- Email: [email protected]
Application of iPBS in high-throughput sequencing for the development of retrotransposon-based molecular markers
Current Plant Biology 1 (2014) 40–44
Contents lists available at ScienceDirect
Current Plant Biology journal homepage: www.elsevier.com/locate/cpb
Application of iPBS in high-throughput sequencing for the development of retrotransposon-based molecular markers Yuki Monden, Kentaro Yamaguchi, Makoto Tahara ∗ Graduate School of Environmental and Life Science, Okayama University, 1-1-1 Tsushimanaka Kitaku, Okayama, Okayama 700-8530, Japan
a r t i c l e
i n f o
Article history: Received 26 April 2014 Received in revised form 28 August 2014 Accepted 2 September 2014 Keywords: Retrotransposon Next-generation sequencing Polymorphism Molecular marker Strawberry
a b s t r a c t Retrotransposons are major components of higher plant genomes, and long terminal repeat (LTR) retrotransposons are especially predominant. Thus, numerous LTR retrotransposon families with high copy numbers exist in most plant genomes. As the integrated copies of these retrotransposons are genetically inherited, their insertion polymorphisms among crop cultivars have been used as functional molecular markers such as inter-retrotransposon amplification polymorphism (IRAP), retrotransposon microsatellite amplification polymorphism (REMAP), retrotransposon-based insertion polymorphism (RBIP) and sequence-specific amplification polymorphism (S-SAP). However, the effective use of these methods requires suitable LTR sequences showing high insertion polymorphism among crop cultivars. Recently, we conducted an efficient screening of LTR retrotransposon families that showed high insertion polymorphism among closely related strawberry cultivars using a next-generation sequencing platform. This method focuses on the primer binding site (PBS), which is adjacent to the 5 LTR sequence and is conserved among different LTR retrotransposon families. Construction of a sequencing library using the PBS motif allowed us to identify a large number of LTR sequences and their insertion sites throughout the genome. The LTR sequences identified by our method showed high insertion polymorphism among closely related strawberry cultivars, and these families should thus be useful in the development of molecular markers for phylogenetic and genetic diversity studies. This article briefly describes the general aspects of retrotransposon-based molecular markers and also outlines our method for screening LTR sequences suitable for genetic analyses. (http://www.ddbj.nig.ac.jp/). © 2014 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/3.0/).
1. Introduction Retrotransposons are a type of transposable element (TE) consisting of mobile DNA sequences within eukaryotic genomes [1–3]. In higher plant genomes, retrotransposons are major components [1,4]. For example, over 75% of the maize genome is derived from retrotransposon sequences, and long terminal repeat (LTR) retrotransposons are especially predominant [5]. LTR retrotransposons contain LTR sequences at both ends and are divided into Ty1-copia and Ty3-gypsy classes based on the structures of their protein-coding domains, which contain capsid protein (CP), protease (PR), integrase (INT), reverse transcriptase (RT) and RNaseH [1,2,6]. In addition, several nonautonomous elements have
∗ Corresponding author. Tel.: +81 86 251 8312; fax: +81 86 251 8388. E-mail addresses: y [email protected] (Y. Monden), [email protected] (K. Yamaguchi), [email protected], [email protected] (M. Tahara).
been characterized, including terminal repeat retrotransposons in miniature (TRIMs) and large retrotransposon derivatives (LARDs) [7–9]. These elements amplify their copy numbers using a “copy and paste” mechanism involving the reverse transcription and integration of cDNA fragments, which leads to the substantial accumulation of retrotransposon families with high copy numbers within the genome [1,4]. 2. Retrotransposon-based molecular markers Several molecular markers based on retrotransposon insertion polymorphisms (IRAP, REMAP, S-SAP and RBIP) have previously been developed [10–21]. The multiple insertion sites of retrotransposons are distributed throughout the entire genome and are genetically inherited without excision, which makes insertion polymorphisms highly useful as molecular markers [22–24] (Fig. 1). The IRAP method amplifies the genomic regions between two different LTR sequences using PCR primers that are specific to the LTR sequences [9,12,16,19,21], whereas the REMAP method
http://dx.doi.org/10.1016/j.cpb.2014.09.001 2214-6628/© 2014 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/3.0/).
Y. Monden et al. / Current Plant Biology 1 (2014) 40–44
41
Fig. 3. Conserved region among LTR retrotransposon families. The PBS is adjacent to the 5 LTR sequence. Reverse transcription of LTR retrotransposons is initiated by the binding of tRNA to the PBS region. Thus, while LTR sequences differ among different LTR retrotransposon families, the PBS sequence is highly conserved. Fig. 1. Retrotransposon insertion polymorphism between strawberry cultivars. Numerous retrotransposon families exist in the nuclear genome, and their insertion sites are distributed throughout the genome. Several of these insertion sites (indicated by circles) differ among modern crop cultivars.
amplifies the regions between LTR sequences and simple sequence repeats (SSRs) using LTR-specific and SSR-specific primer combinations [9,12,13,21] (Fig. 2(a) and (b)). The S-SAP method detects insertion polymorphisms by amplifying the DNA fragments from LTR sequences to the nearest restriction enzyme cutting sites, following a procedure of restriction enzyme digestion, adapter ligation to the digested DNA fragment and PCR amplification with LTR-specific and adapter-specific primer sets [10,14,15,17,18,20] (Fig. 2(c)). These methods can visualize multiple and polymorphic DNA fragments through a single reaction using agarose/acrylamide electrophoresis. In contrast, the RBIP method targets one insertion site and detects polymorphism based on the presence/absence of this insertion [11]. PCR amplification is performed using LTR-specific and flanking region-specific primer sets to provide codominant markers [11] (Fig. 2(d)). These retrotransposon-based molecular markers have been widely applied in phylogenetic and genetic diversity analyses [22–24]. However, the availability of these methods depends largely on the presence of suitable LTR sequences. iPBS, developed by Kalendar et al. (2010), is a method for identifying diverse LTR sequences and directly visualizing their
polymorphism among cultivars [25]. This method focuses on the PBS region, which is adjacent to the 5 LTR and is conserved among different LTR retrotransposon families [25] (Fig. 3). Because tRNA binds to the PBS region to initiate reverse transcription, the PBS sequence is complementary to the 3 terminal sequence of tRNA and is conserved across nearly all LTR retrotransposon families, with several exceptions [26–29]. Thus, designing PCR primers at this region produces DNA fragments that contain diverse LTR sequences, including nonautonomous elements such as TRIMs and LARDs that lack protein-coding regions [25] (Fig. 4). Earlier methods for cloning LTR sequences relied on conserved proteincoding domain, such as reverse transcriptase and integrase, and required genomic walking to the LTRs, which limited the screening of autonomous elements. Therefore, the iPBS method has several advantages for screening diverse LTR sequences and conducting DNA fingerprinting [25]. Additionally, next-generation sequencing technologies have accelerated genetic and genomic studies in recent years by allowing larger volumes of sequence data to be acquired in shorter times and with lower costs. Thus, the combination of the iPBS method with a high-throughput sequencing platform was hypothesized to be capable of screening a large number of LTR retrotransposon families on a genome-wide scale.
Fig. 2. Retrotransposon-based molecular markers. (a) Inter-retrotransposon amplification polymorphism (IRAP). IRAP amplifies the intervening region between two LTR sequences. (b) Retrotransposon microsatellite amplification polymorphism (REMAP). The DNA fragment between an LTR sequence and an SSR motif is amplified. (c) Sequencespecific amplification polymorphism (S-SAP). Genomic DNAs are digested by a restriction enzyme, and adapters are ligated to the digested DNA fragments. PCR amplification is performed with LTR-specific and adapter-specific primer sets. (d) Retrotransposon-based insertion polymorphism (RBIP). RBIP targets one retrotransposon insertion site in the presence/absence allelic states. To detect the presence of the LTR retrotransposon insertion, primers specific to the flanking regions of the insertion site are used with an LTR-specific primer. In contrast, primers specific to the flanking regions are used for the empty site. The arrows represent PCR primer, and the dotted lines represent the amplified region. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
42
Y. Monden et al. / Current Plant Biology 1 (2014) 40–44
Fig. 4. The procedure of our method. (a) Output of paired-end sequencing. One set of reads, from the PBS-specific primer (PBS reads), contain diverse LTR sequences, while the other set of reads, from the adapter-specific primer (non-PBS reads), contain insertion site sequences. Thus, the non-PBS reads of several cultivars were mapped to the reference genome to identify the insertion sites of LTR sequences. (b) Comparison of mapped sites among several cultivars. Cultivar-specific sites were extracted from these sites, as this type of insertion was hypothesized to have occurred quite recently. Pooling and clustering analyses were conducted using PBS reads corresponding to the cultivar-specific sites, which led to the candidate LTR sequences. (c) Experimental confirmation of insertion polymorphism by the S-SAP method. The S-SAP method visualized DNA fragments by specifically amplifying the insertion sites for the identified LTR sequences.
3. High-throughput sequencing for screening LTR sequences showing high insertion polymorphism In our research, we employed an Illumina HiSeq 2000 sequencing platform; this platform is widely used and can produce huge amounts of sequencing data. We constructed a sequencing library through PCR amplification using PBS-specific primers with a multiplex barcoding system for eight strawberry cultivars (Fig. 4(a)) [30]. The procedure of our method was briefly described. At first, genomic DNA from eight cultivars was fragmented using g-TUBE (Covaris). These fragmented DNA samples were end repaired, modified to add 3 A overhangs and ligated to the forked adapters. The forked adapters were prepared by annealing two DNA oligomers: one of the Forked Type1-4 and Forked Com (Table 1). We designed PBS-specific primers based on the two types of PBS sequences that matched part of the sequence of the iMET and Asp tRNA genes (indicated as Fr Mal iMET * and Fr Mal Asp * in Table 1). These PBS-specific (iMET and Asp) primers contained 7–8 nt barcode sequence for multiplexing (Table 1). We performed primary PCR with adapter-specific (AP2 Type*) and PBS-specific (Fr Mal iMET *
and Fr Mal Asp *) primer combinations using the ligated products as the template. Then, secondary PCR was performed with adapter-specific (AP3 Type*) and PBS-specific (Fr Mal iMET * and Fr Mal Asp *) primer combinations using the initial PCR products as the template. The PCR cycling program consisted of an initial denaturation at 94 ◦ C for 4 min, 30 cycles of 94 ◦ C for 30 s, 80 ◦ C for 30 s, 58 ◦ C for 30 s and 72 ◦ C for 60 s and a final extension at 72 ◦ C for 15 min. These PCR products were size-selected (300–500 bp) on agarose gels and purified with QIAquick Gel Extraction Kit (QIAGEN). Finally, these libraries were pooled into one sequencing sample. Paired-end reads of 101 bp were generated on an Illumina HiSeq 2000 platform. In this library, the set of reads amplified from the PBS-specific primer (designated as PBS-reads) should represent the LTR sequences, whereas the set of reads from the adapter-specific primer (designated as non-PBS reads) should contain insertion site sequences (Fig. 4(a)). After filtering those reads based on the primer sequence of the cultivar barcode and PBS with the Q scores of all base calls being ≥30, the non-PBS reads were mapped to the Fragaria vesca reference genome [31] to identify the insertion sites of these LTR sequences for each cultivar (Fig. 4(b)).
Y. Monden et al. / Current Plant Biology 1 (2014) 40–44 Table 1 Sequences of the adapters and primers used in our method. Primer name
Sequence (5 →3 )
Forked Type1 Forked Type2 Forked Type3 Forked Type4 Forked Com AP2 Type1 AP2 Type2 AP2 Type3 AP2 Type4 AP3 Type1 AP3 Type2 AP3 Type3 AP3 Type4 Fr Mal iMET 1 Fr Mal iMET 2 Fr Mal iMET 3 Fr Mal iMET 4 Fr Mal iMET 5 Fr Mal iMET 6 Fr Mal iMET 7 Fr Mal iMET 8 Fr Mal Asp 1 Fr Mal Asp 2 Fr Mal Asp 3 Fr Mal Asp 4 Fr Mal Asp 5 Fr Mal Asp 6 Fr Mal Asp 7 Fr Mal Asp 8
AATAGGGCTCGAGCGGCAGCTATTAATAGTACT AATAGGGCAGCTGCGGCAGCTATTAATAGTACT AATAGGGCGATGGCGGCAGCTATTAATAGTACT AATAGGGCCTACGCGGCAGCTATTAATAGTACT GTACTATTAATAGCATCTTCGTTCGTCGAT AATAGGGCTCGAGCGGC AATAGGGCAGCTGCGGC AATAGGGCGATGGCGGC AATAGGGCCTACGCGGC TCGAGCGGCAGCTATTAATAGTACT AGCTGCGGCAGCTATTAATAGTACT GATGGCGGCAGCTATTAATAGTACT CTACGCGGCAGCTATTAATAGTACT AGACTGCNNGCTCTGATACCA ATGATCGCNNGCTCTGATACCA CGTCCAANNGCTCTGATACCA CTTGACCNNGCTCTGATACCA GACTAGTCNNGCTCTGATACCA GAGTGTGNNGCTCTGATACCA TCAGCTAGNNGCTCTGATACCA TCCAGATGNNGCTCTGATACCA AGACTGCAGACGGCGCCA ATGATCGAGACGGCGCCA CGTCCAAAGACGGCGCCA CTTGACCAGACGGCGCCA GACTAGTAGACGGCGCCA GAGTGTGAGACGGCGCCA TCAGCTAAGACGGCGCCA TCCAGATAGACGGCGCCA
Out of these mapped sites, we extracted uniquely mapped loci for the non-PBS reads. Because the lengths of the LTR sequences varied from a few hundred to over a thousand bases, several of the non-PBS reads may have contained LTR sequences, but these reads could be mapped to the reference genome at multiple loci. After comparing the uniquely mapped loci among several cultivars, we focused on the cultivar specific insertion loci which were detected only in one cultivar, but not in the others (Fig. 4(b)). These insertion sites were considered to have occurred relatively recently, presumably after cultivar divergence. Thus, we pooled these insertion sites and extracted the corresponding PBS reads which represented LTR sequences (Fig. 4(b)). By clustering these extracted PBS reads, we obtained 24 candidate LTR sequences that contained more than two reliable cultivar specific insertion sites. In contrast, we identified a total of 20,918 LTR retrotransposon family candidates by clustering all PBS reads in this study [unpublished data]. This number may represent the majority of LTR retrotransposon families present in the strawberry genome, because we selected the two most frequently used tRNA sequences (iMET and Asp) to construct the sequencing library. Finally, the insertion polymorphism in these identified LTR sequences was experimentally investigated by SSAP analysis, indicating high insertion polymorphism even among Japanese strawberry cultivars known to be closely related genetically (Fig. 4(c)). Thus, these LTR sequences should be useful for the development of retrotransposon-based molecular markers. 4. Concluding remarks Due to the prevalence and progress of high-throughput sequencing technologies, a number of methods and techniques for sequence analysis have been developed, including genome-wide association studies (GWAS), restriction-site associated DNA (RAD) sequencing and MutMap [32–40]. High-throughput sequencing platforms and multiplex barcoding systems allow us to investigate a large number of genomic loci, including retrotransposon insertion sites, for multiple samples in a single sequencing run [41–46]. For example, our research showed that 76,912 genotypic
43
data points (2024 retrotransposon insertion loci for 38 cultivars) were obtained in one Illumina MiSeq sequencing run for sweet potato (Ipomoea batatas) [47]. We constructed a MiSeq sequencing library through the PCR amplification of the insertion loci of target retrotransposon families, namely Rtsp-1 [48] and LIb [49]. Because these insertion loci were highly polymorphic among cultivars, we acquired a number of molecular markers for cultivar screening and also revealed the genetic relationships among the cultivars without using the reference genome. In addition, our recent research has indicated that retrotransposon insertion sites are quite suitable for linkage map construction aimed at the isolation of agronomically important genes in outcrossing polyploid plant species [unpublished results]. Thus, the targeted sequencing of these polymorphic retrotransposon insertion sites is highly effective for extensive DNA genotyping and marker development. However, retrotransposon families that show little insertion polymorphism among crop cultivars are obviously impractical for these genetic analyses. Although retrotransposon-based molecular markers techniques such as IRAP, REMAP and S-SAP have previously been applied for a number of genetic analyses, these methods are limited by their need for suitable LTR sequences and ability to detect, at most, several dozen sites through agarose/acrylamide electrophoresis. Thus, we believe that our method for screening LTR sequences with high insertion polymorphism and conducting extensive genotyping based on these insertion polymorphisms via high-throughput sequencing platforms should accelerate the genetic analyses such as phylogenetic and genetic diversity studies and promote plant breeding through the map-based cloning of genes in a wide range of plant species. Acknowledgements We thank Nobuyuki Fujii and Kazuho Ikeo of the National Institute of Genetics for their support of the data analyses, as well as Yoshiko Nakazawa and Takamitsu Waki of the Tochigi Prefectural Agricultural Experiment Station and Keita Hirashima and Yosuke Uchimura of the Fukuoka Agricultural Research Center for their assistance in the S-SAP experiment. This work was supported by a Research and Development Projects for Application in Promoting New Policy of Agriculture, Forestry and Fisheries grant from the Ministry of Agriculture, Forestry and Fisheries of Japan, as well as by funding from the Program to Disseminate Tenure Tracking System of the Ministry of Education, Culture, Sports, Science and Technology (MEXT), Japan (to Y.M.). References [1] A. Kumar, J.L. Bennetzen, Plant retrotransposons, Annu. Rev. Genet. 33 (1999) 479–532, http://dx.doi.org/10.1146/annurev.genet.33.1.479. [2] C. Feschotte, N. Jiang, S.R. Wessler, Plant transposable elements: where genetics meets genomics, Nat. Rev. Genet. 3 (2002) 329–341, http://dx.doi.org/10.1038/ nrg793. [3] S.R. Wessler, Transposable elements and the evolution of eukaryotic genomes, Proc. Natl. Acad. Sci. U. S. A. 103 (2006) 17600–17601, http://dx.doi.org/10. 1073/pnas.0607612103. [4] M. Bento, D. Tomas, W. Viegas, M. Silva, Retrotransposons represent the most labile fraction for genomic rearrangements in polyploid plant species, Cytogenet. Genome Res. 140 (2013) 286–294, http://dx.doi.org/10.1159/ 000353308. [5] P.S. Schnable, D. Ware, R.S. Fulton, J.C. Stein, F. Wei, S. Pasternak, C. Liang, J. Zhang, L. Fulton, T.A. Graves, et al., The B73 maize genome: complexity, diversity, and dynamics, Science 326 (2009) 1112–1115, http://dx.doi.org/10.1126/ science.1178534. [6] E.R. Havecker, X. Gao, D.F. Voytas, The diversity of LTR retrotransposons, Genome Biol. 5 (2004) 225, http://dx.doi.org/10.1186/gb-2004-5-6-225. [7] C. Witte, Q.H. Le, T. Bureau, A. Kumar, Terminal-repeat retrotransposons in miniature (TRIM) are involved in restructuring plant genomes, Proc. Natl. Acad. Sci. U. S. A. 98 (2001) 13778–13783, http://dx.doi.org/10.1073/ pnas.241341898. [8] R. Kalendar, C.M. Vicient, O. Peleg, K. Anamthawat-Jonsson, A. Bolshoy, A.H. Schulman, Large retrotransposon derivatives: abundant, conserved but nonautonomous retroelements of barley and related genomes, Genetics 166 (2004) 1437–1450, http://dx.doi.org/10.1534/genetics.166.3.1437.
44
Y. Monden et al. / Current Plant Biology 1 (2014) 40–44
[9] K. Antonius-Klemola, R. Kalendar, A.H. Schulman, TRIM retrotransposons occur in apple and are polymorphic between varieties but not sports, Theor. Appl. Genet. 112 (2006) 999–1008, http://dx.doi.org/10.1007/s00122-005-0203-0. [10] R. Waugh, K. McLean, A.J. Flavell, S.R. Pearce, A. Kumar, B.B. Thomas, W. Powell, Genetic distribution of Bare-1-like retrotransposable elements in the barley genome revealed by sequence-specific amplification polymorphisms (S-SAP), Mol. Gen. Genet. 253 (1997) 687–694 http://www.ncbi.nlm. nih.gov/pubmed/9079879 [11] A.J. Flavell, M.R. Knox, S.R. Pearce, T.H. Ellis, Retrotransposon-based insertion polymorphisms (RBIP) for high throughput marker analysis, Plant J. 16 (1998) 643–650 http://www.ncbi.nlm.nih.gov/pubmed/10036780 [12] R. Kalendar, T. Grob, M. Regina, A. Suoniemi, A. Schulman, IRAP and REMAP: two new retrotransposon-based DNA fingerprinting techniques, Theor. Appl. Genet. 98 (1998) 704–711, http://dx.doi.org/10.1007/s001220051124. [13] R. Kalendar, J. Tanskanen, S. Immonen, E. Nevo, A.H. Schulman, Genome evolution of wild barley (Hordeum spontaneum) by BARE-1 retrotransposon dynamics in response to sharp microclimatic divergence, Proc. Natl. Acad. Sci. U. S. A. 97 (2000) 6603–6607, http://dx.doi.org/10.1073/pnas.110587497. [14] N.H. Syed, S. Sureshsundar, M.J. Wilkinson, B.S. Bhau, J.J.V. Cavalcanti, A.J. Flavell, Ty1-copia retrotransposon-based SSAP marker development in cashew (Anacardium occidentale L.), Theor. Appl. Genet. 110 (2005) 1195–1202, http://dx.doi.org/10.1007/s00122-005-1948-1. [15] Q. Lou, J. Chen, Ty1-copia retrotransposon-based SSAP marker development and its potential in the genetic study of cucurbits, Genome 810 (2007) 802–810, http://dx.doi.org/10.1139/G07-067. [16] A. Belyayev, R. Kalendar, L. Brodsky, E. Nevo, A. Schulman, O. Raskina, Transposable elements in a marginal plant population: temporal fluctuations provide new insights into genome evolution of wild diploid wheat, Mob. DNA 1 (2010) 1–6, http://dx.doi.org/10.1186/1759-8753-1-6. [17] M. Petit, C. Guidat, J. Daniel, E. Denis, E. Montoriol, Q.T. Bui, K.Y. Lim, A. Kovarik, A.R. Leitch, M. Grandbastien, et al., Mobilization of retrotransposons in synthetic allotetraploid tobacco, N. Phytol. 186 (2010) 135–147, http://dx.doi.org/10.1111/j.1469-8137.2009.03140.x. [18] F.A. Konovalov, N.P. Goncharov, S. Goryunova, A. Shaturova, T. Proshlyakova, A. Kudryavtsev, Molecular markers based on LTR retrotransposons BARE1 and Jeli uncover different strata of evolutionary relationships in diploid wheats, Mol. Genet. Genomics 283 (2010) 551–553, http://dx.doi.org/10. 1007/s00438-010-0539-2. ´ N. Baˇcová-Kerteszová, R. Kalendar, J. Corander, A.H. Schulman, M. [19] P. Smykal, Pavelek, Genetic diversity of cultivated flax (Linum usitatissimum L.) germplasm assessed by retrotransposon-based markers, Theor. Appl. Genet. 122 (2011) 1385–1397, http://dx.doi.org/10.1007/s00122-011-1539-2. [20] N.V. Melnikova, A.V. Kudryavtseva, A.S. Speranskaya, A.A. Krinitsina, A.A. Dmitriev, M.S. Belenikin, V.P. Upelniek, E.R. Batrak, I.S. Kovaleva, A.M. Kudryavtsev, The FaRE1 LTR-retrotransposon based SSAP markers reveal genetic polymorphism of strawberry (Fragaria x ananassa) cultivars, J. Agric. Sci. 4 (2012) 111–118, http://dx.doi.org/10.5539/jas.v4n11p111. [21] S. Nasri, B. Abdollahi Mandoulakani, R. Darvishzadeh, I. Bernousi, Retrotransposon insertional polymorphism in Iranian bread wheat cultivars and breeding lines revealed by IRAP and REMAP markers, Biochem. Genet. 51 (2013) 927–943, http://dx.doi.org/10.1007/s10528-013-9618-5. [22] A. Kumar, H. Hirochika, Applications of retrotransposons as genetic tools in plant biology, Trends Plant Sci. 6 (2001) 127–134 http://www.ncbi.nlm.nih. gov/pubmed/11239612 [23] A.H. Schulman, A.H. Flavell, T.H.N. Ellis, The application of LTR retrotransposons as molecular markers in plants, Methods Mol. Biol. 260 (2004) 145–173, http://dx.doi.org/10.1385/1-59259-755-6.145. [24] P. Poczai, I. Varga, M. Laos, A. Cseh, N. Bell, J.P. Valkonen, J. Hyvönen, Advances in plant gene-targeted and functional markers: a review, Plant Methods 9 (2013) 6, http://dx.doi.org/10.1186/1746-4811-9-6. ´ [25] R. Kalendar, K. Antonius, P. Smykal, A.H. Schulman, iPBS: a universal method for DNA fingerprinting and retrotransposon isolation, Theor. Appl. Genet. 121 (2010) 1419–1430, http://dx.doi.org/10.1007/s00122-010-1398-2. [26] R. Marquet, C. Isel, C. Ehresmann, B. Ehresmann, tRNAs as primer of reverse transcriptases, Biochimie 77 (1995) 113–124 http://www.ncbi.nlm.nih.gov/ pubmed/7541250 [27] J. Mak, L. Kleiman, Primer tRNAs for reverse transcription, J. Virol. 71 (1997) 8087–8095. [28] N.J. Kelly, M.T. Palmer, C.D. Morrow, Selection of retroviral reverse transcription primer is coordinated with tRNA biogenesis, J. Virol. 77 (2003) 8695–8701, http://dx.doi.org/10.1128/jvi.77.16.8695. [29] A. Hizi, The reverse transcriptase of the Tf1 retrotransposon has a specific novel activity for generating the RNA self-primer that is functional in cDNA synthesis, J. Virol. 82 (2008) 10906–10910, http://dx.doi.org/10.1128/jvi.0137008.
[30] Y. Monden, N. Fujii, K. Yamaguchi, K. Ikeo, Y. Nakazawa, T. Waki, K. Hirashima, Y. Uchimura, M. Tahara, Efficient screening of the long terminal repeat (LTR) retrotransposons that show high insertion polymorphism via highthroughput sequencing of the primer binding site, Genome 57 (2014) 1–8, http://dx.doi.org/10.1139/gen-2014-0031. [31] Fragaria vesca Genome v1.1 Assembly. http://www.rosaceae.org/projects/ strawberry genome/v1.1/assembly [32] X. Huang, X. Wei, T. Sang, Q. Zhao, Q. Feng, Y. Zhao, C. Li, C. Zhu, T. Lu, Z. Zhang, et al., Genome-wide association studies of 14 agronomic traits in rice landraces, Nat. Genet. 42 (2010) 961–967, http://dx.doi.org/10.1038/ng.695. [33] S.W. Baxter, J.W. Davey, J.S. Johnston, A.M. Shelton, D.G. Heckel, C.D. Jiggins, M.L. Blaxter, Linkage mapping and comparative genomics using next-generation RAD sequencing of a non-model organism, PLoS ONE 6 (2011) e19315, http://dx.doi.org/10.1371/journal.pone.0019315. [34] R.L. Elshire, J.C. Glaubitz, Q. Sun, J.A. Poland, K. Kawamoto, E.S. Buckler, S.E. Mitchell, A robust, simple genotyping-by-sequencing (GBS) approach for high diversity species, PLoS ONE 6 (2011) e19379, http://dx.doi.org/10.1371/ journal.pone.0019379. [35] F. Tian, P.J. Bradbury, P.J. Brown, H. Hung, Q. Sun, S. Flint-Garcia, T.R. Rocheford, M.D. McMullen, J.B. Holland, E.S. Buckler, Genome-wide association study of leaf architecture in the maize nested association mapping population, Nat. Genet. 43 (2011) 6–11, http://dx.doi.org/10.1038/ng.746. [36] A. Abe, S. Kosugi, K. Yoshida, S. Natsume, H. Takagi, H. Kanzaki, H. Matsumura, K. Yoshida, C. Mitsuoka, M. Tamiru, et al., Genome sequencing reveals agronomically important loci in rice using MutMap, Nat. Biotechnol. 30 (2012) 174–178, http://dx.doi.org/10.1038/nbt.2095. [37] A.L. Harper, M. Trick, J. Higgins, F. Fraser, L. Clissold, R. Wells, C. Hattori, P. Werner, I. Bancroft, Associative transcriptomics of traits in the polyploid crop species Brassica napus, Nat. Biotechnol. 30 (2012) 798–802, http://dx.doi. org/10.1038/nbt.2302. [38] R. Fekih, H. Takagi, M. Tamiru, A. Abe, S. Natsume, H. Yaegashi, S. Sharma, H. Kanzaki, H. Matsumura, H. Saitoh, et al., MutMap+: genetic mapping and mutant identification without crossing in rice, PLoS ONE 8 (2013) e68529, http://dx.doi.org/10.1371/journal.pone.0068529. [39] D.T. Morishige, P.E. Klein, J.L. Hilley, S.M.E. Sahraeian, A. Sharma, J.E. Mullet, Digital genotyping of sorghum – a diverse plant species with a large repeat-rich genome, BMC Genomics 14 (2013) 448, http://dx.doi.org/10.1186/ 1471-2164-14-448. [40] H. Takagi, A. Uemura, H. Yaegashi, M. Tamiru, A. Abe, C. Mitsuoka, H. Utsushi, S. Natsume, H. Kanzaki, H. Matsumura, et al., Methods MutMap-Gap: wholegenome resequencing of mutant F2 progeny bulk combined with de novo assembly of gap regions identifies the rice blast resistance gene Pii, N. Phytol. 200 (2013) 276–283, http://dx.doi.org/10.1111/nph.12369. [41] R.C. Iskow, M.T. McCabe, R.E. Mills, S. Torene, W.S. Pittard, A.F. Neuwald, E.G. Van Meir, P.M. Vertino, S.E. Devine, Natural mutagenesis of human genomes by endogenous retrotransposons, Cell 141 (2010) 1253–1261, http://dx.doi.org/10.1016/j.cell.2010.05.020. [42] A.D. Ewing, H.H. Kazazian, Whole-genome resequencing allows detection of many rare LINE-1 insertion alleles in humans, Genome Res. 21 (2011) 985–990, http://dx.doi.org/10.1101/gr.114777.110. [43] F. Hormozdiari, C. Alkan, M. Ventura, I. Hajirasouliha, M. Malig, F. Hach, D. Yorukoglu, P. Dao, M. Bakhshi, S.C. Sahinalp, et al., Alu repeat discovery and characterization within human genomes, Genome Res. 21 (2011) 840–849, http://dx.doi.org/10.1101/gr.115956.110. ´ [44] D.F. Urbanski, A. Małolepszy, J. Stougaard, S.U. Andersen, Genome-wide LORE1 retrotransposon mutagenesis and high-throughput insertion detection in Lotus japonicas, Plant J. 69 (2012) 731–741, http://dx.doi.org/10.1111/ j.1365-313X.2011.04827.x. [45] M. David, H. Mustafa, M. Brudno, Detecting Alu insertions from highthroughput sequencing data, Nucleic Acids Res. 41 (2013) e169, http://dx.doi. org/10.1093/nar/gkt612. [46] J. Xing, D.J. Witherspoon, L.B. Jorde, Mobile element biology: new possibilities with high-throughput sequencing, Trends Genet. 29 (2013) 280–289, http://dx.doi.org/10.1016/j.tig.2012.12.002. [47] Y. Monden, A. Yamamoto, A. Shindo, M. Tahara, Efficient DNA fingerprinting based on the targeted sequencing of active retrotransposon insertion sites using a bench-top high-throughput sequencing platform, DNA Res. (2014), http://dx.doi.org/10.1093/dnares/dsu015. [48] M. Tahara, T. Aoki, S. Suzuka, H. Yamashita, M. Tanaka, S. Matsunaga, S. Kokumai, Isolation of an active element from a high-copy-number family of retrotransposons in the sweetpotato genome, Mol. Genet. Genomics 272 (2004) 116–127, http://dx.doi.org/10.1007/s00438-004-1044-2. [49] H. Yamashita, M. Tahara, A LINE-type retrotransposon active in meristem stem cells causes heritable transpositions in the sweetpotato genome, Plant Mol. Biol. 61 (2006) 79–94, http://dx.doi.org/10.1007/s11103-005-6002-9.
Contents lists available at ScienceDirect
Current Plant Biology journal homepage: www.elsevier.com/locate/cpb
Application of iPBS in high-throughput sequencing for the development of retrotransposon-based molecular markers Yuki Monden, Kentaro Yamaguchi, Makoto Tahara ∗ Graduate School of Environmental and Life Science, Okayama University, 1-1-1 Tsushimanaka Kitaku, Okayama, Okayama 700-8530, Japan
a r t i c l e
i n f o
Article history: Received 26 April 2014 Received in revised form 28 August 2014 Accepted 2 September 2014 Keywords: Retrotransposon Next-generation sequencing Polymorphism Molecular marker Strawberry
a b s t r a c t Retrotransposons are major components of higher plant genomes, and long terminal repeat (LTR) retrotransposons are especially predominant. Thus, numerous LTR retrotransposon families with high copy numbers exist in most plant genomes. As the integrated copies of these retrotransposons are genetically inherited, their insertion polymorphisms among crop cultivars have been used as functional molecular markers such as inter-retrotransposon amplification polymorphism (IRAP), retrotransposon microsatellite amplification polymorphism (REMAP), retrotransposon-based insertion polymorphism (RBIP) and sequence-specific amplification polymorphism (S-SAP). However, the effective use of these methods requires suitable LTR sequences showing high insertion polymorphism among crop cultivars. Recently, we conducted an efficient screening of LTR retrotransposon families that showed high insertion polymorphism among closely related strawberry cultivars using a next-generation sequencing platform. This method focuses on the primer binding site (PBS), which is adjacent to the 5 LTR sequence and is conserved among different LTR retrotransposon families. Construction of a sequencing library using the PBS motif allowed us to identify a large number of LTR sequences and their insertion sites throughout the genome. The LTR sequences identified by our method showed high insertion polymorphism among closely related strawberry cultivars, and these families should thus be useful in the development of molecular markers for phylogenetic and genetic diversity studies. This article briefly describes the general aspects of retrotransposon-based molecular markers and also outlines our method for screening LTR sequences suitable for genetic analyses. (http://www.ddbj.nig.ac.jp/). © 2014 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/3.0/).
1. Introduction Retrotransposons are a type of transposable element (TE) consisting of mobile DNA sequences within eukaryotic genomes [1–3]. In higher plant genomes, retrotransposons are major components [1,4]. For example, over 75% of the maize genome is derived from retrotransposon sequences, and long terminal repeat (LTR) retrotransposons are especially predominant [5]. LTR retrotransposons contain LTR sequences at both ends and are divided into Ty1-copia and Ty3-gypsy classes based on the structures of their protein-coding domains, which contain capsid protein (CP), protease (PR), integrase (INT), reverse transcriptase (RT) and RNaseH [1,2,6]. In addition, several nonautonomous elements have
∗ Corresponding author. Tel.: +81 86 251 8312; fax: +81 86 251 8388. E-mail addresses: y [email protected] (Y. Monden), [email protected] (K. Yamaguchi), [email protected], [email protected] (M. Tahara).
been characterized, including terminal repeat retrotransposons in miniature (TRIMs) and large retrotransposon derivatives (LARDs) [7–9]. These elements amplify their copy numbers using a “copy and paste” mechanism involving the reverse transcription and integration of cDNA fragments, which leads to the substantial accumulation of retrotransposon families with high copy numbers within the genome [1,4]. 2. Retrotransposon-based molecular markers Several molecular markers based on retrotransposon insertion polymorphisms (IRAP, REMAP, S-SAP and RBIP) have previously been developed [10–21]. The multiple insertion sites of retrotransposons are distributed throughout the entire genome and are genetically inherited without excision, which makes insertion polymorphisms highly useful as molecular markers [22–24] (Fig. 1). The IRAP method amplifies the genomic regions between two different LTR sequences using PCR primers that are specific to the LTR sequences [9,12,16,19,21], whereas the REMAP method
http://dx.doi.org/10.1016/j.cpb.2014.09.001 2214-6628/© 2014 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/3.0/).
Y. Monden et al. / Current Plant Biology 1 (2014) 40–44
41
Fig. 3. Conserved region among LTR retrotransposon families. The PBS is adjacent to the 5 LTR sequence. Reverse transcription of LTR retrotransposons is initiated by the binding of tRNA to the PBS region. Thus, while LTR sequences differ among different LTR retrotransposon families, the PBS sequence is highly conserved. Fig. 1. Retrotransposon insertion polymorphism between strawberry cultivars. Numerous retrotransposon families exist in the nuclear genome, and their insertion sites are distributed throughout the genome. Several of these insertion sites (indicated by circles) differ among modern crop cultivars.
amplifies the regions between LTR sequences and simple sequence repeats (SSRs) using LTR-specific and SSR-specific primer combinations [9,12,13,21] (Fig. 2(a) and (b)). The S-SAP method detects insertion polymorphisms by amplifying the DNA fragments from LTR sequences to the nearest restriction enzyme cutting sites, following a procedure of restriction enzyme digestion, adapter ligation to the digested DNA fragment and PCR amplification with LTR-specific and adapter-specific primer sets [10,14,15,17,18,20] (Fig. 2(c)). These methods can visualize multiple and polymorphic DNA fragments through a single reaction using agarose/acrylamide electrophoresis. In contrast, the RBIP method targets one insertion site and detects polymorphism based on the presence/absence of this insertion [11]. PCR amplification is performed using LTR-specific and flanking region-specific primer sets to provide codominant markers [11] (Fig. 2(d)). These retrotransposon-based molecular markers have been widely applied in phylogenetic and genetic diversity analyses [22–24]. However, the availability of these methods depends largely on the presence of suitable LTR sequences. iPBS, developed by Kalendar et al. (2010), is a method for identifying diverse LTR sequences and directly visualizing their
polymorphism among cultivars [25]. This method focuses on the PBS region, which is adjacent to the 5 LTR and is conserved among different LTR retrotransposon families [25] (Fig. 3). Because tRNA binds to the PBS region to initiate reverse transcription, the PBS sequence is complementary to the 3 terminal sequence of tRNA and is conserved across nearly all LTR retrotransposon families, with several exceptions [26–29]. Thus, designing PCR primers at this region produces DNA fragments that contain diverse LTR sequences, including nonautonomous elements such as TRIMs and LARDs that lack protein-coding regions [25] (Fig. 4). Earlier methods for cloning LTR sequences relied on conserved proteincoding domain, such as reverse transcriptase and integrase, and required genomic walking to the LTRs, which limited the screening of autonomous elements. Therefore, the iPBS method has several advantages for screening diverse LTR sequences and conducting DNA fingerprinting [25]. Additionally, next-generation sequencing technologies have accelerated genetic and genomic studies in recent years by allowing larger volumes of sequence data to be acquired in shorter times and with lower costs. Thus, the combination of the iPBS method with a high-throughput sequencing platform was hypothesized to be capable of screening a large number of LTR retrotransposon families on a genome-wide scale.
Fig. 2. Retrotransposon-based molecular markers. (a) Inter-retrotransposon amplification polymorphism (IRAP). IRAP amplifies the intervening region between two LTR sequences. (b) Retrotransposon microsatellite amplification polymorphism (REMAP). The DNA fragment between an LTR sequence and an SSR motif is amplified. (c) Sequencespecific amplification polymorphism (S-SAP). Genomic DNAs are digested by a restriction enzyme, and adapters are ligated to the digested DNA fragments. PCR amplification is performed with LTR-specific and adapter-specific primer sets. (d) Retrotransposon-based insertion polymorphism (RBIP). RBIP targets one retrotransposon insertion site in the presence/absence allelic states. To detect the presence of the LTR retrotransposon insertion, primers specific to the flanking regions of the insertion site are used with an LTR-specific primer. In contrast, primers specific to the flanking regions are used for the empty site. The arrows represent PCR primer, and the dotted lines represent the amplified region. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
42
Y. Monden et al. / Current Plant Biology 1 (2014) 40–44
Fig. 4. The procedure of our method. (a) Output of paired-end sequencing. One set of reads, from the PBS-specific primer (PBS reads), contain diverse LTR sequences, while the other set of reads, from the adapter-specific primer (non-PBS reads), contain insertion site sequences. Thus, the non-PBS reads of several cultivars were mapped to the reference genome to identify the insertion sites of LTR sequences. (b) Comparison of mapped sites among several cultivars. Cultivar-specific sites were extracted from these sites, as this type of insertion was hypothesized to have occurred quite recently. Pooling and clustering analyses were conducted using PBS reads corresponding to the cultivar-specific sites, which led to the candidate LTR sequences. (c) Experimental confirmation of insertion polymorphism by the S-SAP method. The S-SAP method visualized DNA fragments by specifically amplifying the insertion sites for the identified LTR sequences.
3. High-throughput sequencing for screening LTR sequences showing high insertion polymorphism In our research, we employed an Illumina HiSeq 2000 sequencing platform; this platform is widely used and can produce huge amounts of sequencing data. We constructed a sequencing library through PCR amplification using PBS-specific primers with a multiplex barcoding system for eight strawberry cultivars (Fig. 4(a)) [30]. The procedure of our method was briefly described. At first, genomic DNA from eight cultivars was fragmented using g-TUBE (Covaris). These fragmented DNA samples were end repaired, modified to add 3 A overhangs and ligated to the forked adapters. The forked adapters were prepared by annealing two DNA oligomers: one of the Forked Type1-4 and Forked Com (Table 1). We designed PBS-specific primers based on the two types of PBS sequences that matched part of the sequence of the iMET and Asp tRNA genes (indicated as Fr Mal iMET * and Fr Mal Asp * in Table 1). These PBS-specific (iMET and Asp) primers contained 7–8 nt barcode sequence for multiplexing (Table 1). We performed primary PCR with adapter-specific (AP2 Type*) and PBS-specific (Fr Mal iMET *
and Fr Mal Asp *) primer combinations using the ligated products as the template. Then, secondary PCR was performed with adapter-specific (AP3 Type*) and PBS-specific (Fr Mal iMET * and Fr Mal Asp *) primer combinations using the initial PCR products as the template. The PCR cycling program consisted of an initial denaturation at 94 ◦ C for 4 min, 30 cycles of 94 ◦ C for 30 s, 80 ◦ C for 30 s, 58 ◦ C for 30 s and 72 ◦ C for 60 s and a final extension at 72 ◦ C for 15 min. These PCR products were size-selected (300–500 bp) on agarose gels and purified with QIAquick Gel Extraction Kit (QIAGEN). Finally, these libraries were pooled into one sequencing sample. Paired-end reads of 101 bp were generated on an Illumina HiSeq 2000 platform. In this library, the set of reads amplified from the PBS-specific primer (designated as PBS-reads) should represent the LTR sequences, whereas the set of reads from the adapter-specific primer (designated as non-PBS reads) should contain insertion site sequences (Fig. 4(a)). After filtering those reads based on the primer sequence of the cultivar barcode and PBS with the Q scores of all base calls being ≥30, the non-PBS reads were mapped to the Fragaria vesca reference genome [31] to identify the insertion sites of these LTR sequences for each cultivar (Fig. 4(b)).
Y. Monden et al. / Current Plant Biology 1 (2014) 40–44 Table 1 Sequences of the adapters and primers used in our method. Primer name
Sequence (5 →3 )
Forked Type1 Forked Type2 Forked Type3 Forked Type4 Forked Com AP2 Type1 AP2 Type2 AP2 Type3 AP2 Type4 AP3 Type1 AP3 Type2 AP3 Type3 AP3 Type4 Fr Mal iMET 1 Fr Mal iMET 2 Fr Mal iMET 3 Fr Mal iMET 4 Fr Mal iMET 5 Fr Mal iMET 6 Fr Mal iMET 7 Fr Mal iMET 8 Fr Mal Asp 1 Fr Mal Asp 2 Fr Mal Asp 3 Fr Mal Asp 4 Fr Mal Asp 5 Fr Mal Asp 6 Fr Mal Asp 7 Fr Mal Asp 8
AATAGGGCTCGAGCGGCAGCTATTAATAGTACT AATAGGGCAGCTGCGGCAGCTATTAATAGTACT AATAGGGCGATGGCGGCAGCTATTAATAGTACT AATAGGGCCTACGCGGCAGCTATTAATAGTACT GTACTATTAATAGCATCTTCGTTCGTCGAT AATAGGGCTCGAGCGGC AATAGGGCAGCTGCGGC AATAGGGCGATGGCGGC AATAGGGCCTACGCGGC TCGAGCGGCAGCTATTAATAGTACT AGCTGCGGCAGCTATTAATAGTACT GATGGCGGCAGCTATTAATAGTACT CTACGCGGCAGCTATTAATAGTACT AGACTGCNNGCTCTGATACCA ATGATCGCNNGCTCTGATACCA CGTCCAANNGCTCTGATACCA CTTGACCNNGCTCTGATACCA GACTAGTCNNGCTCTGATACCA GAGTGTGNNGCTCTGATACCA TCAGCTAGNNGCTCTGATACCA TCCAGATGNNGCTCTGATACCA AGACTGCAGACGGCGCCA ATGATCGAGACGGCGCCA CGTCCAAAGACGGCGCCA CTTGACCAGACGGCGCCA GACTAGTAGACGGCGCCA GAGTGTGAGACGGCGCCA TCAGCTAAGACGGCGCCA TCCAGATAGACGGCGCCA
Out of these mapped sites, we extracted uniquely mapped loci for the non-PBS reads. Because the lengths of the LTR sequences varied from a few hundred to over a thousand bases, several of the non-PBS reads may have contained LTR sequences, but these reads could be mapped to the reference genome at multiple loci. After comparing the uniquely mapped loci among several cultivars, we focused on the cultivar specific insertion loci which were detected only in one cultivar, but not in the others (Fig. 4(b)). These insertion sites were considered to have occurred relatively recently, presumably after cultivar divergence. Thus, we pooled these insertion sites and extracted the corresponding PBS reads which represented LTR sequences (Fig. 4(b)). By clustering these extracted PBS reads, we obtained 24 candidate LTR sequences that contained more than two reliable cultivar specific insertion sites. In contrast, we identified a total of 20,918 LTR retrotransposon family candidates by clustering all PBS reads in this study [unpublished data]. This number may represent the majority of LTR retrotransposon families present in the strawberry genome, because we selected the two most frequently used tRNA sequences (iMET and Asp) to construct the sequencing library. Finally, the insertion polymorphism in these identified LTR sequences was experimentally investigated by SSAP analysis, indicating high insertion polymorphism even among Japanese strawberry cultivars known to be closely related genetically (Fig. 4(c)). Thus, these LTR sequences should be useful for the development of retrotransposon-based molecular markers. 4. Concluding remarks Due to the prevalence and progress of high-throughput sequencing technologies, a number of methods and techniques for sequence analysis have been developed, including genome-wide association studies (GWAS), restriction-site associated DNA (RAD) sequencing and MutMap [32–40]. High-throughput sequencing platforms and multiplex barcoding systems allow us to investigate a large number of genomic loci, including retrotransposon insertion sites, for multiple samples in a single sequencing run [41–46]. For example, our research showed that 76,912 genotypic
43
data points (2024 retrotransposon insertion loci for 38 cultivars) were obtained in one Illumina MiSeq sequencing run for sweet potato (Ipomoea batatas) [47]. We constructed a MiSeq sequencing library through the PCR amplification of the insertion loci of target retrotransposon families, namely Rtsp-1 [48] and LIb [49]. Because these insertion loci were highly polymorphic among cultivars, we acquired a number of molecular markers for cultivar screening and also revealed the genetic relationships among the cultivars without using the reference genome. In addition, our recent research has indicated that retrotransposon insertion sites are quite suitable for linkage map construction aimed at the isolation of agronomically important genes in outcrossing polyploid plant species [unpublished results]. Thus, the targeted sequencing of these polymorphic retrotransposon insertion sites is highly effective for extensive DNA genotyping and marker development. However, retrotransposon families that show little insertion polymorphism among crop cultivars are obviously impractical for these genetic analyses. Although retrotransposon-based molecular markers techniques such as IRAP, REMAP and S-SAP have previously been applied for a number of genetic analyses, these methods are limited by their need for suitable LTR sequences and ability to detect, at most, several dozen sites through agarose/acrylamide electrophoresis. Thus, we believe that our method for screening LTR sequences with high insertion polymorphism and conducting extensive genotyping based on these insertion polymorphisms via high-throughput sequencing platforms should accelerate the genetic analyses such as phylogenetic and genetic diversity studies and promote plant breeding through the map-based cloning of genes in a wide range of plant species. Acknowledgements We thank Nobuyuki Fujii and Kazuho Ikeo of the National Institute of Genetics for their support of the data analyses, as well as Yoshiko Nakazawa and Takamitsu Waki of the Tochigi Prefectural Agricultural Experiment Station and Keita Hirashima and Yosuke Uchimura of the Fukuoka Agricultural Research Center for their assistance in the S-SAP experiment. This work was supported by a Research and Development Projects for Application in Promoting New Policy of Agriculture, Forestry and Fisheries grant from the Ministry of Agriculture, Forestry and Fisheries of Japan, as well as by funding from the Program to Disseminate Tenure Tracking System of the Ministry of Education, Culture, Sports, Science and Technology (MEXT), Japan (to Y.M.). References [1] A. Kumar, J.L. Bennetzen, Plant retrotransposons, Annu. Rev. Genet. 33 (1999) 479–532, http://dx.doi.org/10.1146/annurev.genet.33.1.479. [2] C. Feschotte, N. Jiang, S.R. Wessler, Plant transposable elements: where genetics meets genomics, Nat. Rev. Genet. 3 (2002) 329–341, http://dx.doi.org/10.1038/ nrg793. [3] S.R. Wessler, Transposable elements and the evolution of eukaryotic genomes, Proc. Natl. Acad. Sci. U. S. A. 103 (2006) 17600–17601, http://dx.doi.org/10. 1073/pnas.0607612103. [4] M. Bento, D. Tomas, W. Viegas, M. Silva, Retrotransposons represent the most labile fraction for genomic rearrangements in polyploid plant species, Cytogenet. Genome Res. 140 (2013) 286–294, http://dx.doi.org/10.1159/ 000353308. [5] P.S. Schnable, D. Ware, R.S. Fulton, J.C. Stein, F. Wei, S. Pasternak, C. Liang, J. Zhang, L. Fulton, T.A. Graves, et al., The B73 maize genome: complexity, diversity, and dynamics, Science 326 (2009) 1112–1115, http://dx.doi.org/10.1126/ science.1178534. [6] E.R. Havecker, X. Gao, D.F. Voytas, The diversity of LTR retrotransposons, Genome Biol. 5 (2004) 225, http://dx.doi.org/10.1186/gb-2004-5-6-225. [7] C. Witte, Q.H. Le, T. Bureau, A. Kumar, Terminal-repeat retrotransposons in miniature (TRIM) are involved in restructuring plant genomes, Proc. Natl. Acad. Sci. U. S. A. 98 (2001) 13778–13783, http://dx.doi.org/10.1073/ pnas.241341898. [8] R. Kalendar, C.M. Vicient, O. Peleg, K. Anamthawat-Jonsson, A. Bolshoy, A.H. Schulman, Large retrotransposon derivatives: abundant, conserved but nonautonomous retroelements of barley and related genomes, Genetics 166 (2004) 1437–1450, http://dx.doi.org/10.1534/genetics.166.3.1437.
44
Y. Monden et al. / Current Plant Biology 1 (2014) 40–44
[9] K. Antonius-Klemola, R. Kalendar, A.H. Schulman, TRIM retrotransposons occur in apple and are polymorphic between varieties but not sports, Theor. Appl. Genet. 112 (2006) 999–1008, http://dx.doi.org/10.1007/s00122-005-0203-0. [10] R. Waugh, K. McLean, A.J. Flavell, S.R. Pearce, A. Kumar, B.B. Thomas, W. Powell, Genetic distribution of Bare-1-like retrotransposable elements in the barley genome revealed by sequence-specific amplification polymorphisms (S-SAP), Mol. Gen. Genet. 253 (1997) 687–694 http://www.ncbi.nlm. nih.gov/pubmed/9079879 [11] A.J. Flavell, M.R. Knox, S.R. Pearce, T.H. Ellis, Retrotransposon-based insertion polymorphisms (RBIP) for high throughput marker analysis, Plant J. 16 (1998) 643–650 http://www.ncbi.nlm.nih.gov/pubmed/10036780 [12] R. Kalendar, T. Grob, M. Regina, A. Suoniemi, A. Schulman, IRAP and REMAP: two new retrotransposon-based DNA fingerprinting techniques, Theor. Appl. Genet. 98 (1998) 704–711, http://dx.doi.org/10.1007/s001220051124. [13] R. Kalendar, J. Tanskanen, S. Immonen, E. Nevo, A.H. Schulman, Genome evolution of wild barley (Hordeum spontaneum) by BARE-1 retrotransposon dynamics in response to sharp microclimatic divergence, Proc. Natl. Acad. Sci. U. S. A. 97 (2000) 6603–6607, http://dx.doi.org/10.1073/pnas.110587497. [14] N.H. Syed, S. Sureshsundar, M.J. Wilkinson, B.S. Bhau, J.J.V. Cavalcanti, A.J. Flavell, Ty1-copia retrotransposon-based SSAP marker development in cashew (Anacardium occidentale L.), Theor. Appl. Genet. 110 (2005) 1195–1202, http://dx.doi.org/10.1007/s00122-005-1948-1. [15] Q. Lou, J. Chen, Ty1-copia retrotransposon-based SSAP marker development and its potential in the genetic study of cucurbits, Genome 810 (2007) 802–810, http://dx.doi.org/10.1139/G07-067. [16] A. Belyayev, R. Kalendar, L. Brodsky, E. Nevo, A. Schulman, O. Raskina, Transposable elements in a marginal plant population: temporal fluctuations provide new insights into genome evolution of wild diploid wheat, Mob. DNA 1 (2010) 1–6, http://dx.doi.org/10.1186/1759-8753-1-6. [17] M. Petit, C. Guidat, J. Daniel, E. Denis, E. Montoriol, Q.T. Bui, K.Y. Lim, A. Kovarik, A.R. Leitch, M. Grandbastien, et al., Mobilization of retrotransposons in synthetic allotetraploid tobacco, N. Phytol. 186 (2010) 135–147, http://dx.doi.org/10.1111/j.1469-8137.2009.03140.x. [18] F.A. Konovalov, N.P. Goncharov, S. Goryunova, A. Shaturova, T. Proshlyakova, A. Kudryavtsev, Molecular markers based on LTR retrotransposons BARE1 and Jeli uncover different strata of evolutionary relationships in diploid wheats, Mol. Genet. Genomics 283 (2010) 551–553, http://dx.doi.org/10. 1007/s00438-010-0539-2. ´ N. Baˇcová-Kerteszová, R. Kalendar, J. Corander, A.H. Schulman, M. [19] P. Smykal, Pavelek, Genetic diversity of cultivated flax (Linum usitatissimum L.) germplasm assessed by retrotransposon-based markers, Theor. Appl. Genet. 122 (2011) 1385–1397, http://dx.doi.org/10.1007/s00122-011-1539-2. [20] N.V. Melnikova, A.V. Kudryavtseva, A.S. Speranskaya, A.A. Krinitsina, A.A. Dmitriev, M.S. Belenikin, V.P. Upelniek, E.R. Batrak, I.S. Kovaleva, A.M. Kudryavtsev, The FaRE1 LTR-retrotransposon based SSAP markers reveal genetic polymorphism of strawberry (Fragaria x ananassa) cultivars, J. Agric. Sci. 4 (2012) 111–118, http://dx.doi.org/10.5539/jas.v4n11p111. [21] S. Nasri, B. Abdollahi Mandoulakani, R. Darvishzadeh, I. Bernousi, Retrotransposon insertional polymorphism in Iranian bread wheat cultivars and breeding lines revealed by IRAP and REMAP markers, Biochem. Genet. 51 (2013) 927–943, http://dx.doi.org/10.1007/s10528-013-9618-5. [22] A. Kumar, H. Hirochika, Applications of retrotransposons as genetic tools in plant biology, Trends Plant Sci. 6 (2001) 127–134 http://www.ncbi.nlm.nih. gov/pubmed/11239612 [23] A.H. Schulman, A.H. Flavell, T.H.N. Ellis, The application of LTR retrotransposons as molecular markers in plants, Methods Mol. Biol. 260 (2004) 145–173, http://dx.doi.org/10.1385/1-59259-755-6.145. [24] P. Poczai, I. Varga, M. Laos, A. Cseh, N. Bell, J.P. Valkonen, J. Hyvönen, Advances in plant gene-targeted and functional markers: a review, Plant Methods 9 (2013) 6, http://dx.doi.org/10.1186/1746-4811-9-6. ´ [25] R. Kalendar, K. Antonius, P. Smykal, A.H. Schulman, iPBS: a universal method for DNA fingerprinting and retrotransposon isolation, Theor. Appl. Genet. 121 (2010) 1419–1430, http://dx.doi.org/10.1007/s00122-010-1398-2. [26] R. Marquet, C. Isel, C. Ehresmann, B. Ehresmann, tRNAs as primer of reverse transcriptases, Biochimie 77 (1995) 113–124 http://www.ncbi.nlm.nih.gov/ pubmed/7541250 [27] J. Mak, L. Kleiman, Primer tRNAs for reverse transcription, J. Virol. 71 (1997) 8087–8095. [28] N.J. Kelly, M.T. Palmer, C.D. Morrow, Selection of retroviral reverse transcription primer is coordinated with tRNA biogenesis, J. Virol. 77 (2003) 8695–8701, http://dx.doi.org/10.1128/jvi.77.16.8695. [29] A. Hizi, The reverse transcriptase of the Tf1 retrotransposon has a specific novel activity for generating the RNA self-primer that is functional in cDNA synthesis, J. Virol. 82 (2008) 10906–10910, http://dx.doi.org/10.1128/jvi.0137008.
[30] Y. Monden, N. Fujii, K. Yamaguchi, K. Ikeo, Y. Nakazawa, T. Waki, K. Hirashima, Y. Uchimura, M. Tahara, Efficient screening of the long terminal repeat (LTR) retrotransposons that show high insertion polymorphism via highthroughput sequencing of the primer binding site, Genome 57 (2014) 1–8, http://dx.doi.org/10.1139/gen-2014-0031. [31] Fragaria vesca Genome v1.1 Assembly. http://www.rosaceae.org/projects/ strawberry genome/v1.1/assembly [32] X. Huang, X. Wei, T. Sang, Q. Zhao, Q. Feng, Y. Zhao, C. Li, C. Zhu, T. Lu, Z. Zhang, et al., Genome-wide association studies of 14 agronomic traits in rice landraces, Nat. Genet. 42 (2010) 961–967, http://dx.doi.org/10.1038/ng.695. [33] S.W. Baxter, J.W. Davey, J.S. Johnston, A.M. Shelton, D.G. Heckel, C.D. Jiggins, M.L. Blaxter, Linkage mapping and comparative genomics using next-generation RAD sequencing of a non-model organism, PLoS ONE 6 (2011) e19315, http://dx.doi.org/10.1371/journal.pone.0019315. [34] R.L. Elshire, J.C. Glaubitz, Q. Sun, J.A. Poland, K. Kawamoto, E.S. Buckler, S.E. Mitchell, A robust, simple genotyping-by-sequencing (GBS) approach for high diversity species, PLoS ONE 6 (2011) e19379, http://dx.doi.org/10.1371/ journal.pone.0019379. [35] F. Tian, P.J. Bradbury, P.J. Brown, H. Hung, Q. Sun, S. Flint-Garcia, T.R. Rocheford, M.D. McMullen, J.B. Holland, E.S. Buckler, Genome-wide association study of leaf architecture in the maize nested association mapping population, Nat. Genet. 43 (2011) 6–11, http://dx.doi.org/10.1038/ng.746. [36] A. Abe, S. Kosugi, K. Yoshida, S. Natsume, H. Takagi, H. Kanzaki, H. Matsumura, K. Yoshida, C. Mitsuoka, M. Tamiru, et al., Genome sequencing reveals agronomically important loci in rice using MutMap, Nat. Biotechnol. 30 (2012) 174–178, http://dx.doi.org/10.1038/nbt.2095. [37] A.L. Harper, M. Trick, J. Higgins, F. Fraser, L. Clissold, R. Wells, C. Hattori, P. Werner, I. Bancroft, Associative transcriptomics of traits in the polyploid crop species Brassica napus, Nat. Biotechnol. 30 (2012) 798–802, http://dx.doi. org/10.1038/nbt.2302. [38] R. Fekih, H. Takagi, M. Tamiru, A. Abe, S. Natsume, H. Yaegashi, S. Sharma, H. Kanzaki, H. Matsumura, H. Saitoh, et al., MutMap+: genetic mapping and mutant identification without crossing in rice, PLoS ONE 8 (2013) e68529, http://dx.doi.org/10.1371/journal.pone.0068529. [39] D.T. Morishige, P.E. Klein, J.L. Hilley, S.M.E. Sahraeian, A. Sharma, J.E. Mullet, Digital genotyping of sorghum – a diverse plant species with a large repeat-rich genome, BMC Genomics 14 (2013) 448, http://dx.doi.org/10.1186/ 1471-2164-14-448. [40] H. Takagi, A. Uemura, H. Yaegashi, M. Tamiru, A. Abe, C. Mitsuoka, H. Utsushi, S. Natsume, H. Kanzaki, H. Matsumura, et al., Methods MutMap-Gap: wholegenome resequencing of mutant F2 progeny bulk combined with de novo assembly of gap regions identifies the rice blast resistance gene Pii, N. Phytol. 200 (2013) 276–283, http://dx.doi.org/10.1111/nph.12369. [41] R.C. Iskow, M.T. McCabe, R.E. Mills, S. Torene, W.S. Pittard, A.F. Neuwald, E.G. Van Meir, P.M. Vertino, S.E. Devine, Natural mutagenesis of human genomes by endogenous retrotransposons, Cell 141 (2010) 1253–1261, http://dx.doi.org/10.1016/j.cell.2010.05.020. [42] A.D. Ewing, H.H. Kazazian, Whole-genome resequencing allows detection of many rare LINE-1 insertion alleles in humans, Genome Res. 21 (2011) 985–990, http://dx.doi.org/10.1101/gr.114777.110. [43] F. Hormozdiari, C. Alkan, M. Ventura, I. Hajirasouliha, M. Malig, F. Hach, D. Yorukoglu, P. Dao, M. Bakhshi, S.C. Sahinalp, et al., Alu repeat discovery and characterization within human genomes, Genome Res. 21 (2011) 840–849, http://dx.doi.org/10.1101/gr.115956.110. ´ [44] D.F. Urbanski, A. Małolepszy, J. Stougaard, S.U. Andersen, Genome-wide LORE1 retrotransposon mutagenesis and high-throughput insertion detection in Lotus japonicas, Plant J. 69 (2012) 731–741, http://dx.doi.org/10.1111/ j.1365-313X.2011.04827.x. [45] M. David, H. Mustafa, M. Brudno, Detecting Alu insertions from highthroughput sequencing data, Nucleic Acids Res. 41 (2013) e169, http://dx.doi. org/10.1093/nar/gkt612. [46] J. Xing, D.J. Witherspoon, L.B. Jorde, Mobile element biology: new possibilities with high-throughput sequencing, Trends Genet. 29 (2013) 280–289, http://dx.doi.org/10.1016/j.tig.2012.12.002. [47] Y. Monden, A. Yamamoto, A. Shindo, M. Tahara, Efficient DNA fingerprinting based on the targeted sequencing of active retrotransposon insertion sites using a bench-top high-throughput sequencing platform, DNA Res. (2014), http://dx.doi.org/10.1093/dnares/dsu015. [48] M. Tahara, T. Aoki, S. Suzuka, H. Yamashita, M. Tanaka, S. Matsunaga, S. Kokumai, Isolation of an active element from a high-copy-number family of retrotransposons in the sweetpotato genome, Mol. Genet. Genomics 272 (2004) 116–127, http://dx.doi.org/10.1007/s00438-004-1044-2. [49] H. Yamashita, M. Tahara, A LINE-type retrotransposon active in meristem stem cells causes heritable transpositions in the sweetpotato genome, Plant Mol. Biol. 61 (2006) 79–94, http://dx.doi.org/10.1007/s11103-005-6002-9.