- Email: [email protected]
Application of potassium polyacrylate increases soil water status and improves growth of bermudagrass (Cynodon dactylon) under drought stress condition
G Model
ARTICLE IN PRESS
HORTI-6133; No. of Pages 7
Scientia Horticulturae xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti
Application of potassium polyacrylate increases soil water status and improves growth of bermudagrass (Cynodon dactylon) under drought stress condition Xun Liu a,b , Zhulong Chan a,∗ a Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan 430074, China b University of Chinese Academy of Sciences, Beijing 100039, China
a r t i c l e
i n f o
Article history: Received 29 June 2015 Received in revised form 21 October 2015 Accepted 23 October 2015 Available online xxx Keywords: Bermudagrass Drought Potassium polyacrylate Super-absorbent polymers Reactive oxygen species
a b s t r a c t Water availability is the key factor limiting plant growth and development especially in dry and semiarid ecosystems. Super-absorbent polymers help soil keep water after raining or irrigation, and release water gradually during plant growth. This study examined the effect of potassium polyacrylate (K-PAM) on soil water content and physiological changes of bermudagrass in the greenhouse. The results showed that incorporation of K-PAM increased soil water content and survival rate of bermudagrass. Physiological parameter analysis showed that K-PAM treatment resulted in decreased cell membrane damage through modulation of EL and MDA contents in bermudagrass. Plants grown with K-PAM accumulated higher amount of proteins and proline under stress condition, and decreased ROS production. Expression level of several ROS related genes and stress inducible genes were largely up-regulated in plants by drought stress. However, plants grown in K-PAM mixed soil exhibited lower gene expression levels when compared to plants without K-PAM. The results indicated that K-PAM application effectively increased soil water content and improved bermudagrass growth under drought stress condition. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Of the Earth’s ice-free land surface, only 3% have a high level of productivity, while about 30% are too dry (deserts and dryland soils) for agricultural crop production (Osman, 2013). Drought is the most severe abiotic stress which significantly limits plant growth and development. To cope with the harsh environmental conditions including drought, plants develop complex mechanisms to adapt to stress conditions and reduce damages caused by water stress, including modulation of stress responsive genes which resulted in accumulation of osmolytes, detoxification of oxidative stress, modification of cell wall and reduced water loss through regulation of stomatal closure. Although limiting water loss is important for plant survival under drought stress condition, water availability is the key factor for plant growth especially in dry and semiarid ecosystems (Chirino
Abbreviations: EL, electrolyte leakage; GR, glutathione reductase; GSH, glutathione; K-PAM, potassium polyacrylate; MDA, malondialdehyde; POD, peroxidase; ROS, reactive oxygen species; SAPs, super-absorbent polymers; SOD, superoxide dismutase. ∗ Corresponding author. Fax: +86 27 87510251. E-mail address: [email protected] (Z. Chan).
et al., 2011). Under natural environment condition, drought stress varies in severity, timing and duration because of changes in rainfall patterns (Chenu et al., 2013; Kirkegaard et al., 2007). Recently, increased water deficits associated with over-use of surface water and groundwater are largely threatening the sustainability of agricultural production globally. Therefore, use of super-absorbent polymers (SAPs) is an effective approach to increase soil water availability (Azzam, 1983; Blodgett et al., 1993; Taylor and Halfacre, 1986; Islam et al., 2011a,b,c,d). SAPs help plants soil keep water after raining or irrigation and release water gradually in soil during plant growth. Application of SAPs enhances seed germination and emergence, crop growth and yield, and reduces the irrigation requirement of plants (Azzam, 1983; Blodgett et al., 1993; Gehring and Lewis, 1980; Yazdani et al., 2007). Because of technical development, costs for SAPs production decreased and the prices became comparatively cheaper (about 5 USD kg−1 ) (Islam et al., 2011b). Additionally, polymers are safe and non-toxic and will finally decompose to carbon dioxide, water, ammonia, and potassium ion, without any residue (Mikkelsen, 1994). There are no environmental problems for SAPs application in the field. Bermudagrass (Cynodon dactylon) is a widely used warm-season turfgrass on home lawns, golf courses, sport fields and ecosystem
http://dx.doi.org/10.1016/j.scienta.2015.10.041 0304-4238/© 2015 Elsevier B.V. All rights reserved.
Please cite this article in press as: Liu, X., Chan, Z., Application of potassium polyacrylate increases soil water status and improves growth of bermudagrass (Cynodon dactylon) under drought stress condition. Sci. Hortic. (2015), http://dx.doi.org/10.1016/j.scienta.2015.10.041
G Model HORTI-6133; No. of Pages 7
ARTICLE IN PRESS X. Liu, Z. Chan / Scientia Horticulturae xxx (2015) xxx–xxx
2
restoration. As a C4 grass, bermudagrass is adapted to cultivation in a wide range of hot, dry climatic regions and generally considered to have superior drought resistance to other warm-season turfgrass species (Carrow, 1995, 1996; Qian and Fry, 1997; Shi et al., 2013a,b). However, water consumption of bermudagrass is considerably high, especially for lawn maintaining in arid and semiarid regions. In this study, potassium polyacrylate (K-PAM) was applied as a SAP during cultivation of bermudagrass in a greenhouse. The soil water content was monitored and plant physiological changes were assayed. Expression level changes of several stress inducible genes were also determined after application of K-PAM.
Table 1 List of primer sequences used for gene expression analysis. Gene
Primer sequence
SOD
Forward: CTGACTGGGCCTCATTCTATAC Reverse: CCTGCGTTTCCTGTTGATTTAC Forward: CAGTGCTGGACAACAACTACTA Reverse: TCCTTCCACAGCGTCTCGTT Forward: GTGCCATTGTCCTTCTCTTG Reverse: CGCAGGGATGGTTCTTAGAG Forward: ACGTCATGAAGCTGCAGATC Reverse: CCATTTGTTTTCCCTTCACCC
POD OSMOTIN SULFUR E2
dismutase (SOD) activity was measured by the NBT-illumination method as described by Shi et al. (2012).
2. Materials and methods 2.5. Measurement of proline and GSH contents 2.1. Plant materials and growth conditions The seeds of bermudagrass (provided by American Seed Research of Oregon Company, USA) were first vernalized at 4 ◦ C for 7 days in darkness. Then, the seeds were sterilized with 70% alcohol for 5 min and sown in the nutrient soil (Beilei Fertilizer Company, Zhengjiang, China). The seeds germinated and grew in the growth room which was controlled at an irradiance of about 150 m quantam−2 s−1 , 16 h light and 8 h dark cycles, 28 ±2 ◦ C, and about 65–75% relative air humidity. 2.2. Plant treatment At the 11th day after sowing, the seedlings were transferred to new pots filled with the same nutrient soil with or without 1% K-PAM based on preliminary experiment. The 21-day-old plants with the same size were subjected to drought treatment by withholding water in the soil for 21 days. For the control treatment, plants were watered every other day. Each treatment contained five pots and each pot had at least 90 seedlings. All the pots were conducted in a completely random design and rotated every day to minimize the environmental deviation. The soil water content was measured at 7, 14 and 21 days after withholding water, using the soil moisture and temperature recorder (L99-TWS-1, Shanghai, China). At 7, 14 and 21 day, the leaf samples were collected for physiological parameter measurement and gene expression analyses. At 2 day after re-watering, the survival rate of each treatment was measured. 2.3. Assay of electrolyte leakage (EL) For EL assay, 0.15 g plant leaf samples were shaken in Mili-Q water for 6 h at the room temperature to take initial conductivity (Ci ). Leaf samples were then boiled for 15 min and cooled to room temperature to take the fully divided conductivity (Cmax ). The electrolyte leakage was calculated as the ratio of Ci and Cmax . 2.4. Determination of soluble protein and antioxidant enzyme activities
The proline was extracted using sulfosalicylic acid, and the samples were boiled with acidic-ninhydrin for 40 min. The proline content was measured at 520 nm absorbance after the samples cooling to room temperature (Shi et al., 2012). GSH content was assayed using the GSH Assay Kit (Nanjing Jiancheng, China) according to the manufacturer’s instructions. 2.6. Quantification of malondialdehyde (MDA) and H2 O2 The MDA of bermudagrass was extracted using thiobarbituric acid (TBA) reagent and MDA content was determined at 450, 532 and 600 nm of absorbance with a spectrometer as described by Yang et al. (2015). The content of H2 O2 was measured using the titanium sulfate regent as described by Shi et al. (2012). 2.7. Quantitative realtime PCR Total RNA was isolated from fresh leaves of bermudagrass using TRIzol reagent (Invitrogen, USA). First Strand cDNA was synthesized using the RevertAidTM First Strand cDNA Synthesis Kit (TOYOBO, Japan), according to the manufacturer’s instructions. The qPCR was performed by the SYBR-green fluorescence using a CFX96 Real Time PCR Detection System (BIO-RAD, USA). The relative fold change in gene expression was calculated following the CT method (Livak and Schmittgen, 2001). Three independent biological replicates and three technical replicates for each sample were maintained. The primers for selected genes were designed based on previous RNA sequencing data (Shi et al., 2015) and listed as Table 1. 2.8. Statistical analysis In this study, SPSS 20.0 software was used for statistical analyses. The treatment differences were performed by ANOVA, and variables contented at least three replicates. Mean separations were performed using Duncan’s multiple range test with P ≤ 0.05. 3. Results 3.1. K-PAM improved drought tolerance of bermudagrass
For protein extraction, 1.5 g samples were triturated with liquid nitrogen and homogenized in phosphate buffer. The samples were then centrifuged at 12,000 × g for 15 min. The supernatant was used for the measurement of antioxidant enzyme activities, glutathione (GSH) content and H2 O2 content. According to the manufacturer’s instructions, the peroxidase (POD) and glutathione reductase (GR) activities were assayed using Plant POD Assay Kit (Nanjing Jiancheng, China) and GR Assay Kit (Beyotime, China), respectively. The superoxide
After 21 days of withholding water, plants in pots without KPAM were wilted and plant growth was severely retarded, whereas most plants in pots with K-PAM were green and healthy (Fig. 1A). At 2 day after rewatering, most plants in pots with K-PAM survived, but plants in pots without K-PAM were completely dead (Fig. 1A). The soil water content was measured at 7, 14 and 21 day after withholding water. There were significant differences in soil water content between pots with K-PAM and without K-PAM. At 14
Please cite this article in press as: Liu, X., Chan, Z., Application of potassium polyacrylate increases soil water status and improves growth of bermudagrass (Cynodon dactylon) under drought stress condition. Sci. Hortic. (2015), http://dx.doi.org/10.1016/j.scienta.2015.10.041
G Model HORTI-6133; No. of Pages 7
ARTICLE IN PRESS X. Liu, Z. Chan / Scientia Horticulturae xxx (2015) xxx–xxx
3
Fig. 1. Potassium polyacrylate (K-PAM) improved bermudagrass drought tolerance. (A) Phenotype of bermudagrass before and after drought treatment with or without K-PAM; B: Soil water content at 7, 14, and 21 day after drought treatment. Vertical bars represent mean values ± the standard deviation for each mean. The vertical bars with different lower-case letters are significantly different from each other at P ≤ 0.05 according to Duncan’s method.
and 21 day after treatment, soil water content in pots with K-PAM was significantly higher than that in pots without K-PAM (Fig. 1B). The results indicated that application of K-PAM increased soil water content resulting in improved bermudagrass growth under drought stress condition. 3.2. Effect of K-PAM on changes of EL, MDA, protein, and proline contents After drought stress treatment, EL and MDA content were examined. At 7 and 14 day after drought treatment, the EL in all plants did not show any significant differences. However, at 21 day after drought treatment, the EL in plants without K-PAM largely increased and was significantly higher than that in plants with K-PAM (Fig. 2A). Application of K-PAM resulted in slightly
decreased MDA content at 7 and 14 day, but significantly declined MDA content at 21 day after withholding water (Fig. 2B). These results showed that K-PAM application caused decreased membrane damage through modulation of EL and MDA contents in bermudagrass. Under controlled condition, the protein content showed no significant difference in samples after 7, 14 and 21 days drought treatment. However, after drought treatment for 21 day, the protein content in plants without K-PAM was significantly higher than that in plants with K-PAM (Fig. 2C). Drought stress treatment gradually increased proline content in all bermudagrass plants. However, proline content in plants without K-PAM was the highest after drought treatment (Fig. 2D). These results indicated that plants without K-PAM accumulated higher amount of proteins and proline under stress condition.
Please cite this article in press as: Liu, X., Chan, Z., Application of potassium polyacrylate increases soil water status and improves growth of bermudagrass (Cynodon dactylon) under drought stress condition. Sci. Hortic. (2015), http://dx.doi.org/10.1016/j.scienta.2015.10.041
G Model HORTI-6133; No. of Pages 7 4
ARTICLE IN PRESS X. Liu, Z. Chan / Scientia Horticulturae xxx (2015) xxx–xxx
Fig. 2. Effect of potassium polyacrylate (K-PAM) on changes of bermudagrass electrolyte leakage (A), MDA content (B), protein content (C) and proline content (D) before and after drought treatment. Vertical bars represent mean values ± the standard deviation for each mean. The vertical bars with different lower-case letters are significantly different from each other at P ≤ 0.05 according to Duncan’s method.
3.3. K-PAM treatment modulated reactive oxygen species (ROS) pathway In order to test how ROS were involved in plant stress responses after application of K-PAM, H2 O2 content, POD and SOD activities were assayed in this study (Fig. 3). At 21 day after drought treatment, plants without K-PAM accumulated significantly higher H2 O2 than others (Fig. 3A). Consistently, the activity of POD in
plants without K-PAM was significantly lower than that in plants with K-PAM (Fig. 3B). Drought treatment increased the SOD activity, and plants without K-PAM exhibited highest SOD activity than others at 21 day under drought condition (Fig. 3C). Therefore, application of K-PAM alleviated ROS over-production in bermudagrass plants partially through modulation of antioxidant enzyme activities.
Please cite this article in press as: Liu, X., Chan, Z., Application of potassium polyacrylate increases soil water status and improves growth of bermudagrass (Cynodon dactylon) under drought stress condition. Sci. Hortic. (2015), http://dx.doi.org/10.1016/j.scienta.2015.10.041
G Model HORTI-6133; No. of Pages 7
ARTICLE IN PRESS X. Liu, Z. Chan / Scientia Horticulturae xxx (2015) xxx–xxx
5
Fig. 4. Effect of potassium polyacrylate (K-PAM) on changes of bermudagrass GR activity (A) and GSH content (B) before and after drought treatment. Vertical bars represent mean values ± the standard deviation for each mean. The vertical bars with different lower-case letters are significantly different from each other at P ≤ 0.05 according to Duncan’s method.
fold, respectively, higher than those in plants with K-PAM (Fig. 5C and D). Therefore, the application of K-PAM inhibited expression of these stress responsive gene in bermudagrass. 4. Discussion
Fig. 3. Modulation of ROS pathway by K-PAM before and after drought treatment. Vertical bars represent mean values ± the standard deviation for each mean. The vertical bars with different lower-case letters are significantly different from each other at P ≤ 0.05 according to Duncan’s method.
3.4. Effect of K-PAM on changes of GR and GSH levels GR activity in plants without K-PAM was significantly higher than that in plants with K-PAM at 7, 14 and 21 days after drought treatment (Fig. 4A). Although no significant difference was observed for GSH content between drought treatment and control at 7 and 14 days, plants without K-PAM treatment exhibited highest GSH content at 21 day under drought condition (Fig. 5B). 3.5. Modulation of stress responsive gene expression after application of K-PAM Based on previous results (Shi et al., 2015), several stress inducible genes in bermudagrass were selected for gene expression analysis using quantitative realtime PCR. At 14 day after drought treatment, SOD expression in plants without K-PAM was 1.8-fold higher than that in plants with K-PAM (Fig. 5A). At both 7 and 14 days under drought condition, APX expression in plants without K-PAM was significantly higher than that in plants with K-PAM (Fig. 5B). Expression levels of OSMOTIN and SULFUR E2 decreased after drought treatment at 7 day, however, OSMOTIN and SULFUR E2 expression levels in plants without K-PAM were 2.2-fold and 5-
In arid and semiarid regions, water availability is the key factor inhibiting plant growth and crop production. Since water is expected to become even scarcer in the future, water competition between plants and human makes the situation even worse. Application of SAPs including K-PAM is highly recommended to increase soil water availability. In this study, 1% K-PAM was mixed with soil and the results showed that the incorporation of K-PAM was effective to decrease soil water loss and therefore increase soil water content even at 21 day after drought treatment (Fig. 1). Drought stress modulated extensive reprogramming in plants at physiological, biochemical and transcriptomic levels. Under drought condition, the stress signals are perceived by several receptors at the cell membrane, followed by transduction to multiple second messengers such as abscisic acid (ABA), nitric oxide (NO) and ROS (Mittler, 2002; Chan and Shi, 2015). Drought stress causes oxidative stress via rapid and excessive production of ROS, and H2 O2 is the most important one (Apel and Hirt, 2004; Mittler, 2002; Mittler et al., 2004). The over-production of H2 O2 can lead to oxidative damages by oxidizing proteins, damaging nucleic acids and causing lipid peroxidation (MDA). To scavenge the over-production of ROS and protect plant cells from ROS damage, plant developed complex antioxidant defense systems, including antioxidant enzymes like SOD, CAT, POD and GR. SOD functions as the first stage of the antioxidant defense system by catalysing O2 − into H2 O2 and O2 , while CAT, POD and GR are also essential for break down H2 O2 through different pathways (Apel and Hirt, 2004; Mittler, 2002; Mittler et al., 2004). In this study, bermudagrass without KPAM showed increased SOD activity and decreased POD and APX activities, resulting in high accumulation of H2 O2 (Fig. 3). Since
Please cite this article in press as: Liu, X., Chan, Z., Application of potassium polyacrylate increases soil water status and improves growth of bermudagrass (Cynodon dactylon) under drought stress condition. Sci. Hortic. (2015), http://dx.doi.org/10.1016/j.scienta.2015.10.041
G Model HORTI-6133; No. of Pages 7 6
ARTICLE IN PRESS X. Liu, Z. Chan / Scientia Horticulturae xxx (2015) xxx–xxx
As sessile organisms, plants have developed sophisticated strategies to respond to diverse environmental stresses, including accumulation of osmolites. Proline is the most common osmolite in the organelle and cytoplasm to regulate cell membrane stability and balance osmotic pressure of cytoplasm and environment. Therefore high proline content provides a significant advantage for plants to advent different stresses (Lu et al., 2009; Zhao et al., 2011). We observed significant increase of proline content after drought stress treatment. However, plants without K-PAM accumulated much higher proline than plants with K-PAM (Fig. 2D), indicating that plants without K-PAM suffered more severely from drought stress. These results were consistent with stressed phenotype and ROS level changes in plants without K-PAM. As a quick response to stress conditions in plants, stress responsive genes were activated right after stress treatment. Previously we characterized bermudagrass transcriptomic changes after stress treatment and pre-treatment with melatonin (Shi et al., 2015). In this study, several genes involved in ROS metabolism and induced by abiotic stresses were selected for expression level analysis. Two stress inducible genes in bermudagrass showed significant increase after drought treatment in plants without K-PAM, indicating drought stress strongly activated gene expressions in these plants. SOD gene also exhibited increased expression pattern in plants without K-PAM at 14 day after drought treatment (Fig. 5), which was in line with change of SOD activity. POD gene was slightly induced by drought, whereas POD activity was decreased upon drought treatment in plants without K-PAM. Several reasons might be attributed to the discrepancy. First, POD exists as a large family of isozymes and they have been implicated in a broad range of physiological processes including stress responses (Hiraga et al., 2001). In Arabidopsis thaliana, the POD family possesses a total of 73 members (Tognolli et al., 2002). Upregulation of one specific POD gene does not rule out the possibility of down-regulation of other POD genes in bermudagrass. Second, genes are often activated earlier than enzymes. And third, gene expression level changes might be different from protein level changes because of transcriptional and post-transcriptional modifications. Taken together, this study indicated that incorporation of KPAM in soil helped maintain soil water content and improve plant growth under drought stress condition. Plants without K-PAM suffered more severely from drought stress, as evidenced by increased EL, MDA content and over-production of ROS, resulting in retarded growth and decreased biomass. Acknowledgements This research was supported by “the Hundred Talents Program”, the Knowledge Innovative Key Program of Chinese Academy of Sciences (Grant No.54Y154761O01076 and No.Y329631O0263) to Zhulong Chan. References Fig. 5. Modulation of stress responsive gene expression by potassium polyacrylate (K-PAM) before and after drought treatment. Vertical bars represent mean values ± the standard deviation for each mean. The vertical bars with different lower-case letters are significantly different from each other at P ≤ 0.05 according to Duncan’s method.
bermudagrass without K-PAM showed severe damage and retarded growth under drought stress condition (Fig. 1), we speculated that drought stress induced ROS overproduction in plants without KPAM, leading to increased membrane damages as evidenced by increased EL and MDA content (Fig. 2A and B).
Apel, K., Hirt, H., 2004. Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annu. Rev. Plant Biol. 55, 373–399. Azzam, R.A.I., 1983. Polymeric conditioner gels for desert soils. Commun. Soil Sci. Plant Anal. 14, 739–760. Blodgett, A.M., Beattis, D.J., White, J.W., Elliot, G.C., 1993. Hydrophilic polymers and wetting agents affect absorption and evaporative water loss. Hort. Sci. 28, 633–635. Carrow, R.N., 1996. Drought resistance aspects of turfgrasses in the southeast: root–shoot responses. Crop Sci. 36, 687–694. Carrow, R.N., 1995. Drought resistance aspects of turfgrasses in the southeast: evapotranspiration and crop coefficients. Crop Sci. 35, 1685–1690. Chan, Z., Shi, H., 2015. Improved abiotic stress tolerance of bermudagrass by exogenous small molecules. Plant Signal Behav. 10, e991577. Chenu, K., Deihimfard, R., Chapman, S.C., 2013. Large-scale characterization of drought pattern: a continent-wide modelling approach applied to the Australian wheatbelt–spatial and temporal trends. New Phytol. 198, 801–820.
Please cite this article in press as: Liu, X., Chan, Z., Application of potassium polyacrylate increases soil water status and improves growth of bermudagrass (Cynodon dactylon) under drought stress condition. Sci. Hortic. (2015), http://dx.doi.org/10.1016/j.scienta.2015.10.041
G Model HORTI-6133; No. of Pages 7
ARTICLE IN PRESS X. Liu, Z. Chan / Scientia Horticulturae xxx (2015) xxx–xxx
Chirino, E., Vilagrosa, A., Vallejo, V.R., 2011. Using hydrogel and clay to improve the water status of seedlings for dryland restoration. Plant Soil 344, 99–110. Gehring, J.M., Lewis, A.J., 1980. Effect of polymer on wilting and moisture stress of bedding plants. J. Am. Soc. Hort. Sci. 105, 511–513. Hiraga, S., Sasaki, K., Ito, H., Ohashi, Y., Matsui, H., 2001. A large family of class III plant peroxidases. Plant Cell Physiol. 42, 462–468. Islam, M.R., Hu, Y., Mao, S., Jia, P., Eneji, A.E., Xue, X., 2011a. Effects of water-saving superabsorbent polymer on antioxidant enzyme activities and lipid peroxidation in corn (Zea mays L.) under drought stress. J. Sci. Food Agr. 91, 813–819. Islam, M.R., Hu, Y., Mao, S., Mao, Z., Eneji, A.E., Xue, Z., 2011b. Effectiveness of a water-saving super-absorbent polymer in soil water conservation for corn (Zea mays L.) based on eco-physiological parameters. J. Sci. Food Agr. 91, 1998–2005. Islam, M.R., Mao, S., Xue, X., Eneji, A., Zhao, X., Hu, Y., 2011c. A lysimeter study of nitrate leaching, optimum fertilisation rate and growth responses of corn (Zea mays L.) following soil amendment with water-saving super-absorbent polymer. J. Sci. Food Agr. 91, 1990–1997. Islam, M.R., Xue, X., Mao, S., Ren, C., Eneji, A., Hu, Y., 2011d. Effects of water-saving superabsorbent polymer on antioxidant enzyme activities and lipid peroxidation in oat (Avena sativa L.) under drought stress. J. Sci. Food Agr. 91, 680–686. Kirkegaard, J.A., Lilley, J.M., Howe, G.N., Graham, J.M., 2007. Impact of subsoil water use on wheat yield. Aust. J. Agr. Res. 58, 303–315. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−CT method. Methods 25, 402–408. Lu, S., Chen, C., Wang, Z., Guo, Z., Li, H., 2009. Physiological responses of somaclonal variants of triploid bermudagrass (Cynodon transvaalensis × Cynodon dactylon) to drought stress. Plant Cell Rep. 28, 517–526. Mikkelsen, R.L., 1994. Using hydrophilic polymers to control nutrient release. Fert. Res. 38, 53–59. Mittler, R., 2002. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 7, 405–410. Mittler, R., Vanderauwera, S., Gollery, M., Van, B.F., 2004. Reactive oxygen gene network of plants. Trends Plant Sci. 9, 490–498.
7
Osman, K.T., 2013. Soils: Principles, Properties and Management. Springer Netherlands, Dordrecht. Qian, Y., Fry, J., 1997. Water relations and drought tolerance of four turfgrasses. J. Am. Soc. Hortic. Sci. 122, 129–133. Shi, H., Jiang, C., Ye, T., Tan, D., Reiter, R.J., Zhang, H., Liu, R., Chan, Z., 2015. Comparative physiological, metabolic and transcriptomic analyses reveal mechanisms of improved abiotic stress resistance in bermudagrass (Cynodon dactylon (L). Pers.) by exogenous melatonin. J. Exp. Bot. 66, 681–694. Shi, H., Wang, Y., Cheng, Z., Ye, T., Chan, Z., 2012. Analysis of natural variation in bermudagrass (Cynodon dactylon) reveals physiological responses underlying drought tolerance. PLoS ONE 7, e53422. Shi, H., Ye, T., Chan, Z., 2013a. Comparative proteomic and physiological analyses reveal the protective effect of exogenous polyamines in the bermudagrass (Cynodon dactylon) response to salt and drought stresses. J. Proteome Res. 12, 4951–4964. Shi, H., Ye, T., Chan, Z., 2013b. Exogenous application of hydrogen sulfide donor sodium hydrosulfide enhanced multiple abiotic stress tolerance in bermudagrass (Cynodon dactylon (L). Pers.). Plant Physiol. Biochem. 71, 226–234. Taylor, K.C., Halfacre, R.G., 1986. The effect of hydrophilic polymer on media water retention and nutrient availability to Ligustrum lucidum. Hort. Sci. 21, 1159–1161. Tognolli, M., Penel, C., Greppin, H., Simon, P., 2002. Analysis and expression of the class III peroxidase large gene family in Arabidopsis thaliana. Gene 288, 129–138. Yang, F., Han, C., Li, Z., Guo, Y., Chan, Z., 2015. Dissecting tissue- and species-specific responses of two Plantago species to waterlogging stress at physiological level. Environ. Exp. Bot. 109, 177–185. Yazdani, F., Allahdadi, I., Akbari, G.A., 2007. Impact of superabsorbent polymer on yield and growth analysis of soybean (Glycine max L.) under drought stress condition. Pak. J. Biol. Sci. 10, 4190–4196. Zhao, Y., Du, H., Wang, Z., Huang, B., 2011. Identification of proteins associated with water-deficit tolerance in C4 perennial grass species, Cynodon dactylon × Cynodon transvaalensis and Cynodon dactylon. Physiol. Plantarum 141, 40–55.
Please cite this article in press as: Liu, X., Chan, Z., Application of potassium polyacrylate increases soil water status and improves growth of bermudagrass (Cynodon dactylon) under drought stress condition. Sci. Hortic. (2015), http://dx.doi.org/10.1016/j.scienta.2015.10.041
ARTICLE IN PRESS
HORTI-6133; No. of Pages 7
Scientia Horticulturae xxx (2015) xxx–xxx
Contents lists available at ScienceDirect
Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti
Application of potassium polyacrylate increases soil water status and improves growth of bermudagrass (Cynodon dactylon) under drought stress condition Xun Liu a,b , Zhulong Chan a,∗ a Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan 430074, China b University of Chinese Academy of Sciences, Beijing 100039, China
a r t i c l e
i n f o
Article history: Received 29 June 2015 Received in revised form 21 October 2015 Accepted 23 October 2015 Available online xxx Keywords: Bermudagrass Drought Potassium polyacrylate Super-absorbent polymers Reactive oxygen species
a b s t r a c t Water availability is the key factor limiting plant growth and development especially in dry and semiarid ecosystems. Super-absorbent polymers help soil keep water after raining or irrigation, and release water gradually during plant growth. This study examined the effect of potassium polyacrylate (K-PAM) on soil water content and physiological changes of bermudagrass in the greenhouse. The results showed that incorporation of K-PAM increased soil water content and survival rate of bermudagrass. Physiological parameter analysis showed that K-PAM treatment resulted in decreased cell membrane damage through modulation of EL and MDA contents in bermudagrass. Plants grown with K-PAM accumulated higher amount of proteins and proline under stress condition, and decreased ROS production. Expression level of several ROS related genes and stress inducible genes were largely up-regulated in plants by drought stress. However, plants grown in K-PAM mixed soil exhibited lower gene expression levels when compared to plants without K-PAM. The results indicated that K-PAM application effectively increased soil water content and improved bermudagrass growth under drought stress condition. © 2015 Elsevier B.V. All rights reserved.
1. Introduction Of the Earth’s ice-free land surface, only 3% have a high level of productivity, while about 30% are too dry (deserts and dryland soils) for agricultural crop production (Osman, 2013). Drought is the most severe abiotic stress which significantly limits plant growth and development. To cope with the harsh environmental conditions including drought, plants develop complex mechanisms to adapt to stress conditions and reduce damages caused by water stress, including modulation of stress responsive genes which resulted in accumulation of osmolytes, detoxification of oxidative stress, modification of cell wall and reduced water loss through regulation of stomatal closure. Although limiting water loss is important for plant survival under drought stress condition, water availability is the key factor for plant growth especially in dry and semiarid ecosystems (Chirino
Abbreviations: EL, electrolyte leakage; GR, glutathione reductase; GSH, glutathione; K-PAM, potassium polyacrylate; MDA, malondialdehyde; POD, peroxidase; ROS, reactive oxygen species; SAPs, super-absorbent polymers; SOD, superoxide dismutase. ∗ Corresponding author. Fax: +86 27 87510251. E-mail address: [email protected] (Z. Chan).
et al., 2011). Under natural environment condition, drought stress varies in severity, timing and duration because of changes in rainfall patterns (Chenu et al., 2013; Kirkegaard et al., 2007). Recently, increased water deficits associated with over-use of surface water and groundwater are largely threatening the sustainability of agricultural production globally. Therefore, use of super-absorbent polymers (SAPs) is an effective approach to increase soil water availability (Azzam, 1983; Blodgett et al., 1993; Taylor and Halfacre, 1986; Islam et al., 2011a,b,c,d). SAPs help plants soil keep water after raining or irrigation and release water gradually in soil during plant growth. Application of SAPs enhances seed germination and emergence, crop growth and yield, and reduces the irrigation requirement of plants (Azzam, 1983; Blodgett et al., 1993; Gehring and Lewis, 1980; Yazdani et al., 2007). Because of technical development, costs for SAPs production decreased and the prices became comparatively cheaper (about 5 USD kg−1 ) (Islam et al., 2011b). Additionally, polymers are safe and non-toxic and will finally decompose to carbon dioxide, water, ammonia, and potassium ion, without any residue (Mikkelsen, 1994). There are no environmental problems for SAPs application in the field. Bermudagrass (Cynodon dactylon) is a widely used warm-season turfgrass on home lawns, golf courses, sport fields and ecosystem
http://dx.doi.org/10.1016/j.scienta.2015.10.041 0304-4238/© 2015 Elsevier B.V. All rights reserved.
Please cite this article in press as: Liu, X., Chan, Z., Application of potassium polyacrylate increases soil water status and improves growth of bermudagrass (Cynodon dactylon) under drought stress condition. Sci. Hortic. (2015), http://dx.doi.org/10.1016/j.scienta.2015.10.041
G Model HORTI-6133; No. of Pages 7
ARTICLE IN PRESS X. Liu, Z. Chan / Scientia Horticulturae xxx (2015) xxx–xxx
2
restoration. As a C4 grass, bermudagrass is adapted to cultivation in a wide range of hot, dry climatic regions and generally considered to have superior drought resistance to other warm-season turfgrass species (Carrow, 1995, 1996; Qian and Fry, 1997; Shi et al., 2013a,b). However, water consumption of bermudagrass is considerably high, especially for lawn maintaining in arid and semiarid regions. In this study, potassium polyacrylate (K-PAM) was applied as a SAP during cultivation of bermudagrass in a greenhouse. The soil water content was monitored and plant physiological changes were assayed. Expression level changes of several stress inducible genes were also determined after application of K-PAM.
Table 1 List of primer sequences used for gene expression analysis. Gene
Primer sequence
SOD
Forward: CTGACTGGGCCTCATTCTATAC Reverse: CCTGCGTTTCCTGTTGATTTAC Forward: CAGTGCTGGACAACAACTACTA Reverse: TCCTTCCACAGCGTCTCGTT Forward: GTGCCATTGTCCTTCTCTTG Reverse: CGCAGGGATGGTTCTTAGAG Forward: ACGTCATGAAGCTGCAGATC Reverse: CCATTTGTTTTCCCTTCACCC
POD OSMOTIN SULFUR E2
dismutase (SOD) activity was measured by the NBT-illumination method as described by Shi et al. (2012).
2. Materials and methods 2.5. Measurement of proline and GSH contents 2.1. Plant materials and growth conditions The seeds of bermudagrass (provided by American Seed Research of Oregon Company, USA) were first vernalized at 4 ◦ C for 7 days in darkness. Then, the seeds were sterilized with 70% alcohol for 5 min and sown in the nutrient soil (Beilei Fertilizer Company, Zhengjiang, China). The seeds germinated and grew in the growth room which was controlled at an irradiance of about 150 m quantam−2 s−1 , 16 h light and 8 h dark cycles, 28 ±2 ◦ C, and about 65–75% relative air humidity. 2.2. Plant treatment At the 11th day after sowing, the seedlings were transferred to new pots filled with the same nutrient soil with or without 1% K-PAM based on preliminary experiment. The 21-day-old plants with the same size were subjected to drought treatment by withholding water in the soil for 21 days. For the control treatment, plants were watered every other day. Each treatment contained five pots and each pot had at least 90 seedlings. All the pots were conducted in a completely random design and rotated every day to minimize the environmental deviation. The soil water content was measured at 7, 14 and 21 days after withholding water, using the soil moisture and temperature recorder (L99-TWS-1, Shanghai, China). At 7, 14 and 21 day, the leaf samples were collected for physiological parameter measurement and gene expression analyses. At 2 day after re-watering, the survival rate of each treatment was measured. 2.3. Assay of electrolyte leakage (EL) For EL assay, 0.15 g plant leaf samples were shaken in Mili-Q water for 6 h at the room temperature to take initial conductivity (Ci ). Leaf samples were then boiled for 15 min and cooled to room temperature to take the fully divided conductivity (Cmax ). The electrolyte leakage was calculated as the ratio of Ci and Cmax . 2.4. Determination of soluble protein and antioxidant enzyme activities
The proline was extracted using sulfosalicylic acid, and the samples were boiled with acidic-ninhydrin for 40 min. The proline content was measured at 520 nm absorbance after the samples cooling to room temperature (Shi et al., 2012). GSH content was assayed using the GSH Assay Kit (Nanjing Jiancheng, China) according to the manufacturer’s instructions. 2.6. Quantification of malondialdehyde (MDA) and H2 O2 The MDA of bermudagrass was extracted using thiobarbituric acid (TBA) reagent and MDA content was determined at 450, 532 and 600 nm of absorbance with a spectrometer as described by Yang et al. (2015). The content of H2 O2 was measured using the titanium sulfate regent as described by Shi et al. (2012). 2.7. Quantitative realtime PCR Total RNA was isolated from fresh leaves of bermudagrass using TRIzol reagent (Invitrogen, USA). First Strand cDNA was synthesized using the RevertAidTM First Strand cDNA Synthesis Kit (TOYOBO, Japan), according to the manufacturer’s instructions. The qPCR was performed by the SYBR-green fluorescence using a CFX96 Real Time PCR Detection System (BIO-RAD, USA). The relative fold change in gene expression was calculated following the CT method (Livak and Schmittgen, 2001). Three independent biological replicates and three technical replicates for each sample were maintained. The primers for selected genes were designed based on previous RNA sequencing data (Shi et al., 2015) and listed as Table 1. 2.8. Statistical analysis In this study, SPSS 20.0 software was used for statistical analyses. The treatment differences were performed by ANOVA, and variables contented at least three replicates. Mean separations were performed using Duncan’s multiple range test with P ≤ 0.05. 3. Results 3.1. K-PAM improved drought tolerance of bermudagrass
For protein extraction, 1.5 g samples were triturated with liquid nitrogen and homogenized in phosphate buffer. The samples were then centrifuged at 12,000 × g for 15 min. The supernatant was used for the measurement of antioxidant enzyme activities, glutathione (GSH) content and H2 O2 content. According to the manufacturer’s instructions, the peroxidase (POD) and glutathione reductase (GR) activities were assayed using Plant POD Assay Kit (Nanjing Jiancheng, China) and GR Assay Kit (Beyotime, China), respectively. The superoxide
After 21 days of withholding water, plants in pots without KPAM were wilted and plant growth was severely retarded, whereas most plants in pots with K-PAM were green and healthy (Fig. 1A). At 2 day after rewatering, most plants in pots with K-PAM survived, but plants in pots without K-PAM were completely dead (Fig. 1A). The soil water content was measured at 7, 14 and 21 day after withholding water. There were significant differences in soil water content between pots with K-PAM and without K-PAM. At 14
Please cite this article in press as: Liu, X., Chan, Z., Application of potassium polyacrylate increases soil water status and improves growth of bermudagrass (Cynodon dactylon) under drought stress condition. Sci. Hortic. (2015), http://dx.doi.org/10.1016/j.scienta.2015.10.041
G Model HORTI-6133; No. of Pages 7
ARTICLE IN PRESS X. Liu, Z. Chan / Scientia Horticulturae xxx (2015) xxx–xxx
3
Fig. 1. Potassium polyacrylate (K-PAM) improved bermudagrass drought tolerance. (A) Phenotype of bermudagrass before and after drought treatment with or without K-PAM; B: Soil water content at 7, 14, and 21 day after drought treatment. Vertical bars represent mean values ± the standard deviation for each mean. The vertical bars with different lower-case letters are significantly different from each other at P ≤ 0.05 according to Duncan’s method.
and 21 day after treatment, soil water content in pots with K-PAM was significantly higher than that in pots without K-PAM (Fig. 1B). The results indicated that application of K-PAM increased soil water content resulting in improved bermudagrass growth under drought stress condition. 3.2. Effect of K-PAM on changes of EL, MDA, protein, and proline contents After drought stress treatment, EL and MDA content were examined. At 7 and 14 day after drought treatment, the EL in all plants did not show any significant differences. However, at 21 day after drought treatment, the EL in plants without K-PAM largely increased and was significantly higher than that in plants with K-PAM (Fig. 2A). Application of K-PAM resulted in slightly
decreased MDA content at 7 and 14 day, but significantly declined MDA content at 21 day after withholding water (Fig. 2B). These results showed that K-PAM application caused decreased membrane damage through modulation of EL and MDA contents in bermudagrass. Under controlled condition, the protein content showed no significant difference in samples after 7, 14 and 21 days drought treatment. However, after drought treatment for 21 day, the protein content in plants without K-PAM was significantly higher than that in plants with K-PAM (Fig. 2C). Drought stress treatment gradually increased proline content in all bermudagrass plants. However, proline content in plants without K-PAM was the highest after drought treatment (Fig. 2D). These results indicated that plants without K-PAM accumulated higher amount of proteins and proline under stress condition.
Please cite this article in press as: Liu, X., Chan, Z., Application of potassium polyacrylate increases soil water status and improves growth of bermudagrass (Cynodon dactylon) under drought stress condition. Sci. Hortic. (2015), http://dx.doi.org/10.1016/j.scienta.2015.10.041
G Model HORTI-6133; No. of Pages 7 4
ARTICLE IN PRESS X. Liu, Z. Chan / Scientia Horticulturae xxx (2015) xxx–xxx
Fig. 2. Effect of potassium polyacrylate (K-PAM) on changes of bermudagrass electrolyte leakage (A), MDA content (B), protein content (C) and proline content (D) before and after drought treatment. Vertical bars represent mean values ± the standard deviation for each mean. The vertical bars with different lower-case letters are significantly different from each other at P ≤ 0.05 according to Duncan’s method.
3.3. K-PAM treatment modulated reactive oxygen species (ROS) pathway In order to test how ROS were involved in plant stress responses after application of K-PAM, H2 O2 content, POD and SOD activities were assayed in this study (Fig. 3). At 21 day after drought treatment, plants without K-PAM accumulated significantly higher H2 O2 than others (Fig. 3A). Consistently, the activity of POD in
plants without K-PAM was significantly lower than that in plants with K-PAM (Fig. 3B). Drought treatment increased the SOD activity, and plants without K-PAM exhibited highest SOD activity than others at 21 day under drought condition (Fig. 3C). Therefore, application of K-PAM alleviated ROS over-production in bermudagrass plants partially through modulation of antioxidant enzyme activities.
Please cite this article in press as: Liu, X., Chan, Z., Application of potassium polyacrylate increases soil water status and improves growth of bermudagrass (Cynodon dactylon) under drought stress condition. Sci. Hortic. (2015), http://dx.doi.org/10.1016/j.scienta.2015.10.041
G Model HORTI-6133; No. of Pages 7
ARTICLE IN PRESS X. Liu, Z. Chan / Scientia Horticulturae xxx (2015) xxx–xxx
5
Fig. 4. Effect of potassium polyacrylate (K-PAM) on changes of bermudagrass GR activity (A) and GSH content (B) before and after drought treatment. Vertical bars represent mean values ± the standard deviation for each mean. The vertical bars with different lower-case letters are significantly different from each other at P ≤ 0.05 according to Duncan’s method.
fold, respectively, higher than those in plants with K-PAM (Fig. 5C and D). Therefore, the application of K-PAM inhibited expression of these stress responsive gene in bermudagrass. 4. Discussion
Fig. 3. Modulation of ROS pathway by K-PAM before and after drought treatment. Vertical bars represent mean values ± the standard deviation for each mean. The vertical bars with different lower-case letters are significantly different from each other at P ≤ 0.05 according to Duncan’s method.
3.4. Effect of K-PAM on changes of GR and GSH levels GR activity in plants without K-PAM was significantly higher than that in plants with K-PAM at 7, 14 and 21 days after drought treatment (Fig. 4A). Although no significant difference was observed for GSH content between drought treatment and control at 7 and 14 days, plants without K-PAM treatment exhibited highest GSH content at 21 day under drought condition (Fig. 5B). 3.5. Modulation of stress responsive gene expression after application of K-PAM Based on previous results (Shi et al., 2015), several stress inducible genes in bermudagrass were selected for gene expression analysis using quantitative realtime PCR. At 14 day after drought treatment, SOD expression in plants without K-PAM was 1.8-fold higher than that in plants with K-PAM (Fig. 5A). At both 7 and 14 days under drought condition, APX expression in plants without K-PAM was significantly higher than that in plants with K-PAM (Fig. 5B). Expression levels of OSMOTIN and SULFUR E2 decreased after drought treatment at 7 day, however, OSMOTIN and SULFUR E2 expression levels in plants without K-PAM were 2.2-fold and 5-
In arid and semiarid regions, water availability is the key factor inhibiting plant growth and crop production. Since water is expected to become even scarcer in the future, water competition between plants and human makes the situation even worse. Application of SAPs including K-PAM is highly recommended to increase soil water availability. In this study, 1% K-PAM was mixed with soil and the results showed that the incorporation of K-PAM was effective to decrease soil water loss and therefore increase soil water content even at 21 day after drought treatment (Fig. 1). Drought stress modulated extensive reprogramming in plants at physiological, biochemical and transcriptomic levels. Under drought condition, the stress signals are perceived by several receptors at the cell membrane, followed by transduction to multiple second messengers such as abscisic acid (ABA), nitric oxide (NO) and ROS (Mittler, 2002; Chan and Shi, 2015). Drought stress causes oxidative stress via rapid and excessive production of ROS, and H2 O2 is the most important one (Apel and Hirt, 2004; Mittler, 2002; Mittler et al., 2004). The over-production of H2 O2 can lead to oxidative damages by oxidizing proteins, damaging nucleic acids and causing lipid peroxidation (MDA). To scavenge the over-production of ROS and protect plant cells from ROS damage, plant developed complex antioxidant defense systems, including antioxidant enzymes like SOD, CAT, POD and GR. SOD functions as the first stage of the antioxidant defense system by catalysing O2 − into H2 O2 and O2 , while CAT, POD and GR are also essential for break down H2 O2 through different pathways (Apel and Hirt, 2004; Mittler, 2002; Mittler et al., 2004). In this study, bermudagrass without KPAM showed increased SOD activity and decreased POD and APX activities, resulting in high accumulation of H2 O2 (Fig. 3). Since
Please cite this article in press as: Liu, X., Chan, Z., Application of potassium polyacrylate increases soil water status and improves growth of bermudagrass (Cynodon dactylon) under drought stress condition. Sci. Hortic. (2015), http://dx.doi.org/10.1016/j.scienta.2015.10.041
G Model HORTI-6133; No. of Pages 7 6
ARTICLE IN PRESS X. Liu, Z. Chan / Scientia Horticulturae xxx (2015) xxx–xxx
As sessile organisms, plants have developed sophisticated strategies to respond to diverse environmental stresses, including accumulation of osmolites. Proline is the most common osmolite in the organelle and cytoplasm to regulate cell membrane stability and balance osmotic pressure of cytoplasm and environment. Therefore high proline content provides a significant advantage for plants to advent different stresses (Lu et al., 2009; Zhao et al., 2011). We observed significant increase of proline content after drought stress treatment. However, plants without K-PAM accumulated much higher proline than plants with K-PAM (Fig. 2D), indicating that plants without K-PAM suffered more severely from drought stress. These results were consistent with stressed phenotype and ROS level changes in plants without K-PAM. As a quick response to stress conditions in plants, stress responsive genes were activated right after stress treatment. Previously we characterized bermudagrass transcriptomic changes after stress treatment and pre-treatment with melatonin (Shi et al., 2015). In this study, several genes involved in ROS metabolism and induced by abiotic stresses were selected for expression level analysis. Two stress inducible genes in bermudagrass showed significant increase after drought treatment in plants without K-PAM, indicating drought stress strongly activated gene expressions in these plants. SOD gene also exhibited increased expression pattern in plants without K-PAM at 14 day after drought treatment (Fig. 5), which was in line with change of SOD activity. POD gene was slightly induced by drought, whereas POD activity was decreased upon drought treatment in plants without K-PAM. Several reasons might be attributed to the discrepancy. First, POD exists as a large family of isozymes and they have been implicated in a broad range of physiological processes including stress responses (Hiraga et al., 2001). In Arabidopsis thaliana, the POD family possesses a total of 73 members (Tognolli et al., 2002). Upregulation of one specific POD gene does not rule out the possibility of down-regulation of other POD genes in bermudagrass. Second, genes are often activated earlier than enzymes. And third, gene expression level changes might be different from protein level changes because of transcriptional and post-transcriptional modifications. Taken together, this study indicated that incorporation of KPAM in soil helped maintain soil water content and improve plant growth under drought stress condition. Plants without K-PAM suffered more severely from drought stress, as evidenced by increased EL, MDA content and over-production of ROS, resulting in retarded growth and decreased biomass. Acknowledgements This research was supported by “the Hundred Talents Program”, the Knowledge Innovative Key Program of Chinese Academy of Sciences (Grant No.54Y154761O01076 and No.Y329631O0263) to Zhulong Chan. References Fig. 5. Modulation of stress responsive gene expression by potassium polyacrylate (K-PAM) before and after drought treatment. Vertical bars represent mean values ± the standard deviation for each mean. The vertical bars with different lower-case letters are significantly different from each other at P ≤ 0.05 according to Duncan’s method.
bermudagrass without K-PAM showed severe damage and retarded growth under drought stress condition (Fig. 1), we speculated that drought stress induced ROS overproduction in plants without KPAM, leading to increased membrane damages as evidenced by increased EL and MDA content (Fig. 2A and B).
Apel, K., Hirt, H., 2004. Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annu. Rev. Plant Biol. 55, 373–399. Azzam, R.A.I., 1983. Polymeric conditioner gels for desert soils. Commun. Soil Sci. Plant Anal. 14, 739–760. Blodgett, A.M., Beattis, D.J., White, J.W., Elliot, G.C., 1993. Hydrophilic polymers and wetting agents affect absorption and evaporative water loss. Hort. Sci. 28, 633–635. Carrow, R.N., 1996. Drought resistance aspects of turfgrasses in the southeast: root–shoot responses. Crop Sci. 36, 687–694. Carrow, R.N., 1995. Drought resistance aspects of turfgrasses in the southeast: evapotranspiration and crop coefficients. Crop Sci. 35, 1685–1690. Chan, Z., Shi, H., 2015. Improved abiotic stress tolerance of bermudagrass by exogenous small molecules. Plant Signal Behav. 10, e991577. Chenu, K., Deihimfard, R., Chapman, S.C., 2013. Large-scale characterization of drought pattern: a continent-wide modelling approach applied to the Australian wheatbelt–spatial and temporal trends. New Phytol. 198, 801–820.
Please cite this article in press as: Liu, X., Chan, Z., Application of potassium polyacrylate increases soil water status and improves growth of bermudagrass (Cynodon dactylon) under drought stress condition. Sci. Hortic. (2015), http://dx.doi.org/10.1016/j.scienta.2015.10.041
G Model HORTI-6133; No. of Pages 7
ARTICLE IN PRESS X. Liu, Z. Chan / Scientia Horticulturae xxx (2015) xxx–xxx
Chirino, E., Vilagrosa, A., Vallejo, V.R., 2011. Using hydrogel and clay to improve the water status of seedlings for dryland restoration. Plant Soil 344, 99–110. Gehring, J.M., Lewis, A.J., 1980. Effect of polymer on wilting and moisture stress of bedding plants. J. Am. Soc. Hort. Sci. 105, 511–513. Hiraga, S., Sasaki, K., Ito, H., Ohashi, Y., Matsui, H., 2001. A large family of class III plant peroxidases. Plant Cell Physiol. 42, 462–468. Islam, M.R., Hu, Y., Mao, S., Jia, P., Eneji, A.E., Xue, X., 2011a. Effects of water-saving superabsorbent polymer on antioxidant enzyme activities and lipid peroxidation in corn (Zea mays L.) under drought stress. J. Sci. Food Agr. 91, 813–819. Islam, M.R., Hu, Y., Mao, S., Mao, Z., Eneji, A.E., Xue, Z., 2011b. Effectiveness of a water-saving super-absorbent polymer in soil water conservation for corn (Zea mays L.) based on eco-physiological parameters. J. Sci. Food Agr. 91, 1998–2005. Islam, M.R., Mao, S., Xue, X., Eneji, A., Zhao, X., Hu, Y., 2011c. A lysimeter study of nitrate leaching, optimum fertilisation rate and growth responses of corn (Zea mays L.) following soil amendment with water-saving super-absorbent polymer. J. Sci. Food Agr. 91, 1990–1997. Islam, M.R., Xue, X., Mao, S., Ren, C., Eneji, A., Hu, Y., 2011d. Effects of water-saving superabsorbent polymer on antioxidant enzyme activities and lipid peroxidation in oat (Avena sativa L.) under drought stress. J. Sci. Food Agr. 91, 680–686. Kirkegaard, J.A., Lilley, J.M., Howe, G.N., Graham, J.M., 2007. Impact of subsoil water use on wheat yield. Aust. J. Agr. Res. 58, 303–315. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−CT method. Methods 25, 402–408. Lu, S., Chen, C., Wang, Z., Guo, Z., Li, H., 2009. Physiological responses of somaclonal variants of triploid bermudagrass (Cynodon transvaalensis × Cynodon dactylon) to drought stress. Plant Cell Rep. 28, 517–526. Mikkelsen, R.L., 1994. Using hydrophilic polymers to control nutrient release. Fert. Res. 38, 53–59. Mittler, R., 2002. Oxidative stress, antioxidants and stress tolerance. Trends Plant Sci. 7, 405–410. Mittler, R., Vanderauwera, S., Gollery, M., Van, B.F., 2004. Reactive oxygen gene network of plants. Trends Plant Sci. 9, 490–498.
7
Osman, K.T., 2013. Soils: Principles, Properties and Management. Springer Netherlands, Dordrecht. Qian, Y., Fry, J., 1997. Water relations and drought tolerance of four turfgrasses. J. Am. Soc. Hortic. Sci. 122, 129–133. Shi, H., Jiang, C., Ye, T., Tan, D., Reiter, R.J., Zhang, H., Liu, R., Chan, Z., 2015. Comparative physiological, metabolic and transcriptomic analyses reveal mechanisms of improved abiotic stress resistance in bermudagrass (Cynodon dactylon (L). Pers.) by exogenous melatonin. J. Exp. Bot. 66, 681–694. Shi, H., Wang, Y., Cheng, Z., Ye, T., Chan, Z., 2012. Analysis of natural variation in bermudagrass (Cynodon dactylon) reveals physiological responses underlying drought tolerance. PLoS ONE 7, e53422. Shi, H., Ye, T., Chan, Z., 2013a. Comparative proteomic and physiological analyses reveal the protective effect of exogenous polyamines in the bermudagrass (Cynodon dactylon) response to salt and drought stresses. J. Proteome Res. 12, 4951–4964. Shi, H., Ye, T., Chan, Z., 2013b. Exogenous application of hydrogen sulfide donor sodium hydrosulfide enhanced multiple abiotic stress tolerance in bermudagrass (Cynodon dactylon (L). Pers.). Plant Physiol. Biochem. 71, 226–234. Taylor, K.C., Halfacre, R.G., 1986. The effect of hydrophilic polymer on media water retention and nutrient availability to Ligustrum lucidum. Hort. Sci. 21, 1159–1161. Tognolli, M., Penel, C., Greppin, H., Simon, P., 2002. Analysis and expression of the class III peroxidase large gene family in Arabidopsis thaliana. Gene 288, 129–138. Yang, F., Han, C., Li, Z., Guo, Y., Chan, Z., 2015. Dissecting tissue- and species-specific responses of two Plantago species to waterlogging stress at physiological level. Environ. Exp. Bot. 109, 177–185. Yazdani, F., Allahdadi, I., Akbari, G.A., 2007. Impact of superabsorbent polymer on yield and growth analysis of soybean (Glycine max L.) under drought stress condition. Pak. J. Biol. Sci. 10, 4190–4196. Zhao, Y., Du, H., Wang, Z., Huang, B., 2011. Identification of proteins associated with water-deficit tolerance in C4 perennial grass species, Cynodon dactylon × Cynodon transvaalensis and Cynodon dactylon. Physiol. Plantarum 141, 40–55.
Please cite this article in press as: Liu, X., Chan, Z., Application of potassium polyacrylate increases soil water status and improves growth of bermudagrass (Cynodon dactylon) under drought stress condition. Sci. Hortic. (2015), http://dx.doi.org/10.1016/j.scienta.2015.10.041