- Email: [email protected]
Aptamer-incorporated DNA Holliday junction for the targeted delivery of siRNA
G Model
JIEC 3529 1–7 Journal of Industrial and Engineering Chemistry xxx (2017) xxx–xxx
Contents lists available at ScienceDirect
Journal of Industrial and Engineering Chemistry journal homepage: www.elsevier.com/locate/jiec
1
Short communication
2
Aptamer-incorporated DNA Holliday junction for the targeted delivery of siRNA
3
4 Q1 5 6
Eun Hye Jeong, Hansaem Jeong, Bora Jang, Boyoung Kim, Minjeong Kim, Hyokyoung Kwon, Kyuri Lee* , Hyukjin Lee* College of Pharmacy, Graduate School of Pharmaceutical Sciences, Ewha Womans University, Seoul 13760, Republic of Korea
A R T I C L E I N F O
Article history: Received 16 June 2017 Received in revised form 14 July 2017 Accepted 21 July 2017 Available online xxx Keywords: Aptamer siRNA Nucleic acid nanostructures Carrier-free delivery system
A B S T R A C T
There have been unmet needs of developing carrier-free siRNA delivery systems to overcome the undesirable cellular toxicity and immunogenicity of conventional delivery systems such as cationic lipids and polymers. Various nucleic acid nanostructures have been proposed to achieve this goal, however many of them required potent ligands for the intracellular delivery of siRNA. Among various ligands, aptamers received much interest due to their facile preparation process as well as a high binding affinity toward target receptors. In addition, nucleic acid based aptamers can be easily incorporated with various nucleic acid nanostructures through a simple base-pair hybridization. In this study, aptamer incorporated siRNA (Apt-siRNA) was self-assembled with DNA Holliday junction for enhancing targeted delivery of siRNA to the Mucin 1 (MUC1) overexpressing cancer cells. Molecularly self-assembled Holliday DNA junction with Apt-siRNA was analyzed to confirm their cellular uptake and gene silencing as compared to the Apt-siRNA alone in the GFP expressing KB cells. The multivalent Apt-siRNA DNA nanostructure (Holliday-Apt-siRNA) clearly showed their superior potency over the Apt-siRNA alone suggesting their use in carrier-free siRNA delivery systems. © 2017 The Korean Society of Industrial and Engineering Chemistry. Published by Elsevier B.V. All rights reserved.
7
Introduction
8
Since the discovery of RNAi (RNA interference) mechanism in eukaryotic cells, siRNA has received much attention as a new approach of gene therapy with great potential to treat various hard-to-cure diseases including cancer [1,2]. It has been well known that once siRNA is successfully delivered into cells, it suppresses target mRNA through a sequence specific cleavage by forming RNA-induced silencing complex (RISC) [3,4]. To achieve considerable gene silencing effect, it is necessary to develop intracellular delivery systems for siRNA to enhance its cellular uptake and RNAi effect in cells. Generally, positively charged lipids or polymers have been utilized for delivering siRNA by forming polyelectrolyte complex (PEC) [5,6]. The positive charged PEC can efficiently deliver siRNA into the cells by interacting with the negative charged cellular membrane. However, the potential toxicity and immunogenicity of most cationic materials have hindered their wide use in clinical applications. To resolve this
9 10 11 12 13 14 15 16 17 18 19 20 21 22 23
* Corresponding authors. Fax: +82 2 3277 2851. E-mail addresses: [email protected] (K. Lee), [email protected] (H. Lee).
problem, there have been various attempts to develop carrier-free delivery systems by utilizing nucleic acid nanotechnology [7,8]. Recently, various DNA or RNA nanostructures have been developed for the delivery of siRNA with high efficiency [9–11]. Due to the specific hybridization of nucleic acids, well-defined two or three-dimensional nucleic nanostructures can be prepared by designing the base pair sequences of nucleic acids. In addition, precise numbers of siRNAs can be incorporated into the designed nucleic acid nanostructures, constructing self-assembled nanostructures for the delivery of multiple siRNAs [12]. These selfassembled systems have shown the enhanced cellular uptake and gene inhibition efficiency compared to that of the single siRNAs without use or with minimal use of cationic carriers [13]. However, additional strategies for facilitating the target cell specific cellular uptake of siRNAs are still needed. There exist various ligands that induce the receptor-mediated endocytosis by recognizing specific receptors located on the surface of target cells [14]. Among various cell recognizing molecules, aptamers have received great attention from many researchers due to their facile screening and preparation [12,15]. It is well-known that the aptamers can be quickly screened by the SELEX (Systematic evolution of ligands by exponential enrichment) process. In addition, their binding affinity
http://dx.doi.org/10.1016/j.jiec.2017.07.025 1226-086X/© 2017 The Korean Society of Industrial and Engineering Chemistry. Published by Elsevier B.V. All rights reserved.
Please cite this article in press as: E.H. Jeong, et al., Aptamer-incorporated DNA Holliday junction for the targeted delivery of siRNA, J. Ind. Eng. Chem. (2017), http://dx.doi.org/10.1016/j.jiec.2017.07.025
24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45
G Model
JIEC 3529 1–7 2 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68
E.H. Jeong et al. / Journal of Industrial and Engineering Chemistry xxx (2017) xxx–xxx
to target receptors is as comparable to or better than that of the antibodies, one of the powerful cell recognizing ligands. Therefore, there have been multiple studies developing carrier-free siRNA delivery systems using aptamers. In this study, the DNA Holliday junction was constructed to enhance the cellular uptake of siRNA and subsequently inducing gene silencing [16]. The DNA aptamer that selectively bind to the mucin 1 glycoprotein (MUC1 aptamer) were simply incorporated into the DNA Holliday junction for the target cell-specific cellular uptake [17,18]. To achieve this, the base pair sequences of four DNA strands were precisely designed and self-assembled into a Holliday junction that exposes the sticky overhangs at the each arm of junction. Four aptamer incorporated siRNAs (Apt-siRNAs) were introduced into the each ends of DNA Holliday junction by a simple DNA-RNA hybridization, resulting the Holliday junction having 4 Apt-siRNAs (Holliday-Apt-siRNA). It was reported that the multivalent aptamer conjugates can greatly facilitate the cellular uptake efficiency compared to the single aptamer [19]. To further evaluate this phenomenon, we have compared the aptamermediated cellular uptake of Apt-siRNA and Holliday-Apt-siRNA. Different cancer cell lines (MCF-7 and KB) with MUC1 positive expression were tested for the cellular uptake and subsequent gene silencing.
69
Materials and methods
70
Preparation of the Holliday junction incorporated with aptamersiRNA (Holliday-Apt-siRNA)
71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92
The sequences of all DNA and RNA strands utilized in this study are listed in Table 1. All genetic materials were purchased from Integrated DNA Technologies (IDT, USA). The siRNA sequence was designed to suppress the green fluorescence proteins (GFP). To prepare MUC1 aptamer-incorporated siRNA (Apt-siRNA), the DNA sequence of the MUC1 aptamer was added at the 30 end of the sense strand of siRNA. In addition, for the subsequent incorporation into the constructed DNA Holliday junction, the sticky overhang with length of 18 nucleotides was added at the 30 end of the anti-sense strand of siRNA. The sense strand having the MUC1 aptamer and the anti-sense strand having the sticky overhang were annealed in 1 phosphate-buffered saline (PBS) solution by heating at 95 C for 5 min and subsequent cooling at 4 C using Thermal cycler (BIO-RAD, USA). To construct the DNA Holliday junction, four DNA strands (S1, S2, S3, S4) were prepared and simply mixed at a weight ratio of 1:1:1:1. The mixture of 4 DNA strands was heated and slowly cooled from 95 C to 4 C for 1 h (MgCl2 5 mM). All DNA sequences were designed to have overhangs at the four 30 ends of the constructed Holliday junction. Subsequently, the sticky overhang of the MUC1 aptamer-siRNA were hybridized with the overhangs of the DNA Holliday junction at room temperatures
for 1–2 h. Since the DNA Holliday junction have 4 overhangs within single structures, the molar ratio of the Apt-siRNAs and the Holliday junction was 4:1. The successful preparation of the Holliday junction were verified by using the gel electrophoresis. Samples of each preparation step were loaded onto 5% polyacrylamide gels and run for 30 min at 120 V. To visualize the band, the gel was stained with GelRed (Biotium, UK) and imaged by using Gel Doc Imager, ImageLab software (BIO-RAD, USA).
93
AFM measurement
101
To prepare the samples for the atomic force microscopy (AFM), 20 ng of the prepared Holliday junction were dissolved in the AFM buffer (40 mM HEPES, NiCl2 10 mM) (CTX, Sigma–Aldrich, MO, USA). The dissolved samples were loaded onto the surface of mica (Highest Grade V1 Mica Discs, Kimnfriends, South Korea) followed by incubation for 30 min. After incubation, the mica was washed with deionized water and subsequently dried using N2 gas. The prepared mica samples were visualized on an AFM (NX-10, Park Systems, South Korea) in non-contact mode.
102
Cell culture
111
All cells were cultured in the appropriate medium containing 10% Fetal Bovine Serum (FBS) and 1% Penicillin/Streptomycin (P/S) (100 U/mL) (Invitrogen Corp, Caelsbad, CA, USA) in 5% CO2 at 37 C. The growth medium for HepG2 cells (liver hepatocellular carcinoma cells), KB-GFP cells (Human oral epidermoid carcinoma cells stably expressing GFP), MCF-7 cells (human breast adenocarcinoma cells), and MCF-7-GFP cells (human breast adenocarcinoma cells stably expressing GFP) were Dulbecco’s Modified Eagle Medium (DMEM) with low glucose (1 g/L) and sodium pyruvate, Roswell Park Memorial Institute (RPMI) 1640 medium, RPMI 1540 medium (with 25 mM HEPES, 25 mM NaHCO3), and Minimum Essential Media (MEM), respectively.
112
Evaluation of the relative expression levels of MUC1 in cell lines
124
For verifying the relative expression levels of MUC1 in the 3 different cell lines (MCF-7, KB, HepG2), each cell line was plated on 6-well plates at a density of 3 106 cells/well. After 1 day incubation, the total RNAs in each plated cells were isolated, and the complimentary DNA (cDNA) was synthesized by using SuperScriptTM II RT according to the manufacturer's protocol (Invitrogen Corp, Caelsbad, CA, USA). The quantitative levels of the MUC1 in the prepared cDNAs were measured by using the real-time polymerase chain reaction (qPCR). The primers utilized for amplifying MUC1 were listed in Table 1. The qPCR was performed by using TOPrealTM qPCR 2X PreMIX (SYBR Green with high ROX) on a CFX96 TouchTM Real-Time PCR Detection System (BIO-RAD, USA).
125
Table 1 Oligo sequences. Sequence (50 -30 )
Name Aptamer-siGFP
Apt-sense Antisense-overhang
rArCrArUrGrArArGrCrArGrCrArCrGrArCrUrUTTGCAGTTGATCCTTTGGATACCCTGG rArArGrUrCrGrUrGrCrUrGrCrUrUrCrArUrGrUTTGATCTATGATCGTACGAT
Holliday junction
S1-overhang S2-overhang S3-overhang S4-overhang
CCGATGAATAGCGGTCAGATCCGTACCTACATCGTACGATCATAGATC GTAGGTACGGATCTGCGTATTGCGAACGACATCGTACGATCATAGATC GTCGTTCGCAATACGGCTGTACGTATGGTCATCGTACGATCATAGATC GACCATACGTACAGCACCGCTATTCATCGGATCGTACGATCATAGATC
Primers
MUC1
Forward: TGAGTGATGTGCCATTTCC Reverse: CTGCCCGTAGTTCTTTCG Forward: AGAGCTACGAGCTGCCTGAC Reverse: AGCACTGTGTTGGCGTACAG
b-actin
Please cite this article in press as: E.H. Jeong, et al., Aptamer-incorporated DNA Holliday junction for the targeted delivery of siRNA, J. Ind. Eng. Chem. (2017), http://dx.doi.org/10.1016/j.jiec.2017.07.025
94 95 96 97 98 99 100
103 104 105 106 107 108 109 110
113 114 115 116 117 118 119 120 121 122 123
126 127 128 129 130 131 132 133 134 135 136
G Model
JIEC 3529 1–7 E.H. Jeong et al. / Journal of Industrial and Engineering Chemistry xxx (2017) xxx–xxx 137
Target-specific cellular uptake of Holliday-Apt-siRNA
138
To evaluate the target-specific cellular uptake efficiency of the Holliday-Apt-siRNA, 3 different cell lines (HepG2, KB, and MCF7 cells) showing different expression levels of MUC1 were utilized. The Cy5 fluorescence dye-labelled siRNAs were utilized in the preparation of all siRNA samples including the naked siRNA, the Apt-siRNA, and the Holliday-Apt-siRNA. Cells were plated on the 12-well plates at a density of 1 105 cells/well and pre-incubated for 24 h. Varying concentrations of the naked siRNA, Apt-siRNA, and Holliday-Apt-siRNA (10, 20, 50, 100 nM of siRNA) were treated to the pre-incubated cells for 24 h. The relative fluorescence levels of the treated cells were quantitatively analyzed by using flow cytometry (BD FACSCalibur). In each sample, 10,000 cells (gated events) were counted, and the mean fluorescence level of the counted cells was statistically calculated by using the FlowJo software (Tree star, Inc. USA). For the confocal microscopy analysis, the cells were seeded in 4-well CultureSlides at a density of 5 104 cells/well and preincubated for 48 h. The plated cells were treated with all siRNA samples (naked siRNA, Apt-siRNA, Holliday-Apt-siRNA) at a concentration of 50 nM siRNA for 24 h. After the treatment, the cells were washed, fixed with 1% paraformaldehyde, and imaged by using ZEISS ApoTome microscopy (Zeiss, New York, NY)
139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159
Target-specific gene silencing of Holliday-Apt-siRNA
160
191
The low-molecular weight branched polyethylenimine (PEI 800 kDa) modified with lipids containing C10 alkyl chain were prepared by ring-opening reaction between the amine groups of the PEI and the 1,2-epoxydodecane. The PEI and 1,2-epoxydodecane were dissolved in ethanol at a molar ratio of 1:6 (PEI: 1,2-epoxydodecane) and incubated at 75 C for 2 days (total volume = 1 mL). The prepared PEI-lipid was utilized as an endosome breaking reagent (ER) in the gene inhibition assay. To verify the weight ratio at which the positive-charged complex was generated, all siRNA samples (naked siRNA, Apt-siRNA, HollidayApt-siRNA) were incubated with varying amount of ER (ER/siRNA samples weight ratio: 0.1, 0.5, 1, 2, 5, 10) in the 25 mM NaOAc buffer for 10 min. After the incubation, samples were run on polyacrylamide gel for 30 min at 120 V. For the gene inhibition assay, the KB-GFP and the MCF-7-GFP cells were plated on 96-well plates at a density of 1 104 cells/well and pre-incubated for 24 h. The ERs were incubated with all siRNA samples (the naked siRNA, the Apt-siRNA, and the Holliday-AptsiRNA) at the weight ratio of 1:2 (siRNA samples:ER) for 10 min prior to the sample treatment to the plated cells. All siRNA samples that were pre-incubated or not pre-incubated with the ER were treated to the plated cells for 4 h in the serum free medium. After the 4 h of transfection, the mediums were changed to the fresh medium containing 10% serum and further incubated for 48 h. Subsequently, the treated cells were lysed with the CelLyticTM M buffer (CTX, Sigma–Aldrich, MO, USA). The relative GFP fluorescence levels in the lysed buffers were analyzed by using Infinite 200 PRO NanoQuant Microplate-reader (TECAN). The excitation and the emission of the GFP were 488 nm and 520 nm, respectively. The detected fluorescence levels in each sample were normalized by measuring total protein amount by using Bradford Reagent (CTX, Sigma–Aldrich, MO, USA).
192
Results and discussion
161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190
193 194 195 196
Holliday-Apt-siRNA for enhanced cellular uptake and gene silencing efficiency Recently, there have been some reports utilizing the Holliday junction for delivering siRNAs [20,21]. According to the studies,
3
Holliday junction induces a sufficient level of cellular uptake of multiple siRNAs by incorporating appropriate aptamers. In this study, DNA Holliday junction incorporated with 4 Apt-siRNAs (Holliday-Apt-siRNA) was developed for enhanced gene silencing in target cells (Fig. 1a). For the targeted delivery of Holliday-AptsiRNA, mucin 1 (MUC1) aptamer was employed. It is well-known that MUC1 is a glycoprotein overexpressed in the various human carcinoma cells. Therefore, MUC1 aptamer–drug conjugates have enabled specific binding to the receptors in cancer cells triggering the cellular uptake of drugs [22]. Beside the simple 1:1 aptamer– drug conjugates, some studies reported the use of multivalent aptamers for enhancing drug delivery efficiency through the avidity change of ligands and receptors [19,23,24]. To further evaluate this avidity change, Holliday-Apt-siRNA has been prepared. Four DNA strands were self-assembled to form the Holliday junction exposing the 30 single strand overhangs at each arm of DNA junction (Fig. 1b). By a simple base-pair hybridization, siRNAs with a sticky overhang at the 30 end of anti-sense strand can be easily incorporated into the Holliday junction. In addition, sequences of MUC1 aptamers were simply added to the 30 end of sense strand of siRNA to allow target specific recognition of Holliday-Apt-siRNA. The step-wise self-assembly of Holliday-AptsiRNA was monitored through the polyacrylamide gel electrophoresis. As shown in Fig. 1c, there was a significant band shift toward upper part of the gel as the self-assembly progressed. The morphology and size of DNA Holliday junction were measured by atomic force microscopy (AFM). As shown in Fig. 1d, nano-sized DNA Holliday junctions were observed with a narrow size distribution 30 nm.
197
Target-specific cellular uptake of Holliday-Apt-siRNA
226
MUC1 is known to be overexpressed in many human carcinoma cells and engaged in the metastasis [25]. Since several aptamers were reported to bind MUC1 selectively, there have been various approaches to utilize the MUC1 aptamers for the targeted drug delivery systems [26]. Before evaluating the MUC1 aptamermediated cellular uptake, 3 different cancer cell lines were screened to confirm their levels of MUC1 expression on cell surface. The relative expression levels of MUC1 were measured by q-RT-PCR (Fig. 2a). Previously, MCF-7 and KB cells have been reported as MUC1 overexpressing cell lines, while HepG2 cells were utilized as a negative control [17]. Therefore, it was expected that the MUC1 mRNA expression levels of MCF-7 and KB cells would be higher than that of HepG2 cells. As expected, MCF-7 and KB cells showed more than two times higher mRNA expression of MUC1 as compared to the HepG2 cells. Among the MUC1 positive cell lines, MCF-7 resulted slightly higher MUC1 expression level than that of KB cells. The relative MUC1 mRNA expression levels were also verified by gel electrophoresis and the result was corresponded well with that of q-RT-PCR. Since only MCF-7 and KB cells were verified as MUC1 positive cell lines, the MUC1 aptamer incorporated siRNA (Apt-siRNA) and the Apt-siRNA incorporated Holliday junction (Holliday-AptsiRNA) were expected to be taken up by only in the MCF-7 and KB cells. To verify the relative cellular uptake of the Apt-siRNA and the Holliday-Apt-siRNA in 3 different cell lines, each cell line was treated with varying concentrations of the Apt-siRNA or the Holliday-Apt-siRNA. Cy5 labeled siRNAs were used for the quantitative evaluation of cellular uptake. The relative fluorescence levels of Cy5 in the cells were measured by flow cytometry. As shown in Fig. 2b, both the Apt-siRNA and the Holliday-AptsiRNA induced considerable increase of cellular uptake only in the MUC1 positive cell lines, whereas there was no distinct difference of cellular uptake in the HepG2 cells. In fact, native siRNA alone cannot be taken up by the cells due to their strong negative charge.
227
Please cite this article in press as: E.H. Jeong, et al., Aptamer-incorporated DNA Holliday junction for the targeted delivery of siRNA, J. Ind. Eng. Chem. (2017), http://dx.doi.org/10.1016/j.jiec.2017.07.025
198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225
228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260
G Model
JIEC 3529 1–7 4
E.H. Jeong et al. / Journal of Industrial and Engineering Chemistry xxx (2017) xxx–xxx
Fig. 1. (a) Schematic illustration of the intracellular uptake of the Apt-siRNA and the Holliday-Apt-siRNA by aptamer-mediated endocytosis. (b) Schematic illustration of the developed Holliday junction incorporated with Apt-siRNA. (c) Verification of the prepared Holliday junction (L: low molecular weight ladder, 1: H1, 2: H1 + H2, 3: H1 + H2 + H3, 4: H1 + H2 + H3 + H4). As one more DNA strand was added in each step, the bands were shifted, suggesting the complete Holliday junction was successfully prepared. (d) AFM image of the constructed DNA Holliday junction.
261 262 263 264 265
However, siRNAs without aptamers (naked siRNA) were also taken up by all cell lines to some extent. It was reported that siRNAs can be efficiently delivered into cells by modifying them to be hydrophobic [27,28]. Therefore, the cellular uptake of naked siRNA is possibly due to the increase of hydrophobicity of siRNAs after
Cy5 labeling. To measure the actual cellular uptake mediated by aptamers, the fluorescence levels of each point were compared with that of the naked siRNA with same concentrations. Considering the relatively low cellular uptake of naked siRNA, the aptamer-mediated cellular uptake was much higher in the
Please cite this article in press as: E.H. Jeong, et al., Aptamer-incorporated DNA Holliday junction for the targeted delivery of siRNA, J. Ind. Eng. Chem. (2017), http://dx.doi.org/10.1016/j.jiec.2017.07.025
266 267 268 269 270
G Model
JIEC 3529 1–7 E.H. Jeong et al. / Journal of Industrial and Engineering Chemistry xxx (2017) xxx–xxx
5
Fig. 2. (a) q-RT-PCR analysis for verifying the relative mucin1 mRNA expression levels in different cell lines (MCF-7, KB, HepG2). (b) Cellular uptake efficiency of the Apt-siRNA and the Holliday-Apt-siRNA in three different cell lines (*p < 0.05). (c) Confocal microscope analysis of cellular uptake efficiency of the Apt-siRNA and the Holliday-Apt-siRNA (siRNA concentration = 50 nM).
271 272 273 274 275 276 277 278 279
MCF-7 and KB cells. Among the MUC1 positive cell lines, MCF7 again showed more extent of cellular uptake and this was likely due to the relatively higher MUC1 expression levels of MCF-7 cells compared to the KB cells. To further confirm whether the cellular uptake of the Holliday-Apt-siRNA was mediated by the incorporated aptamers, the MUC1 positive cells (KB cells) were pre-treated with 100 nM of free MUC1 aptamers for 2 h and removed, subsequently treated with the Holliday-Apt-siRNA for overnight. The pre-treatment of free aptamers largely inhibited the cellular
uptake of the Holliday-Apt-siRNA, whereas the naked siRNA not having aptamers was not affected by the pre-treatment (Supplementary data 1). This suggests that the cellular uptake efficiency of the Holliday-Apt-siRNA is mainly mediated by interactions between MUC1 aptamers and their receptors. However, the pretreatment of aptamers didn’t completely inhibit the cellular uptake of the Holliday-Apt-siRNA possibly due to the recovery of receptors during the incubation with the Holliday-Apt-siRNA after the removal of the pre-treated free aptamers.
Please cite this article in press as: E.H. Jeong, et al., Aptamer-incorporated DNA Holliday junction for the targeted delivery of siRNA, J. Ind. Eng. Chem. (2017), http://dx.doi.org/10.1016/j.jiec.2017.07.025
280 281 282 283 284 285 286 287 288
G Model
JIEC 3529 1–7 6 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316
E.H. Jeong et al. / Journal of Industrial and Engineering Chemistry xxx (2017) xxx–xxx
Moreover, the amount of cellular uptake by Holliday-Apt-siRNA was directly compared with the single Apt-siRNA to confirm the effect of avidity change on the receptor-mediate intracellular delivery. In KB cells, more amounts of siRNAs were delivered by Holliday-Apt-siRNA as compared to the single Apt-siRNA. It is likely that the multivalent aptamers of the Holliday-Apt-siRNA indeed facilitated the receptor-mediated cellular uptake. However, the improvement of cellular uptake by the Holliday-Apt-siRNA was marginally observed in MCF-7 cells. Therefore, it is important to note that the effect of avidity change on cellular uptake can be diverse depending on the tested cell types. In addition to the flow cytometry analysis, the relative cellular uptake of the Apt-siRNA and the Holliday-Apt-siRNA in each cell was visualized by confocal microscopy. As shown in Fig. 2c, the red fluorescence indicating Cy5 labeled siRNAs was observed only in the MUC1 positive cell lines (KB and MCF-7 cells), when these cells were treated with AptsiRNA and the Holliday-Apt-siRNA. In addition, KB cells treated with the Holliday-Apt-siRNA exhibited brighter fluorescence signals than that of the single Apt-siRNA. This result was consistent with the data obtained from flow cytometry and indicated the enhanced cellular uptake could be achieved by the Holliday-AptsiRNA. From these results, it was confirmed that the Apt-siRNA and the Holliday-Apt-siRNA were readily taken up by MUC1 positive cancer cells. The relative MUC1 expression levels of each cell line were well correlated with the cellular uptake of the Apt-siRNA and the Holliday-Apt-siRNA. In addition, the Holliday-Apt-siRNA could enhance the cellular uptake of siRNAs due to the avidity increase from multivalent ligand interactions [29].
Enhanced gene silencing of Holliday-Apt-siRNA
317
Previously, some studies have noted that the aptamer-siRNA conjugates were not able to deliver siRNAs into the cytosol [30]. It was thought that aptamers only enhance the cellular uptake but cannot break the endosomal compartments after the cellular uptake. Therefore, some chemical agents are necessary to break the endosomes after the cellular uptake to induce siRNA-mediated RNAi. It is well-known that many positive-charged molecules with tertiary amines are capable of breaking endosome by the protonsponge effect [31]. Generally, these positive-charged molecules were utilized to function both as a cellular uptake agent and an endosome breaking agent by forming the polyelectrolyte complex (PEC) with the siRNAs. However, a large amount of positive charged molecules is often needed to induce sufficient levels of the cellular uptake. As a result, undesirable cellular toxicity and immunogenicity are observed. It has been reported that the overall positive charge of the PEC is the major reason for the cellular toxicity [32]. In this study, we tried to achieve considerable gene silencing by using minimum amounts of cationic materials with the co-delivery of Holliday-Apt-siRNA. Since the Holliday-Apt-siRNA already induced sufficient level of cellular uptake in target cells, only small amounts of positive-charged molecules were necessary for endosome break. As an endosome breaking reagent (ER), lowmolecular weight PEI (MW 800 kDa) with lipid tails containing C10 alkyl chains was synthesized by a ring-opening reaction between the amines of PEI and the epoxide of epoxydodecane. To examine the weight ratio of the siRNAs and the positive-charged
318
Fig. 3. (a) Verification of charge interaction between ER and siRNA samples (siRNA, Apt-siRNA, Holliday-Apt-siRNA). (b) Cytotoxicity assay of endosome breaking reagent (ER) in 3 different cell lines (HepG2, KB, MCF-7). (c) Gene silencing assay of the Holliday-Apt-siRNA in the two MUC1 positive cell lines stably expressing GFP (KB-GFP and MCF-7-GFP). The siRNA inhibiting GFP mRNA was utilized to prepare all siRNA samples (siRNA, Apt-siRNA, Holliday-Apt-siRNA) (siRNA concentration = 10 nM) (*p < 0.05; ns = not significant).
Please cite this article in press as: E.H. Jeong, et al., Aptamer-incorporated DNA Holliday junction for the targeted delivery of siRNA, J. Ind. Eng. Chem. (2017), http://dx.doi.org/10.1016/j.jiec.2017.07.025
319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343
G Model
JIEC 3529 1–7 E.H. Jeong et al. / Journal of Industrial and Engineering Chemistry xxx (2017) xxx–xxx 344
400
ER to form positively charged complexes, the gel electrophoresis study was conducted after incubating the siRNA samples with varying amounts of ER for 15 min. As shown in Fig. 3a, both the naked siRNA and the Apt-siRNA generated the positive charged complexes at the weight ratio of 10, while the Holliday-Apt-siRNA generated at the weight ratio of 5. This result indicated that the Holliday-Apt-siRNA interacts more readily with positive-charged ER molecules than the single siRNA or the Apt-siRNA. It was likely that the high charge density of the Holliday-Apt-siRNA was accounted for this phenomenon [24,33]. Therefore, it was expected that the Holliday-Apt-siRNA can carry more ERs with them to facilitate the endosomal escape of siRNA to the cytoplasm. Gene silencing activity of the Holliday-Apt-siRNA was evaluated by measuring the relative fluorescence levels of the green fluorescence proteins (GFP) in the MCF-7 and KB cells. To maximize the aptamer-mediated cellular delivery, only small amount of ER was added to the siRNA samples with the weight ratio of 1:2 (siRNA samples:ER). At this weight ratio, all the siRNA samples including naked siRNA, the Apt-siRNA, and the Holliday-Apt-siRNA would maintain their distinct structures. After 2 days of post-transfection, the level of GFP expression was analyzed by flow cytometry. As shown in Fig. 3c, the Holliday-Apt-siRNA showed considerable gene silencing effect in both KB and MCF-7 cells only when they were co-treated with ER. There was no notable gene silencing when they were treated alone. This result was similar to those reported before confirming the aptamer mediated intracellular delivery cannot support the endosomal break alone [34]. Whereas the Apt-siRNA induced moderate inhibition of GFP expression, the gene inhibition effect of the Holliday-Apt-siRNA was as comparable or better than that of the lipofectamine (LF) utilized as a positive control. This result suggests that the Holliday structure is more suitable for the sufficient gene silencing effect of siRNA than the single Apt-siRNA. In addition, the ER induced no notable cytotoxicity in the range of treated doses of the gene inhibition assay (0.2–0.7 ng/mL) in all cell lines (HepG2, KB, and MCF-7 cells) (Fig. 3b). These results confirmed that, with the help of ER, the Holliday-Apt-siRNA could efficiently induce the gene silencing without triggering any cellular cytotoxicity. In addition, it was noticeable that the Holliday-Apt-siRNA resulted enhanced GFP gene silencing than that of the Apt-siRNA. There were two possible explanations for this phenomenon. First, enhanced cellular uptake of the Holliday-Apt-siRNA can be one factor affecting the gene silencing efficiency. As we discussed earlier, multivalent aptamers have indeed increased the cellular uptake of the Holliday-AptsiRNA and subsequent endosomal release by ER can greatly increase the cytosolic release of siRNAs. Second, high negative charge density of the Holliday-Apt-siRNA can be another factor. Even though there was marginal improvement of cellular uptake efficiency in MCF-7 cells treated with the Holliday-Apt-siRNA compared to the Apt-siRNA (Fig. 2b), the gene inhibitory effect of the Holliday-Apt-siRNA was considerably better than that of the Apt-siRNA (Fig. 3c). It was likely that the Holliday-Apt-siRNA could carry much more ERs within them as compared to that of AptsiRNA due to their charge density further enhancing the endolytic effect as well as gene silencing. From these results, it was confirmed that the Holliday-Apt-siRNA could efficiently induce targeted gene silencing in MUC1 positive cells.
401
Conclusion
402
In this study, MUC1 aptamer incorporated DNA Holliday junction (Holliday-Apt-siRNA) was prepared to enhance the target
345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399
403
7
specific cellular uptake of siRNA and gene silencing. The prepared Holliday-Apt-siRNA showed greater cellular uptake in MUC1 positive cell lines (MCF-7 and KB cells). The enhanced cellular uptake of the Holliday-Apt-siRNA was likely to be related with the avidity change through multivalent aptamers. However, the aptamer-mediated delivery of siRNAs using Apt-siRNA and Holliday-Apt-siRNA did not support considerable gene silencing in cells. To overcome this, co-delivery of endolytic reagent was necessary to facilitate the endosomal release and cytosolic delivery of siRNAs. The Holliday-Apt-siRNA interacted more readily with the positive-charged endosome breaking reagents (ER) than the Apt-siRNA, enhancing the gene silencing efficiency. It was thought that the high negative charge density of the Holliday junction could account for this result. From our results, it was suggested that the Holliday-Apt-siRNA could serve as a powerful delivery platform for siRNA improving the target-specific cellular uptake and gene silencing.
404
Acknowledgments
421
This work was supported by the National Research Foundation Q3 of South Korea: Basic Science Research Program (2015R1A1A1A05027352), GiRC Program (2012K1A1A2A01056092), Pioneer Research Center Program (2014M3C1A3054153), and BioMedical Technology Development Program (2015M3A9D7031026).
422
Appendix A. Supplementary data
428
Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jiec.2017.07.025.
429
References
431
[1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] [19] [20] [21] [22] [23] [24] [25] [26] [27] [28] [29] [30] [31] [32] [33] [34]
H. Shen, T. Sun, M. Ferrari, Cancer Gene Ther. 19 (6) (2012) 367. R. Kanasty, et al., Nat. Mater. 12 (11) (2013) 967. A. Fire, et al., Nature 391 (6669) (1998) 806. G.J. Hannon, Nature 418 (6894) (2002) 244. S.H. Lee, S.H. Kim, T.G. Park, Biochem. Biophys. Res. Commun. 357 (2) (2007) 511. S.W. Choi, et al., Biotechnol. Prog. 26 (1) (2010) 57. K.A. Whitehead, R. Langer, D.G. Anderson, Nat. Rev. Drug Discov. 8 (2) (2009) 129. M. Dominska, D.M. Dykxhoorn, J. Cell Sci. 123 (8) (2010) 1183. J.B. Lee, et al., Nat. Mater. 11 (4) (2012) 316. J.H. Jeong, T.G. Park, S.H. Kim, Pharm. Res. 28 (9) (2011) 2072. E.H. Jeong, et al., Adv. Drug Deliv. Rev. 104 (2016) 29. J. Zhou, J.J. Rossi, Oligonucleotides 21 (1) (2011) 1. H. Lee, et al., Nat. Nanotechnol. 7 (6) (2012) 389. J. Sudimack, R.J. Lee, Adv. Drug Deliv. Rev. 41 (2) (2000) 147. T. Hermann, D.J. Patel, Science 287 (5454) (2000) 820. D.R. Duckett, et al., Cell 55 (1) (1988) 79. Y. Hu, et al., PLoS One 7 (2) (2012) e31970. C. Yu, et al., PLoS One 6 (9) (2011) e24077. J. Kim, et al., Chem. Commun. (Camb.) 51 (43) (2015) 9038. J. Tung, et al., Sci. Rep. 7 (1) (2017) 793. Z. Li, et al., Angew. Chem. Int. Ed. Engl. 54 (40) (2015) 11706. R. Savla, et al., J. Control. Release 153 (1) (2011) 16. H. Mok, et al., Nat. Mater. 9 (3) (2010) 272. H. Yoo, et al., Chem. Commun. (Camb.) 50 (51) (2014) 6765. J. Taylor-Papadimitriou, et al., Biochim. Biophys. Acta 1455 (2–3) (1999) 301. L. Tan, et al., Macromol. Biosci. 11 (10) (2011) 1331. A.M. Krieg, et al., Proc. Natl. Acad. Sci. U. S. A. 90 (3) (1993) 1048. S. Ly, et al., Nucleic Acids Res. 45 (1) (2017) 15. C.J. Chene, W.M. Saltzman, Biomaterials 32 (26) (2011) 6194. J.P. Dassie, et al., Nat. Biotechnol. 27 (9) (2009) 839. J.-P. Behr, CHIMIA Int. J. Chem. 51 (1–2) (1997) 34. E. Zhao, et al., Nanoscale 4 (16) (2012) 5102. M. Panigaj, J. Reiser, DNA RNA Nanotechnol. 2 (1) (2015) 42. J. Zhou, et al., Pharmaceuticals (Basel) 6 (1) (2013) 85.
Please cite this article in press as: E.H. Jeong, et al., Aptamer-incorporated DNA Holliday junction for the targeted delivery of siRNA, J. Ind. Eng. Chem. (2017), http://dx.doi.org/10.1016/j.jiec.2017.07.025
405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420
423 424 425 426 427
430
432
433
JIEC 3529 1–7 Journal of Industrial and Engineering Chemistry xxx (2017) xxx–xxx
Contents lists available at ScienceDirect
Journal of Industrial and Engineering Chemistry journal homepage: www.elsevier.com/locate/jiec
1
Short communication
2
Aptamer-incorporated DNA Holliday junction for the targeted delivery of siRNA
3
4 Q1 5 6
Eun Hye Jeong, Hansaem Jeong, Bora Jang, Boyoung Kim, Minjeong Kim, Hyokyoung Kwon, Kyuri Lee* , Hyukjin Lee* College of Pharmacy, Graduate School of Pharmaceutical Sciences, Ewha Womans University, Seoul 13760, Republic of Korea
A R T I C L E I N F O
Article history: Received 16 June 2017 Received in revised form 14 July 2017 Accepted 21 July 2017 Available online xxx Keywords: Aptamer siRNA Nucleic acid nanostructures Carrier-free delivery system
A B S T R A C T
There have been unmet needs of developing carrier-free siRNA delivery systems to overcome the undesirable cellular toxicity and immunogenicity of conventional delivery systems such as cationic lipids and polymers. Various nucleic acid nanostructures have been proposed to achieve this goal, however many of them required potent ligands for the intracellular delivery of siRNA. Among various ligands, aptamers received much interest due to their facile preparation process as well as a high binding affinity toward target receptors. In addition, nucleic acid based aptamers can be easily incorporated with various nucleic acid nanostructures through a simple base-pair hybridization. In this study, aptamer incorporated siRNA (Apt-siRNA) was self-assembled with DNA Holliday junction for enhancing targeted delivery of siRNA to the Mucin 1 (MUC1) overexpressing cancer cells. Molecularly self-assembled Holliday DNA junction with Apt-siRNA was analyzed to confirm their cellular uptake and gene silencing as compared to the Apt-siRNA alone in the GFP expressing KB cells. The multivalent Apt-siRNA DNA nanostructure (Holliday-Apt-siRNA) clearly showed their superior potency over the Apt-siRNA alone suggesting their use in carrier-free siRNA delivery systems. © 2017 The Korean Society of Industrial and Engineering Chemistry. Published by Elsevier B.V. All rights reserved.
7
Introduction
8
Since the discovery of RNAi (RNA interference) mechanism in eukaryotic cells, siRNA has received much attention as a new approach of gene therapy with great potential to treat various hard-to-cure diseases including cancer [1,2]. It has been well known that once siRNA is successfully delivered into cells, it suppresses target mRNA through a sequence specific cleavage by forming RNA-induced silencing complex (RISC) [3,4]. To achieve considerable gene silencing effect, it is necessary to develop intracellular delivery systems for siRNA to enhance its cellular uptake and RNAi effect in cells. Generally, positively charged lipids or polymers have been utilized for delivering siRNA by forming polyelectrolyte complex (PEC) [5,6]. The positive charged PEC can efficiently deliver siRNA into the cells by interacting with the negative charged cellular membrane. However, the potential toxicity and immunogenicity of most cationic materials have hindered their wide use in clinical applications. To resolve this
9 10 11 12 13 14 15 16 17 18 19 20 21 22 23
* Corresponding authors. Fax: +82 2 3277 2851. E-mail addresses: [email protected] (K. Lee), [email protected] (H. Lee).
problem, there have been various attempts to develop carrier-free delivery systems by utilizing nucleic acid nanotechnology [7,8]. Recently, various DNA or RNA nanostructures have been developed for the delivery of siRNA with high efficiency [9–11]. Due to the specific hybridization of nucleic acids, well-defined two or three-dimensional nucleic nanostructures can be prepared by designing the base pair sequences of nucleic acids. In addition, precise numbers of siRNAs can be incorporated into the designed nucleic acid nanostructures, constructing self-assembled nanostructures for the delivery of multiple siRNAs [12]. These selfassembled systems have shown the enhanced cellular uptake and gene inhibition efficiency compared to that of the single siRNAs without use or with minimal use of cationic carriers [13]. However, additional strategies for facilitating the target cell specific cellular uptake of siRNAs are still needed. There exist various ligands that induce the receptor-mediated endocytosis by recognizing specific receptors located on the surface of target cells [14]. Among various cell recognizing molecules, aptamers have received great attention from many researchers due to their facile screening and preparation [12,15]. It is well-known that the aptamers can be quickly screened by the SELEX (Systematic evolution of ligands by exponential enrichment) process. In addition, their binding affinity
http://dx.doi.org/10.1016/j.jiec.2017.07.025 1226-086X/© 2017 The Korean Society of Industrial and Engineering Chemistry. Published by Elsevier B.V. All rights reserved.
Please cite this article in press as: E.H. Jeong, et al., Aptamer-incorporated DNA Holliday junction for the targeted delivery of siRNA, J. Ind. Eng. Chem. (2017), http://dx.doi.org/10.1016/j.jiec.2017.07.025
24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45
G Model
JIEC 3529 1–7 2 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68
E.H. Jeong et al. / Journal of Industrial and Engineering Chemistry xxx (2017) xxx–xxx
to target receptors is as comparable to or better than that of the antibodies, one of the powerful cell recognizing ligands. Therefore, there have been multiple studies developing carrier-free siRNA delivery systems using aptamers. In this study, the DNA Holliday junction was constructed to enhance the cellular uptake of siRNA and subsequently inducing gene silencing [16]. The DNA aptamer that selectively bind to the mucin 1 glycoprotein (MUC1 aptamer) were simply incorporated into the DNA Holliday junction for the target cell-specific cellular uptake [17,18]. To achieve this, the base pair sequences of four DNA strands were precisely designed and self-assembled into a Holliday junction that exposes the sticky overhangs at the each arm of junction. Four aptamer incorporated siRNAs (Apt-siRNAs) were introduced into the each ends of DNA Holliday junction by a simple DNA-RNA hybridization, resulting the Holliday junction having 4 Apt-siRNAs (Holliday-Apt-siRNA). It was reported that the multivalent aptamer conjugates can greatly facilitate the cellular uptake efficiency compared to the single aptamer [19]. To further evaluate this phenomenon, we have compared the aptamermediated cellular uptake of Apt-siRNA and Holliday-Apt-siRNA. Different cancer cell lines (MCF-7 and KB) with MUC1 positive expression were tested for the cellular uptake and subsequent gene silencing.
69
Materials and methods
70
Preparation of the Holliday junction incorporated with aptamersiRNA (Holliday-Apt-siRNA)
71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92
The sequences of all DNA and RNA strands utilized in this study are listed in Table 1. All genetic materials were purchased from Integrated DNA Technologies (IDT, USA). The siRNA sequence was designed to suppress the green fluorescence proteins (GFP). To prepare MUC1 aptamer-incorporated siRNA (Apt-siRNA), the DNA sequence of the MUC1 aptamer was added at the 30 end of the sense strand of siRNA. In addition, for the subsequent incorporation into the constructed DNA Holliday junction, the sticky overhang with length of 18 nucleotides was added at the 30 end of the anti-sense strand of siRNA. The sense strand having the MUC1 aptamer and the anti-sense strand having the sticky overhang were annealed in 1 phosphate-buffered saline (PBS) solution by heating at 95 C for 5 min and subsequent cooling at 4 C using Thermal cycler (BIO-RAD, USA). To construct the DNA Holliday junction, four DNA strands (S1, S2, S3, S4) were prepared and simply mixed at a weight ratio of 1:1:1:1. The mixture of 4 DNA strands was heated and slowly cooled from 95 C to 4 C for 1 h (MgCl2 5 mM). All DNA sequences were designed to have overhangs at the four 30 ends of the constructed Holliday junction. Subsequently, the sticky overhang of the MUC1 aptamer-siRNA were hybridized with the overhangs of the DNA Holliday junction at room temperatures
for 1–2 h. Since the DNA Holliday junction have 4 overhangs within single structures, the molar ratio of the Apt-siRNAs and the Holliday junction was 4:1. The successful preparation of the Holliday junction were verified by using the gel electrophoresis. Samples of each preparation step were loaded onto 5% polyacrylamide gels and run for 30 min at 120 V. To visualize the band, the gel was stained with GelRed (Biotium, UK) and imaged by using Gel Doc Imager, ImageLab software (BIO-RAD, USA).
93
AFM measurement
101
To prepare the samples for the atomic force microscopy (AFM), 20 ng of the prepared Holliday junction were dissolved in the AFM buffer (40 mM HEPES, NiCl2 10 mM) (CTX, Sigma–Aldrich, MO, USA). The dissolved samples were loaded onto the surface of mica (Highest Grade V1 Mica Discs, Kimnfriends, South Korea) followed by incubation for 30 min. After incubation, the mica was washed with deionized water and subsequently dried using N2 gas. The prepared mica samples were visualized on an AFM (NX-10, Park Systems, South Korea) in non-contact mode.
102
Cell culture
111
All cells were cultured in the appropriate medium containing 10% Fetal Bovine Serum (FBS) and 1% Penicillin/Streptomycin (P/S) (100 U/mL) (Invitrogen Corp, Caelsbad, CA, USA) in 5% CO2 at 37 C. The growth medium for HepG2 cells (liver hepatocellular carcinoma cells), KB-GFP cells (Human oral epidermoid carcinoma cells stably expressing GFP), MCF-7 cells (human breast adenocarcinoma cells), and MCF-7-GFP cells (human breast adenocarcinoma cells stably expressing GFP) were Dulbecco’s Modified Eagle Medium (DMEM) with low glucose (1 g/L) and sodium pyruvate, Roswell Park Memorial Institute (RPMI) 1640 medium, RPMI 1540 medium (with 25 mM HEPES, 25 mM NaHCO3), and Minimum Essential Media (MEM), respectively.
112
Evaluation of the relative expression levels of MUC1 in cell lines
124
For verifying the relative expression levels of MUC1 in the 3 different cell lines (MCF-7, KB, HepG2), each cell line was plated on 6-well plates at a density of 3 106 cells/well. After 1 day incubation, the total RNAs in each plated cells were isolated, and the complimentary DNA (cDNA) was synthesized by using SuperScriptTM II RT according to the manufacturer's protocol (Invitrogen Corp, Caelsbad, CA, USA). The quantitative levels of the MUC1 in the prepared cDNAs were measured by using the real-time polymerase chain reaction (qPCR). The primers utilized for amplifying MUC1 were listed in Table 1. The qPCR was performed by using TOPrealTM qPCR 2X PreMIX (SYBR Green with high ROX) on a CFX96 TouchTM Real-Time PCR Detection System (BIO-RAD, USA).
125
Table 1 Oligo sequences. Sequence (50 -30 )
Name Aptamer-siGFP
Apt-sense Antisense-overhang
rArCrArUrGrArArGrCrArGrCrArCrGrArCrUrUTTGCAGTTGATCCTTTGGATACCCTGG rArArGrUrCrGrUrGrCrUrGrCrUrUrCrArUrGrUTTGATCTATGATCGTACGAT
Holliday junction
S1-overhang S2-overhang S3-overhang S4-overhang
CCGATGAATAGCGGTCAGATCCGTACCTACATCGTACGATCATAGATC GTAGGTACGGATCTGCGTATTGCGAACGACATCGTACGATCATAGATC GTCGTTCGCAATACGGCTGTACGTATGGTCATCGTACGATCATAGATC GACCATACGTACAGCACCGCTATTCATCGGATCGTACGATCATAGATC
Primers
MUC1
Forward: TGAGTGATGTGCCATTTCC Reverse: CTGCCCGTAGTTCTTTCG Forward: AGAGCTACGAGCTGCCTGAC Reverse: AGCACTGTGTTGGCGTACAG
b-actin
Please cite this article in press as: E.H. Jeong, et al., Aptamer-incorporated DNA Holliday junction for the targeted delivery of siRNA, J. Ind. Eng. Chem. (2017), http://dx.doi.org/10.1016/j.jiec.2017.07.025
94 95 96 97 98 99 100
103 104 105 106 107 108 109 110
113 114 115 116 117 118 119 120 121 122 123
126 127 128 129 130 131 132 133 134 135 136
G Model
JIEC 3529 1–7 E.H. Jeong et al. / Journal of Industrial and Engineering Chemistry xxx (2017) xxx–xxx 137
Target-specific cellular uptake of Holliday-Apt-siRNA
138
To evaluate the target-specific cellular uptake efficiency of the Holliday-Apt-siRNA, 3 different cell lines (HepG2, KB, and MCF7 cells) showing different expression levels of MUC1 were utilized. The Cy5 fluorescence dye-labelled siRNAs were utilized in the preparation of all siRNA samples including the naked siRNA, the Apt-siRNA, and the Holliday-Apt-siRNA. Cells were plated on the 12-well plates at a density of 1 105 cells/well and pre-incubated for 24 h. Varying concentrations of the naked siRNA, Apt-siRNA, and Holliday-Apt-siRNA (10, 20, 50, 100 nM of siRNA) were treated to the pre-incubated cells for 24 h. The relative fluorescence levels of the treated cells were quantitatively analyzed by using flow cytometry (BD FACSCalibur). In each sample, 10,000 cells (gated events) were counted, and the mean fluorescence level of the counted cells was statistically calculated by using the FlowJo software (Tree star, Inc. USA). For the confocal microscopy analysis, the cells were seeded in 4-well CultureSlides at a density of 5 104 cells/well and preincubated for 48 h. The plated cells were treated with all siRNA samples (naked siRNA, Apt-siRNA, Holliday-Apt-siRNA) at a concentration of 50 nM siRNA for 24 h. After the treatment, the cells were washed, fixed with 1% paraformaldehyde, and imaged by using ZEISS ApoTome microscopy (Zeiss, New York, NY)
139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159
Target-specific gene silencing of Holliday-Apt-siRNA
160
191
The low-molecular weight branched polyethylenimine (PEI 800 kDa) modified with lipids containing C10 alkyl chain were prepared by ring-opening reaction between the amine groups of the PEI and the 1,2-epoxydodecane. The PEI and 1,2-epoxydodecane were dissolved in ethanol at a molar ratio of 1:6 (PEI: 1,2-epoxydodecane) and incubated at 75 C for 2 days (total volume = 1 mL). The prepared PEI-lipid was utilized as an endosome breaking reagent (ER) in the gene inhibition assay. To verify the weight ratio at which the positive-charged complex was generated, all siRNA samples (naked siRNA, Apt-siRNA, HollidayApt-siRNA) were incubated with varying amount of ER (ER/siRNA samples weight ratio: 0.1, 0.5, 1, 2, 5, 10) in the 25 mM NaOAc buffer for 10 min. After the incubation, samples were run on polyacrylamide gel for 30 min at 120 V. For the gene inhibition assay, the KB-GFP and the MCF-7-GFP cells were plated on 96-well plates at a density of 1 104 cells/well and pre-incubated for 24 h. The ERs were incubated with all siRNA samples (the naked siRNA, the Apt-siRNA, and the Holliday-AptsiRNA) at the weight ratio of 1:2 (siRNA samples:ER) for 10 min prior to the sample treatment to the plated cells. All siRNA samples that were pre-incubated or not pre-incubated with the ER were treated to the plated cells for 4 h in the serum free medium. After the 4 h of transfection, the mediums were changed to the fresh medium containing 10% serum and further incubated for 48 h. Subsequently, the treated cells were lysed with the CelLyticTM M buffer (CTX, Sigma–Aldrich, MO, USA). The relative GFP fluorescence levels in the lysed buffers were analyzed by using Infinite 200 PRO NanoQuant Microplate-reader (TECAN). The excitation and the emission of the GFP were 488 nm and 520 nm, respectively. The detected fluorescence levels in each sample were normalized by measuring total protein amount by using Bradford Reagent (CTX, Sigma–Aldrich, MO, USA).
192
Results and discussion
161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190
193 194 195 196
Holliday-Apt-siRNA for enhanced cellular uptake and gene silencing efficiency Recently, there have been some reports utilizing the Holliday junction for delivering siRNAs [20,21]. According to the studies,
3
Holliday junction induces a sufficient level of cellular uptake of multiple siRNAs by incorporating appropriate aptamers. In this study, DNA Holliday junction incorporated with 4 Apt-siRNAs (Holliday-Apt-siRNA) was developed for enhanced gene silencing in target cells (Fig. 1a). For the targeted delivery of Holliday-AptsiRNA, mucin 1 (MUC1) aptamer was employed. It is well-known that MUC1 is a glycoprotein overexpressed in the various human carcinoma cells. Therefore, MUC1 aptamer–drug conjugates have enabled specific binding to the receptors in cancer cells triggering the cellular uptake of drugs [22]. Beside the simple 1:1 aptamer– drug conjugates, some studies reported the use of multivalent aptamers for enhancing drug delivery efficiency through the avidity change of ligands and receptors [19,23,24]. To further evaluate this avidity change, Holliday-Apt-siRNA has been prepared. Four DNA strands were self-assembled to form the Holliday junction exposing the 30 single strand overhangs at each arm of DNA junction (Fig. 1b). By a simple base-pair hybridization, siRNAs with a sticky overhang at the 30 end of anti-sense strand can be easily incorporated into the Holliday junction. In addition, sequences of MUC1 aptamers were simply added to the 30 end of sense strand of siRNA to allow target specific recognition of Holliday-Apt-siRNA. The step-wise self-assembly of Holliday-AptsiRNA was monitored through the polyacrylamide gel electrophoresis. As shown in Fig. 1c, there was a significant band shift toward upper part of the gel as the self-assembly progressed. The morphology and size of DNA Holliday junction were measured by atomic force microscopy (AFM). As shown in Fig. 1d, nano-sized DNA Holliday junctions were observed with a narrow size distribution 30 nm.
197
Target-specific cellular uptake of Holliday-Apt-siRNA
226
MUC1 is known to be overexpressed in many human carcinoma cells and engaged in the metastasis [25]. Since several aptamers were reported to bind MUC1 selectively, there have been various approaches to utilize the MUC1 aptamers for the targeted drug delivery systems [26]. Before evaluating the MUC1 aptamermediated cellular uptake, 3 different cancer cell lines were screened to confirm their levels of MUC1 expression on cell surface. The relative expression levels of MUC1 were measured by q-RT-PCR (Fig. 2a). Previously, MCF-7 and KB cells have been reported as MUC1 overexpressing cell lines, while HepG2 cells were utilized as a negative control [17]. Therefore, it was expected that the MUC1 mRNA expression levels of MCF-7 and KB cells would be higher than that of HepG2 cells. As expected, MCF-7 and KB cells showed more than two times higher mRNA expression of MUC1 as compared to the HepG2 cells. Among the MUC1 positive cell lines, MCF-7 resulted slightly higher MUC1 expression level than that of KB cells. The relative MUC1 mRNA expression levels were also verified by gel electrophoresis and the result was corresponded well with that of q-RT-PCR. Since only MCF-7 and KB cells were verified as MUC1 positive cell lines, the MUC1 aptamer incorporated siRNA (Apt-siRNA) and the Apt-siRNA incorporated Holliday junction (Holliday-AptsiRNA) were expected to be taken up by only in the MCF-7 and KB cells. To verify the relative cellular uptake of the Apt-siRNA and the Holliday-Apt-siRNA in 3 different cell lines, each cell line was treated with varying concentrations of the Apt-siRNA or the Holliday-Apt-siRNA. Cy5 labeled siRNAs were used for the quantitative evaluation of cellular uptake. The relative fluorescence levels of Cy5 in the cells were measured by flow cytometry. As shown in Fig. 2b, both the Apt-siRNA and the Holliday-AptsiRNA induced considerable increase of cellular uptake only in the MUC1 positive cell lines, whereas there was no distinct difference of cellular uptake in the HepG2 cells. In fact, native siRNA alone cannot be taken up by the cells due to their strong negative charge.
227
Please cite this article in press as: E.H. Jeong, et al., Aptamer-incorporated DNA Holliday junction for the targeted delivery of siRNA, J. Ind. Eng. Chem. (2017), http://dx.doi.org/10.1016/j.jiec.2017.07.025
198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225
228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260
G Model
JIEC 3529 1–7 4
E.H. Jeong et al. / Journal of Industrial and Engineering Chemistry xxx (2017) xxx–xxx
Fig. 1. (a) Schematic illustration of the intracellular uptake of the Apt-siRNA and the Holliday-Apt-siRNA by aptamer-mediated endocytosis. (b) Schematic illustration of the developed Holliday junction incorporated with Apt-siRNA. (c) Verification of the prepared Holliday junction (L: low molecular weight ladder, 1: H1, 2: H1 + H2, 3: H1 + H2 + H3, 4: H1 + H2 + H3 + H4). As one more DNA strand was added in each step, the bands were shifted, suggesting the complete Holliday junction was successfully prepared. (d) AFM image of the constructed DNA Holliday junction.
261 262 263 264 265
However, siRNAs without aptamers (naked siRNA) were also taken up by all cell lines to some extent. It was reported that siRNAs can be efficiently delivered into cells by modifying them to be hydrophobic [27,28]. Therefore, the cellular uptake of naked siRNA is possibly due to the increase of hydrophobicity of siRNAs after
Cy5 labeling. To measure the actual cellular uptake mediated by aptamers, the fluorescence levels of each point were compared with that of the naked siRNA with same concentrations. Considering the relatively low cellular uptake of naked siRNA, the aptamer-mediated cellular uptake was much higher in the
Please cite this article in press as: E.H. Jeong, et al., Aptamer-incorporated DNA Holliday junction for the targeted delivery of siRNA, J. Ind. Eng. Chem. (2017), http://dx.doi.org/10.1016/j.jiec.2017.07.025
266 267 268 269 270
G Model
JIEC 3529 1–7 E.H. Jeong et al. / Journal of Industrial and Engineering Chemistry xxx (2017) xxx–xxx
5
Fig. 2. (a) q-RT-PCR analysis for verifying the relative mucin1 mRNA expression levels in different cell lines (MCF-7, KB, HepG2). (b) Cellular uptake efficiency of the Apt-siRNA and the Holliday-Apt-siRNA in three different cell lines (*p < 0.05). (c) Confocal microscope analysis of cellular uptake efficiency of the Apt-siRNA and the Holliday-Apt-siRNA (siRNA concentration = 50 nM).
271 272 273 274 275 276 277 278 279
MCF-7 and KB cells. Among the MUC1 positive cell lines, MCF7 again showed more extent of cellular uptake and this was likely due to the relatively higher MUC1 expression levels of MCF-7 cells compared to the KB cells. To further confirm whether the cellular uptake of the Holliday-Apt-siRNA was mediated by the incorporated aptamers, the MUC1 positive cells (KB cells) were pre-treated with 100 nM of free MUC1 aptamers for 2 h and removed, subsequently treated with the Holliday-Apt-siRNA for overnight. The pre-treatment of free aptamers largely inhibited the cellular
uptake of the Holliday-Apt-siRNA, whereas the naked siRNA not having aptamers was not affected by the pre-treatment (Supplementary data 1). This suggests that the cellular uptake efficiency of the Holliday-Apt-siRNA is mainly mediated by interactions between MUC1 aptamers and their receptors. However, the pretreatment of aptamers didn’t completely inhibit the cellular uptake of the Holliday-Apt-siRNA possibly due to the recovery of receptors during the incubation with the Holliday-Apt-siRNA after the removal of the pre-treated free aptamers.
Please cite this article in press as: E.H. Jeong, et al., Aptamer-incorporated DNA Holliday junction for the targeted delivery of siRNA, J. Ind. Eng. Chem. (2017), http://dx.doi.org/10.1016/j.jiec.2017.07.025
280 281 282 283 284 285 286 287 288
G Model
JIEC 3529 1–7 6 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316
E.H. Jeong et al. / Journal of Industrial and Engineering Chemistry xxx (2017) xxx–xxx
Moreover, the amount of cellular uptake by Holliday-Apt-siRNA was directly compared with the single Apt-siRNA to confirm the effect of avidity change on the receptor-mediate intracellular delivery. In KB cells, more amounts of siRNAs were delivered by Holliday-Apt-siRNA as compared to the single Apt-siRNA. It is likely that the multivalent aptamers of the Holliday-Apt-siRNA indeed facilitated the receptor-mediated cellular uptake. However, the improvement of cellular uptake by the Holliday-Apt-siRNA was marginally observed in MCF-7 cells. Therefore, it is important to note that the effect of avidity change on cellular uptake can be diverse depending on the tested cell types. In addition to the flow cytometry analysis, the relative cellular uptake of the Apt-siRNA and the Holliday-Apt-siRNA in each cell was visualized by confocal microscopy. As shown in Fig. 2c, the red fluorescence indicating Cy5 labeled siRNAs was observed only in the MUC1 positive cell lines (KB and MCF-7 cells), when these cells were treated with AptsiRNA and the Holliday-Apt-siRNA. In addition, KB cells treated with the Holliday-Apt-siRNA exhibited brighter fluorescence signals than that of the single Apt-siRNA. This result was consistent with the data obtained from flow cytometry and indicated the enhanced cellular uptake could be achieved by the Holliday-AptsiRNA. From these results, it was confirmed that the Apt-siRNA and the Holliday-Apt-siRNA were readily taken up by MUC1 positive cancer cells. The relative MUC1 expression levels of each cell line were well correlated with the cellular uptake of the Apt-siRNA and the Holliday-Apt-siRNA. In addition, the Holliday-Apt-siRNA could enhance the cellular uptake of siRNAs due to the avidity increase from multivalent ligand interactions [29].
Enhanced gene silencing of Holliday-Apt-siRNA
317
Previously, some studies have noted that the aptamer-siRNA conjugates were not able to deliver siRNAs into the cytosol [30]. It was thought that aptamers only enhance the cellular uptake but cannot break the endosomal compartments after the cellular uptake. Therefore, some chemical agents are necessary to break the endosomes after the cellular uptake to induce siRNA-mediated RNAi. It is well-known that many positive-charged molecules with tertiary amines are capable of breaking endosome by the protonsponge effect [31]. Generally, these positive-charged molecules were utilized to function both as a cellular uptake agent and an endosome breaking agent by forming the polyelectrolyte complex (PEC) with the siRNAs. However, a large amount of positive charged molecules is often needed to induce sufficient levels of the cellular uptake. As a result, undesirable cellular toxicity and immunogenicity are observed. It has been reported that the overall positive charge of the PEC is the major reason for the cellular toxicity [32]. In this study, we tried to achieve considerable gene silencing by using minimum amounts of cationic materials with the co-delivery of Holliday-Apt-siRNA. Since the Holliday-Apt-siRNA already induced sufficient level of cellular uptake in target cells, only small amounts of positive-charged molecules were necessary for endosome break. As an endosome breaking reagent (ER), lowmolecular weight PEI (MW 800 kDa) with lipid tails containing C10 alkyl chains was synthesized by a ring-opening reaction between the amines of PEI and the epoxide of epoxydodecane. To examine the weight ratio of the siRNAs and the positive-charged
318
Fig. 3. (a) Verification of charge interaction between ER and siRNA samples (siRNA, Apt-siRNA, Holliday-Apt-siRNA). (b) Cytotoxicity assay of endosome breaking reagent (ER) in 3 different cell lines (HepG2, KB, MCF-7). (c) Gene silencing assay of the Holliday-Apt-siRNA in the two MUC1 positive cell lines stably expressing GFP (KB-GFP and MCF-7-GFP). The siRNA inhibiting GFP mRNA was utilized to prepare all siRNA samples (siRNA, Apt-siRNA, Holliday-Apt-siRNA) (siRNA concentration = 10 nM) (*p < 0.05; ns = not significant).
Please cite this article in press as: E.H. Jeong, et al., Aptamer-incorporated DNA Holliday junction for the targeted delivery of siRNA, J. Ind. Eng. Chem. (2017), http://dx.doi.org/10.1016/j.jiec.2017.07.025
319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343
G Model
JIEC 3529 1–7 E.H. Jeong et al. / Journal of Industrial and Engineering Chemistry xxx (2017) xxx–xxx 344
400
ER to form positively charged complexes, the gel electrophoresis study was conducted after incubating the siRNA samples with varying amounts of ER for 15 min. As shown in Fig. 3a, both the naked siRNA and the Apt-siRNA generated the positive charged complexes at the weight ratio of 10, while the Holliday-Apt-siRNA generated at the weight ratio of 5. This result indicated that the Holliday-Apt-siRNA interacts more readily with positive-charged ER molecules than the single siRNA or the Apt-siRNA. It was likely that the high charge density of the Holliday-Apt-siRNA was accounted for this phenomenon [24,33]. Therefore, it was expected that the Holliday-Apt-siRNA can carry more ERs with them to facilitate the endosomal escape of siRNA to the cytoplasm. Gene silencing activity of the Holliday-Apt-siRNA was evaluated by measuring the relative fluorescence levels of the green fluorescence proteins (GFP) in the MCF-7 and KB cells. To maximize the aptamer-mediated cellular delivery, only small amount of ER was added to the siRNA samples with the weight ratio of 1:2 (siRNA samples:ER). At this weight ratio, all the siRNA samples including naked siRNA, the Apt-siRNA, and the Holliday-Apt-siRNA would maintain their distinct structures. After 2 days of post-transfection, the level of GFP expression was analyzed by flow cytometry. As shown in Fig. 3c, the Holliday-Apt-siRNA showed considerable gene silencing effect in both KB and MCF-7 cells only when they were co-treated with ER. There was no notable gene silencing when they were treated alone. This result was similar to those reported before confirming the aptamer mediated intracellular delivery cannot support the endosomal break alone [34]. Whereas the Apt-siRNA induced moderate inhibition of GFP expression, the gene inhibition effect of the Holliday-Apt-siRNA was as comparable or better than that of the lipofectamine (LF) utilized as a positive control. This result suggests that the Holliday structure is more suitable for the sufficient gene silencing effect of siRNA than the single Apt-siRNA. In addition, the ER induced no notable cytotoxicity in the range of treated doses of the gene inhibition assay (0.2–0.7 ng/mL) in all cell lines (HepG2, KB, and MCF-7 cells) (Fig. 3b). These results confirmed that, with the help of ER, the Holliday-Apt-siRNA could efficiently induce the gene silencing without triggering any cellular cytotoxicity. In addition, it was noticeable that the Holliday-Apt-siRNA resulted enhanced GFP gene silencing than that of the Apt-siRNA. There were two possible explanations for this phenomenon. First, enhanced cellular uptake of the Holliday-Apt-siRNA can be one factor affecting the gene silencing efficiency. As we discussed earlier, multivalent aptamers have indeed increased the cellular uptake of the Holliday-AptsiRNA and subsequent endosomal release by ER can greatly increase the cytosolic release of siRNAs. Second, high negative charge density of the Holliday-Apt-siRNA can be another factor. Even though there was marginal improvement of cellular uptake efficiency in MCF-7 cells treated with the Holliday-Apt-siRNA compared to the Apt-siRNA (Fig. 2b), the gene inhibitory effect of the Holliday-Apt-siRNA was considerably better than that of the Apt-siRNA (Fig. 3c). It was likely that the Holliday-Apt-siRNA could carry much more ERs within them as compared to that of AptsiRNA due to their charge density further enhancing the endolytic effect as well as gene silencing. From these results, it was confirmed that the Holliday-Apt-siRNA could efficiently induce targeted gene silencing in MUC1 positive cells.
401
Conclusion
402
In this study, MUC1 aptamer incorporated DNA Holliday junction (Holliday-Apt-siRNA) was prepared to enhance the target
345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399
403
7
specific cellular uptake of siRNA and gene silencing. The prepared Holliday-Apt-siRNA showed greater cellular uptake in MUC1 positive cell lines (MCF-7 and KB cells). The enhanced cellular uptake of the Holliday-Apt-siRNA was likely to be related with the avidity change through multivalent aptamers. However, the aptamer-mediated delivery of siRNAs using Apt-siRNA and Holliday-Apt-siRNA did not support considerable gene silencing in cells. To overcome this, co-delivery of endolytic reagent was necessary to facilitate the endosomal release and cytosolic delivery of siRNAs. The Holliday-Apt-siRNA interacted more readily with the positive-charged endosome breaking reagents (ER) than the Apt-siRNA, enhancing the gene silencing efficiency. It was thought that the high negative charge density of the Holliday junction could account for this result. From our results, it was suggested that the Holliday-Apt-siRNA could serve as a powerful delivery platform for siRNA improving the target-specific cellular uptake and gene silencing.
404
Acknowledgments
421
This work was supported by the National Research Foundation Q3 of South Korea: Basic Science Research Program (2015R1A1A1A05027352), GiRC Program (2012K1A1A2A01056092), Pioneer Research Center Program (2014M3C1A3054153), and BioMedical Technology Development Program (2015M3A9D7031026).
422
Appendix A. Supplementary data
428
Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jiec.2017.07.025.
429
References
431
[1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] [19] [20] [21] [22] [23] [24] [25] [26] [27] [28] [29] [30] [31] [32] [33] [34]
H. Shen, T. Sun, M. Ferrari, Cancer Gene Ther. 19 (6) (2012) 367. R. Kanasty, et al., Nat. Mater. 12 (11) (2013) 967. A. Fire, et al., Nature 391 (6669) (1998) 806. G.J. Hannon, Nature 418 (6894) (2002) 244. S.H. Lee, S.H. Kim, T.G. Park, Biochem. Biophys. Res. Commun. 357 (2) (2007) 511. S.W. Choi, et al., Biotechnol. Prog. 26 (1) (2010) 57. K.A. Whitehead, R. Langer, D.G. Anderson, Nat. Rev. Drug Discov. 8 (2) (2009) 129. M. Dominska, D.M. Dykxhoorn, J. Cell Sci. 123 (8) (2010) 1183. J.B. Lee, et al., Nat. Mater. 11 (4) (2012) 316. J.H. Jeong, T.G. Park, S.H. Kim, Pharm. Res. 28 (9) (2011) 2072. E.H. Jeong, et al., Adv. Drug Deliv. Rev. 104 (2016) 29. J. Zhou, J.J. Rossi, Oligonucleotides 21 (1) (2011) 1. H. Lee, et al., Nat. Nanotechnol. 7 (6) (2012) 389. J. Sudimack, R.J. Lee, Adv. Drug Deliv. Rev. 41 (2) (2000) 147. T. Hermann, D.J. Patel, Science 287 (5454) (2000) 820. D.R. Duckett, et al., Cell 55 (1) (1988) 79. Y. Hu, et al., PLoS One 7 (2) (2012) e31970. C. Yu, et al., PLoS One 6 (9) (2011) e24077. J. Kim, et al., Chem. Commun. (Camb.) 51 (43) (2015) 9038. J. Tung, et al., Sci. Rep. 7 (1) (2017) 793. Z. Li, et al., Angew. Chem. Int. Ed. Engl. 54 (40) (2015) 11706. R. Savla, et al., J. Control. Release 153 (1) (2011) 16. H. Mok, et al., Nat. Mater. 9 (3) (2010) 272. H. Yoo, et al., Chem. Commun. (Camb.) 50 (51) (2014) 6765. J. Taylor-Papadimitriou, et al., Biochim. Biophys. Acta 1455 (2–3) (1999) 301. L. Tan, et al., Macromol. Biosci. 11 (10) (2011) 1331. A.M. Krieg, et al., Proc. Natl. Acad. Sci. U. S. A. 90 (3) (1993) 1048. S. Ly, et al., Nucleic Acids Res. 45 (1) (2017) 15. C.J. Chene, W.M. Saltzman, Biomaterials 32 (26) (2011) 6194. J.P. Dassie, et al., Nat. Biotechnol. 27 (9) (2009) 839. J.-P. Behr, CHIMIA Int. J. Chem. 51 (1–2) (1997) 34. E. Zhao, et al., Nanoscale 4 (16) (2012) 5102. M. Panigaj, J. Reiser, DNA RNA Nanotechnol. 2 (1) (2015) 42. J. Zhou, et al., Pharmaceuticals (Basel) 6 (1) (2013) 85.
Please cite this article in press as: E.H. Jeong, et al., Aptamer-incorporated DNA Holliday junction for the targeted delivery of siRNA, J. Ind. Eng. Chem. (2017), http://dx.doi.org/10.1016/j.jiec.2017.07.025
405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420
423 424 425 426 427
430
432
433