Application of recombinant fimbrial protein for the specific detection of Salmonella enteritidis infection in poultry

Application of Recombinant Fimbrial Protein for the Specific Detection of Salmonella enteritidis Infection in Poultry Gireesh Rajashekara, Shirin Munir, Chinta M. Lamichhane, Alberto Back, Vivek Kapur, David A. Halvorson, and Kakambi V. Nagaraja

A number of disease outbreaks of Salmonella enterica serotype enteritidis (SE) in humans have been traced to the consumption of SE-contaminated egg and egg products. A rapid, specific, and inexpensive method of detecting SE infection in poultry is necessary to reduce human outbreaks. We evaluated rSEF14 fimbrial antigen of SE for specific detection of SEinfected birds in latex agglutination test and enzyme-linked immunosorbent assay. rSEF14 antigen was highly specific in identifying birds infected with SE. The sera from birds infected with closely related serogroup-D Salmonella and other avian

pathogens did not react with rSEF14 antigen. The rSEF14 antigen identified antibodies in serum of 88% of birds during the first 2 weeks of infection, and 100% of the birds subsequently. The SE-specific antibodies were detected in egg yolk as early as 6 days post-infection in rSEF14-enzyme-linked immunosorbent assay. Our results suggest that rSEF14-based assays could be used as screening tests for detection of SE antibodies and would overcome the cross reactions observed with existing serological tests. © 1998 Elsevier Science Inc.

INTRODUCTION

infection in humans have been traced to the consumption of SE-contaminated eggs (Hedberg et al. 1993; St. Louis et al. 1988). In the USA, 67 billion eggs were produced in 1996 and to the producers of these eggs, SE is an important economic as well as public health issue. It is estimated that 0.01% of all shell eggs contain SE, and the percentage may be even higher in some parts of the USA (Mason and Ebel 1992). The presence of SE in chickens and its transmission through table eggs into human food chain highlights the need for specific test to identify SEinfected chickens and to eliminate them from the flock. Preharvest food safety is the most important component of an effective prevention and control strategy for SE infection. Many control strategies have been implemented to reduce the prevalence of SE infection in poultry with the ultimate aim of reducing SE outbreaks in humans. Successful implemen-

Salmonellosis is the most common foodborne infectious disease of humans reported in the USA. In 1996, among 39,072 culture-confirmed cases of salmonellosis reported, Salmonella enterica serotype enteritidis (SE) was the number one cause of human salmonellosis (Angula 1997). The incidence of cases of SE in humans in the USA began to rise in the late 1970s, and in 1990 it became the leading serotype responsible for food poisoning in the USA (Rodrigue et al. 1990). A number of disease outbreaks from SE From the Department of Veterinary PathoBiology (GR, SM, AB, VK, DAH, KVN), University of Minnesota, St. Paul, MN 55108 and Kirkegaard and Perry Laboratories (CML), Gaithersburg, MD 20879. Address reprint requests to Dr. Kakambi V. Nagaraja, Department of Veterinary PathoBiology, 1971 Commonwealth Avenue, University of Minnesota, St. Paul, MN 55108. Received 11 May 1998; revised and accepted 21 July 1998.

DIAGN MICROBIOL INFECT DIS 1998;32:147–157 © 1998 Elsevier Science Inc. All rights reserved. 655 Avenue of the Americas, New York, NY 10010

0732-8893/98/$19.00 PII S0732-8893(98)00091-1

Rajashekara et al.

148 tation of control measures requires rapid, specific, and inexpensive methods of detection of birds infected with SE. Current methods for the detection of SE infection in chickens rely primarily on conventional bacteriologic culture. This procedure is relatively slow, often taking up to 3 to 4 days to provide even a presumptive diagnosis. More importantly, birds infected with Salmonella may not excrete the organism everyday and with this intermittent shedding, traditional bacteriologic culture methods generally have low sensitivity. The detection of antibodies specific to the bacterium can provide an alternate method for assessing the presence of infection. Several serological methods such as serum plate agglutination (Chart et al. 1990a, 1990b), microagglutination (Williams and Whittemore 1971), microantiglobulin tests (Cooper et al. 1989), ELISA (Kim et al. 1991; Timoney et al. 1990; Van Zijderveld et al. 1992) have previously been used for the detection of SE infection in poultry. The major problem with these assays is that they lack either the sensitivity or the specificity to detect SEinfected birds, or the tests are too difficult to perform in a routine laboratory or at field setting (Barrow 1994). This has precluded the widespread application of these tests for the detection of SE infection. Egg yolk has been recognized as an excellent source of antibodies (Jensenius et al. 1981; Polson et al. 1980). Only a small proportion of eggs from infected flocks may be positive for Salmonella on culture and the examination of large number of eggs for evidence of infection by culture is impractical. Alternatively, detection of antibodies in eggs from SEinfected birds does not involve physical handling of birds and is economical. SE produces at least four distinct fimbriae: SEF14, SEF17, SEF18, and SEF21 (Clouthier et al. 1994; Collinson et al. 1991; Muller et al. 1991; Thorns et al. 1990). The SEF14 fimbriae is a uniquely specific structure consists of repeating subunits with a molecular mass of 14,300 Da (Thorns et al. 1990). The gene sefA, encoding SEF14 has been shown to have limited distribution among Salmonella serotypes belonging to serogroup-D. SEF14 fimbriae are present in S. enteritidis, Salmonella dublin, Salmonella moscow, and Salmonella blegdam (Thorns et al. 1992). Though, many of the serogroup-D Salmonella such as Salmonella typhi, Salmonella gallinarum, and Salmonella pullorum possess the intact gene, they fail to express SEF14 fimbriae (Turcotte and Woodward 1993). Here we describe the in vitro expression of SEF14 fimbrial antigen and the development of specific serological assays using the recombinant SEF14 fimbrial antigen for the detection of SE-specific antibodies in serum and egg yolk in birds exposed to SE.

MATERIALS AND METHODS Isolation of SE Genomic DNA S. enteritidis UMN4 was grown overnight at 37°C in Luria-Bertani (LB) broth and the genomic DNA was extracted as described (Koeuth et al. 1995).

Oligonucleotide Primer Selection and Synthesis Oligonucleotide primers corresponding to an internal fragment (64 – 498 bp) of the sefA gene were used for PCR amplification. Additional bases were added to the 59 end of each primer to confer a recognition sequence for either EcoRI (forward primer) or XhoI (reverse primer). The oligonucleotide primers were obtained from Integrated DNA technologies Inc. (Ames, IA). The DNA sequences for the forward and reverse primers are 59 GGGAATTCGCTGGCTTTGTTGGTAACA and 59 GGGCTCGAGTTAGTTTTGATACTGAACGTA. Additional nucleotides added to the 59 end of the primers are underlined.

PCR Amplification and Cloning of sefA Gene Fragment Amplification reactions were performed in 30 mL volumes with 30 pmol of each primer and 5 mM MgCl2. The reagents and enzymes used for PCR were obtained from Perkin Elmer (Foster City, CA). SE genomic DNA (100 ng) was used as a template for PCR amplification with the following parameters: an initial denaturation at 94°C for 5 min, followed by 35 cycles of denaturation (94°C for 1.5 min), annealing (52°C for 1 min), extension (72°C for 2 min), and a final extension (72°C for 15 min). Amplification reactions were performed in a DNA thermal cycler (Perkin-Elmer Cetus. Model 480). The PCR products were analyzed on 1% agarose gel, stained with ethidium bromide (0.5 mg/mL), and photographed under UV light. PCR products were gel extracted (Qiagen Inc., Chatsworth, CA), quantitated spectrophometrically at 260 nm, and cloned into pGEM-T vector (Promega, Madison, WI). After ligation, 2 mL of the reaction products were transformed into Escherichia coli DH5a cells (Gibco BRL, Gaithersburg, MD) by heat shock method. Recombinant colonies were selected on ampicillin/IPTG-Xgal-containing plates and screened for the presence of the appropriate insert by restriction analysis.

Nucleotide Sequence Analysis A bacterial colony containing the recombinant plasmid with the sefA gene fragment was grown in LBampicillin media, and the plasmid was extracted us-

S. enteritidis Immunodiagnosis ing plasmid extraction kit (Qiagen). The nucleotide sequence of the insert was determined using oligonucleotide primers specific to the vector sequence by automated DNA sequencing (Advanced Genetic Analysis Center, University of Minnesota St. Paul, MN). The sefA gene insert was sequenced in its entirety in both orientations, and the amino acid sequence deduced using the standard genetic code (DNA*, Madison, WI).

SefA Gene Fragment Expression The pGEM-T plasmid carrying sefA fragment was digested with EcoRI and XhoI, and the digested products were gel purified (Qiagen) and cloned into EcoRI and XhoI digested pET/ABC expression vectors (Novagen Inc., Madison, WI). Ligation products (2 mL) from each of the reactions were transformed into E. coli BL21(DE3) or E. coli BL21PlysS cells by heat shock method. The transformed mixture was plated on kanamycin and/or chloramphenicol containing plates, and the recombinant clones were selected based on restriction enzyme analysis and analyzed for sefA expression as described by the manufacturer (Novagen).

149 nant protein contained traces of non-specific proteins, the rSEF14 protein was further purified by electroelution (Bio-Rad).

Development of rSEF14 Protein-based Latex Agglutination Test (rSEF14-LAT) The electroeluted rSEF14 protein was coupled to 0.5-mm blue-dyed latex beads by gluteraldehyde method (Polysciences Inc., Warrington, PA). The rSEF14-coated latex beads were examined as test antigens in a slide agglutination test with known positive and negative SE sera from chickens. A total volume of 7.5 mL of rSEF14-coated latex beads were mixed with an equal volume of serum. The presence or absence of agglutination was recorded after 1 min of observation.

Development of rSEF14 Protein-based Enzyme-linked Immunosorbent Assay (rSEF14-ELISA)

The E. coli cells expressing rSEF14 were lysed and the lysates were analyzed by SDS-polyacrylamide gel electrophoresis (PAGE) for the presence of the rSEF14 by mixing with an equal volume of 2x SDS solubilization buffer separating on 12% polyacrylamide gel, and staining with Coomassie blue. For western blot the proteins from polyacrylamide gel (12%) were transferred onto a nitrocellulose membrane using Transblot apparatus (Bio-Rad laboratories, Hercules, CA). After transfer, the membrane was blocked with 3% bovine serum albumin (BSA) in phosphate-buffered saline (PBS) and stained with either T7 tag antibody (Novagen) or rabbit SEF14specific antibody (kindly provided by Dr. W. W. Kay, University of Victoria, BC, Canada). The membrane was washed and stained with anti-rabbit IgG/ horse radish peroxidase (HRP) conjugate and treated with developing reagent (Amersham life sciences Inc., USA) for 1 min, exposed to X-ray film, and the radiograph developed.

ELISA was developed following the standard procedures (Bullock and Walls 1977; Kim et al. 1991) with slight modifications. The 96-well microtiter plates were coated with 100 mL of 1:200 diluted rSEF14 antigen (6.6 mg/mL) using carbonate/bicarbonate buffer overnight at 4°C. The coated plates were blocked and stabilized using KPL blocking buffer (KPL, Gaithersburg, MD). The plates were exposed to test serum (1:100 dilution in KPL proflock dilution buffer) for 30 min at room temperature (RT), the plates were washed with KPL washing buffer (3 min 3 3) and were incubated with 100 mL of Biotinylated-goat anti chicken IgG (1:100 dilution) for 30 min at RT. After incubation the plates were washed with KPL washing buffer (3 min 3 3) and exposed to 100 mL of streptavidin-HRP (1:100 dilution) for 30 min at RT. The plates were washed with KPL washing buffer (3 min 3 3) and developed with KPL TMB substrate for 15 min at RT. The reaction was stopped with KPL TMB stop solution and the optical density was measured at 630 nm in a micro ELISA reader. The data were analyzed using KPL proflock software. The ELISA for yolk samples was conducted with the same protocol as above, except the purified yolk samples were used at 1:20 dilution.

Purification of rSEF14 Protein by Column Chromatography and Electroelution

Specificity of rSEF14 Antigen for Detection of SE Antibodies in LAT and ELISA

The recombinant SEF14 protein was purified using nickel columns as described by the manufacturer (Novagen). The protein was quantitated using a BioRad protein assay kit (Bio-Rad), and analyzed by SDS-PAGE. Because the column purified recombi-

Five 4-week-old specific pathogen free (SPF) white leghorn chickens (Hy-vac, Adel, IA) were experimentally exposed to one of the following Salmonella serotypes: S. enteritidis, S. pullorum, S. typhimurium, S. gallinarum, S. berta, and S. dublin. An overnight broth

SDS-PAGE and Western Blot Analysis

Rajashekara et al.

150 culture of Salmonella was centrifuged, the bacterial cell pellet was resuspended in PBS and inactived with 0.3% formalin. Birds were inoculated intramuscularly with formalin-killed Salmonella cultures at weekly intervals for up to 5 weeks. The sera from birds exposed to Salmonella cultures were examined in LAT and ELISA using rSEF14 antigen. In addition, rSEF14 antigen was also tested in ELISA on a panel of antisera (Table 1) against various avian pathogens obtained from National Veterinary Services Laboratories (NVSL, Ames, IA).

Sensitivity of rSEF14 Antigen for Detection of SE Antibodies in LAT and ELISA The ability of rSEF14 antigen in LAT and ELISA to detect the birds exposed to two different doses of SE cells was examined. Briefly, 55-week-old white leghorn layer chickens were divided into three groups (A, B, and C) of 10 birds each. These birds were tested negative for SE by culture and had no antibodies to SE when tested with serum plate and microagglutination tests. The birds in Groups A and B were given orally SE culture of 104 cfu and 1010 cfu per bird, respectively. Birds in Group C were given 1 mL PBS. The serum samples were collected at TABLE 1 Specificity of the rSEF14 Protein for the Detection of Antibodies to SE Serological tests Species Salmonella enteritidis Salmonella gallinarum Salmonella pullorum Salmonella dublin Salmonella berta Salmonella typhimurium Salmonella arizonae Escherichia coli Mycoplasma synoviae Mycoplasma gallisepticum Pox virus Reo virus Reticuloendothelial virus Marek’s disease virus SB-1 Infectious bursal disease virus Infectious laryngotracheitis virus Lymphoid leukosis virus A Lymphoid leukosis virus B Newcastle disease virus Chicken anaemia virus Herpes virus of turkeys Infectious bronchitis virus a

a

SPT MTb LATc ELISAd 1 1 1 1 1 2 2 2 NT NT NT NT NT NT NT NT NT NT NT NT NT NT

1 1 1 1 1 1 2 2 NT NT NT NT NT NT NT NT NT NT NT NT NT NT

1 2 2 1 2 2 2 2 NT NT NT NT NT NT NT NT NT NT NT NT NT NT

1 2 2 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2

Serum plate test using pullorum whole-cell antigen; b microagglutination test using enteritids whole-cell antigen; c LAT using rSEF14 antigen; and d ELISA using rSEF14 antigen. NT, not tested; 1, positive; 2, negative.

weekly intervals from birds in all groups for up to 7 weeks, at which point the experiment was terminated. Eggs from all birds were collected daily for 49 days. In addition, cloacal swabs were taken at weekly intervals for 7 weeks from all the birds and cultured for SE to monitor fecal shedding of SE. The serum samples and eggs were analyzed for the presence of SE-specific antibodies using LAT and ELISA. The samples were also analyzed by serum plate test (SPT) using S. pullorum whole-cell antigen and microagglutination test (MT) using SE whole-cell antigen for comparison.

Extraction of Egg Yolk Antibodies Antibodies from egg yolk were extracted using polyethylene glycol (PEG) precipitation method (Polson et al. 1980). Eggs collected every third day were used for antibody extraction. Briefly, eggs were allowed to warm at RT, yolk was aseptically collected and transferred into a clean, sterile 50-mL flask, and mixed. Ten mL of yolk from each egg was used for extraction of antibodies. Yolk was stirred slowly on a magnetic stirrer and mixed with 3 volumes of solution A (4.67% PEG8000, 10mMK2HPO4, pH 7.4, and 0.1M NaCl) for 5 min. The precipitate was centrifuged at 9,0003 g for 15 min at 4°C, the supernatant was transferred to another flask by filtering through four layers of gauze. The sample was precipitated again with solution B (36% PEG8000, 10 mM K2HPO4, pH 7.4, and 0.1M NaCl) for 5 min by gentle stirring. The final precipitate was centrifuged at 9,0003 g for 20 min at 4°C and the supernatant was discarded, the pellet containing antibody was suspended in storage buffer (0.01M K2HPO4, pH 7.4, 0.1M NaCl, 50 mg/mL gentamicin sulfate), and stored at 4°C until further use.

RESULTS Expression of S. enteritidis SEF14 Fimbrial Protein Using DNA sequences corresponding to sefA gene encoding mature SEF14 fimbrial protein was cloned and expressed in pET expression systems. The SEF14 protein was expressed in E. coli BL21DE3 or PlysS cells harbouring pETA/sefA plasmid as a fusion protein in a soluble form of molecular mass approximately 19 kDa (Figure 1A). The fusion part of the rSEF14 at the amino terminus contained amino acid residues that facilitated the purification (His tag) and identification (T7 tag) of the expressed protein (Figure 1B). The rSEF14 antigen expressed in E. coli was confirmed by western blot using antibodies to fusion

S. enteritidis Immunodiagnosis

151 The rSEF14 antigen-based LAT and ELISA specifically identified antibodies in serum from birds infected with SE. Serum samples obtained from birds infected with other serogroup-D Salmonella serotypes did not show antibodies to SEF14 antigen except S. dublin (Table 1). In contrast, SPT using pullorum whole-cell antigen and MT using SE whole-cell antigen cross reacted with the antibodies to all the serogroup-D Salmonella serotypes tested. In addition, antibodies to various avian pathogens did not react with rSEF14 in ELISA.

Sensitivity of rSEF14-LAT and rSEF14-ELISA

FIGURE 1 A. SDS-PAGE of soluble extracts from BL21DE3 E. coli cells expressing rSEF14 protein. Lane 1, cell extract before purification; Lane 2, cell extract after purification by nickel column; Lane 3, MW marker; and Lane 4, electroeluted nickel column purified rSEF14 protein: B. The deduced amino acid sequence of rSEF14 protein. Additional amino acid residues at the amino terminus are underlined.

peptide as well as the SEF14 antigen itself (Figure 2A and B).

Specificity of rSEF14-LAT and rSEF14-ELISA The rSEF14 antigen was evaluated in LAT as well as in ELISA for the detection of SE-specific antibodies.

The ability of rSEF14-LAT and rSEF14-ELISA to detect the antibodies in the birds exposed to different concentrations of SE cells was examined. Serum Antibody Response. The results of rSEF14LAT are shown in Figure 3. The rSEF14-LAT identified antibodies to SE in 88% of the birds at 1 and 2 weeks post-inoculation (PI) in the group given 1010 cfu of SE. Thereafter, the sensitivity of detection reached 44% by 7 weeks PI. In contrast, rSEF14-LAT identified SE antibodies in 55% and 66% of the birds in the group given 104 cfu of SE at 1 and 2 weeks PI, respectively. No bird was found positive for SE antibodies by rSEF14-LAT from 6 weeks PI onwards. The results of rSEF14-ELISA for antibodies to SE in serum and egg yolk from birds exposed to SE are shown in Figure 4. In birds exposed to 1010 cfu of SE, the serum antibodies to SE were detected in 88% of birds at 1 and 2 weeks PI and in 100% of birds from Week 3 PI onwards. With the birds given 104 cfu of SE, 55% of the birds were positive up to 4 weeks PI. The percentage of positive birds increased to 77% by 7 weeks PI. The serum samples were also analyzed

FIGURE 2 Western blot of rSEF14 expressed in E. coli BL21DE3 or PlysS cells. A. The soluble extracts from E. coli BL21DE3 or PlysS cell expressing rSEF14 probed with T7-tag monoclonal antibody. Lane 1, BL21DE3-(pETA/sefA plasmid); Lane 2, PlysS-(pETA/sefA plasmid); Lane 3, BL21DE3-(pETA/fimA plasmid) plasmid control; Lane 4, BL21DE3(pETA/sefA plasmid) uninduced control; Lane 5, PlysS (pETA/sefA plasmid) uninduced control; Lane 6, BL21DE3 (pETB/sefA plasmid) induced control; Lane 7, BL21DE3 (pETC/sefA plasmid) induced control; and Lane 8, BL21DE3 (pETA/fimA plasmid) uninduced control. B. Western blot of nickel column purified rSEF14. Lane 1, probed with monospecific polyclonal anti-SEF14 antibody; and Lane 2, probed with T7-tag monoclonal antibody.

Rajashekara et al.

152

DISCUSSION

FIGURE 3 Detection of antibodies to SE in the serum with rSEF14 antigen in LAT.

by conventional tests. Figure 5 and 6 shows the serum antibody response of the birds detected by SPT and MT. Egg Yolk Antibody Response. The SE specific antibody was also detected in egg yolk by rSEF14-ELISA. The SE-specific antibodies were detected as early as 6 days PI in both the 104 cfu (25%) as well as 1010 cfu (28%) of SE-exposed groups. The percentage of eggs positive for SE antibodies increased to 100% by Day 12 PI in birds given 1010 cfu of SE. However, in birds given 104 cfu of SE only, 80% of the eggs were found positive for SE antibodies. The yolk samples were also analyzed in SPT and MT. In SPT no positive reaction was observed in eggs until 15 days PI and only 25% of the eggs were found positive throughout the course of the experiment (Figure 5). On the other hand, MT test detected antibodies as early as 12 days PI and up to 50% of the eggs were positive for SE antibodies throughout the course of the experiment (Figure 6).

Fecal Shedding of SE The fecal shedding of SE was monitored by culturing cloacal swabs from SE-exposed chickens. Figure 7 shows the fecal shedding of SE post-exposure. SE was isolated from all the chickens administered with 1010 cfu of SE only during the first week of PI. In chickens administered with 104 cfu of SE, no SE was isolated at 1 week PI and only 25% of birds were positive for SE by the second week of PI. Thereafter, no isolation of SE was made from the cloacal swabs in these birds.

The infection of chickens with S. enteritidis and its spread through table eggs into human food chain, highlights the need for procedures to identify SEinfected chickens to intervene in its transmission. Testing of primary and multiplier breeder flocks of chickens for SE has been suggested by the United States Department of Agriculture (USDA), National Poultry Improvement Plan (NPIP), Centers for Disease Control (CDC), and other regulatory agencies to prevent the spread of SE to commercial egg laying birds. The control efforts for SE have focused on testing birds suspected for SE infection and the initiation of intervention programs. The increase in bacteriological monitoring of poultry flocks for SE has required an evaluation of alternative screening procedures to reduce the time and costs involved. The most likely alternative approach is serological testing. Currently used serologic test for monitoring SE infection include agglutination tests or ELISA. The agglutination tests such as SPT using S. pullorum whole-cell antigen and MT using SE whole-cell antigen are not able to detect SE infection specifically and give false positive reactions with other Salmonella serotypes (Barrow 1994). The ELISAs commonly used to detect SE infection involve use of either lipopolysccharide (LPS) or flagellar antigen of SE. Though these tests are more sensitive than agglutination tests, the major problem with these ELISAs are that they are not specific. The antigenic determinents of LPS and flagellar antigens of SE are also shared by other Salmonella serotypes that result in cross reactions in the field (Barrow 1994). In addition, the group D Salmonella includes two very important serotypes, S. gallinarum and S. pullorum, which are highly egg transmitted and are not pathogenic to humans, unlike SE, which belongs to the same group. In the poultry industry there is an eradication program for S. pullorum and S. gallinarum administered by USDA. The antigen used in this eradication program is a whole-cell antigen made from S. pullorum. This antigen does not distinguish SE, S. pullorum, and S. gallinarum infection of chickens. If and when there is a positive reaction with this antigen, the ability to differentiate it from SE infection is very important to avoid confusion before declaring the flock positive for S. pullorum or S. gallinarum. The expression of SEF14 fimbrial antigen by SE ensures its differentiation from other Salmonella serotypes including closely related serogroup-D Salmonella. In this study we investigated the application of rSEF14 fimbrial antigen for the specific serodiagnosis of chickens infected with SE. In our studies the rSEF14 antigen was highly specific in LAT and ELISA in identifying birds infected with SE (Table 1). Although, the sefA gene, which encodes SEF14 pro-

S. enteritidis Immunodiagnosis

153

FIGURE 4 Detection of antibodies to SE with rSEF14 antigen in ELISA: serum antibodies (top panel) and egg yolk antibodies (bottom panel).

tein, is present in many serogroup-D Salmonella, only S. enteritidis, S. dublin, S. moscow, and S. blegdam express SEF14 antigen (Turcotte and Woodward 1993). Because S. dublin, S. moscow, and S. belgdam are rarely found in birds, a presumptive identification of SE infection in chickens is possible using SEF14 antigen. Even though S. blegdam, S. dublin, and S. moscow are very closely related antigenically to SE, they are extremely rare in chickens. There were no isolations of S. blegdam and S. moscow from chickens reported by NVSL since 1984 except for 10 isolations of S. blegdam reported in the year 1994. Although S. dublin isolations though occasionally reported in chickens, only a total of 10 isolations have been reported since 1984. Similarly, no examples of S. blegdam, S. dublin, and S. moscow isolations have been reported from Central Veterinary Laboratories (CVL)

since the Zoonoses Order (1975) started in the United Kingdom in 1976 (Thorns et al. 1992). We demonstrated the use of latex agglutination test to specifically detect SE infection. This test can be a cost-effective alternate procedure to conventional culturing methods, which often have very low sensitivity because of intermittent shedding of the organisms in the feces. In our study 55 to 88% of the birds were positive by rSEF14-LAT by first-week PI depending on the amount of SE cells inoculated (Figure 3). Subsequently less number of birds was found positive in both the groups. This can be attributed to the type of antibody response that the infected chickens will have in the early phase of infection and the fact that the test mainly detects IgM antibodies. However, in SPT and MT tests 75 to 100% of the birds remained positive throughout course of the experi-

154

Rajashekara et al.

FIGURE 5 Detection of antibodies to SE in serum plate agglutination test using pullorum whole-cell antigen; serum antibodies (top panel) and egg yolk antibodies (bottom panel).

ment in the 1010 cfu of SE-inoculated group. This is probably because of the ability of these tests to detect antibody to variety of SE antigens including SEF14. Where as rSEF14-LAT detects antibodies to SEF14 fimbrial antigens alone and thus identify birds specifically infected with SE. In the group of birds exposed to 104 cfu of SE, less number of birds was found positive for SE antibodies in all three tests. It has been suggested that the serotypes, which have been associated with human food poisoning, unlike the host-adapted strains such as S. pullorum, produce low levels of agglutinin antibodies (Cullen and Nicholas 1991). In an examination of nearly 50 flocks with a history of SE infection the SPT detected antibody in only 50% of flocks. More revealingly, SPT detected antibody in only 30 of 92 naturally infected birds

from which SE was isolated from organs (Cullen and Nicholas 1991). In addition, the use of SPT has many disadvantages, it produces cross reaction with other Salmonella serotypes including group B Salmonella such as S. typhimurium (Chart et al. 1990a, 1990b). IgG antibodies can be detected in serum and egg yolk long after an active infection with SE has ceased (Barrow 1992). Several ELISA tests, based on a variety of Salmonella antigens or on Salmonella monoclonal antibodies (van Zijderveld et al. 1992) have been developed to detect antibodies to Salmonella infection in poultry. In the present study the rSEF14-ELISA was able to detect 55% (104 cfu) and 88% (1010 cfu) of the SE infected birds during first 2 weeks PI; however, subsequently 77% (104 cfu) and 100% (1010 cfu) of birds remained positive for SE antibodies through-

S. enteritidis Immunodiagnosis

155

FIGURE 6 Detection of antibodies to SE in microagglutination test using SE whole-cell antigen: serum antibodies (top panel) and egg yolk antibodies (bottom panel).

out the course of the experiment (Figure 4). Thorns et al. (1993) have also shown that the birds infected with SE readily seroconvert within 7 days of infection and the SEF14 IgG response persists at least 8 weeks thereafter. Several investigators have used LPS from SE in ELISA for detection of SE infection. This has often resulted in positive reaction with other Salmonella serotypes particularly against S. gallinarum and S. typhimurium (Desmidt et al. 1996). This result is expected because both serotypes share somatic antigens with SE (Le Minor 1984). Some investigators have used flagellar antigen (gm) of SE (Timoney et al. 1990) to overcome the cross-reaction observed with LPS-ELISA. One has to recognize that the serotypes sharing the same gm flagellar antigens

would result in cross reaction and may conceivably pose a problem. In the field cross reactions seem to occur with other Salmonella serotypes (Barrow 1994). Therefore, the use of fimbrial antigen specific to SE would overcome the drawbacks associated with the existing ELISAs. The results of our investigation suggested that antibodies to SE could be detected in egg yolk using the rSEF14 antigen. Eggs provide a convenient and inexpensive source of antibodies. The antibodies in the egg yolk can be detected using the same methods used for detecting serum antibodies without affecting the biosecurity of the flock. In the present study the antibodies to SEF14 antigen in the egg yolk of SE-infected birds was observed as early as 6-day

156

FIGURE 7 The fecal shedding of SE by culturing cloacal swab. The birds were inoculated with 104 cfu and 1010 cfu of SE orally and cloacal swabs were collected at weekly intervals.

post-infection in rSEF14-ELISA and the number of positive eggs increased subsequently. Moreover, higher number of birds was found positive for SEF14 antibodies in eggs than the serum from 104 cfu SEinoculated group. It has been suggested that the antibody level in the egg yolk seems to exceed those in the serum (Kasper et al. 1991; Patterson et al. 1962; Rose and Orlans 1981). Investigators in the UK have similarly identified antibodies to Salmonella species

Rajashekara et al. at high titers in the eggs of experimentally infected hens (Dadrast et al. 1990). However, the SPT and MT did not detect antibodies to SE in eggs until 15 days and 12 days post-inoculation, respectively. In addition, only up to 25% and 50% of the eggs were found positive in SPT and MT, respectively, throughout the course of the experiment. The rSEF14-ELISA was very efficient in identifying the eggs from SEinfected birds than SPT and MT, both in terms of percentage of eggs giving positive reaction as well as detecting SE antibodies in early stages of infection. In the birds infected with either 1010 or 104 cfu of SE, the isolation of SE from cloacal swab was very inconsistent (Figure 7). This suggests the poor sensitivity of bacteriologic culture for the detection of SE infected birds. The serological tests using rSEF14 antigen identified birds exposed to SE even though, they were found negative on culture of cloacal swabs. In conclusion, the results of the present investigation suggest that rSEF14-based serological assays (LAT and ELISA) provide a sensitive and specific identification tool for diagnosis of SE infection. We believe that the rSEF14-based assays will have wide application as screening tests in the control of SE infection in poultry and the subsequent reduction of human illnesses. Further studies to evaluate the rSEF14 based serological assays for commercial use are in progress.

REFERENCES Angula F (1997) The emergence of multidrug-resistant Salmonella typhimurium DT104 in humans in the United States. Proceedings of Research on salmonellosis in the Food Safety Consortium. Eds B. P. Smith and K. V. Nagaraja. US Animal Health Association meeting. Louisville, Kentucky, October 20. Barrow PA (1992) ELISA and the serological analysis of Salmonella infections in poultry: a review. Epidemiol Infect 109:361–369. Barrow PA (1994) Serological diagnosis of Salmonella serotype enteritidis infection in poultry by ELISA and other tests. Int J Food Microbiol 21:55–68. Bullock SL, Walls KW (1977) Evaluation of some of the parameters of the enzyme-linked immunosorbent assay. J Infect Dis 136:S279–285. Chart H, Rowe B, Baskerville A, Humphrey TJ (1990a) Serological tests for Salmonella enteritidis in chickens. Vet Rec 126:20. Chart H, Rowe B, Baskerville A, Humphrey TJ (1990b) Serological tests for Salmonella enteritidis in chickens. Vet Rec 126:92. Clouthier SC, Collinson SK, Kay WW (1994) Unique fimbriae-like structures encoded by sefD of the SEF14 fimbrial gene cluster of Salmonella enteritidis. Mol Microbiol 12:893–903.

Collinson SK, Emody L, Muller KH, Trust TJ, Kay WW (1991) Purification and characterization of thin, aggregative fimbriae from Salmonella enteritidis. J Bacteriol 173:4773–4781. Cooper GL, Nicholas RAJ, Bracewell CD (1989) Serological and bacteriological investigations of chickens from flocks naturally infected with Salmonella enteritidis. Vet Record 125:567–572. Cullen GA, Nicholas RA (1991) Serological analysis for antibodies to S. enteritidis. Vet Record 128:387–388. Dadrast H, Hesketh R, Taylor DJ (1990) Egg-yolk antibody detection in identification of Salmonella infected poultry. Vet Rec 126:219. Desmidt M, Ducatelle R, Haesebrouck F, De Groot PA, Verlinden M, Wijffels R, Hinton M, Bale JA, Allen VM (1996) Detection of antibodies to Salmonella enteritidis in sera and yolks from experimentally and naturally infected chickens. Vet Record 138:223–226. Hedberg CW, David MJ, White KE, MacDonald KL, Osterholm MT (1993) Role of egg consumption in sporadic Salmonella enteritidis of phage type 4 for chickens and Salmonella typhimurium infections in Minnesota. J Infect Dis 167:107–111. Jensenius JC, Andersen I, Hau J, Crone M, Koch C (1981)

S. enteritidis Immunodiagnosis

Eggs: conveniently packaged antibodies. Methods for purification of yolk IgG. J Immunol Meth 46:63–68. Kaspers B, Schranner I, Losch U (1991) Distribution of immunoglobulins during embryogenesis in the chicken. J Vet Med A38:73–79. Kim CJ, Nagaraja KV, Pomeroy BS (1991) Enzyme-linked immunosorbent assay for the detection of Salmonella enteritidis infection in chickens. Am J Vet Res 52:1069– 1074. Koeuth T, Versalovic J, Lupski JR (1995) Differential subsequence conservation of interspersed repetitive Streptococcus pneumoniae BOX elements in diverse bacteria. Genome Research 5:408–418. Le Minor (1984) Genus 111. Salmonella Lignieres 1900. In Bergey’s Manual of Systematic Bacteriology. Eds Krieg NR and Holt JG.. 1st Ed, Baltimore: Williams & Wilkins, p. 447. Mason J, Ebel E (1992) USDA-APHIS Salmonella enteritidis control program. In: Proceedings of the Symposium on the Diagnosis and Control of Salmonella. Ed, GH Snoeyenbos. Richmond, Virginia: US Animal Health Association, p. 78. Muller KH, Collinson SK, Trust TJ, Kay WW (1991) Type 1 fimbriae of Salmonella enteritidis. J Bacteriol 173:4765– 4772. Patterson R, Youngner JS, Weigle WO, Dixon FJ (1962) Antibody production and transfer to egg yolk in chickens. J Immunol 89:272–278. Polson A, Von Wechmar MB, Van Regenmortel MHV (1980) Isolation of viral IgY antibodies from yolks of immunized hens. Immunol Commun 9:475–493. Rose ME, Orlans E (1981) Immunoglobulins in the egg, embryo and young chick. Dev Comp Immunol 5:15–20. Rodrigue DC, Tauxe RV, Rowe B (1990) International increase in Salmonella enteritidis: A new pandemic? Epidemiol Infect 105:21–27.

157

St. Louis ME, Morse DL, Potter ME, DeMelfi TM, Guzewich JJ, Tauxe RV, Blake PA (1988) The emergence of grade A eggs as a major source of Salmonella enteritidis infection. J Am Med Assoc 259:2103–2107. Thorns CJ, Sojka MG, Chase D (1990) Detection of a novel fimbrial structure on the surface of Salmonella enteritidis by using a monoclonal antibody. J Clin Microbiol 28: 2409–2414. Thorns CJ, Sojka MG, McLaren IM, Dibb-Fuller M (1992) Characterization of monoclonal antibodies against a fimbrial structure of Salmonella enteritidis and certain other serogroup D salmonellae and their application as serotyping reagents. Res Vet Sci 53:300–308. Thorns CJ, Nicholas RAJ, Bell MM, Chrisnall SC (1993) Preliminary results on the use of SEF14 fimbrial antigen in an ELISA for the serodiagnosis of Salmonella enteritidis infection in chickens. Proceedings of the EC workshop on ELISA for serological diagnosis of Salmonella infection in poultry. Brussels, 7–9 June. Directorate General for Agriculture, Commission of the European communities Brussels. Timoney JF, Sikora N, Shivaprasad HL, Opitz M (1990) Detection of antibody to Salmonella enteritidis by a gm flagellin-based ELISA. Vet Rec 127:18–19. Turcotte C, Woodward MJ (1993) Cloning, DNA nucleotide sequence and distribution of the gene encoding SEF14, a fimbrial antigen of Salmonella enteritidis. J Gen Microbiol 139:1477–1485. Van Zijderveld FG, Van Bemmel AMV, Anakotta J (1992) Comparison of four different enzyme-linked immunosorbent assays for serological diagnosis of Salmonella enteritidis infections in experimentally infected chickens. J Clin Microbiol 30:2560–2566. Williams JE, Whittemore AD (1971) Serological diagnosis of pullorum disease with the microagglutination system. Appl Microbiol 21:394–399.