Application of ohmic heating to extend shelf life and retain the physicochemical, microbiological, and sensory properties of pulque

Food and Bioproducts Processing 1 1 8 ( 2 0 1 9 ) 139–148

Contents lists available at ScienceDirect

Food and Bioproducts Processing journal homepage: www.elsevier.com/locate/fbp

Application of ohmic heating to extend shelf life and retain the physicochemical, microbiological, and sensory properties of pulque Alejandra E. Alcántara-Zavala a , Juan de Dios Figueroa-Cárdenas a,∗ , Eduardo Morales-Sánchez b , Jesús A. Aldrete-Tapia c , Sofía M. Arvizu-Medrano c , Héctor E. Martínez-Flores d a

Centro de Investigación y de Estudios Avanzados (CIVESTAV-Unidad Querétaro), Libramiento Norponiente 2000, Real de Juriquilla, Querétaro, Qro. C.P., 76230, Mexico b Instituto Politcnico Nacional, CICATA-IPN, Cerro Blanco 141, Col. Colinas del Cimatario, Querétaro, Qro. C. P., 76090, Mexico c Universidad Autónoma de Querétaro, Departamento de Investigación y Posgrado de Alimentos. C.U., Cerro de las Campanas s/n, Col. Las Campanas, Querétaro, Qro. C.P., 76010, Mexico d Universidad Michoacana de San Nicolás de Hidalgo, Facultad de Químico Farmacobiología, Tzintzuntzan 173, Col. Matamoros, Morelia, Michoacán, Mexico

a r t i c l e

i n f o

a b s t r a c t

Article history:

Pulque is a Mexican alcoholic, probiotic beverage with shelf life of 3 days. The physicochem-

Received 5 April 2019

ical, probiotic, and sensory properties of pulque depend on its content of lactic acid bacteria

Received in revised form 9

(LAB) and yeasts. The aim of this study was to apply ohmic heating (OH) in order to extend

September 2019

the shelf life of pulque without altering its properties. Pulque processed by conventional pas-

Accepted 15 September 2019

teurization (63 ◦ C, 30 min) was used as control. Parameters such as electrical conductivity

Available online 20 September 2019

(0.22 S/m) and optimal pasteurization conditions by OH (65 ◦ C, 5 and 7 min; 70 ◦ C, 3 and 5 min) were determined. Shelf life was evaluated with these parameters during 22 days of

Keywords:

storage at 4 ± 1 ◦ C. A higher content of LAB (6.68 and 5.96 log10 CFU/mL) was obtained at

Pulque

65 ◦ C for 5 and 7 min, respectively, compared with conventional pasteurization (3.54 log10

Ohmic heating

CFU/mL). After 22 days, physicochemical properties (pH, color, and alcohol content) were

Shelf life

stable for both methods of pasteurization. However, the pulque treated with OH had greater

Probiotic microorganisms

sensory acceptance. For the first time, OH was used to process pulque, and results revealed

Physicochemical properties

that is an effective technology for extending the shelf life until 22 days, preserving microbiological and physicochemical properties. Microorganisms as surviving the OH treatments were identified as Lactobacillus acidophilus, Lactobacillus kefiri, and Saccharomyces cerevisiae. © 2019 Institution of Chemical Engineers. Published by Elsevier B.V. All rights reserved.

1.

Introduction

Pulque is a non-distilled, alcoholic probiotic beverage which is white, viscous and acidic. Pulque is produced by the fermentation of the sap of an agave plant (Gómez et al., 2016; González et al., 2015; Chlebowska et al., 2017). This traditional Mexican beverage is also

known as agave wine and its consumption may go back to the Olmec times of 2000 BCE (Bruman, 2000). The production of pulque begins with the removal of agave leaves (castration) and the extraction of the fresh sweet liquid (the sap is called aguamiel) secreted by the plant. Aguamiel is collected and allowed to ferment in open barrels, where a diverse range of microorganisms such as yeasts, lactic acid bacteria (LAB), and acetic acid bacteria (AAB), which are naturally present

∗

Corresponding author. E-mail address: [email protected] (J.d.D. Figueroa-Cárdenas). https://doi.org/10.1016/j.fbp.2019.09.007 0960-3085/© 2019 Institution of Chemical Engineers. Published by Elsevier B.V. All rights reserved.

140

Food and Bioproducts Processing 1 1 8 ( 2 0 1 9 ) 139–148

in the agave and in its growth environment (Escalante et al., 2008; González et al., 2015). Aguamiel fermentation lasts from 3 to 6 h at room temperature (Jennings et al., 2005; Tovar et al., 2008; Valadez et al., 2012), and this process can be accelerated by the addition of an inoculums (fermented pulque). The sugars present in aguamiel, such as sucrose, glucose, fructose, and several pentoses, are fermented

2.

Materials and methods

2.1.

Samples of pulque

by microorganisms. LAB produce lactic acid, Saccharomyces cerevisiae, and Zymomonas mobilis produce alcohol (ethanol), Gluconobacter and Acetobacter produce acetic acid, and Leuconostoc mesenteroides produce

A fresh batch of pulque was obtained from traditional rural producers of Mompani, Querétaro, Mexico. Pulque was collected in a sterile container and transported at 4 ◦ C. It was immediately analyzed and processed.

dextrans, fructans, and exopolysaccharides (Escalante et al., 2016). These compounds are rapidly produced during fermentation, alter-

2.2.

ing the quality and shelf life of the beverage. The quality of pulque depends on three parameters: microbiological, physicochemical, and sensory. Therefore, a high microbial load on pulque reduces shelf life to less than 3 days; after this time, the taste becomes stronger and more acidic and the beverage is not palatable for consumption. The microbiological content can alter the physicochemical (pH, alcohol content, and color) and the sensory quality (flavor, odor, acidity, and color) in pulque during storage (Escalante et al., 2008). Additionally, the content of LAB determines its probiotic properties. Lactic acid bacteria from pulque has been shown to possess probiotic properties, such as anti-inflammatory activity, enhancing/modulating the immune response, attenuating colitis, an antimicrobial effect against pathogenic microbes such as Escherichia coli, Listeria monocytogenes, and Salmonella typhimurium, counteracting gastrointestinal diseases, and increasing the epithelial barrier (Prado et al., 2008; Escalante et al., 2016; Torres et al., 2016). Pulque is a beverage with interesting properties; therefore, there is a need to extend its shelf life and conserve its quality. This would in

Ohmic heating equipment and treatment

Experiments were conducted in a laboratory-scale ohmicheating system (CINVESTAV, Qro., Mexico). The equipment consisted of a power supply, a computer, 304 type stainless steel electrodes, and cells with a capacity of 50 mL. The electrodes were sterilized before use. The temperature was monitored utilizing a thermocouple (CINVESTAV, Qro., Mexico).

2.3. Determination of the electrical conductivity of pulque Electrical conductivity (␴ Siemens/cm) was determined at 60 Hz in samples of pulque (30 mL) at different voltages (60, 80, 100, and 120 V) up to a final temperature of 72 ◦ C. It was calculated with the following equation (Morales et al., 2009):

turn lead to an increase in its consumption and reactivating the econ-

IL VA

omy particularly for small producers in the countryside, whose income sometimes depends on the sale of pulque.

=

Many attempts have been made to achieve stabilized and preserved pulque (Escalante et al., 2012). These attempts have included the use of

Where I is the measured electrical current, L is the distance between the two electrodes, V is the voltage applied, and A is the cell transversal area. The distance between electrodes was 4 cm and the transversal area of the electrodes was 16 cm2 . The efficiency of OH is dependent on the electrical conductivity of beverage to be processed; it is for this reason that parameters must be calculated in pulque.

conventional pasteurization and the application of substances, such as preservatives, antioxidants, colorants, and texturizing agents have been used, but these options have affected the content of lactic acid bacteria (Ramírez et al., 2004). This means that the probiotic quality of the beverage decreases. In recent years, the food industry has been using Ohmic Heating (OH), which is an attractive technique for processing of foods and beverages (Jun and Sastry, 2005). Processing by OH consists of heating foods, both liquid and solid, by passing an electric current

(1)

2.4. Determination of optimal pasteurization conditions for pulque by OH

through the food matrix. This current creates an oscillatory movement of ions, generating heat. The rate of heat generation depends on the electrical conductivity of the food, the electrical-field strength, voltage, and the treatment time (Icier and Ilicali, 2005; Shiby et al., 2014). The electrical current can be used to heat, pasteurize or sterilize in a manner equally comparable to the conventional method of processing (Charles et al., 2007); therefore, OH can be used to control the microbiological, enzymatic, and physicochemical quality in food (FDA, 1998). The mechanism to inactivate and reduce the microbial load in foods by OH is through electroporation (Park and Kang, 2013). This consists of inducing a potential from an external electrical field that causes the attraction between opposite charges of the internal and external sides of the cell membrane. Therefore, cell death occurs when many pores are formed in the membrane as a result of a rupture (Soliva et al., 2009; Knirsch et al., 2010). The use of OH in food products offers advantages, such as rapid and uniform heating, higher yield, higher retention of the food’s nutritional value, low energy consumption, stability, and microbiological quality (Torkian et al., 2015). Therefore, the aim of the present study was to apply ohmic heating in order to extend the shelf life of pulque and to preserve the physicochemical (pH, color, and alcohol content) and probiotic properties (lactic acid bacteria content) during 22 days of storage at 4 ± 1 ◦ C and to compare ohmically heated pulque to conventionally pasteurized and un-pasteurized pulque.

Different holding temperatures and times were applied to 30 mL samples of pulque. The samples were processed in duplicate with a voltage of 120 V under the following conditions: at 50 ◦ C for 5, 7, 9, and 12 min; at 60 ◦ C for 3, 6, 8, and 10, min; at 65 ◦ C for 3, 5, 7, and 9 min, and at 70 ◦ C for 0.5, 1.5, 3, and 5 min. The distance between electrodes was 4 cm. Temperatures of 50–70 ◦ C were selected at times less than 12 min to avoid causing lethal effects on Lactic acid bacteria and yeasts. These microorganisms were determined in triplicate for each treatment evaluated.

2.5.

Processing pulque by OH to extend its shelf life

The treatments of 65 ◦ C (for 5 and 7 min) and at 70 ◦ C (for 3 and 5 min) were applied to evaluate shelf life. These were the optimal conditions found for pasteurization. A volume of 450 mL of pulque was processed at 120 V and stored for 22 days at 4 ± 1 ◦ C. The pulque was stored in sterile containers. Conventional pasteurization (CP) was performed in a sterile container, and 250 mL of pulque was heated to 63 ◦ C and held at that temperature for 30 min. After this time, cooling was carried out to cause thermal shock and the pulque was also stored in a sterile

Food and Bioproducts Processing 1 1 8 ( 2 0 1 9 ) 139–148

container for 22 days at 4 ◦ C ± 1. The conventionally pasteurized sample was used as the control. For both methods, OH and CP microbiological (LAB and yeasts) and physicochemical (pH, color, and alcohol content) parameters were evaluated in triplicate every 72 h for each treatment.

2.6.

Microbiological analysis

Microbiological analysis was conducted according to methods described by the U.S. Federal Drug Administration (FDA, 1984). The determination of LAB was carried out on Man, Rogose, and Sharp agar (Sigma–Aldrich, USA) supplemented with 100 mg/L of cycloheximide (Sigma–Aldrich, USA). Sabourand glucose with chloramphenicol agar (Sigma–Aldrich, USA) was employed for the enumeration of yeasts. 10 mL of sample was suspended in 90 mL of peptone water 0.1% w/v (MCD-LAB, México) as diluent. One mL of aliquot was serially diluted in 9 mL of peptone water. The method spread-plate was employed to quantify and the incubation at 27 ◦ C for 5 days was made for yeasts and 37 ◦ C for 48 h for LAB.

2.7.

Effect of ohmic heating on microbial morphology

Lactic acid bacteria and yeasts of processed pulque by OH at 65 ◦ C and at 70 ◦ C for 5 min were grown in specific medium (Section 2.6), to observe possible damage to cells due to the effect of electroporation caused by OH and its morphology. For this purpose the Scanning Electron Microscopy (SEM) analysis was employed. Samples of raw pulque was used as a control. Samples were coated with gold and observed using a JEOL model JSM-7610 F (JEOL, Japan) microscope with ultra-high resolution, coupled to Electron Backscatter Diffraction (JEOL, Japan), obtaining images at 8,500× on yeasts and at 18,000× for LAB with a voltage of 1.0 Kv.

2.8.

Identification of lactic acid bacteria and yeasts

The Lactobacillus sp. and yeasts were isolated and identified in raw and processed pulque by ohmic heating at 65 ◦ C for 5 min and for 7 min. Total genomic DNA was extracted with a pre-treatment to remove salts and proteins, obtaining the cell pellet, according to the technique reported by (Aldrete et al., 2014). Cells were subjected to lysis by heat and DNA was purified with ethanol precipitation. DNA amplification and sequencing was performed by the Macrogen Laboratory (Geumcheon-gu, Korea). The 16S rRNA gene was amplified using the following primers: for yeasts, NL1 (5-´ GCATATCAATAAGCGGAGGAAAAG3´) and NL4 (5-´ GGTCCGTGTTTCAAGACGG-3´), and for lactic acid bacteria, pA (5 -AGAGTTTGATCCTGGCTCAG-3´) and pH (5-´ AAGGAGGTGATCCAGCCGCA-3´). Species were identified by searching databases using BLAST (Basic Local Alignment Search Tool) (http://www.ncbi.nlm.nih.gov/BLAST/). This study was carried out to identify some species of Lactobacillus and yeasts that survived the OH treatment. However, there are other species that have not yet been identified in raw and processed pulque by OH (this is not the main objective this study). This will be conducted in upcoming investigations.

2.9.

Physicochemical determinations

2.9.1.

pH

pH was measured in raw and processed pulque by ohmic heating and conventional pasteurization. A pH meter HI 221

141

(HANNA Instruments, USA) was used to measure a 20 mL sample according to the 981.12 method of the Official Methods of Analysis, (AOAC) (1996).

2.9.2.

Alcohol content

Pulque samples of 250 mL were distilled according to the method reported by (León et al., 2012). The product obtained was measured with the alcoholmeter (Robsan, México) and the result was expressed as a percentage (% v/v) of alcohol (ethanol).

2.9.3.

Lightness

A Hunter-Lab model 45/0-L colorimeter (Hunter Associates Laboratory, USA) was employed to measure the lightness of the pulque. Color value was expressed as L* to describe the color variation of the samples on a scale from 0 (darkness) to 100 (lightness) (Yildiz et al., 2009).

2.9.4.

Determination of minerals

Quantification of minerals (Ca, Mg, Zn, Fe, Na, and K) was determined by ICP-OES, Inductively Coupled PlasmaOptical Emission Spectrometry (Horiba, USA), according to the 40–75.01 method of AACC International (2000).

2.9.5.

Sensory analysis

Raw and processed pulque were evaluated organoleptically at 22 days of storage by a panel of 15 judges who were familiar with this Mexican beverage. A glass of water and a slice of bread were used by the panelists to cleanse their palates between samples. Pulque samples were graded for three sensory attributes, including color, flavor, and odor. An affective test (hedonic type) was applied to determine the acceptability of the product’s consumption. The samples were measured on the following scale: from 1 = Dislike very much; 2 = Dislike moderately; 3 = Neither dislike nor like; 4 = Like moderately; and 5 = Like very much (Everitt, 2009). In addition, the intensity of two particular flavor notes was assessed, such as acidity and the perception of alcohol. In this case, the scale utilized was as follows: 1 = very weak; 2 = weak; 3 = intermediate; 4 = strong; 5 = very strong.

2.9.6.

Statistical analysis

ANOVA and Tukey tests were employed to determine statistically significant differences among the treatments, considering a significance level of p ≤ 0.05. All statistical analyses were performed using JMP® ver. 8.0.

3.

Results and discussion

3.1. Determination of electrical conductivity and minerals Electrical conductivity is an important parameter for determining whether pulque is a candidate for processing by OH. The results showed that on applying 120 V at 72 ◦ C, a conductivity of 0.22 S/m was obtained. This value was the highest observed, while at voltages of 60–100 V values ranging from 0.10 to 0.15 S/m were noted (Fig. 1). Pulque is a mineral-rich beverage; thus, calcium (65.27 mg/L), sodium (20.03 mg/L), magnesium (10.95 mg/L), potassium (43.31 mg/L), and iron (0.13 mg/L) can contribute to its electrical conductivity. In addition, dissolved substances in

142

Food and Bioproducts Processing 1 1 8 ( 2 0 1 9 ) 139–148

3.2. Microbial reduction load and optimal pasteurization conditions for pulque

Fig. 1 – Determining electrical conductivity on raw pulque at 60, 80, 100 and 120 V and ranging of temperatures from 20 to 72 ◦ C.

ionic form, such as lactic, acetic, and ascorbic organic acids, may also enhance electrical conductivity. It was noted that electrical conductivity increased linearly with the temperature at a constant voltage gradient (Fig. 1), as is expected and consistent with the observation made by various researchers in different products, such as pomegranate juice (Darvishi et al., 2013), meats, and other fruits (Shiby et al., 2014), in which that particular voltage gradient exerted a significant effect. The efficiency of processing by OH depends on the electrical conductivity of the food matrix. Therefore, foods such as fruits with values of 0.067–0.187 S/m are considered to possess low electrical conductivity and slow heating. Electrical conductivity above 0.20 S/m permits efficient and fast processing (Zoltai and Swearingen, 1996). Electrical conductivity values below 0.10 S/m were observed at temperatures ranging from 20 to 50 ◦ C (Fig. 1). These values produce a slower heating rate. Temperatures of 50–72 ◦ C showed better electrical conductivity (0.10–0.22 S/m) at 120 V for processing pulque.

This experiment was conducted previously and necessary prior to evaluating shelf life in order to determine suitable conditions for processing pulque by ohmic heating. The initial content of microorganisms in raw pulque was 8.09 log10 CFU/mL of yeasts and 7.90 log10 CFU/mL of LAB. Pulque did not reveal fungal development. Treatments at 50 ◦ C for 5, 7, 9, and 12 min exhibited reductions ranging from 0.56 to 1.85 log10 CFU/mL for yeasts, while ohmic treatment with a holding temperature of 60 ◦ C during 6, 8, and 10 min demonstrated reductions ranging from 1.64 to 2.73 log10 CFU/mL (Fig. 2A). The maximal reduction of 2.73 log10 allowed the survival of 5.36 log10 CFU/mL of yeasts. This amount of cells would likely still lead to decomposition of pulque and, as a result, a short shelf life. Therefore, treatments at 50 and 60 ◦ C did not exhibit significant reductions of yeasts (p ≤ 0.05). At 65◦ C for 5, 7, and 9 min, yeasts were reduced from 3.19, 4.87, and 6.98 log10 CFU/mL, it was observed that a higher processing time, increases the microbial reduction. Samples processed at 65 ◦ C demonstrated a better microbial reduction than at 60 ◦ C. Treatments at 70 ◦ C during 3 and 5 min reduced 4.98 and 6.45 log10 CFU/mL, respectively (Fig. 2A). According to Mejía et al. (2016), when yeasts such as Saccharomyces cerevisiae are subjected to high temperatures (≥40 ◦ C), they express a gene of Hsp104 protein that confers thermo-tolerance. Therefore, temperatures above 60 ◦ C were necessary for reducing their load. On the other hand, the reduction of lactic acid bacteria at 50 ◦ C was not significant among the times evaluated (p ≤ 0.05). However, at 60 ◦ C for 10 min, a maximum of 2.92 log10 reductions was achieved (Fig. 2B). Treatments at 65 ◦ C during 5, 7, and 9 min revealed better reductions than those at 50 and 60 ◦ C. These reductions in LAB were 4.38, 4.98, and 6.05 log10 (Fig. 2B), while at 70 ◦ C, after 3 and 5 min, decreases of 5.89 and 6.88 log10 were achieved for each treatment. The reductions in yeasts obtained in treatments at 65 ◦ C and 70 ◦ C could contribute to preserving the beverage for more than 3 days. Therefore, it was considered that the optimal treatments for processing pulque by OH were at 65 ◦ C (for 5 and 7 min) and at 70 ◦ C (for 3 and 5 min). These conditions were selected to evaluate the shelf life of the beverage; furthermore, these were sub-lethal and allowed the survival of the yeasts and LAB.

Fig. 2 – Survival curves of yeasts (A) and Lactic Acid Bacteria (B) in pulque processed by ohmic heating at 50, 60, 65 and 70 ◦ C. Each value is expressed as mean ± standard deviation.

Food and Bioproducts Processing 1 1 8 ( 2 0 1 9 ) 139–148

143

Fig. 3 – SEM micrographs of yeasts and Lactobacillus sp. of fresh raw pulque (A) and (B), on processed pulque at 65 ◦ C for 5 min (C) and (D), and at 70 ◦ C for 5 min (E) and (F). Bar is 1 ␮m. These microorganisms are necessary for preserving the probiotic and physicochemical properties in pulque.

3.3. Effects of the ohmic heating treatment on the morphology of LAB and yeasts The typical morphology of yeasts and Lactobacillus sp. from raw pulque is shown in Fig. 3A and B. In the samples of pulque processed by OH at 65 ◦ C during 5 min, yeasts and LAB clearly showed pore formation in their morphology (Fig. 3C and D). This phenomenon is known as electroporation and it occurs due to the effect of electrical current. However, no cellular breaks were observed because the treatment was sublethal. Nevertheless, the yeasts and LAB exhibited changes in their morphology, such as roughness and, specifically greater elongation was observed in yeasts. It is well known that the phenomenon of electroporation causes mainly the formation of pores in the lipid bilayer and of cell-membrane proteins (Castro et al., 1993; Tian et al., 2018). On applying a temperature of 70 ◦ C for 5 min, the damage was more severe, as illustrated in Fig. 3E and F. Consequently, Lactobacillus sp. showed drastic changes in its morphology, including larger pores and a little breakage of the bacterial body, compared with the treatment

at 65 ◦ C for 5 min (Fig. 3D). Yeasts exhibited pore formation and roughness. Similar results were reported by Park and Kang (2013) in the cells of E. coli O157:H7, Salmonella typhi, and L. monocytogenes. These authors applied OH at (60 ◦ C, 30 s) to peptone water and juice apple; the same effect was observed. In general, the effect of electroporation was observed in the evaluated treatments of ohmic heating. Such an effect for microbial reduction confers an advantage for maintaining the quality of the beverage.

3.4. Microbial growth during storage in processed pulque The content of lactic acid bacteria and yeasts determines the probiotic properties and the quality parameters of the beverage. In this study, it was found that, at 22 days of storage, raw pulque showed a maximal growth of 7.35 and 7.53 log10 CFU/mL in LAB and yeasts, respectively (Fig. 4A and B), while in pulque processed by OH at 65 ◦ C for 5 min and 7 min, the yeast content was 6.65 and 6.21 log10 CFU/mL for each treatment (Fig. 4A). For lactic acid bacteria the 5 and 7 min treatments resulted in 6.68 and 5.96 log10 CFU/mL after 22 days of growth (Fig. 4B). At 65 ◦ C and for 5 min, the highest microorganism development

144

Food and Bioproducts Processing 1 1 8 ( 2 0 1 9 ) 139–148

Fig. 4 – Development of yeasts (A) and Lactic Acid Bacteria, LAB (B) in raw pulque (), processing pulque by OH at 65 ◦ C, 5 min(䊉); 65 ◦ C, 7 min (); 70 ◦ C, 3 min(); 70 ◦ C, 5 min (), and conventionally pasteurized pulque () stored for 22 days at 4 ± 1 ◦ C. Each value is expressed as mean ± standard deviation. was observed. Fig. 4A shows that at 70 ◦ C for 3 min and for 5 min after 22 days of storage, a content of 5.38 and 4.0 log10 CFU/mL of yeasts were obtained, while for LAB values, these were 5.67 and 5.50 log10 CFU/mL. Treatments evaluated by OH at 65 ◦ C for 5 and 7 min showed the highest growth of yeasts and LAB. In contrast, levels of these microorganisms in conventionally pasteurized pulque were scarcely achieved the 3.54 log10 CFU/mL for LAB and 3.72 log10 CFU/mL for yeasts. According to (Escalante et al., 2016), a low content of yeasts and lactic acid bacteria could generate an alteration in the sensorial and physicochemical quality of pulque. These microorganisms are responsible for the aroma, color, flavor, ethanol content, and acidity in the fermented beverage. The LAB content is important, due to that it can preserve the probiotic benefits of the beverage. The OH treatments applied gave rise to a sub-lethal effect on the microorganisms; as a result, injured LAB and yeasts are likely to have recovered and multiplied during 22 days of storage. It is suggested that the cells possessed the ability to regenerate after cell damage at temperatures of 4–5 ◦ C. This behavior coincides with that reported by Parra, (2010). This author established that the microorganisms utilized nutrients from pulque as carbon sources for multiplication and development. This event is crucial for preserving the quality of pulque during shelf life. Pulque can be compared to yogurt: both have probiotic benefits and their quality parameters depend on their microbial content (Chlebowska et al., 2019). These results demonstrated that raw pulque had the highest levels of LAB (7.35 log10 CFU/mL) and yeasts (7.53 log10 CFU/mL). This causes rapid decomposition during storage, reducing its shelf life to 3 days. In contrast, pulque processed by OH exhibited microbial stability during 22 days of storage. It demonstrated less microbial content, without losing its probiotic properties. The same effect was not achieved with the conventional pasteurization method. Therefore, the conditions evaluated could be applied in order to pasteurize pulque by OH and to prolong its shelf life up to 22 days at 4 ◦ C. Additionally, OH was more efficient when compared with conventional pasteurization, due to that OH treatment employs processing times of less than 7 min. In addition, OH is a low-cost, energy-saving, and less expensive process, as well as a reliable and safe technology.

3.5. Physicochemical stability in processed pulque during storage Parameters such as pH, color, alcohol content, and sensory aspects define the physicochemical quality of pulque; therefore, changes in these attributes might negatively affect it.

3.5.1.

pH

In raw pulque, it was observed that the pH decreased by 0.18 units to a value of 3.54 after 22 days of storage (Fig. 5), while pulque processed by OH at 65 ◦ C for 5 and 7 min exhibited final pH values of 3.68 and 3.69, respectively. Similar values were obtained in samples processed at 70 ◦ C for 3 min and for 5 min. These presented final pH values of 3.67 and 3.69, respectively. No significant changes (p ≤ 0.05) between these treatments were obtained. With regard to pulque processed by conventional pasteurization, this exhibited an initial and final pH of 3.72 and 3.65, respectively (Figs. 5A and 5B). These values were similar to those of pulque processed by OH. The microbial reduction obtained in treatments by OH and CP permitted reaching stability in the pH. Our results suggest that a high content of LAB could alter the physicochemical quality, as a result of high acidity. This was demonstrated with the pH values in raw pulque and its microbial content obtained (Fig. 4). This conclusion is supported by the investigations conducted by Ricci et al. (2018) and by Téllez et al. (2003). These authors explained that LAB degrade glucose and other carbohydrates present in pulque; as a result, lactic, acetic, and carbonic acid were generated. After treatment by ohmic heating (day zero of storage) on pulque (Figs. 5A and 5B), no significant changes of pH were observed. Therefore, both methods, that is, OH and CP contribute to preserving the stability of pH during storage. They satisfy Mexican standard NMX-V-037-1972, which establishes pH values of 3.5–4.0 for fresh pulque.

3.5.2.

Alcohol content

Regarding ethanol content, this parameter determines the quality index, due to that pulque is considered an alcoholic beverage. Therefore, in the samples evaluated, it was found that raw pulque had 3.58 ± 0.040% (v/v) (Table 1) and, after 22 days of storage at 4 ± 1 ◦ C, it showed an increase of 3.30% (v/v) of ethanol (final value, 6.88 ± 0.11% v/v).

145

Food and Bioproducts Processing 1 1 8 ( 2 0 1 9 ) 139–148

Fig. 5 – Variation of pH during 22 days storage at 4 ± 1 ◦ C in raw pulque, processed by Ohmic Heating (OH) at 65 ◦ C (A), at 70 ◦ C (B), and by conventional pasteurization (CP) (A and B). Each value is expressed as mean ± standard deviation. Table 1 – Alcohol content in raw and processed pulque by conventional pasteurization and ohmic heating stored at 0, 15 and 22 days at 4 ± 1 ◦ C.

Table 2 – Color on pulque processed by OH and conventional pasteurization, and storage during 0, 7, and 22 days at 4 ◦ C.

Parameter

Ethanol (% v/v)

Parameter

Storage days Sample Raw pulque a CP 65 ◦ C/5 min 65 ◦ C/7 min 70 ◦ C/3 min 70 ◦ C/5 min

0

15

22

Storage days

0

7

22

3.58 ± 0.040 3.51 ± 0.03 3.57 ± 0.01 3.55 ± 0.04 3.58 ± 0.03 3.55 ± 0.04

5.97 ± 0.07 3.85 ± 0.07 4.26 ± 0.06 3.98 ± 0.06 4.02 ± 0.17 3.97 ± 0.007

6.88 ± 0.11 4.12 ± 0.08 4.87 ± 0.12 4.45 ± 0.21 4.35 ± 0.19 4.20 ± 0.04

Treatment Raw pulque 1 CP 65 ◦ C/5 min OH 65 ◦ C/7 min OH 70 ◦ C/3 min OH 70 ◦ C/5 min OH

46.62 ± 0.40a 44.44 ± 0.19bc 45.60 ± 0.08ab 42.41 ± 0.25d 44.95 ± 0.39b 43.29 ± 0.31cd

43.27 ± 0.57bc 43.34 ± 0.32ab 42.37 ± 0.03bc 40.76 ± 0.41d 44.83 ± 0.10a 41.78 ± 0.45cd

29.17 ± 0.55ab 26.79 ± 0.16c 27.72 ± 0.24bc 28.95 ± 0.65ab 27.71 ± 0.47bc 29.63 ± 0.36a

Each value is expressed as mean ± standard deviation (n = 2). a

Conventional pasteurization.

The samples processed by OH at 65 ◦ C for 5 and 7 min under the same storage conditions, showed values of 4.87 ± 0.12% (v/v) and 4.45 ± 0.21% (v/v), respectively (Table 1). However, pulque processed by OH at 70 ◦ C during 3 min and 5 min demonstrated contents from 4.20 to 4.35% (v/v), respectively. Pulque processed by conventional pasteurization exhibited a content of 4.12 ± 0.08% (v/v). This content was lower than the content obtained in pulque processed by OH. The samples processed by ohmic heating and conventional pasteurization complied with Mexican standard NMX-V-037-1972 for commercial pulque, which establishes an alcohol content ranging from 4.0 to 6.0% (v/v). Treatments by OH revealed higher alcohol content than conventional pasteurization in pulque during storage, these results are consistent with the levels of yeasts in the 3 products (raw pulque, conventional pasteurization, and OH). These microorganisms produce ethanol by means of the fermentation of carbohydrates such as glucose; therefore, a low content can generate less production of alcohol (Leng et al., 2004). This was demonstrated with values obtained in the CP treatment. The alcoholic concentration of pulque is slightly increased during storage of the OH treated sample.

3.5.3.

Color

Color is a parameter that defines the visual acceptance of the product. It was observed that raw pulque has an initial lightness L* value of 46.62 ± 0.40 (Table 2). However, over the storage time, this parameter decreases. At 22 days, it revealed

L*

L*: lightness value. Each value is expressed as mean ± standard deviation (n = 3). Values with the same letter in the same column are not significantly different according at p ≤ 0.05. 1 Conventional pasteurization (63 ◦ C, 30 min).

a lightness of 29.17 ± 0.55. Similar behavior was observed in all OH and CP treatments. Samples processed by OH at 65 ◦ C for 5 min and for 7 min exhibited values of lightness of 27.72 ± 0.24 and 28.95 ± 0.95, respectively, at 22 days storage, while at 70 ◦ C for 5 min, the samples showed similar lightness value (29.63 ± 0.36) to that of raw pulque. On the other hand, conventional pasteurization demonstrated a lower lightness value (26.79) compared that of OH treatments (Table 2). A study conducted by Leizerson and Shimoni, (2005), who reported stability in the L* value of orange juice processed by OH during storage. In our results, changes in color could be altered by the microbial activity in carbohydrates. However, at 22 days of storage, higher values of lightness were obtained in OH treatments compared with those with CP. Therefore, the results obtained showed that OH may contribute to preserving the quality of color in pulque during storage.

3.5.4.

Sensory analysis

The sensory parameter is important because it determines the quality and acceptance of the product by the consumer. In the results evaluated at 22 days of storage, the only sample that showed significant changes in flavor was raw pulque (Table 3). Best taste according to the panelists was exhibited by the treatments at 65 ◦ C for 5 min and for 7 min (Table 3).Treat-

146

Food and Bioproducts Processing 1 1 8 ( 2 0 1 9 ) 139–148

Table 3 – Sensory analysis of pulque processed by OH and conventional pasteurization and storage during 22 days at 4 ◦ C. (N = 15 judges). Treatments/ parameter

Flavor

Color

Aroma

b

Acidity b Alcoholic perception

65 ◦ C /5 min OH 65 ◦ C/7 min OH 70 ◦ C/3 min OH 70 ◦ C/5 min OH a CP Raw pulque

4.0a 4.0a 2.9b 2.9b 2.7b 1.0c

4.2a 4.1a 4.0a 4.6a 2.9b 1.0c

4.2a 4.3a 4.1a 4.6a 2.9b 1.0c

3.6ab 3.8a 2.3c 3.1ab 3.3ab 5.0d

4.1b 4.9a 2.9cd 2.4d 3.4c 5.0e

Values followed by the same letter in the same column is not significant different at p ≤ 0.05. Sensory code: 1 = Dislike very much; 2 = Dislike moderately; 3 = Neither like nor dislike; 4 = Like moderately; 5 = Like very much. a b

CP: Conventional pasteurization (63 ◦ C, 30 min). Intensity scale: 1 = very weak; 2 = weak; 3 = intermediate; 4 = strong, and 5 = very strong.

ments by OH demonstrated better acceptance in terms of color and aroma than pulque processed by conventional pasteurization; as a result, treatments with significant changes in these parameters included raw pulque and conventional pasteurization (p ≥ 0.05). A low content of yeasts can alter the flavor and aroma of the beverages (Lappe et al., 2008; Wang et al., 2018; Loviso and Libkind, 2019). Conventional pasteurization exhibited a lesser content of yeasts (Fig. 4A): thus, its acceptability was lower than that for OH. Regarding notes of flavor, such as acidity and the perception of alcohol, these are essential; due to that pulque is an acidic and an alcohol-fermented beverage. The results obtained in Table 3 showed that raw pulque exhibited a very strong acidity, as a consequently, the product is not palatable for consumption, while samples processed by OH at 65 ◦ C for 5 and for 7 min and 70 ◦ C for 5 min showed moderate acidity. The same intensity of acidity was observed for samples processed by conventional pasteurization (Table 3). By the contrast, according to the panelists the treatment at 70 ◦ C for 3 min revealed a weak acidity. Similar results were obtained by (Leizerson and Shimoni, 2005) in orange juice processed by both methods, CP and OH. Additionally, a strong alcoholic perception was obtained for treatments at 65 ◦ C for 5 and for 7 min. This means that pulque preserves a good content of alcohol at 22 days of storage and, therefore the beverage is acceptable for consumption. According to the scale alcoholic perception raw pulque revealed a very strong perception, while treatments by CP showed a perception intermediate (Table 3). The ohmic heat treatments demonstrated better sensory-quality retention compared with those of conventional pasteurization. Therefore, OH could be a good option for processing and preserving the quality of pulque.

3.6.

Identification of lactic acid Bacteria and yeasts

Identification allows us to know whether pulque processed by OH preserves some LAB species with probiotic activity as already reported, and the proven survival of Saccharomyces cerevisiae. It was found that Lactobacilli identified in raw and processed pulque comprised Lactobacillus acidophilus and Lactobacillus kefiri. Both species had a percentage of homology greater than 95% according to the BLAST database. The species identified of yeasts was Saccharomyces cerevisiae with a homology of 99%. Through this research, it has been emphasized

that the presence of LAB and yeasts in pulque is indispensable, in that they contribute to the sensory, physicochemical, and probiotic quality. Regarding the probiotic aspect, it has been reported that L. kefiri possesses antimicrobial properties against Gram-negative and Gram-positive pathogenic strains (Carasi et al., 2014), while L. acidophilus can adhere to the intestinal mucosa, forming a protective barrier (Saito, 2004). Foods containing these microorganisms (L. kefiri and L. acidophilus) are believed to provide probiotic and health benefits. In pulque, there is a diversity of LAB species with probiotic activity, such as Lactobacillus plantarum, Leuconostoc mesenteroides, Lactobacillus paracasei, and Lactobacillus brevis. Thus, it is a non-dairy fermented beverage that offers many benefits to the consumer. On the other hand, Saccharomyces cerevisiae is very well known as being the main yeasts responsible for producing ethanol in alcoholic beverages. It also participates in the formation of compounds for sensory properties (Estrada et al., 2001). This microorganism has many applications in food industry. In general, it has been demonstrated that pulque processed by OH retains its probiotic properties, on the identification of some of the LAB species that survived the treatments. Therefore, this investigation suggests that OH could be a viable technology for processing pulque and preserving its properties.

4.

Conclusions

Pulque showed good electrical conductivity at voltages higher than 100 V due to its mineral content, while that the best treatments for processing pulque by OH were those at 65 ◦ C for 5 min and for 7 min. They exhibited the preservation of the physicochemical, sensory, and probiotic properties in pulque up to 22 days of storage at 4 ◦ C. In contrast, pulque processed by conventional pasteurization exhibited less content of probiotic bacteria (LAB), and its acceptation according to sensory evaluation demonstrated, a lower preference that processed by OH treatments. This research proposes OH as an alternative technology to conventional pasteurization for pulque processing. Furthermore, OH is low-cost, consumer-friendly, and preserves the quality parameters of pulque. This method can provide an attractive option for the beverage industry that aims to process or develop novel non-dairy, probiotic fermented alcoholic products, and fermented food in general, without the use of preservatives that altering quality. The LAB species found in pulque processed by OH were L. acidophilus and L. kefiri. This demonstrated that pulque preserves LAB with probiotic properties. Additionally, these microorganisms could open a new opportunity for the development of new industrial applications, or for the addition this microorganism to foods and beverages to increase their probiotic benefits.

Funding This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.

Acknowledgments Alejandra Elizabeth Alcántara-Zavala thanks CONACYTMéxico for her PhD fellowship and José Juan Véles, Verónica Flores, David Santiago, Alfonso Topete, and Dalia Miranda for their technical support.

Food and Bioproducts Processing 1 1 8 ( 2 0 1 9 ) 139–148

References AACC international, 2000. Approved methods of analysis. In: Method 40-75.01 Mineral Determination, 10th ed. AACC International, Minessota. Aldrete, T.A., Escobar, R.M.C., Tamplin, M.L., Hernández, I.M., 2014. High-throughput sequencing of microbial communities in poro cheese, an artisanal Mexican cheese. Food Microbiol. 44, 136–141, http://dx.doi.org/10.1016/j.fm.2014.05.022. AOAC, Official Methods of Analysis, 1996. Method 981.12 Quantitative Chemistry. Bruman, H.J., 2000. Alcohol in Ancient Mexico. University of Utah Press, Utah. Carasi, P., Díaz, M., Racedo, M.S., De Antoni, G., Urdaci, M.C., Serradell, M., 2014. Safety characterization and microbial properties of kéfir isolated Lactobacillus kefiri. Biomed Res. Int., 1–7, http://dx.doi.org/10.1155/2014/208974. Castro, J.A., Barbosa, C.G.V., Swanson, B., 1993. Microbial inactivation of foods by pulsed electric fields. J. Food Process. Preserv. 17, 43–73, http://dx.doi.org/10.1111/j.1745-4549.1993.tb00225.x. Charles, R.A.V., Névarez, M.G.V., Zhang, Q.H., Ortega, R.E., 2007. Comparison of thermal processing and pulsed electric fields treatment in pasteurization of apple juice. Food Bioprod. Process. 85 (C2), 93–97, http://dx.doi.org/10.1205/fbp06045. Chlebowska, S.A., Gniewosz, M., Kieliszek, M., Bzducha, W.A., 2017. The effect of pullulan on the growth and acidifying activity of selected stool microflora of human. Curr. Pharm. Biotechnol. 18 (2), 121–126, http://dx.doi.org/10.2174/1389201017666161229154324. ´ Chlebowska, S.A., Kycia, K., Skocinska, N.K., Kieliszek, M., Gniewosz, M., Krajewska, K.D., 2019. Effect of pullulan on physicochemical, microbiological, and sensory quality of yogurts. Curr. Pharm. Biotechnol. 20 (6), 489–496, http://dx.doi.org/10.2174/1389201020666190416151129. Darvishi, H., Khostaghaza, H.M., Najafi, G., 2013. Ohmic heating of pomegranate juice: electrical conductivity and pH change. J. Saudi Soc. Agric. Sci. 12, 101–108, http://dx.doi.org/10.1016/j.jssas.2012.08.003. Escalante, A., Giles, G.M., Esquivel, F.G., Matus, A.V., Moreno, T.R., López, M.A., 2012. Pulque fermentation. In: Hui, Y.H. (Ed.), Handbook of Plant-Based Fermented Food and Beverage Technology. CRC Press, Boca Raton, FL, pp. 691–706. Escalante, A., Giles, G.M., Hernández, G., Córdova, A.M., López, M.A., Gosset, G., 2008. Analysis of bacteria community during the fermentation of pulque, a traditional Mexican alcoholic beverage, using a polyphasic approach. Int. J. Food Microbiol. 124, 126–134, http://dx.doi.org/10.1016/j.ijfoodmicro.2008.03.003. Escalante, A., López, S.D.R., Velázquez, G.J.E., Gilez, G.M., Bolívar, F., López, M.A., 2016. Pulque, a traditional Mexican alcoholic fermented beverage: historical, microbiological, and technical aspects. Front. Microbiol. 7 (June), 1–18, http://dx.doi.org/10.3389/fmicb.2016.01026. Estrada, G.A.R., Cruz, A.E., Lappe, P., Ulloa, M., García, G.M., Gómez, R.L., 2001. Isolation and identication of killer yeasts from Agave sap (aguamiel) and pulque. World J. Microbiol. Biotechnol. 17, 557–560. Everitt, Margaret, 2009. Chapter 8: consumer-target sensory quality. In: Academic press (Ed.), Global Issues in Food Science and Technology. Washington State University, Pullman, WA, USA, pp. 117–128, http://dx.doi.org/10.1016/B978-0-12-374124-0.00008-9. FDA, 1984. Bacteriological Analytical Manual (BAM), 6th ed. United States Food and Drug Administration, Washingtong, D.C. FDA, 1998. Hazard Analysis and Critical Control Points (HACCP), Procedures for the Safe and Sanitary Processing and Importing of Juice, 63., pp. 20450–20486. Gómez, M.G., Giovanni, J., García, S., Matus, V., Quinatana, I.C., Bolívar, F., Escalante, A., 2016. In vitro and in vivo probiotic assessment of Leuconostoc mesenteroides P45 isolated from

147

pulque, a Mexican traditional alcoholic beverage. SpringerPlus 5 (708), 1–10, http://dx.doi.org/10.1186/s40064-016-2370-7. González, V.R., Azaola, E.A., Mayorga, R.L., Reyes, N.L.A., Shah, N.P., Rivera, E.Y., 2015. Isolation, identification and partial characterization of a Lactobacillus casei strain with bile salt hydrolase activity from pulque. Probiotic and Antimicrobial Protector 7, 242–248, http://dx.doi.org/10.1007/s12602-015-9202-x. Icier, F., Ilicali, C., 2005. The effects of concentration on electrical conductivity of orange juice concentrates during ohmic heating. Eur. Food Res. Technol. 220, 406–414, http://dx.doi.org/10.1007/s00217-004-1043-x. Jennings, J., Antrobus, K.L., Atencio, S.J., Glavich, E., Johnson, R., Loffler, G., 2005. Drinking Beer in a Blissful Mood”: Alcohol Production, Operational Chains, and Feasting in the Ancient World. Curr. Anthropol. 46, 275–303. Jun, S., Sastry, S., 2005. Modelling and optimization of ohmic heating of foods inside a flexible package. J. Food Process Eng. 28 (4), 417–436, http://dx.doi.org/10.1111/j.1745-4530.2005.00032.x. Knirsch, M.C., Alves, D.C., De Oliveira, M., Soares, V.A., Vessoni, P.T., 2010. Ohmic heating–a review. Trends Food Sci. Technol. 21 (9), 436–444, http://dx.doi.org/10.1016/j.tifs.2010.06.003. Lappe, O.P., Moreno, T.M., Arrizón, G.J., Herrera, S.T., García, M.A., Gschaedler, M.A., 2008. Yeasts associated with the production of Mexican alcoholic nondestilled and distilled Agave beverages. FEMS Yeast Res. J. 8, 1037–1052, http://dx.doi.org/10.1111/j.1567-1364.2008.00430.x. Leizerson, S., Shimoni, E., 2005. Stability and sensory shelf life of orange juice pasteurized by continuous ohmic heating. J. Food Agric. Food Chem. 53, 4012–4018, http://dx.doi.org/10.1021/jf047857q. Leng, A.T., Heard, G., Cox, J., 2004. Yeast ecology of kombucha fermentation. Int. J. Food Microbiol. 95, 119–126, http://dx.doi.org/10.1016/j.ijfoodmicro.2003.12.020. León, O.D.I., Méndez, C.D.S., Rodríguez, P.D.P., Puente, H.L., García, S.F.I., Salgado, B.R., 2012. Bromatological analysis and isolation of microorganisms with probiotic potential from pulque. Investigación Universitaria Multidisciplinaria 1 (11), 115–122. Loviso, C., Libkind, D., 2019. Síntesis y regulación de los compuestos del aroma y sabor derivados de la levadura en la cerveza: alcoholes superiores. Rev. Argent. Microbiol., http://dx.doi.org/10.1016/j.ram.2018.08.006, Article in press. Mejía, B.J., Montoya, P.R., Cortés, R.C., Saavedra, M.A., 2016. Levaduras termotolerantes: aplicaciones industriales, estrés oxidativo y respuesta antioxidante. Información Tecnológica 27 (4), 3–16. Morales, S.E., Figueroa, C.J.D., Gaytán, M.M., 2009. Wet method for measuring starch gelatinization temperature using electrical conductivity. J. Food Sci. 74 (7), E382–E385, http://dx.doi.org/10.1111/j.1750-3841.2009.01279.x. NMX-V-037-1972. Secretaria de Economía, 1972. Pulque Manejado a Granel. Normas Mexicanas Vigentes, Available online at: http://www.economia-nmx.gob.mx/normasmx/detallenorma. nmx?clave=NMX-V-037-1972 [Accessed 10 June 2019]. Park, I.K., Kang, D.H., 2013. Effect of electropermeabilization by ohmic heating for inactivation of Escherichia coli O157:H7, Salmonella enterica Serovar Typhimurium, and Listeria monocytogenes in buffered peptone water and apple juice. Appl. Environ. Microbiol. 79 (23), 7122–7129, http://dx.doi.org/10.1128/AEM.01818-13. Parra, H.R.A., 2010. Review lactic acid bacteria: functional role in the foods. Facultad de Ciencias Agropecuarias 8 (1), 94–105. Prado, F.C., Parada, J.L., Pandey, A., Soccol, C.R., 2008. Trends in non-dairy probiotic beverages. Food Res. Int. 41 (2), 111–123, http://dx.doi.org/10.1016/j.foodres.2007.10.010. Ramírez, J.R., Sánchez, M.A., Álvarez, M.M., Valyasevi, R., 2004. Industrialization of Mexican pulque. In: Steinkraus, K.H. (Ed.), Industrialization of Indigenous Fermented Foods. Marcel Decker, New York, NY, pp. 547–585. Ricci, A., Dall’Asta, C., Galaverna, G., Lazzi, C., 2018. Volatile profile of elderberry juice: effect of lactic acid fermentation

148

Food and Bioproducts Processing 1 1 8 ( 2 0 1 9 ) 139–148

using L. plantarum, L. Rhamnosus and L. Casi strains. Food Res. Int. 105, 412–1422, http://dx.doi.org/10.1016/j.foodres.2017.11.042. Saito, T., 2004. Selection of useful probiotic lactic acid bacteria from the Lactobacillus acidophilus group and their applications to functional foods. J. Anim. Sci. 75, 1–13. Shiby, V.K., Pandey, M.C., Radhakrishna, K., 2014. Technology, applications and modelling of ohmic heating: a review. J. Food Sci. Technol. 51 (10), 2304–2317, http://dx.doi.org/10.1007/s13197-012-0710-3. Soliva, F.R., Balasa, A., Knorr, D., Belloso, O.M., 2009. Effects of pulsed electric fields on bioactive compounds in foods: a review. Trends Food Sci. Technol. 20, 544–556, http://dx.doi.org/10.1016/j.tifs.2009.07.003. Téllez, S.J., Moldes, A.B., Vázquez, M., Alonso, J.L., 2003. Alternative media for lactic acid production by Lactobacillus delbrueckii NRRL B-445. Food Bioprod. Process. 81 (3), 250–256. Tian, X., Yu, Q., Wu, W., D. R, 2018. Inactivation of microorganisms in foods by ohmic heating: a review. J. Food Prot. 81 (7), 1093–1107, http://dx.doi.org/10.4315/0362-028X.JFP-17-343. Torkian, B.M., Mohammd, B.A., Beheshti, B., Ebrahim, H.S., 2015. The process of producing tomato paste by ohmic heating method. J. Food Sci. Technol. 52 (6), 3598–3606, http://dx.doi.org/10.1007/s13197-014-1424-5.

Torres, M.E., Lenoir, M., Mayorga, R.L., Thibault, A., Sokol, H., Langella, P., Sánchez, P.M.E., Bermúdez, H.L.G., 2016. Identification of novel anti-inflammatory probiotic strains isolated from pulque. Appl. Microbiol. Biotechnol. 100, 385–396, http://dx.doi.org/10.1007/s00253-015-7049-4. Tovar, L.R., Olivos, M., Gutierrez, M.E., 2008. Pulque, an alcoholic drink from rural Mexico, contains phytase. Its in vitro effects on corn tortilla. Plant Foods Hum. Nutr. 63, 189–194, http://dx.doi.org/10.1007/s11130-008-0089-5. Valadez, B.R., Bravo, V.G., Santos, S.F.N., Velasco, A.S.I., Montville, T.J., 2012. The artisanal production of pulque, a traditional beverage of the Mexican highlands. Probiotics Antimicrob. Proteins 4, 140–144, http://dx.doi.org/10.1007/s12602-012-9096-9. Wang, M.T., Yang, J.G., Zhao, Q.S., Zhang, K.Z., Su, C., 2018. Research progress on flavor compounds and microorganisms of Maotai flavor baijiu. J. Food Sci. 0, 1–13, http://dx.doi.org/10.1111/1750-3841.14409. Yildiz, H., Bozkurt, H., Icier, F., 2009. Ohmic and conventional heating of pomegranate juice: effects on rheology, color, and total phenolics. Food Sci. Technol. Int. 15 (5), 503–512, http://dx.doi.org/10.1177/1082013209350352. Zoltai, P., Swearingen, P., 1996. Product development considerations for ohmic processing. Food Sci. Technol. 50, 263–266.