Applying sunscreens on earthworms: Molecular response of Eisenia fetida after direct contact with an organic UV filter

Science of the Total Environment 676 (2019) 97–104

Contents lists available at ScienceDirect

Science of the Total Environment journal homepage: www.elsevier.com/locate/scitotenv

Applying sunscreens on earthworms: Molecular response of Eisenia fetida after direct contact with an organic UV filter M. Novo a,b,⁎, A.B. Muñiz-González b, D. Trigo a, S. Casquero a, J.L. Martínez Guitarte b a b

Biodiversity, Ecology and Evolution Department, Faculty of Biology, Complutense University of Madrid, Spain Mathematical and Fluid Physics, Department Environmental Toxicology and Biology Group, Sciences Faculty, UNED, Spain

H I G H L I G H T S

G R A P H I C A L

A B S T R A C T

• Gene expression changes were studied in Eisenia fetida after exposure to a UV filter. • Whole-body tissue was analyzed after acute (48 h) exposure to 4-OHBP. • Gene expression of EcR increased, indicating endocrine disruption. • The filter altered CuZn SOD expression, related to oxidative stress response. • Gene expression of GAPDH, involved in energy metabolism, decreased.

a r t i c l e

i n f o

Article history: Received 27 February 2019 Received in revised form 12 April 2019 Accepted 15 April 2019 Available online 16 April 2019 Editor: Jay Gan Keywords: Xenobiotics Annelids 4-Hydroxybenzophenone Endocrine disruptor Biomarkers

a b s t r a c t The use of organic Ultraviolet (UV) filters has increased in the last years, either in sunscreens, other cosmetics, or even food packaging. These filters may end up in soil and water since the Wastewater Treatment Plants may not successfully remove them. Among them, benzophenones are known to act as endocrine disruptors. However, most of the studies are directed towards vertebrates and aquatic invertebrates, while there is a lack of information on the molecular mechanisms affected by these compounds on soil dwelling invertebrates. Here, we study the impact of direct acute (48 h) contact of 4-hydroxybenzophenone (4-OHBP) at two sublethal concentrations (0.02 and 0.2 mg/mL) on gene expression of the earthworm Eisenia fetida. Investigated genes were involved in endocrine pathways, stress response, detoxification mechanisms, genotoxicity, energy metabolism and epigenetics. Three of them were identified for the first time in earthworms. Our results suggest that exposure to 4OHBP affected endocrine pathways, causing an increase in the Ecdysone receptor gene (EcR) expression. Moreover, the UV filter induced changes in the CuZn superoxide dismutase gene (CuZn SOD), indicating an effect in the stress response. Finally, significant changes were detected for glyceraldehyde-3-phosphate dehydrogenase gene (GAPDH) expression, indicating that energy metabolism is influenced by the 4-OHBP and highlighting the risks of using GAPDH as an internal reference for Real Time PCR. © 2019 Elsevier B.V. All rights reserved.

1. Introduction ⁎ Corresponding author at: Biodiversity, Ecology and Evolution Department, Faculty of Biology, Complutense University of Madrid, Spain. E-mail address: [email protected] (M. Novo).

https://doi.org/10.1016/j.scitotenv.2019.04.238 0048-9697/© 2019 Elsevier B.V. All rights reserved.

The emergence of new chemical compounds in the last years has been accompanied with the concern of their effects on humans and environment. Known as xenobiotics, they are rare or nonexistent in the

98

M. Novo et al. / Science of the Total Environment 676 (2019) 97–104

nature, being artificial products synthetized by us (De Bolster, 1997). Among them, endocrine-disrupting chemicals (EDCs) present such a similar chemical structure to that of certain hormones that they can be bound to steroid hormone receptors and meddle with normal regulation of the endocrine system (Sharma et al., 2017). The use of Ultraviolet (UV) filters within cosmetics and sunscreens has increased lately because of the intensification of UV radiation and associated health damages. They are also added to food packaging and other perfumery products in order to avoid their odour and colour degradation (Lewis, 2016; Wypych, 2015). According to their mechanism of action, UV filters can be classified into physical or chemical, and benzophenones are included within the latter. Because of the difficulty and the lack of regulation for eliminating these filters in the Wastewater Treatment Plants, they often end up in water (Harrison et al., 2006). Eventually, they reach the soil ecosystems through fertilization with sewage sludge or irrigation with regenerated water (Camino-Sanchez et al., 2016). Gago-Ferrero et al. (2011) showed the presence of two main products of the benzophenone-3 (BP-3) degradation in the local sludge of 15 treatments plants in Spain: 4,4′-dihydroxibenzophenone and the focus of this study, 4-hydroxibenzophenone (4-OHBP). Benzophenones are known to accumulate in organisms (Gago-Ferrero et al., 2015; Langford et al., 2015; Liao and Kannan, 2019; Tsui et al., 2017) and several studies show that they are endocrine disruptors (Ghazipura et al., 2017; Kim and Choi, 2014), highlighting the necessity for further investigation of the effects of these compounds. Most of the research has been focused on vertebrates, showing that benzophenones can inhibit gamete development (Weisbrod et al., 2007), reduce daily egg production (Kim et al., 2014), induce a decline in hatching and testosterone (Ghazipura et al., 2017) or change gene expression (Bluthgen et al., 2012) of fishes for example. Studies of the effects of UV filters on invertebrates are scarce and mainly involve water ecosystems, because of their relationship with sunscreens through aquatic leisure activities. For example, Schmitt et al. (2008) showed a decrease in reproduction of the freshwater oligochaete Lumbriculus variegatus and the increase in mortality and embryo production of the snail Potamopyrgus antipodarum after their exposure to certain camphors. Kaiser et al. (2012) showed the decrease in reproduction of two snails after exposure to 3 chemical UV filters and Guyon et al. (2018) observed a decrease in egg hatching success of a marine copepod after exposure to benzophenone. Campos et al. (2017b) found a significant decrease in larval growth, developmental delay in females and weight decrease in males of Chironomus riparius after exposures to BP-3. Negative impacts of BP-3 have been also shown in corals such as bleaching and death (Danovaro et al., 2008) or genotoxicity and endocrine disruption (Downs et al., 2016). Casquero et al. (submitted) presented the first results of the effects of organic UV filters on soil dwelling invertebrates, showing that the exposure of the earthworm Eisenia fetida to 4-OHBP resulted in increased mortality and decreased reproduction capacity. However, the harmful concentrations (100 mg/kg or higher) were above those environmentally relevant. Studies on concentrations of UV filters in soils are scarce and there is not much information on the biodegradation or accumulation potential of these compounds in soil. Jeon et al. (2006) showed that concentrations of UV filters in soil ranged from 500 to 18,380 ng/kg in Korea. Casquero et al. (submitted) found that the direct contact of 4-OHBP on the earthworm E. fetida produced significant mortality at 2 mg/mL. Earthworms are ideal candidates for evaluating the effects of contaminants (Novo et al., 2018) because of their essential role for soil structure and fertility and their basal position in the food chain, representing the main animal biomass in the soil (Lavelle et al., 2006). Standardized tests are available for the earthworm species E. fetida (OECD, 1984, test No. 207; OECD, 2004, test No. 222), which has been widely used for soil toxicity assessments. The typical endpoints are survival, growth, and reproduction, providing eco-toxicologically relevant information. Nevertheless, the insights provided by molecular studies can aid unravelling the mechanisms involved in UV filter effects in

invertebrates, which are poorly understood. Direct contact tests (OECD, 1984 test No. 207) are ideal for the study of the molecular effects exerted by a toxicant since the acute stimulus can clearly unveil the genetic mechanisms involved in the response. Some studies showed that exposure to benzophenones altered endocrine, stress and detoxification pathways of the aquatic midge Chironomus riparius; upregulating the Ecdysone Receptor (EcR, Ozaez et al., 2014; Ozaez et al., 2016b), Heat Shock proteins (HSP70, Ozaez et al., 2014) or cognates (HSC70, Martin-Folgar et al., 2018) and glutathione-peroxidases (GSTs, Martinez-Guitarte, 2018). Moreover, they have shown to have genotoxic effects in corals (Downs et al., 2016). No data on molecular effects of organic UV filters on soil-dwelling animals is available at the moment. The aim of this work is to assess gene expression changes in the earthworm E. fetida, after acute exposures (48 h) to different concentrations of the chemical UV filter 4-OHBP by direct contact tests. Genes involved in different pathways that are potentially interesting in the evaluation of the effects of endocrine disruptors and toxicants are analyzed. Some of them were already described by Novo et al. (2018) and three more have been identified here for the first time in earthworms. Selected genes were involved in endocrine pathways (Ecdysone Receptor [EcR], Membrane Associated Progesterone Receptor [MAPR], Adiponectin Receptor [AdipoR], and Estrogen Receptor [ER]), stress response (heat shock protein cognate 70-4 [HSC70 4], and CuZn superoxide dismutase [CuZn SOD]), detoxification mechanisms (Metallothionein, and glutathione-peroxidase Pi [GST Pi]), genotoxicity (poly [ADP-ribose] polymerase 1 [PARP1], and X-ray repair cross-complementing protein 1 [XRCC1]), energy metabolism (Lumbricine kinase, and glyceraldehyde3-phosphate dehydrogenase [GAPDH]) and epigenetics (DNA methylation = DNA (cytosine-5)-methyltransferases 1 [DNMT1] and 3 beta [DNMT3b]; RNA interference = Piwi2). This study constitutes the first attempt to understand the molecular mechanisms of a soil-dwelling animal affected by an organic UV filter. Moreover, some of the biomarkers used to evaluate these mechanisms in earthworms are presented here for the first time.

2. Material and methods 2.1. Exposures of earthworms by contact toxicity test Individuals of a unique genetic lineage of Eisenia fetida, previously genotyped (Verdu et al., 2018) were used for the exposures. Before starting the experiment, all earthworms were kept in culture chambers under controlled temperature conditions of 21 ± 0.5 °C and food ad libitum (manure of untreated horses; no antibiotics or antiinflammatories). Powdered 4-Hydroxibenzophenone (4-OHBP) was acquired from SIGMA-ALDRICH® (purity N98%, CAS No. 1137-42-4). Direct exposure of the earthworms to the 4-OHBP solution was performed following the OECD contact test (OECD, 1984 test No. 207) and modified as described in Verdu et al. (2018). In brief, two rounded pieces of filter paper were placed in Petri dishes of 9 cm diameter and 1 mL of the selected concentration of 4-OHBP dissolved in absolute ethanol was added. Casquero et al. (submitted) showed in a contact test that a concentration of 2 mg/mL of 4-OHBP provoked the death of all the earthworms (N = 10). Therefore, here two sub lethal concentrations were used in order to study the molecular mechanisms implied in the response to this filter: 0.02, and 0.2 mg/mL plus the control that included only ethanol. Filter papers were left in the dark for evaporation and when dried, they were remoistened with 2 mL of distilled water. Then, one adult (clitellated) earthworm was introduced per plate between the two filter papers and maintained at 21 ± 0.5 °C and darkness for 48 h. Six replicates (one earthworm per replicate) were performed per concentration. Earthworms were stored in RNAlater® (Invitrogen) and conserved at −80 °C until RNA extraction.

M. Novo et al. / Science of the Total Environment 676 (2019) 97–104

2.2. RNA extraction and retrotranscription Full body tissue was homogenized using Trizol reagent (Invitrogen) and total RNA was extracted following the manufacturer's protocol. Samples were afterwards treated with RNase-free DNase (Roche) for 90 min and organic extraction was performed with phenolchloroform-isoamyl alcohol and Phase Lock Gel Light tubes (Quantabio). Absorption spectroscopy (Biophotometer Eppendorf) was used to check concentration and quality of RNA. Reverse transcription was done from 1 μg of RNA and adding 100 units of the M-MLV enzyme (Invitrogen), 0.5 μg oligo dT20 primer (Sigma), 0.5 μg random hexamers (Sigma) and 0.5 mM dNTPs (Biotools) at 37 °C for 50 min in a final reaction volume of 20 μL. 2.3. Real time-PCR Primer pairs were retrieved from Novo et al. (2018) for genes that code for the proteins EcR, MAPR, AdipoR, HSC70 4, CuZn SOD, GAPDH, Metallothionein, GST Pi, PARP1, DNMT1, DNMT3b, and Piwi2 (Table 1). Additionally, sequences that code for proteins ER, Lumbrokinase, and XRCC1 were identified from the transcriptomic data generated in Novo et al. (2015, ENA study number PRJEB7919). For those, primer3 v.0.4.0. Software was used for primer pair design and a mix of cDNA samples from E. fetida was used in order to check for amplification and PCR efficiency. Firstly, a regular polymerase chain reaction (PCR) was performed. The reaction mixture contained the following: 10 μl of DNA AmpliTools Green Master Mix 2× (Biotools), including MgCl2, dNTPs and Taq DNA polymerase; 1.2 μl of a mixture of forward and reverse primers (5 μM each); 1000 ng of cDNA template; and sterile H2O to a final volume of 20 μl. The PCR profile was 95 °C (30 s), 40 cycles of [95 °C (5 s), 62 °C (15 s), 65 °C (10 s)], with a final extension of 5 s at 65 °C. PCR products were checked in 9% acrylamide gels stained with ethidium bromide and those primers that produced a single band were subsequently used for Real-time PCR. PCR efficiency was determined from a standard curve using template dilutions 1:10 in five steps and under the same PCR conditions. The reaction was carried out with 0.5 units of DNA polymerase (Biotools, Spain), 2 mM Cl2Mg, 0.4 mM dNTPs (Biotools, Spain), 0.5× Eva Green (Biotium, USA), 5 μM of each primer (Forward and Reverse), 20 μg of bovine serum albumin (BSA, Sigma) and 500 ng of cDNA in a final volume of 20 μl. The PCR profile was 95 °C (30 s), 35 cycles of [95 °C (5 s), 62 °C (10 s), 65 °C (15 s)], 65 °C (5 s) and 95 °C (5 s). The primers with efficiencies between 94 and 111% were used for amplification of the experimental samples and are shown in Table 1. Melting curves were evaluated post run for verification of the accuracy of the amplicons. Expression profiles of the selected genes were evaluated in samples from different concentrations in a CFX96 thermocycler (Bio-Rad). Samples were run in duplicate wells

99

and two independent PCR replicates were done. Levels of mRNA were determined by the standard 2−ΔCT method normalized to the reference gene in the software BioRad CFX Manager 3.1. Ribosomal protein L13 (Novo et al., 2018) was used as endogenous reference. GAPDH was going to be included as a reference as well but its expression showed to be modified by the toxicant (see below). 2.4. Statistical analyses SPSS Statistics 24 (IBM Corp., USA) was used for statistics. Highest and lowest value per treatment were discarded in order to reduce the variability due to individual changes. Normal distribution and homocedascity of the data were assessed by Shapiro-Wilk and Levene tests respectively. Analysis of variance (ANOVA) was performed for normally distributed data, followed by a Tukey test for post-hoc comparisons. Some of the genes were log transformed in order to fulfill the criteria. Nonparametric Kruskal-Wallis test was performed when assumptions for ANOVA were not satisfied. P-values b0.05 were considered statistically significant. 3. Results 3.1. Identification of genes Three new sequences which code for the proteins estrogen receptor (ER), lumbrokinase (also known as lumbricine kinase), and X-ray repair cross-complementing protein 1 (XRCC1) were identified. Only ER showed a full ORF while the other two had truncated ORFs. The sequence coding for ER had 3082 bp with an ORF of 745 aa. Comparison with database showed that the highest homology was with the estrogen receptor of Nucella lapidus, a mollusk, in the region coding for the DNA binding domain and the ligand binding domain. These domains are characteristic of this receptor and allow the identification of the gene. The second sequence coded for the C-terminal region of lumbrokinase, a protein related with phosphagen kinases. It had 601 bp of length and the ORF was the C-terminal 145 aa. An incomplete creatine kinase domain, characteristic of these proteins, can be identified. The highest homology found was with the taurocyamine kinase of the polychaete Arenicola brasiliensis. Finally, the last sequence had a length of 457 bp and included 98 aa in the ORF. The highest homology found was with the N-terminal domain of XRCC-1, a protein related with the DNA repairing mechanisms, of Capitella teleta, another annelid. These three new sequences identified allow to study endocrine response, energy metabolism, and DNA repairing mechanisms in earthworms, opening new possibilities in the characterization of the response to toxicants. Representation of the protein structure can be found in Fig. 1 and Genbank accession numbers are shown in Table 1.

Table 1 Primers used for real-time polymerase chain reaction in Eisenia fetida. Information on the new generated primers is shown in bold. Function

Gene

Forward (5′-3′)

Reverse (5′-3′)

Endocrine

EcR MAPR AdipoR ER HSC70-4 CuZn SOD Metallothionein GST Pi PARP1 XRCC1 DNMT1 DNMT3b Piwi2 GAPDH Lumbrokinase L13

TCAACTGTGATGCGTTACGA AAGTATTTGATGTCACGCGC GGTGGTCTCGCTTATGGATC AGGCCACGTTGACTACGAC TCTTGCTGAGGGTCTCTTCA GATCAGGAGAGGCATGTTGG CTTCTCAGCGTCAGCACAG TCTCCTACCTGTCTCGATGG GGTACGACGATTGGTGGAAA GGAAATGTGTGGCAGGTGAA AAGAAATGAGTGCCCTGGTG GAGTTCTGCCGGATACTGTG TGGTATTCACGGGTCTGTTG GTATCGGTTGTCGACCTGAC CATCTCCAACTCAGCCAGAC CATCAACAAGAAAGAGGCGC

AGAGATTGCAGTGAGAAGGC GCATCCCTTCCAGCGAATAT GAAAGCACGTCAGAACTCCA GTCACTTCCTGCAGAAATCC GCCAAACACTTTACGAACCA ATGATTGAATTTGGCCCGGT CGCAAGAGAGGGATCAACTT CTCGGTACTTGGCGATCTTA TGTCGGCATACACACTCTTG CCACAAAAGCTGATCCCTCA GTCTCGCCAATCAGATCCTC AGAGATGATCGTGCGTGATT CTCTCTGGCAGCTTGTGATT AGACGACCTCATCCTCTGTG GAGGTCGTCGATGCTTTCTC GCGATATTCCTTCAGACGCT

Stress response Detoxification DNA modification (genotoxicity and repair) Epigenetic modification RNA interference Energy Reference gene

Efficiency (E%) 94.9 103.9 104.5 108 111 109.4 99.3 108.8 105 102.9 105.4 106.2 109 110.7 108.9 100.3

Study Novo et al., 2018 Novo et al., 2018 Novo et al., 2018 This study Novo et al., 2018 Novo et al., 2018 Novo et al., 2018 Novo et al., 2018 Novo et al., 2018 This study Novo et al., 2018 Novo et al., 2018 Novo et al., 2018 Novo et al., 2018 This study Novo et al., 2018

GeneBank accession MF324870 MF324871 MF324876 MK550701 MF324874 MF324875 MF324873 MF324872 MF324880 MK550703 MF324877 MF324878 MF324879 MF324881 MK550702 MF324882

100

M. Novo et al. / Science of the Total Environment 676 (2019) 97–104

Estrogen receptor 1

NR_DBD_ER

NR_LBD_ER_like

745

Lumbrokinase 1

145

Creatine kinase-like X-ray repair cross-complementing protein 1 (XRCC1) 1

98

XRCC1 N-terminal Fig. 1. Structure and conserved domains of the proteins identified within this study for Eisenia fetida.

3.2. Gene expression changes Fig. 2 represents gene expression changes after acute and direct exposure of earthworms to 4-OHBP during 48 h. Our results show that there is a statistically significant increase in the expression of the endocrine related gene EcR (P b 0.05) for both concentrations tested. A slight but statistically non-significant increase can be observed for AdipoR as well. Regarding stress response, changes are found for CuZn SOD expression, which significantly decreases for the lowest 4-OHBP concentration tested (P b 0.05), whereas for the highest concentration, expression levels are intermediate. A similar but statistically non-significant pattern is observed for HSC70 4. Regarding energy metabolism, statistically significant changes are found for GAPDH expression, that shows to be decreased at the highest concentration of 4-OHBP tested when compared to the lowest (P b 0.05). A nearly significant increase is shown for the expression of detoxification related Metallothionein at the highest concentration of 4-OHBP tested. No statistically significant changes in expression were found for genes related to DNA modification (genotoxicity and DNA repair) or epigenetics. ER and DNMT3b showed very low expression levels for the samples of this experiment and therefore were excluded from the analyses and figures.

4. Discussion Very limited information is available on the toxicity of emerging contaminants, such as organic UV filters, on invertebrates, and there is a total lack of information in relation to edaphic animals, including earthworms. The only study that has evaluated the effects of chemical UV filters on earthworms provided ecotoxicological information but no data on the affected molecular mechanisms (Casquero et al., submitted). In the present study, we provide a first approach to identify the cellular pathways and processes involved in the response to these toxicants. We newly identified the mRNAs of three proteins that could serve as biomarkers for ecotoxicological studies of earthworms and increase the number of processes that can be analyzed at molecular level. Those, together with the ones identified in Novo et al. (2018) were used in order to investigate the molecular mechanisms affected by the acute exposure (48 h) of Eisenia fetida to the UV filter 4-OHBP. We found that the toxicant exerted a significant impact on endocrine, stress, and energy related genes of earthworms. Regarding endocrine pathways, we found significant increase of EcR expression after exposure to both 4-OHBP tested concentrations when compared to control. Casquero et al. (submitted) showed measurable effects on reproduction of E. fetida after longer exposures in soil to 4-OHBP, which could be

explained in part by this disturbance in the expression of the endocrine related genes. EcR is a specific nuclear receptor involved in the molting of arthropods and activation of a cascade of hormonal effects (Spindler et al., 2009) but its specific role in other organisms such as annelids is unknown. Injected precursors of ecdysone can be modified by annelids (Mercer et al., 1988) but no internal source has been detected. It is a similar situation to that proposed for mollusks with estrogens, showing ER expression but with doubts about the expression of a key enzyme, aromatase, to produce estrogens endogenously (Scott, 2018). Nevertheless, other endocrine disruptors, such as Bisphenol A (BPA), have been able to modify the expression of EcR gene in earthworms (Novo et al., 2018). However, in that case, the effect was the opposite and was only found in masculine reproductive tissue after chronic exposures (28 days) but not in full body tissue after acute exposures. These results suggest that EcR could be affected specifically depending on the compound, supporting its relevance in the analysis of endocrine disruptors in earthworms. Previous studies in invertebrates show similar effects of organic UV filters on EcR expression. Ozaez et al. (2016b) found that 5 filters, including 4-OHBP, provoked a significant overexpression of this gene in embryos of C. riparius after 24 h of exposure. The expression of EcR also increased in salivary gland cells of this midge after exposure to BP-3 (Ozaez et al., 2014). However, while EcR has a defined function in molting and development on insects, its function in annelids is still under research. Other studies on vertebrates have shown that organic UV filters provoke estrogenic activity and activate the ER in fishes (Coronado et al., 2008; Inui et al., 2003), humans (Schreurs et al., 2004) and rats (Mueller et al., 2003). Nevertheless, we failed to prove that in earthworms, since the expression levels found for ER in the experimental samples were very low. A slight increase was observed as well for AdipoR, but it was non-significant, while no change was observed for MAPR. Similarly to EcR, BPA was able to modify the expression of both genes in masculine tissue (Novo et al., 2018) so these results show that using the whole animal may be masking a differential expression of endocrine related genes. It would be interesting to analyze the expression of these genes in other tissues in order to know the mRNA levels upon chemical stress and to decide which of these genes are adequate for analysis of whole animal and which for tissue-specific studies. On the other hand, Adiponectin modulates a number of metabolic processes, including glucose regulation and fatty acid oxidation, so the response of the AdipoR could connect the response of the energy metabolism with the hormone regulation. It could be possible that the slight increase observed in AdipoR, involved in insulin metabolism on vertebrates (Yamauchi et al., 2014) could be related, indirectly, with the changes in GAPDH expression. Although MAPR did not show any change, it is important to remind that it shows a similar non-covalent

AdipoR

4

Endocrine Stress response

3

b

b

2

40

2

Detoxificaon

30

1

DNA modificaon

1

1

RNA interference

0

0

DNA methylaon

Control

1

0.2 mg/ml

10 0 0.02 mg/ml

25

1

15

0

10

0

5

0

0 0.2 mg/ml

Metallothionein

25

3

a ab

b

2 1 0

Control

0.02 mg/ml

0.2 mg/ml

GST Pi

8

Control

2

0

ab a

XRCC1

0.02 mg/ml

PARP1

1

10

0.02 mg/ml

Control

0.2 mg/ml

Piwi2

1

1

8

0 Control

0.2 mg/ml

b

5

0 Control

0.2 mg/ml

20

10

5

0.02 mg/ml

GAPDH *

25

4

10

0.2 mg/ml

Lumbrokinase

5

15

15

0.02 mg/ml

4

6

20

Control

0.2 mg/ml

CuZn SOD *

30 20

0.02 mg/ml

20

Control

1

Control

a

2

1

2

0.2 mg/ml

DNMT1

3

1

0.02 mg/ml

M. Novo et al. / Science of the Total Environment 676 (2019) 97–104

Gene expression

0.02 mg/ml

HSC70 4

1

30

MAPR

60 50

2

Energy

12

EcR *

3

0

6 4 2 0 Control

0.02 mg/ml

0.2 mg/ml

0

1

0

0

1

0

0 Control

0.02 mg/ml

0.2 mg/ml

0 Control

0.02 mg/ml

0.2 mg/ml

Control

0.02 mg/ml

0.2 mg/ml

4-OHBP concentraon Fig. 2. Expression levels of the analyzed genes in the earthworm Eisenia fetida comparing control conditions and acute direct exposures to 4-hydroxybenzophenone. The horizontal line within the box indicates the median. The boundaries of the box indicate the 25th and 75th percentiles, and the whiskers indicate the highest and lowest results. The mean is indicated by the diamond inside the box. Statistically significant results (P b 0.05) are highlighted by an asterisk. Different letters indicate statistically significant differences among treatments (P b 0.05) in Post-hoc comparisons. The legend at the top left indicates functions in which the analyzed genes are involved. See complete names of the genes in text. 101

102

M. Novo et al. / Science of the Total Environment 676 (2019) 97–104

heme-binding domain related to cytochrome b5, a well-known functional interaction partner of microsomal cytochrome P450 monooxygenase systems (Novo et al., 2018). It has been described that MAPR family could present a diversity of functions because of the interaction with different cytochrome P450 systems (Ryu et al., 2017), so further research is needed to elucidate the importance of its analysis in tissues to know the response to UV filters. Regarding the stress-related genes, we found significant changes in CuZn SOD, for which expression was significantly lower for the lowest concentration of 4-OHBP tested in relation to the control. However, for the highest concentration tested, SOD gene was not significantly different from the control, going up again. Levels of antioxidant enzymes such as SOD have been measured in earthworms as a proxy to oxidative stress, in order to assess the toxic effects of contaminants. The general rule is the activation of these enzymes at low concentrations but lack of effect at higher ones or longer exposures (e.g., Xue et al., 2009; Zhang et al., 2013). The increase of stress-related genes has been reported as well in studies on the effects of UV filters on invertebrates. Ozaez et al. (2014, 2016b) showed that UV filters, including 4-OHBP, induced HSP70 expression in C. riparius. Similar effects were found after exposures to binary mixtures of three filters, including a benzophenone (Ozaez et al., 2016a). BP-3 also induced the expression of the cognate HSC70 3 in C. riparius (Martin-Folgar et al., 2018). A similar to SOD but non-significant non-monotonic response was observed for HSC70 4. HSP70 expression has been measured in order to evaluate induced stress in earthworms (eg., Liu et al., 2017). It is interesting to note that this member of HSP70 family has been related with the Polycomb group of genes (Mollaaghababa et al., 2001), so a role in development could be expected, raising the question about its utility as biomarker in the analysis of developmental toxicity. HSPs are chaperones, important for cellular recovery from stress because they help maintain correct protein folding (Morris et al., 2013). They have also been related to endocrine pathways and some heat shock proteins, such as HSP90 and HSC70, are essential for ecdysone receptor activity in vivo, contributing to the steroid hormone signaling inside of the cells (Arbeitman and Hogness, 2000; Gehring, 1998). Our results show a decrease in expression of the stress-related genes at the lowest concentration tested of 4-OHBP and no effect at the highest, which represents a nonmonotonic response reported for endocrine disruptors and hormones (Li et al., 2007; Vandenberg, 2013). In fact, Novo et al. (2018) showed a similar pattern for HSC70 4 in the male organs of E. fetida after chronic exposure to the endocrine disruptor BPA. Nevertheless they found an increase of the expression of this gene for full-body tissue after acute exposure to this toxicant. The differential expression between compounds requires additional studies to analyze the response of this gene and also its relation with other stress genes or other cellular processes. Regarding energy metabolism, we analyzed GAPDH and lumbricine kinase. While GAPDH expression decreased at the highest concentration of 4-OHBP tested when compared to the lowest, no significant change was observed for lumbricine kinase. This justifies that GAPDH is not used as a reference gene in this case (as opposed to Novo et al., 2018, where it showed to be stable over the different conditions). The use of GAPDH as a reference gene has been discussed as it brings good results in some studies but it is not supported in others, because the specific experimental factors may cause variability of its expression (Kozera and Rapacz, 2013). GAPDH plays a key role in glycolysis and the observed inhibition would lead to a decrease of energy production and reduced growth by the organism (Zinsser et al., 2014). However, Casquero et al. (submitted) showed that growth was unaffected in earthworms after their chronic exposure to the UV filter 4-OHBP. Downregulation of GAPDH and other genes involved in glycolysis has been observed as a result of benzophenone exposure in human cells (Song et al., 2011). Moreover, Campos et al. (2017b) showed an increased energy consumption (measured by quantifying Electron Transport System, ETS) by C. riparius after its exposure to three UV filters, including BP-3, probably related to an increase in energy demands for defensive

mechanisms that could compromise allocation for growth and reproduction (Sokolova et al., 2012). On the other hand, lumbricine kinase is a phosphagen kinase so it is related to first stages of muscle contraction and the high-energy compounds used during this period. The lack of response suggests that this UV filter does not compromise the movement of the earthworm so, probably, it will not prevent the individual from escape of contaminated zones. Regarding detoxification, a nearly significant increase is shown for the expression of Metallothionein at the highest concentration of 4OHBP tested. Metallothioneins have been used as biomarkers for metal exposures in terrestrial organisms, and specifically in earthworms (Sturzenbaum et al., 2004). The exposure of these animals to other endocrine disruptors, such as BPA, is known to provoke a significant increase in Metallothionein expression (Novo et al., 2018). Other animals, such as fishes, have shown a modulation of this gene as a consequence of xenoestrogen action (Werner et al., 2003). Expression levels of different genes involved in detoxification mechanisms, such as GSTs, can change following benzophenone exposure, as reported for the aquatic midge C. riparius (Martinez-Guitarte, 2018). However, in our case, GST Pi expression was unaffected by 4-OHBP. This lack of effect of UV filters on some GSTs has been also observed in C. riparius after exposures to the filters 2-ethylhexyl 4-(dimethylamino) benzoate (ODPABA) and octocrylene (OC, Muñiz-González and Martínez-Guitarte, 2018) or BP-3 (Campos et al., 2017b) and in Sericostoma vittatum after exposures to BP-3 (Campos et al., 2017a). However, it cannot be discarded that other GST genes could be affected so it is necessary to extend the available genes of this family to have a set of them that will allow the study of the detoxification phase II. Combining them with other genes related to enzymes involved in detoxification, could make possible to define the pathway used by the cell in order to remove the contaminant and the effectiveness to do it. Other studies have shown that UV filters such as benzophenones cause DNA damage (eg. in corals: Downs et al., 2016; eg. in human cells: Jeon, 2017) but we failed to prove this fact, since expression of the genes coding for XRRC1 and PARP1 did not show significant changes in the exposed earthworms. However, it is interesting that the lowest concentration seemed to decrease the transcriptional activity of XRRC1 but this profile was not observed for PARP1. XRCC1 is involved in the efficient repair of single-strand break repair, base excision repair and nucleotide excision repair but it has not enzymatic activity, acting as a scaffolding protein that interacts with multiple repair enzymes such as PARP (London, 2015). We have previously observed that PARP1 is altered by BPA in earthworms (Novo et al., 2018), which has been also described to produce DNA damage (Ullah et al., 2019), so combining the study of both genes could be a good approach to evaluate the ability of the cell to manage with the DNA damage. Additional research could help to prove it. Similarly, we did not find changes in genes related to epigenetic functions (DNMT1, DNMT3b or Piwi2) even though they are known to be altered in earthworms after exposure to another endocrine disruptor, BPA (Novo et al., 2018) and BP-3 has been shown to inhibit global DNA methylation status in neuronal cells (Wnuk et al., 2018). This result backs the interest to analyze these genes as elements related to two of the mechanisms involved in epigenetic regulation: DNA methylation and Piwi-interacting RNAs. The lack of response seems to indicate that no epigenetic alterations are produced in the short time but the fact that some trends are observed in each gene invites to evaluate longer times since epigenetic modifications are frequently involved in long-term regulation of expression. Further research on the molecular effects of organic UV filters in soildwelling animals is needed in order to better understand the repercussion of the presence of these compounds in the soil. Here we have provided some new putative biomarkers and contributed to highlight the importance of contact test for analysis of molecular mechanisms of toxicants, which demands a stronger stimulus to clarify the processes involved. Additionally, it is important to note that cellular response can be short-, mid-, and long-term so different exposures will be required

M. Novo et al. / Science of the Total Environment 676 (2019) 97–104

to improve our knowledge and distinguish between responses involved in the survival of the individual and responses that are important for the maintenance of the population.

5. Conclusions Acute cellular response of earthworms to the organic UV filter 4hydroxybenzophenone during 48 h (contact tests) provoked measurable changes in expression of EcR, CuZn SOD and GAPDH, indicating effects in the endocrine system, stress response and energy metabolism. No statistically significant changes of expression were observed for genes related to detoxification, genotoxicity or epigenetics. Comparison to previous data obtained with BPA, reinforce the interest of contact tests to analyze the specific gene expression profile of toxicants to elucidate putative mechanisms of action at molecular level.

Acknowledgements We are grateful to Irene Verdú for guidance on the experiments and to the teams from the Soil Zoology Group (UCM) and the Environmental Toxicology and Biology Group (UNED) for their support in the laboratory. MN was supported by a Postdoctoral Fellowships from UNED and UCM. This study was funded by the grants: CTM2015-64913-R and CGL2013-42908-P from the Spanish Government. References Arbeitman, M.N., Hogness, D.S., 2000. Molecular chaperones activate the Drosophila ecdysone receptor, an RXR heterodimer. Cell 101, 67–77. Bluthgen, N., Zucchi, S., Fent, K., 2012. Effects of the UV filter benzophenone-3 (oxybenzone) at low concentrations in zebrafish (Danio rerio). Toxicol. Appl. Pharmacol. 263, 184–194. Camino-Sanchez, F.J., Zafra-Gomez, A., Dorival-Garcia, N., Juarez-Jimenez, B., Vilchez, J.L., 2016. Determination of selected parabens, benzophenones, triclosan and triclocarban in agricultural soils after and before treatment with compost from sewage sludge: a lixiviation study. Talanta 150, 415–424. Campos, D., Gravato, C., Fedorova, G., Burkina, V., Soares, A.M.V.M., Pestana, J.L.T., 2017a. Ecotoxicity of two organic UV-filters to the freshwater caddisfly Sericostoma vittatum. Environ. Pollut. 228, 370–377. Campos, D., Gravato, C., Quintaneiro, C., Golovko, O., Zlabek, V., Soares, A.M.V.M., et al., 2017b. Toxicity of organic UV-filters to the aquatic midge Chironomus riparius. Ecotoxicol. Environ. Saf. 143, 210–216. Casquero, S., Trigo, D., Martínez Guitarte, J., Novo, M., 2019. When Sunscreens Reach the Soil: Impacts of a UV Filter on the Life Cycle of Earthworms (submitted). Coronado, M., De Haro, H., Deng, X., Rempel, M.A., Lavado, R., Schlenk, D., 2008. Estrogenic activity and reproductive effects of the UV-filter oxybenzone (2-hydroxy-4methoxyphenyl-methanone) in fish. Aquat. Toxicol. 90, 182–187. Danovaro, R., Bongiorni, L., Corinaldesi, C., Giovannelli, D., Damiani, E., Astolfi, P., et al., 2008. Sunscreens cause coral bleaching by promoting viral infections. Environ. Health Perspect. 116, 441–447. De Bolster, M.W.G., 1997. Glossary of terms used in bioinorganic chemistry (IUPAC recommendations 1997). Pure Appl. Chem. 69, 1251–1304. Downs, C.A., Kramarsky-Winter, E., Segal, R., Fauth, J., Knutson, S., Bronstein, O., et al., 2016. Toxicopathological effects of the sunscreen UV filter, oxybenzone (benzophenone-3), on coral planulae and cultured primary cells and its environmental contamination in Hawaii and the U.S. Virgin Islands. Arch. Environ. Contam. Toxicol. 70, 265–288. Gago-Ferrero, P., Diaz-Cruz, M.S., Barcelo, D., 2011. Occurrence of multiclass UV filters in treated sewage sludge from wastewater treatment plants. Chemosphere 84, 1158–1165. Gago-Ferrero, P., Diaz-Cruz, M.S., Barcelo, D., 2015. UV filters bioaccumulation in fish from Iberian river basins. Sci. Total Environ. 518, 518–525. Gehring, U., 1998. Steroid hormone receptors and heat shock proteins. Vitam. Horm. 54, 167–205. Ghazipura, M., McGowan, R., Arslan, A., Hossain, T., 2017. Exposure to benzophenone-3 and reproductive toxicity: a systematic review of human and animal studies. Reprod. Toxicol. 73, 175–183. Guyon, A., Smith, K.F., Charry, M.P., Champeau, O., Tremblay, L.A., 2018. Effects of chronic exposure to benzophenone and diclofenac on DNA methylation levels and reproductive success in a marine copepod. J. Xenobiotics 8, 7674. Harrison, E.Z., Oakes, S.R., Hysell, M., Hay, A., 2006. Organic chemicals in sewage sludges. Sci. Total Environ. 367, 481–497. Inui, M., Adachi, T., Takenaka, S., Inui, H., Nakazawa, M., Ueda, M., et al., 2003. Effect of UV screens and preservatives on vitellogenin and choriogenin production in male medaka (Oryzias latipes). Toxicology 194, 43–50.

103

Jeon, H.-K., 2017. Comparative toxicity related to metabolisms of benzophenone-type UV filters, potentially harmful to the environment and humans. Mol. Cell. Toxicol. 13, 337–343. Jeon, H.K., Chung, Y., Ryu, J.C., 2006. Simultaneous determination of benzophenone-type UV filters in water and soil by gas chromatography-mass spectrometry. J. Chromatogr. A 1131, 192–202. Kaiser, D., Sieratowicz, A., Zielke, H., Oetken, M., Hollert, H., Oehlmann, J., 2012. Ecotoxicological effect characterisation of widely used organic UV filters. Environ. Pollut. 163, 84–90. Kim, S., Choi, K., 2014. Occurrences, toxicities, and ecological risks of benzophenone-3, a common component of organic sunscreen products: a mini-review. Environ. Int. 70, 143–157. Kim, S., Jung, D., Kho, Y., Choi, K., 2014. Effects of benzophenone-3 exposure on endocrine disruption and reproduction of Japanese medaka (Oryzias latipes)—a two generation exposure study. Aquat. Toxicol. 155, 244–252. Kozera, B., Rapacz, M., 2013. Reference genes in real-time PCR. J. Appl. Genet. 54, 391–406. Langford, K.H., Reid, M.J., Fjeld, E., Oxnevad, S., Thomas, K.V., 2015. Environmental occurrence and risk of organic UV filters and stabilizers in multiple matrices in Norway. Environ. Int. 80, 1–7. Lavelle, P., Decaens, T., Aubert, M., Barot, S., Blouin, M., Bureau, F., et al., 2006. Soil invertebrates and ecosystem services. Eur. J. Soil Biol. 42, S3–S15. Lewis, P.R., 2016. Forensic Polymer Engineering: Why Polymer Products Fail in Service. Woodhead Publishing. Li, L., Andersen, M.E., Heber, S., Zhang, Q., 2007. Non-monotonic dose-response relationship in steroid hormone receptor-mediated gene expression. J. Mol. Endocrinol. 38, 569–585. Liao, C., Kannan, K., 2019. Species-specific accumulation and temporal trends of bisphenols and benzophenones in mollusks from the Chinese Bohai Sea during 2006–2015. Sci. Total Environ. 653, 168–175. Liu, T., Wang, X., You, X., Chen, D., Li, Y., Wang, F., 2017. Oxidative stress and gene expression of earthworm (Eisenia fetida) to clothianidin. Ecotoxicol. Environ. Saf. 142, 489–496. London, R.E., 2015. The structural basis of XRCC1-mediated DNA repair. DNA Repair 30, 90–103. Martinez-Guitarte, J.L., 2018. Transcriptional activity of detoxification genes is altered by ultraviolet filters in Chironomus riparius. Ecotoxicol. Environ. Saf. 149, 64–71. Martin-Folgar, R., Aquilino, M., Ozaez, I., Martinez-Guitarte, J.L., 2018. Ultraviolet filters and heat shock proteins: effects in Chironomus riparius by benzophenone-3 and 4methylbenzylidene camphor. Environ. Sci. Pollut. Res. Int. 25, 333–344. Mercer, J.J., Gillespie, J.P., Rees, H.H., 1988. The fate of [3H]ecdysone in three species of annelids AU - Mercer, Julian G. Int. J. Invertebr. Reprod. Dev. 13, 225–238. Mollaaghababa, R., Sipos, L., Tiong, S.Y.K., Papoulas, O., Armstrong, J.A., Tamkun, J.W., et al., 2001. Mutations in Drosophila heat shock cognate 4 are enhancers of Polycomb. Proc. Natl. Acad. Sci. U. S. A. 98, 3958–3963. Morris, J.P., Thatje, S., Hauton, C., 2013. The use of stress-70 proteins in physiology: a reappraisal. Mol. Ecol. 22, 1494–1502. Mueller, S.O., Kling, M., Arifin Firzani, P., Mecky, A., Duranti, E., Shields-Botella, J., et al., 2003. Activation of estrogen receptor α and ERβ by 4-methylbenzylidene-camphor in human and rat cells: comparison with phyto- and xenoestrogens. Toxicol. Lett. 142, 89–101. Muñiz-González, A.-B., Martínez-Guitarte, J.-L., 2018. Effects of single exposure and binary mixtures of ultraviolet filters octocrylene and 2-ethylhexyl 4-(dimethylamino) benzoate on gene expression in the freshwater insect Chironomus riparius. Environ. Sci. Pollut. Res. 25, 35501–35514. Novo, M., Lahive, E., Diez-Ortiz, M., Matzke, M., Morgan, A.J., Spurgeon, D.J., et al., 2015. Different routes, same pathways: molecular mechanisms under silver ion and nanoparticle exposures in the soil sentinel Eisenia fetida. Environ. Pollut. 205, 385–393. Novo, M., Verdu, I., Trigo, D., Martinez-Guitarte, J.L., 2018. Endocrine disruptors in soil: effects of bisphenol A on gene expression of the earthworm Eisenia fetida. Ecotoxicol. Environ. Saf. 150, 159–167. OECD, 1984. OECD 207 - Earthworm, Acute Toxicity Tests, OECD Guideline for Testing of Chemicals. OECD, 2004. OECD 222 - Earthworm Reproduction Test (Eisenia fetida/Eisenia andrei), OECD Guidelines for the Testing of Chemicals. Ozaez, I., Martinez-Guitarte, J.L., Morcillo, G., 2014. The UV filter benzophenone 3 (BP-3) activates hormonal genes mimicking the action of ecdysone and alters embryo development in the insect Chironomus riparius (Diptera). Environ. Pollut. 192, 19–26. Ozaez, I., Morcillo, G., Martinez-Guitarte, J.L., 2016a. The effects of binary UV filter mixtures on the midge Chironomus riparius. Sci. Total Environ. 556, 154–162. Ozaez, I., Morcillo, G., Martinez-Guitarte, J.L., 2016b. Ultraviolet filters differentially impact the expression of key endocrine and stress genes in embryos and larvae of Chironomus riparius. Sci. Total Environ. 557-558, 240–247. Ryu, C.S., Klein, K., Zanger, U.M., 2017. Membrane associated progesterone receptors: promiscuous proteins with pleiotropic functions-focus on interactions with cytochromes P450. Front. Pharmacol. 8, 159. Schmitt, C., Oetken, M., Dittberner, O., Wagner, M., Oehlmann, J., 2008. Endocrine modulation and toxic effects of two commonly used UV screens on the aquatic invertebrates Potamopyrgus antipodarum and Lumbriculus variegatus. Environ. Pollut. 152, 322–329. Schreurs, R.H.M.M., Sonneveld, E., Jansen, J.H.J., Seinen, W., van der Burg, B., 2004. Interaction of polycyclic musks and UV filters with the estrogen receptor (ER), androgen receptor (AR), and progesterone receptor (PR) in reporter gene bioassays. Toxicol. Sci. 83, 264–272. Scott, A.P., 2018. Is there any value in measuring vertebrate steroids in invertebrates? Gen. Comp. Endocrinol. 265, 77–82.

104

M. Novo et al. / Science of the Total Environment 676 (2019) 97–104

Sharma, R.P., Schuhmacher, M., Kumar, V., 2017. Review on crosstalk and common mechanisms of endocrine disruptors: scaffolding to improve PBPK/PD model of EDC mixture. Environ. Int. 99, 1–14. Sokolova, I.M., Frederich, M., Bagwe, R., Lannig, G., Sukhotin, A.A., 2012. Energy homeostasis as an integrative tool for assessing limits of environmental stress tolerance in aquatic invertebrates. Mar. Environ. Res. 79, 1–15. Song, M., Kim, Y.-J., Ryu, J.-C., 2011. Identification of genes induced by benzophenone-2 in human thyroid follicular FTC-238 cells. Mol. Cell. Toxicol. 7, 103–111. Spindler, K.D., Honl, C., Tremmel, C., Braun, S., Ruff, H., Spindler-Barth, M., 2009. Ecdysteroid hormone action. Cell. Mol. Life Sci. 66, 3837–3850. Sturzenbaum, S.R., Georgiev, O., Morgan, A.J., Kille, P., 2004. Cadmium detoxification in earthworms: from genes to cells. Environ. Sci. Technol. 38, 6283–6289. Tsui, M.M.P., Lam, J.C.W., Ng, T., Ang, P.O., Murphy, M.B., Lam, P.K.S., 2017. Occurrence, distribution, and fate of organic UV filters in coral communities. Environ. Sci. Technol. 51, 4182–4190. Ullah, A., Pirzada, M., Jahan, S., Ullah, H., Khan, M.J., 2019. Bisphenol A analogues bisphenol B, bisphenol F, and bisphenol S induce oxidative stress, disrupt daily sperm production, and damage DNA in rat spermatozoa: a comparative in vitro and in vivo study. Toxicol. Ind. Health 35, 294–303 (748233719831528). Vandenberg, L.N., 2013. Non-monotonic dose responses in studies of endocrine disrupting chemicals: bisphenol A as a case study. Dose-response: A Publication of International Hormesis Society. vol. 12, pp. 259–276. Verdu, I., Trigo, D., Martinez-Guitarte, J.L., Novo, M., 2018. Bisphenol A in artificial soil: effects on growth, reproduction and immunity in earthworms. Chemosphere 190, 287–295.

Weisbrod, C.J., Kunz, P.Y., Zenker, A.K., Fent, K., 2007. Effects of the UV filter benzophenone-2 on reproduction in fish. Toxicol. Appl. Pharmacol. 225, 255–266. Werner, J., Wautier, K., Evans, R.E., Baron, C.L., Kidd, K., Palace, V., 2003. Waterborne ethynylestradiol induces vitellogenin and alters metallothionein expression in lake trout (Salvelinus namaycush). Aquat. Toxicol. 62, 321–328. Wnuk, A., Rzemieniec, J., Lasoń, W., Krzeptowski, W., Kajta, M., 2018. Benzophenone-3 impairs autophagy, alters epigenetic status, and disrupts retinoid X receptor signaling in apoptotic neuronal cells. Mol. Neurobiol. 55, 5059–5074. Wypych, G., 2015. Handbook of UV Degradation and Stabilization 2nd Edition Introduction. Handbook of UV Degradation and Stabilization. 2nd edition. pp. 1–7. Xue, Y., Gu, X., Wang, X., Sun, C., Xu, X., Sun, J., et al., 2009. The hydroxyl radical generation and oxidative stress for the earthworm Eisenia fetida exposed to tetrabromobisphenol A. Ecotoxicology 18, 693–699. Yamauchi, T., Iwabu, M., Okada-Iwabu, M., Kadowaki, T., 2014. Adiponectin receptors: a review of their structure, function and how they work. Best Pract. Res. Clin. Endocrinol. Metab. 28, 15–23. Zhang, Q., Zhu, L., Wang, J., Xie, H., Wang, J., Han, Y., et al., 2013. Oxidative stress and lipid peroxidation in the earthworm Eisenia fetida induced by low doses of fomesafen. Environ. Sci. Pollut. Res. Int. 20, 201–208. Zinsser, V.L., Hoey, E.M., Trudgett, A., Timson, D.J., 2014. Biochemical characterisation of glyceraldehyde 3-phosphate dehydrogenase (GAPDH) from the liver fluke, Fasciola hepatica. Biochim. Biophys. Acta, Proteins Proteomics 1844, 744–749.