
9
Dooley, J.J., Paine, K.E., Garrett, S.D., Brown, H.M., 2004. Detection of meat species using TaqMan real-time PCR assays. Meat Sci. 68, 431-438. Everstine, K., Spink, J., Kennedy, S., 2013. Economically motivated adulteration (EMA) of food: Common characteristics of EMA incidents. J. Food Protect. 76, 723-735. Ghovvati, S., Nassiri, M.R., Mirhoseini, S.Z., Heravi Moussavi, A., Javadmanesh, A., 2009. Fraud identification in industrial meat products by multiplex PCR assay. Food Control. 20, 696–699. Girish, P.S., Anjaneyulu, A.S.R., Viswas, K.N., Anand, M., Rajkumar, N., Shivakumar, B.M., Sharma, B., 2004. Sequence analysis of mitochondrial 12S rRNA gene can identify meat species. Meat Sci. 66, 551-556. Girish, P.S., Anjaneyulu, A.S.R., Viswas, K.N., Shivakumar, B.M., Anand, M., Patel, M., Sharma, B., 2005. Meat species identification by Polymerase chain reaction – restriction fragment length polymorphism (PCR-RFLP) of mitochondrial 12S rRNA gene. Meat Sci. 70, 107-112. Gokulakrishnan, P., Kumar, R.R., Sharma, B.D., Mendiratta, S.K., Sharma, D., 2012. A duplex PCR assay for sex determination of cattle meat by simultaneous amplification of SRY, AMELX and AMELY Genes. Food Biotechnol. 26, 75-84. Gupta, S.K., Bhagavatula, J., Thangaraj, K., Singh, L., 2011. Establishing the identity of the massacred tigress in a case of wildlife crime. Forensic Sci. Int.-Gen. 5, 74-75. Gupta, S.K., Verma, S.K., Singh, L., 2005. Molecular insight into a wildlife crime: the case of a peafowl slaughter. Forensic Sci. Int. 154, 214–217 Hellberg, R.S.R., Morrissey, M.T., 2011. Advances in DNA-based techniques for the detection of seafood species substitution on the commercial market. J. Lab. Autom. 16, 308-21. Ioannis, S.A., Nikolaos, E.T., 2005. Implementation of quality control methods in conjunction with chemometrics toward authentication of dairy products. Crit. Rev. Food Sci. Nutr. 45, 231–249. Ivanova, N.V., Clare, E.L., Borisenko, A.L., 2012. DNA Barcoding in Mammals In: W. John Kress and David L. Erickson (eds.), DNA Barcodes: Methods and Protocols, Methods in Molecular Biology, Springer Science+Business Media, LLC. 858, 154-181. Kane, D.E., Hellberg, R.S., 2016. Identification of species in ground meat products sold on the US commercial market using DNA-based methods. Food Control. 59, 158-163.
10
Khamlor,
T.,
Pongpiachan,
P.,
Parnpai,
R.,
Punyawai,
K.,
Sangsritavong,
S.,
Chokesajjawatee, N., 2015. Bovine embryo sex determination by multiplex loopmediated isothermal amplification. Theriogenology. 83, 891–896. Kocher, T.D., Thomas, W.K., Meyer, A., Edwards, S.V., Paabo, S., Villablanca, F.X., Wilson, A.C., 1989. Dynamics of mitochondrial DNA sequence evolution in animals. Proc. Nat. Acad. Sci. 86, 6196-6200. Mahajan, M.V., Gadekar, Y.P., Dighe, V.D., Kokane, R.D., Bannalikar, A.S., 2011. Molecular detection of meat animal species targeting MT 12S rRNA gene Meat Sci. 88, 23-27. Matsunaga, T., Chikuni, K., Tanabe, R., Muoya, S., Shibata, K., Yamada, J., Shinmura, Y.A., 1999. Quick and simple method for the identification of meat species and meat products by PCR assay. Meat Sci. 51, 143–148. National Commission on Cattle Report. 2002. Department of Animal Husbandry & Dairying. Ministry of Agriculture, Government of India. Nischella, S., Vaithiyanathan, S., Ashok, V., Kalyani, P., 2016. Detection of mutton and chevon by PCR assay using Cyt B gene primers. In: Proc of 7 th Indian meat science association (IMSA) conference held on November 10-12 at GADVASU, Ludhiana, India. pp 311. Quinto, C.A., Tinoco, R., Hellberg, R.S., 2016. DNA barcoding reveals mislabeling of game meat species on the U.S. commercial market. Food Control. 59, 386-392. Rahman, M.M., Ali, M.E., Hamid, S.B.A., Mustafa, S., Hashim, U., Hanapi, U.K., 2014. Polymerase chain reaction assay targeting cytochrome b gene for the detection of dog meat adulteration in meatball formulation. Meat Sci. 97, 404-409. Singh, V.P., and Neelam, S., 2011. Meat species specifications to ensure the quality of meatA review. Int. J. Meat Sci. 1 (1), 15-26. 2011. Unseld, M., Beyermann, B., Brandt, P., Hiesel, R., 1995. Identification of the species of origin of highly processed meat products by mitochondrial DNA sequences. PCR Meth. Appl. 4, 241-243. Vaithiyanathan, S., Kulkarni, V.V., 2016. Species identification of cattle and buffalo fat through PCR assay. J. Food Sci. Technol. 53, 2077–2082. Verma, S.K., Goswami, G.K,. 2014. DNA evidence: Current perspective and future challenges in India. Forensic Sci. Int. 2014, 241:183-189.
11
Woolfe, M., Primrose, S., 2003. Food forensics: using DNA technology to combat misdescription and fraud. Trends Biotechnol. 22, 222-226.
Fig. 1: Agarose gel electrophoresis picture of universal mitochondrial 12S r RNA gene amplification of DNA isolated from coded samples (PCR band size: 456bp). (89-104 represents coded samples analysed in MSIL; C and B represents positive cattle and buffalo DNA, NC: negative control).
Fig. 2: Agarose gel electrophoresis picture of mt D-loop duplex PCR amplification of DNA isolated from coded samples (PCR band size: 126bp for cattle and 226bp for buffalo). (89-104 represents coded samples analysed in MSIL; C and B represents positive cattle and buffalo DNA, NC: negative control). 12
Fig.
3a
Fig. 3b
Fig. 3a&3b: Agarose gel electrophoresis picture of RFLP pattern from 12S rRNA amplified products of DNA isolated from coded samples using Alu I and Hha I. (PCR band size: 359 & 97bp for cattle during Alu I digestion 247 & 209bp for buffalo during Hha I digestion). (89-104 represents coded samples analysed in MSIL; C and B represents positive cattle and buffalo DNA, UD: undigested control).
Fig. 4: Agarose gel electrophoresis picture of TS_4 & SAT-I gene PCR amplification of DNA isolated from coded samples (TS_4 amplification produced 300bp band only in male cattle and SAT-I produced bovine specific band size 538bp in both sexes). 13
(92, 93, 95, 100, 101, 102 represents coded samples analysed in MSIL; CF and CM represents positive cattle female and cattle male DNA, NC: negative control).
Fig. 5: Amplification of mitochondrial cyt b gene primer (dog specific) by the known and unknown samples (dog specific product size is 100bp). (L=DNA ladder; A83, A84 = DNA from the sample received by MSIL, C=cattle; B=buffalo; S=sheep, G=Goat, Ch=Chicken, P=Pork, D=dog, NC = negative control
Fig. 6: Amplification of mitochondrial cyt b duplex PCR (sheep and goat specific) by the known and unknown samples (sheep specific product size is 254bp and goat specific is 453bp). (L=DNA ladder; A109 = DNA from the sample received by MSIL, C=cattle; B=buffalo; S=sheep, G=Goat, NC = negative control).
14
Table 1: Details of sequence and product size of various primer pairs used by meat species identification laboratory (MSIL) to identify species origin of meat and meat products.
Primer
Composition 5’
3’
mt 12S
Forward-5′-CAACTGGGATTAGATACC CCACTAT-3′
rRNA
Reverse-5′-GAGGGTGACGGGCGGTGTGT-3’
mt D loop
TK_S4
Target species
Product size
Universal
456 bp
Forward-5’-ACTAGATCACGAGCT TGATCACCATGC-3′
Common
Reverse-5’-GTTATGTGTGAGCATGGGCTGATTGGA-3′
Buffalo
226 bp
Reverse-5’-ATGCCTGGTAAAATTCATTAAATAGCG -3′
Cattle
126 bp
Forward: 5’-CTCAGCAAAGCACACCAGAC-3’
Cattle male
300bp
Reverse: 5’-GAACTTTCAAGCAGCTGAGGC-3’ Sat1
Forward- 5’-TTTACCTTAGAACAAACCGAGGCAC-3’
only in male bovine-specific
Reverse- 5’-TACGGAAAGGAAAGATGACCTGACC-3’ mt Cyt b
Forward-5’-CCTTACTAGGAGTATGCTTG-3’
538bp in both sex
Dog specific
100bp
Forward-5’-TGGGTGACTGATGAAAAAG-3’
mt Cyt b
mt Cyt b
Forward- 5’- TATTGGCACAAACCTAGTCG -3’
Common
Reverse- 5’- TGAGGATGAGGATTAGTAGG -3’
Sheep
254bp
Reverse- 5’- GTGTGGAGGAAGGGTACAAG -3’
Goat
453bp
Forward: 5’- AGCTTTCATGGGCTACGTCC C-3’
Camel specific
435 bp
Reverse: 5’- TCCGGCTTGATATGTGGTGG -3’
15