- Email: [email protected]
Arctigenin inhibits lipopolysaccharide-induced iNOS expression in RAW264.7 cells through suppressing JAK-STAT signal pathway
International Immunopharmacology 11 (2011) 1095–1102
Contents lists available at ScienceDirect
International Immunopharmacology j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / i n t i m p
Arctigenin inhibits lipopolysaccharide-induced iNOS expression in RAW264.7 cells through suppressing JAK-STAT signal pathway Xianjuan Kou a, Shimei Qi b, Wuxing Dai a,⁎, Lan Luo c,⁎, Zhimin Yin b,⁎⁎ a b c
Tongji Medical College, Huazhong University of Science and Technology, PR China Jiangsu Province Key Laboratory for Molecular and Medicine Biotechnology, College of Life Science, Nanjing Normal University, Nanjing, Jiangsu, PR China State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093, PR China
a r t i c l e
i n f o
Article history: Received 1 December 2010 Received in revised form 1 March 2011 Accepted 8 March 2011 Available online 21 March 2011 Keywords: Arctigenin Anti-inflammation JAK-STAT iNOS
a b s t r a c t Arctigenin has been demonstrated to have an anti-inflammatory function, but the precise mechanisms of its action remain to be fully defined. In the present study, we determined the effects of arctigenin on lipopolysaccharide (LPS)-induced production of proinflammatory mediators and the underlying mechanisms involved in RAW264.7 cells. Our results indicated that arctigenin exerted its anti-inflammatory effect by inhibiting ROS-dependent STAT signaling through its antioxidant activity. Arctigenin also significantly reduced the phosphorylation of STAT1 and STAT 3 as well as JAK2 in LPS-stimulated RAW264.7 cells. The inhibitions of STAT1 and STAT 3 by arctigenin prevented their translocation to the nucleus and consequently inhibited expression of iNOS, thereby suppressing the expression of inflammation-associated genes, such as IL-1β, IL-6 and MCP-1, whose promoters contain STAT-binding elements. However, COX-2 expression was slightly inhibited at higher drug concentrations (50 μM). Our data demonstrate that arctigenin inhibits iNOS expression via suppressing JAK-STAT signaling pathway in macrophages. Crown Copyright © 2011 Published by Elsevier B.V. All rights reserved.
1. Introduction Mononuclear phagocytes represent a large family of cell types that includes macrophages, Kupffer, and microglia. Macrophages play an essential role in the regulation of innate immune response, which is vital for the recognition and elimination of invasive microbial pathogens [1,2]. Lipolysaccharide (LPS), a component of the cell wall of gram-negative bacteria, is known to activate a number of cellular signals in macrophages [3]. This activation produces various proinflammatory cytokines and inflammatory mediators such as nitrogen monoxidum (NO), and prostaglandin (PGs) that have protective functions. However, upon overactivation, macrophages have negative effects. This process may lead not only to tissue damage, but also to hemodynamic changes, multiple organ failure, and ultimately death. Thus it may be functionally important to tightly regulate the degree of macrophages activation in inflammatory condition. The JAK-STAT (Janus kinase-signal transducers and activators of transcription) cascade is an essential inflammatory signaling pathway that mediates immune responses [4]. Moreover, Levy, Murray and
⁎ Corresponding authors. ⁎⁎ Correspondence to: Z. Yin, College of Life Sciences, Nanjing Normal University, No. 1 Wenyuan Road, Nanjing 210046, PR China. Tel./fax: + 86 25 85891305. E-mail addresses: [email protected] (W. Dai), [email protected] (L. Luo), [email protected] (Z. Yin).
Okugawa et al. [5–7] reported that STATS have been shown to play roles in the inflammatory signaling cascades triggered by LPS, interferon gamma (IFNr) and other cytokines. Binding of ligands to its receptors induces the phosphorylation of receptor-associated JAK, which in turn leads to STAT phosphorylation. Phosphorylated STATs are released from the receptor complex and then form homo-or heterodimers and then translocate into the nucleus to regulate the transcription of target genes encoding proinflammatory cytokines, chemokines, and inducible enzymes such as iNOS and COX-2 [8–10]. Since JAK-STAT pathway plays roles in mediating proinflammatory gene expression, to prevent detrimental effects, the intensity and duration of JAK-STAT activation are tightly regulated. Thus, there is growing interest in modulating its activity. Arctigenin, one of the major bioactive component of Fructus Arctii, naturally occurs in Bardanae fructus, Arctium lappa L, Saussurea medusa, Torreya nucifera and Ipomea cairica, which has been used clinically as a therapeutic agent to treat inflammation in China, such as the affection of anemopyretic cold, sweeling of throat, cough, measles, syphilis and so on. Arctigenin has received much attention for its antiinflammatory, anti-tumor and neuro protective activities [11–15]. In addition, arctigenin has also been shown to inhibit the replication of human immunodeficiency virus [16,17]. The anti-inflammatory actions of arctigenin seems to be closely related to the suppression of proinflammatory cytokines. There are reports that arctigenin inhibits LPS-induced NF-κB and c-Jun/AP-1 activation [18,19]. However, the mechanisms underlying interactions of arctigenin with these signaling pathways are still obscured. It is well known
1567-5769/$ – see front matter. Crown Copyright © 2011 Published by Elsevier B.V. All rights reserved. doi:10.1016/j.intimp.2011.03.005
1096
X. Kou et al. / International Immunopharmacology 11 (2011) 1095–1102
that many genes that are implicated in the initiation of immune, acute phase, and inflammatory responses are regulated at the level of transcription. Moreover, Galdiero et al. and Yeh et al. reported that STAT1 and STAT3 have been implicated to be key transcription factors in both immunity and inflammatory pathways [20,21]. Thus, we examined whether arctigenin inhibits the JAK-STAT pathways in LPSinduced RAW264.7 cells. In the present study, we investigated the effect of arctigenin on iNOS gene expression and determined the molecular mechanism of arctigenin action on the JAK-STAT signaling pathway. Our results demonstrate that arctigenin inhibits phosphorylation-STAT1 and phosphorylation-STAT3 by inactivation of JAK2 and reducing LPS-induced ROS production. 2. Material and methods 2.1. Antibodies and reagents Polyclonal antibodies against JAK2, phospho-JAK2, STTA1, phosphoSTAT1(tyr705), STAT3, phospho-STAT3(tyr705) were purchased from Cell Signaling Technology (Beverly, MA, USA). These antibodies were diluted at the ratio of 1:1000 according to protocol. Antibody to COX-2 (C20) was obtained from Santa Cruz Biotechnology (Santa Cruz, USA). Monoclonal antibody to iNOS was from BD Pharmingen (San Diego, CA, USA). All secondary antibodies used for Western blotting were purchased from Rockland Immunochemical. Arctigenin were purchased from Santa Cruz Biotechnology. LPS (from Escherichia coli 0111: B4) was purchased from sigma. Dimethyl sulfoxide (DMSO) and Cycloheximide were from Amersco (Solon, USA) and Calbiochem respectively. CM-H2DCFDA was obtained invitrogen (Camarillo, USA). 2.2. Cell culture RAW264.7 murine macrophage-like cells, purchased from the CBCAS (Cell Bank of the Chinese Academic of Sciences, Shanghai, PR China), were cultured in DMEM (Invitrogen) containing 10% (v/v) fetal bovine serum (Hyclone) and antibiotics (100 U/ml penicillin and 100 μg/ml streptomycin) (Hyclone) at 37 °C in an atmosphere of 5% CO2. 2.3. Western blotting Cells were rinsed twice with ice-cold PBS, and solubilized in lysis buffer containing 20 mM Tris (pH7.5), 135 mM NaCl, 2 mM EDTA,2mMDTT, 25 mMβ-glycerophosphate, 2 mMsodiumpyrophosphate, 10% glycerol, 1% Triton X-100, 1 mM sodium orthovanadate, 10 mM NaF, 10 μg/ml aprotinin, 10 μg/ml leupeptin, and 1 mM PMSF for 30 min on ice. Lysates were centrifuged (15,000 × g) at 4 °C for 10 min. Equal amounts of the soluble protein are denatured in SDS, electrophoresed on an 8–12% SDS-PAGE, and transferred to nitrocellulose membranes. Immunoblotting was performed as described previously [22]. The Irdye 800 conjugated IgG secondary antibodies were used against respective primary antibodies. The proteins were visualized using the Odyssey infrared imaging system (LI-COR). 2.4. Real-time quantitative PCR (qPCR) analysis The mRNA expression of iNOS was measured by real-time qPCR. Total RNA from RAW264.7 cells were extracted with Trizol reagent (Gibco, USA) as previously described [23]. Two micrograms of total RNA was reverse-transcribed into complementary DNA and GAPDH served as internal control. Real-time quantitative PCR was performed using SYBRR Green Master Mix. All reactions were performed in triplicate to confirm reproducibility. The amount of mRNA in each sample was normalized using that of the mean GAPDH levels. Primer sequences were as follows: iNOS:forward primer5′- CACCTTGGAGTTCACCCAGT -3′, reverse primer 5′- ACCACTCGTACTTGGGATGC -3′; Two iNOS primers were used to amplify a product 170 bp. GAPDH:
forward primer 5′- AACTTTGGCATTGTGGAAGG -3′, reverse primer 5′ACACATTGGGGGTAGGAACA -3′; Two GAPDH primers were used to amplify a product 223 bp. DEPC-water for the replacement of cDNA template was used as negative control. 2.5. Luciferase assay RAW264.7 cells cultured in 12-well plates were transiently cotransfected with iNOS-Luc plasmids together with the STAT3YF, STAT1YF plasmid. All clones were cotransfected with pCMV-β-galactosidase to normalize cell number and transcription variation. Twenty-four hours after transfection, the cells were incubated for arctigenin for 1 h or not and then treated with or without LPS (100 ng/ml) for another 24 h. Cell lysates were prepared to measure luciferase activities using the Luciferase Assay System (Promega, USA) and analyzed by the Luminometer TD-20/20 (Turner, USA). Luciferase activity was normalized toβ-gal activity. 2.6. Preparation of nuclear extracts Cells were washed with ice-cold PBS and then lysed with hypotonic buffer (20 mM Hepes (pH 7.9), 10 mM KCl, 1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 10% glycerol, 0.1 mM Na3VO4, 1 mM PMSF, protease inhibitor) with 0.2% NP-40 on ice for 10 min. After centrifugation at 13,000 g for 2 min at 4 °C, cell pellets were rinsed with hypotonic buffer and then resuspended in high-salt buffer (20 mM Hepes (pH 7.9), 0.42 M NaCl, 1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 0.1 mM Na3VO4, protease inhibitor) at 4 °C for 15 min. Nuclear extracts were collected from supernatants by centrifugation at 13,000 g for 5 min at 4 °C. 2.7. Cytokine measurement RAW264.7 cells were seeded in 12-well plates and were pretreated with various dose arctigenin or 50 μM AG490 for 1 h followed by incubating with LPS (100 ng/ml) for another 24 h, arctigenin or AG490 treatment, media were collected and centrifuged at 10,000 rpm for 5 min. IL-1β, IL-6, and MCP-1 ELISA level of the media were then determined by a quantitative sandwich enzyme-linked immunosorbent assay (ELISA) using respective mouse-specific ELISA (R&D Systems) according to the manufacturer's instructions. 2.8. ROS production According to previous report [24], RAW264.7 cells were treated with LPS for 30 min in the presence or absence of arctigenin and washed with PBS. Ten micromolar CM-H2DCFDA was then added and incubated for 30 min at 37 °C, and fluorescence was measured using a spectrofluorometer after excitation at 485 nm and emission at 535 nm. 2.9. Cell viability Cell viability was determined by using3-(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide (MTT) assay. RAW264.7 cells were seeded into 96-well plates 24 h before treatment. The cells were then treated with various concentrations of arctigenin followed by incubating with 5 mg/ml of MTT working solution for 4 h at 37 °C. After being treated with 100 μl of DMSO to dissolve the crystals, the cells were detected under an Elx 800 Universal Microplate Reader (BIO-TEK, INC) to measure the absorbance at 570 nm. 2.10. Statistical analysis All experimental data obtained from cultured cells were expressed as mean ± SD. Western blotting analysis experiments were repeated 3 times with similar trends. A one-way repeated measure analysis of
X. Kou et al. / International Immunopharmacology 11 (2011) 1095–1102
1097
variance and a Student's t-test were used to determine the significance of the difference between two groups. 3. Results 3.1. Arctigenin inhibits LPS-induced iNOS gene expression but not COX-2 in Raw264.7 cells iNOS and COX-2 are two of the inflammatory factors which are correlated with LPS stimulation. To investigate the anti-inflammatory activity of arctigenin, Raw264.7 cells were treated with 100 ng/ml LPS for 16 h in the presence or absence of arctigenin, and total proteins were extracted and analyzed by Western blotting. As shown in Fig. 1, arctigenin significantly suppressed LPS-induced iNOS expression in a dose dependent manner. However, only high dose arctigenin can decrease COX-2 expression. 3.2. Arctigenin attenuated LPS-induced increase of iNOS mRNA As above results indicated that arctigenin inhibited the increase of iNOS but not COX-2 protein level induced by LPS, we then performed real-time qPCR to analyze effects of arctigenin on LPS-induced iNOS mRNA levels. RAW264.7 cells were pretreated with arctigenin (50 μM) 1 h before they were incubated with LPS (100 ng/ml). 6 h after LPS stimulation, total RNA were isolated, iNOS mRNA was determined by real-time qPCR. As shown in Fig. 2, significant decrease in iNOS mRNA levels was detected in pretreated cells, as compared with control cells. These findings suggested that arctigenin regulate iNOS protein levels through decreasing iNOS gene transcription. 3.3. Articgenin inhibits LPS-induced activation of STAT1 and STAT3 in RAW264.7 cells STAT1 has been reported to be an important transcription factor for iNOS [25] since previous studies [20,26] has shown that LPS and several cytokines, such as type I interferon, IL-10, and IL-6, activate the JAK-STAT pathway, leading to tyrosine and serine phosphorylation of either STATs. These processes are crucial for production of several cytokines in different cell types. The understanding of the arctigenin down-regulated iNOS pathways is important. Therefore, we tested the hypothesis that arctigenin down-regulates iNOS protein expression by suppressing the JAK-STAT-signaling cascade. In quiescent RAW264.7 cells, LPS induced a weak phosphorylation of STAT1 and STAT3. In contrast, phosphorylation of STAT1 (Tyr701) and STAT3 (Tyr705) was detectable at 30 min, peaked at about 4 h, and remained elevated for at
Fig. 2. Effects of Arctigenin on LPS-induced iNOS mRNA level in RAW264.7 cells. RAW264.7 cells were pretreated with 50 μM of arctigenin for 1 h or not followed by incubating with 100 ng/ml LPS for 6 h. Total RNA was isolated and iNOS mRNA was determined by realtime qPCR analysis. GAPDH mRNA was used as control. Data shown here are representative of three independent experiments. ##p b 0.01, compared with LPS.
least 6 h in RAW264.7 cells. In the current study, Raw264.7 cells were stimulated with 100 ng/ml LPS in the absence or presence arctingenin, and western blot analyses were performed using phosphotryosine STAT1(Tyr701). As shown in Fig. 3A, arctingein notably suppressed STAT1 tyrosine phosphorylation in a dose dependent manner. STAT3 is a key signaling molecule for many cytokines and growthfactor receptors. Therefore, we tested whether arctingenin also suppressed the activation of STAT3. As expected, arctingenin inhibited the phosphorylation of STAT3 in a dose dependent manner (Fig. 3A) because maximal transactivation of STAT3 requires serine phosphorylation by mitogen-activated protein kinase besides tyrosine phosphorylation. Next, we determine the serine phosphorylation of STAT3. However, arctigenin has almost no effect on them. In addition, we also found that arctigenin supressed LPS-induced phosphorylation of STAT1 and STAT3 during the whole experimental time-period from 1 h to 6 h (Fig. 4). As phosphorylated STATs dimerize and translocate into the nucleus to initiate transcription, to further investigate the role of STAT in the arctigenin induced effects, we measured the levels of STAT1 and STAT3 in nuclear extracts from LPS (100 ng/ml)-stimulated RAW264.7 cells. As a result from the elevated phosphorylation of STAT1 and STAT3, LPS induced the increase of STAT1 and STAT3 in the
Fig. 1. Effect of Arctigenin (Arc) on LPS-induced up-regulation of iNOS and COX-2 protein level in RAW264.7 cells. RAW264.7 cells were incubated with 5, 10, 50 μM of arctigenin or not for 1 h, and then were stimulated with LPS (100 ng/ml) for 16 h, the expression of iNOS and COX-2 was then detected by Western blotting. Data shown here are representatives of three independent experiments. #p b 0.05, ##p b 0.01 compared with LPS.
1098
X. Kou et al. / International Immunopharmacology 11 (2011) 1095–1102
Fig. 3. Arctigenin inhibits LPS-induced STAT tyrosine phosphorylation and then blocks the translocation of STAT to the nucleus. Western blot was performed using antibodies to phospho-STAT1, STAT1, phospho-STAT3, or STAT3, GAPDH and H3. (A). RAW264.7 cells were pretreated with arctigenin (5, 10, or 50 μM) for 1 h and then were stimulated with LPS (100 ng/ml) for 4 h. (B) RAW264.7 cells were pretreated with arctigenin (5, 10, or 50 μM) for 1 h and then nucleus extracts were stimulated with LPS (100 ng/ml) for 4 h. The data shown are representatives of three independent experiments. #p b 0.05, compared with LPS. p-stat1(Y) represents phosphorylation of Tyr701, p-stat3(Y) represents phosphorylation of Tyr705.
nucleus. The addition of arctigenin decreased the nuclear translocation of STAT1 and STAT3 (Fig. 3B). These data demonstrated that arctigenin decrease activated STAT1, STAT3 and nuclear P-STAT1 and P-STAT3 content in the setting of LPS exposure, implying that STAT-dependent inflammatory signaling may be related to the anti-inflammatory activity of arctingenin.
3.4. Arctigenin inhibits LPS-induced iNOS promoter activity by STAT inactivation To investigate whether the anti-inflammatory mechanism of arctigenin requires STAT1 and 3 tyrosine phosphorylation, RAW264.7 cells were transiently cotransfected with the iNOS reporter gene and STAT1YF and STAT3YF constructs. STAT1YF and STAT3YF are two dominant-negative form that have the tyrosine 705 mutated by phenylalanine to prevent their phosphorylation. After 24 h transfection, the cells were treated with various doses of arctigenin for 1 h followed by incubation with LPS (100 ng/ml) for 24 h, iNOS reporter activity increased by approximately 3-fold (Fig. 5). Pretreatment of these cells with arctigenin inhibited LPS-induced iNOS reporter activity in a dosedependent manner. Inhibition of iNOS reporter activity was significant when cells were incubated with 10 μM arctigenin, and incubation of the cells with 50 μM arctigenin inhibited reporter activity by approximately 60%. In addition, cells cotransfected with STAT1YF and STAT3YF also attentuated iNOS luciferase activity. These results show that STAT1 or STAT3 is a major molecule in regulating iNOS gene expression. Taken together, the findings show that arctigenin suppressed iNOS promoter
activity by inhibiting STAT1 or STAT3-dependent transcriptional activity. 3.5. Arctingenin suppresses STAT-responsive inflammatory gene expression Inflammatory responses are coordinated by the production of cytokines, chemokines, and reactive oxygen species [27]. Previously, it has been shown that STAT3 and STAT1 play a role in IL-1β and IL-6 production in response to diverse stimuli [28,29]. Our above results demonstrate arctigenin inhibited tyrosine phosphorylation of STAT1, STAT3, and the subsequent nuclear translocation of this protein. To further confirm the inhibitory effect of arctigenin on the JAK/STAT signaling pathway, we analyzed the expression levels of some inflammation-associated genes whose promoters have STAT binding sequences such as IL-1β, IL-6, and MCP-1. Cells were preincubated either in the presence or absence of arctigenin 1 h prior to LPS stimulation and the cytokine concentrations were measured with a commercially available ELISA kit at 24 h. To confirm the involvement of the JAK pathway, we used the AG490, which is an inhibitor of JAK2 as a positive control. Pretreatment with AG490 only partially inhibited LPS-mediated IL-1β, IL-6 and MCP-1 production. In contrast, compared with cells treated with AG490, arctigenin significantly dose-dependently suppressed mediator's production stimulated by LPS. Furthermore, 50 μM arctigenin almost completely abrogated both LPS mediated IL-1β (Fig. 6A), IL-6 (Fig. 6B) and MCP-1 production (Fig. 6C). These results are consistent with results shown in (Fig. 3). The findings indicate that JAK-STAT signaling is
X. Kou et al. / International Immunopharmacology 11 (2011) 1095–1102
1099
Fig. 4. Arctigenin inhibits LPS-induced STAT tyrosine phosphorylation in time-dependent manner. RAW264.7 cells were pretreated with 50 μM arctigenin for 1 h and then were stimulated with LPS (100 ng/ml) for the indicated time periods. Western blots were performed with Abs for phospho-STAT1, phospho-STAT3 and GAPDH. Data shown here are representatives of three independent experiments.
required for IL-1β, IL-6 and MCP-1 release and provide evidence of the critical functional involvement of JAK-STAT signaling in LPS-induced inflammation.
3.6. Arctigenin inhibits LPS-enhanced ROS Reactive oxygen species (ROS) are well documented to function as signaling molecules, stimulating cellular activities ranging from cytokine secretion to cell proliferation, and at higher concentrations, they can induce cell injury and death [30]. The iNOS/NO pathway is known to play an important role in inducing ROS production [31]. In order to further determine whether the anti-inflammatory effect of arctigenin is due to its antioxidant effects Raw264.7cells were preincubated with arctigenin for 1 h at different dose and then stimulated with LPS for 30 min. To measure LPS induced ROS, cells were incubated with oxygensensitive CM-H2DCFDA at 37 °C for 30 min, and intracellular ROS levels were then determined by spectrofluorometer. N-acetylcysteine is known to inhibit expression proinflammatory genes under some conditions. In the present study we used NAC as a positive control. As shown in (Fig. 7), arctigenin reduced ROS production in a dose dependent manner, suggesting that it has an antioxidant effect. 3.7. Arctigenin inhibits phosphorylation of JAK2
Fig. 5. Arctigenin suppresses LPS-induced iNOS promoter activity by STAT inactivation. RAW264.7 cells cultured in 12-well plates were transiently cotransfected with iNOS luciferase and STAT1YF or STAT3YF. Twenty-four hours after transfection, the cells were incubated for arctigenin for 1 h or not and then treated with or without LPS (100 ng/ml) for another 24 h. Cell lysates were prepared to measure luciferase activities using the Luciferase Assay System (Promega, USA) and analyzed by the Luminometer TD-20/20 (Turner, USA). Luciferase activity was normalized toβ-gal activity. (*p b 0.05, compared with control; #p b 0.05, ##p b 0.01 compared with LPS).
Phosphorylation of STATs depends on the activation of JAKs [32]. To gain insight into the inhibitory mechanism of arctigenin on the STAT signal cascade, we examined the effects of arctigenin on JAK activity. Raw264.7 cells were treated with LPS in the presence or absence of arctingenin and analyzed by western blotting. The data presented in Fig. 8 showed that following addition of LPS to cells, only phosphorylation of JAK2 occurred within 5 min. However, LPS did not activate JAK1. As expected, arctingenin completely inhibited the LPS-induced JAK2 phosphorylation but had no impact on total JAK2. These results indicate
1100
X. Kou et al. / International Immunopharmacology 11 (2011) 1095–1102
Fig. 7. Arctigenin reduces ROS production in LPS-stimulated RAW264.7 cells. RAW264.7 cells grown in 96-well plates were treated with LPS (100 ng/ml) in the presence or absence of EP (5, 10, or 50 μM) and then washed with PBS. CM-H2DCFDA (10 μM) was then added and incubated for 30 min at 37 °C. Fluorescence was measured by spectrofluorometer after excitation at 485 nm and emission at 535 nm. NAC was used as a positive control (*p b 0.05, compared with control; #p b 0.05, ##p b 0.01 compared with LPS).
affect cell viability, suggesting that no effective cytotoxicity of arctigenin was detected from dose of 5 to 50.0 μM (Fig. 9). 4. Discussion
Fig. 6. Arctigenin inhibits LPS-mediated IL-1β, IL-6 and MCP-1 production in Raw 264.7 cells. RAW264.7 cells were pretreated for 1 h with different dose arctigenin or without (−) AG490 (50 μM). After pre-incubation, cells were treated with (+) or without (−) LPS (100 ng/mL) for 24 h. IL-1β, IL-6 and MCP-1 immunoreactivity in supernatants was analyzed by ELISA. Data presented are mean values of 6 independent experiments; bars represent means±SD. Significance was determined using student's t-test (*pb 0.05, compared with control; #pb 0.05, ##pb 0.01 compared with LPS;). (A) Inhibition of LPS-induced IL-1β expression in the presence of stattic or AG490 in Raw246.7 cells. (B) Arctigenin or AG490 inhibits LPSinduced IL-6 production in RAW246.7 cells. (C) Arctigenin or AG490 inhibits LPS-induced MCP-1 production in RAW246.7 cells.
that arctingenin inhibits STAT1 and STAT3 phosphorylation via JAK2 inactivation in LPS-induced inflammatory condition. 3.8. Effects of arctigenin on cell viability The cytotoxic effects of arctigenin on RAW264.7 cells were evaluated by using the MTT assay. RAW264.7 cells were incubated with various doses of arctigenin for 24 h. The results of MTT assay showed that arctigenin, even at a concentration of 100 μM, did not
Min Kyung Cho and Feng Zhao et.al. have reported that arctigenin inhibits the expression of iNOS and some proinflammatory cytokines. Until now, the anti-inflammatory actions of arctigenin were attributed to the inhibition of NF-κB activation, a mediator involved in cytokine signaling and inflammation [14]. However, more and more evidence has suggested the possible existence of other functional regulators in LPS-stimulated signal transduction. Moreover, arctigenin appears to act at multiple steps in the signaling cascade underlying inflammation. Thus, in this paper, we describe another potent mechanism underlying the anti-inflammatory effect of arctigenin. Previous studies demonstrated the JAK-STAT signal pathway plays pivotal roles in immune and inflammatory responses [33–35]. For example, activation of STAT signal contributes to LPS-induced endotoxin shock in mice [36]. Components of the STAT signaling pathway are attractive molecular targets for treating various inflammatory diseases. Thus we tested whether the anti-inflammatory action of arctigenin is related to the suppression of JAK-STAT activation in RAW264.7 cells. To address this issue, we examined the effects of arctigenin on the expression iNOS in RAW264.7 cells, because arctigenin is reported to reduce iNOS, and iNOS has STATbinding sites in their promoters. As expected, arctigenin suppressed the up-regulation of iNOS in LPS-stimulated RAW264.7 cells, it is in agreement with previous reports and supporting our hypothesis that arctigenin suppresses inflammatory responses via inhibition of JAKSTAT signaling. In subsequent experiments, we found that arctigenin reduced the phosphorylation of STAT1 and STAT3. Furthermore, we investigated whether the inhibition of STAT1 and STAT3 phosphorylation by arctigenin subsequently prevents STAT1 and STAT3 translocation by inhibiting STAT1 and STAT3 tyrosine phosphorylation. As shown in Fig. 5, nuclear extracts of RAW264.7 cells strongly suggested that arctigenin prevent STAT1 and STAT3 translocation to the nucleus. This finding demonstrates that arctigenin inhibits the role of STAT1 and STAT3 as transcription factors. In addition, we want to know how arctigenin regulates the activation of STAT1 and STAT3. JAK plays critical roles in the immune system, but its clinical implications in infectious disorders remain undetermined. Thus, we tested the upstreams JAK family of STAT including JAK1 and JAK2 in LPS-activated
X. Kou et al. / International Immunopharmacology 11 (2011) 1095–1102
1101
Fig. 8. Arctigenin suppresses the phosphorylation of JAK2 in LPS-stimulated RAW264.7 cells. RAW264.7 cells were pretreated with arctigenin and stimulated with LPS for the indicated time periods. Western blot analysis was performed with Abs for phospho-JAK2. Data shown here are representatives of three independent experiments.
RAW264.7 cells, because JAK3 has been found only in leukocytes. As shown in Fig. 7, phosphorylation of JAK2 was significantly suppressed in LPS-activated RAW264.7 cells. Moreover, we propose that ROS scavenging by arctigenin possibly inhibits JAK-STAT signaling, as JAKSTAT signaling is ROS dependent [34,37] and arctigenin has antioxidant effects. In this study, we observed that arctigenin dosedependently reduced LPS-induced ROS production (Fig. 6). Lobelia Samavati et al. [38] reported that LPS-mediated IL-1β and IL-6 production was associated with tyrosine phosphorylation of STAT1 and STAT3 in a murine macrophage cell line as well as in primary murine bone marrow derived dendritic cells and peritoneal macrophages. Thus, to validate the functional importance of the inhibitory activity of arctigenin on the JAK-STAT inflammatory cascade in RAW264.7 cells we examined the expression of proinflammatory mediator such as IL-1β, IL-6 and MCP-1 that include a STAT binding site in their promoter region. Results showed that arctigenin significantly suppressed IL-1β, IL-6 and MCP-1 expression in LPS activated RAW264.7 cells (Fig. 7). To compare with arctigenin, AG490 was less effective in decreasing LPS-mediated IL-1β, IL-6 and MCP-1 production. STAT3 and NF-κB are central transcription factors in both innate and adaptive immunity. Previous report has shown that arctigenin can also suppress NF-κB activation [14]. Whether suppression of STAT3 activation by arctigenin is linked to inhibition of NF-κB activation is not clear. STAT3 and NF-kB are activated in response to LPS in RAW264.7 cells. The p65 subunit of NF-κB has been shown to interact with STAT3 [39]. Previous study indicates that unphosphorylated STAT3 can bind to NF-κB in competition with IκBα [40].
Fig. 9. Effects of Arctigenin on cell viability. RAW264.7 cells were treated with various concentrations of Arctigenin for 24 h. Cell viability was determined by MTT assay as described in Materials and methods. Cell viability in absence of Arctigenin treatment was taken as 100%. The results were expressed as mean ± SD of three independent experiments.
Inhibition of STAT3 tryosine phosphorylation by arctigenin results in more unphosphorylated STAT3 available to bind to NF-κB. In addition, a recent report indicated that STAT3 prolongs NF-κB nuclear retention through acetyltransferase p300-mediated RelA acetylation, thereby interfering with NF-κB nuclear export [41]. Thus, it is possible that suppression of STAT3 activation may mediate inhibition of NF-κB activation by arctigenin in inflammatory conditions. In conclusion, the results of this study provide initial evidence that arctigenin has anti-inflammatory effects by inhibiting activation of the JAK-STAT pathways. Furthermore, its antioxidant effect contributes to anti-inflammatory mechanisms of arctigenin. Our results provide a new insight for understanding the anti-inflammatory activities of arctigenin in macrophages. Further studies are needed to determine the full pharmacokinetics of arctigenin activity in vivo.
Acknowledgements We greatly thank Dr. Gautam Sethi (National University of Singapore) for providing pRc/CMV-STAT3YF plasmid. This work was supported by grants from the National Nature Science Foundation of China (Nos. 81072433, 31071000, 30770842 and 30771979) and a Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).
References [1] Hoffmann JA, Kafatos FC, Janeway CA, Ezekowitz RA. Science 1999;284:1313–8. [2] Aderem A, Underhill DM. Annu Rev Immunol 1999;17:593–623. [3] Guha M, Mackman N. LPS induction of gene expression in human monocytes. Cell Signal 2001;13:85–94. [4] Park Eun Jung, Soo Young Park, Eun-hye Joe. 15d-PGJ2 and rosiglitazone suppress janus kinase-STAT inflammatory signaling through induction of suppressor of cytokine signaling 1 (SOCS1) and SOCS3 in glia. J Biol Chem 2003;17:14747–52. [5] Levy DE, Darnell Jr. Stats: transcriptional control and biological impact. Nat Rev Mol Cell Biol 2002;3:651–62. [6] Murray PJ. The JAK–STAT signaling pathway: input and output integration. J Immunol 2007;178:2623–9. [7] Okugawa S, Ota Y, Kitazawa T, Nakayama K, Yanagimoto S, Tsukada K, et al. Janus kinase 2 is involved in lipopolysaccharide-induced activation of macrophages. Am J Physiol Cell Physiol 2003;285:C399–408. [8] Kovarik P, Mangold M, Ramsauer K, Heidari H, Steinborn R, Zotter A, et al. Specificity of signaling by STAT1 depends on SH2 and C-terminal domains that regulate Ser727 phosphorylation, differentially affecting specific target gene expression. EMBO J 2001;20:91–100. [9] Ganster RW, Taylor BS, Shao L, Geller DA. Complex regulation of human inducible nitric oxide synthase gene transcription by Stat1 and NF-kappa B. Proc Natl Acad Sci USA 2001;98:8638–43. [10] Wen Z, Zhong Z, Darnell Jr. Maximal activation of transcription by Stat1 and Stat3 requires both tyrosine and serine phosphorylation. Cell 1995;82:241–50. [11] Ayres DC, Loike JD. Lignan: chemical, biological and clinical properties. Cambridge: UK7 Cambridge Univ. Press; 1990. p. 402.
1102
X. Kou et al. / International Immunopharmacology 11 (2011) 1095–1102
[12] Bastos JK, Carvalho JC, De Souza GH, Pedrazzi AH, Sarti SJ. Anti-inflammatory activity of cubebin, a lignan from the leaves of Zanthoxyllum naranjillo Griseb. J Ethnopharmacol 2001;75:279–82. [13] Midori T, Takao K, Katsuko K, Harukuni T, Hoyoku N. Antitumor-promoting activity of lignans from the aerial part of Saussurea medusa. Cancer Lett 2000;158:53–9. [14] Jang YP, Kim SR, Choi YH, Kim J, Kim SG, Markelonis GJ, et al. Arctigenin protects cultured cortical neurons from glutamate-induced neurodegeneration by binding to kainate receptor. J Neurosci Res 2002;68:233–40. [15] Jang YP, Kim SR, Kim YC. Neuroprotective dibenzylbutyrolactonelignans of Torreya nucifera. Planta Med 2001;67:470–2. [16] Schroder HC, Merz H, Steffen R, Muller WE, Sarin PS, Trumm S, et al. Differential in vitro anti-HIV activity of natural lignans. Z Naturforsch 1990;45:1215–21. [17] Eich E, Pertz H, Kaloga M, Schulz J, Fesen MR, Mazumder A, et al. Arctigenin as a lead structure for inhibitors of human immunodeficiency virus type-1 integrase. J Med Chem 1996;39:86–95. [18] Cho MK, Park JW, Jang YP, Kim YC, Kim SG. Potent inhibition of lipopolysaccharideinducible nitric oxide synthase expression by dibenzylbutyrolactone lignans through inhibition of I-kBa phosphorylation and of p65 nuclear translocation in macrophages. Int Immunopharmacol 2002;2:105–16. [19] Feng Zhao, Lu Wang, Ke Liu. In vitro anti-inflammatory effects of arctigenin, a lignan from Arctium lappa L., through inhibition on iNOS pathway. J Ethnopharmacol 2009;122:457–62. [20] Galdiero M, Vitiello M, D'Isanto M, Raieta K, Galdiero E. STAT1 and STAT3 phosphorylation by porins are independent of JAKs but are dependent on MAPK pathway and plays a role in U937 cells production of interleukin-6. Cytokine 2006;36:218–28. [21] Yeh M, Gharavi NM, Choi J, Hsieh X, Reed E, Mouillesseaux KP, et al. Oxidized phospholipids increase interleukin 8(IL-8) synthesis by activation of the c-src/ signal transducers and activators of transcription (STAT)3 pathway. J Biol Chem 2004;279:30175–81. [22] Wu YF, Fan YM, Xue B, Luo L, Shen JY, Yin ZM. Human glutathione S-transferase P1-1 interacts with TRAF2 and regulates TRAF2-ASK1 signals. Oncogene 2006;25: 5787–800. [23] Liu Ziwen, Fan Yumei, Luo Lan, Yin Zhimin. Dipyrithione inhibits lipopolysaccharideinduced iNOS and COX-2 up-regulation in macrophages and protects against endotoxic shock in mice. FEBS Lett 2008;582:1643–50. [24] Kim HongSook, Cho IkHyun, Kim JaEun. Ethyl pyruvate has an anti-inflammatory effect by inhibiting ROS-dependent STAT signaling in activated microglia. Free Radic Biol Med 2008;45:950–63. [25] Ohmori Y, Hamilton TA. Requirement for STAT1 in LPS-induced gene expression in macrophages. J Leukoc Biol 2001;69:598–604. [26] Cho ML, Kang JW, Moon YM, Nam HJ, Jhun JY, Heo SB, et al. STAT3 and NF-kappaB signal pathway is required for IL-23-mediated IL-17 production in spontaneous
[27]
[28]
[29]
[30] [31]
[32] [33] [34]
[35]
[36]
[37] [38]
[39]
[40]
[41]
arthritis animal model IL-1 receptor antagonist-deficient mice. J Immunol 2006;176:5652–61. Kamijo R, Harada H, Matsuyama T, Bosland M, Gerecitano J, Shapiro D, et al. Requirement for transcription factor IRF-1 in NO synthase induction in macrophages. Science 1994;263:1612–5. Lee C, Lim HK, Sakong J, Lee YS, Kim JR, Baek SH. Janus kinase-signal transducer and activator of transcription mediates phosphatidic acid-induced interleukin IL-1βand IL-6 production. Mol Pharmacol 2006;69:1041–7. Sodhi A, Kesherwani V. Signaling molecules involved in production and regulation of IL-1beta bymurine peritoneal macrophages in vitro on treatment with concanavalin A. Int Immunopharmacol 2007;7:1403–13. Lum Hazel, Roebuck Kenneth A. Oxidant stress and endothelial cell dysfunction. Am J Physiol Cell Physiol 2001;280:C719–41. Liu MY, Cheng YJ, Chen CK, Yang BC. Coexposure of lead and lipopolysaccharideinduced liver injury in rats: involvement of nitric oxide-initiated oxidative stress and TNF-alpha. Shock 2005;23:360–4. Stark GR, Kerr IM, Williams BRG, Silvermann RH, Schreiber RD. Annu Rev Biochem 1998;67:227–64. Yasukawa H, Sasaki A, Yoshimura A. Negative regulation of cytokine signaling pathways. Annu Rev Immunol 2000;18:143–64. Kamezaki K, Shimoda K, Numata A, Matsuda T, Nakayama K, Harada M. The role of Tyk2. Stat1 and Stat4 in LPS-induced endotoxin signals. Int Immunol 2004;16: 1173–9. Kim HS, Ye SK, Cho IH, Jung JE, Kim DH, Choi S, et al. 8-Hydroxydeoxyguanosine suppresses NO production and COX-2 activity via Rac1/STATs signaling in LPSinduced brain microglia. Free Radic Biol Med 2006;41:1392–403. Dell'Albani P, Santangelo R, Torrisi L, Nicoletti VG, devellis J, Giuffrida Stella AM. JAK/STAT signaling pathway mediates cytokine-induced iNOS expression in primary astroglial cell cultures. J Neurosci Res 2001;65:417–24. hle JN. The Stat family in cytokine signaling. Curr Opin Cell Biol 2001;13:211–7. Samavati Lobelia, Rastogi Ruchi, Wenjin Du, Hüttemannc Maik, Fitea Alemu, Franchid Luigi. STAT3 tyrosine phosphorylation is critical for interleukin 1 beta and interleukin-6 production in response to lipopolysaccharide and live bacteria. Mol Immunol 2009;46:1867–77. Yu Z, Zhang W, Kone BC. Signal transducers and activators of STAT3 inhibits transcription of the inducible nitric oxide synthase gene by interacting with nuclear factor kappaB. Biochem J 2002;367:97–105. Yang J, Liao X, Agarwal MK, Barnes L, Auron PE, Stark GR. Unphosphorylated STAT3 accumulates in response to IL-6 and activates transcription by binding to NFkappaB. Genes Dev 2007;21:1396–408. lee H, Herrmann A, JH Deng, Kujawski M, Niu G, Li Z, et al. Persistently activated Stat3 maintains constitutive NF-kappaB activity in tumors. Cancer Cell 2009;15:283–93.
Contents lists available at ScienceDirect
International Immunopharmacology j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / i n t i m p
Arctigenin inhibits lipopolysaccharide-induced iNOS expression in RAW264.7 cells through suppressing JAK-STAT signal pathway Xianjuan Kou a, Shimei Qi b, Wuxing Dai a,⁎, Lan Luo c,⁎, Zhimin Yin b,⁎⁎ a b c
Tongji Medical College, Huazhong University of Science and Technology, PR China Jiangsu Province Key Laboratory for Molecular and Medicine Biotechnology, College of Life Science, Nanjing Normal University, Nanjing, Jiangsu, PR China State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing 210093, PR China
a r t i c l e
i n f o
Article history: Received 1 December 2010 Received in revised form 1 March 2011 Accepted 8 March 2011 Available online 21 March 2011 Keywords: Arctigenin Anti-inflammation JAK-STAT iNOS
a b s t r a c t Arctigenin has been demonstrated to have an anti-inflammatory function, but the precise mechanisms of its action remain to be fully defined. In the present study, we determined the effects of arctigenin on lipopolysaccharide (LPS)-induced production of proinflammatory mediators and the underlying mechanisms involved in RAW264.7 cells. Our results indicated that arctigenin exerted its anti-inflammatory effect by inhibiting ROS-dependent STAT signaling through its antioxidant activity. Arctigenin also significantly reduced the phosphorylation of STAT1 and STAT 3 as well as JAK2 in LPS-stimulated RAW264.7 cells. The inhibitions of STAT1 and STAT 3 by arctigenin prevented their translocation to the nucleus and consequently inhibited expression of iNOS, thereby suppressing the expression of inflammation-associated genes, such as IL-1β, IL-6 and MCP-1, whose promoters contain STAT-binding elements. However, COX-2 expression was slightly inhibited at higher drug concentrations (50 μM). Our data demonstrate that arctigenin inhibits iNOS expression via suppressing JAK-STAT signaling pathway in macrophages. Crown Copyright © 2011 Published by Elsevier B.V. All rights reserved.
1. Introduction Mononuclear phagocytes represent a large family of cell types that includes macrophages, Kupffer, and microglia. Macrophages play an essential role in the regulation of innate immune response, which is vital for the recognition and elimination of invasive microbial pathogens [1,2]. Lipolysaccharide (LPS), a component of the cell wall of gram-negative bacteria, is known to activate a number of cellular signals in macrophages [3]. This activation produces various proinflammatory cytokines and inflammatory mediators such as nitrogen monoxidum (NO), and prostaglandin (PGs) that have protective functions. However, upon overactivation, macrophages have negative effects. This process may lead not only to tissue damage, but also to hemodynamic changes, multiple organ failure, and ultimately death. Thus it may be functionally important to tightly regulate the degree of macrophages activation in inflammatory condition. The JAK-STAT (Janus kinase-signal transducers and activators of transcription) cascade is an essential inflammatory signaling pathway that mediates immune responses [4]. Moreover, Levy, Murray and
⁎ Corresponding authors. ⁎⁎ Correspondence to: Z. Yin, College of Life Sciences, Nanjing Normal University, No. 1 Wenyuan Road, Nanjing 210046, PR China. Tel./fax: + 86 25 85891305. E-mail addresses: [email protected] (W. Dai), [email protected] (L. Luo), [email protected] (Z. Yin).
Okugawa et al. [5–7] reported that STATS have been shown to play roles in the inflammatory signaling cascades triggered by LPS, interferon gamma (IFNr) and other cytokines. Binding of ligands to its receptors induces the phosphorylation of receptor-associated JAK, which in turn leads to STAT phosphorylation. Phosphorylated STATs are released from the receptor complex and then form homo-or heterodimers and then translocate into the nucleus to regulate the transcription of target genes encoding proinflammatory cytokines, chemokines, and inducible enzymes such as iNOS and COX-2 [8–10]. Since JAK-STAT pathway plays roles in mediating proinflammatory gene expression, to prevent detrimental effects, the intensity and duration of JAK-STAT activation are tightly regulated. Thus, there is growing interest in modulating its activity. Arctigenin, one of the major bioactive component of Fructus Arctii, naturally occurs in Bardanae fructus, Arctium lappa L, Saussurea medusa, Torreya nucifera and Ipomea cairica, which has been used clinically as a therapeutic agent to treat inflammation in China, such as the affection of anemopyretic cold, sweeling of throat, cough, measles, syphilis and so on. Arctigenin has received much attention for its antiinflammatory, anti-tumor and neuro protective activities [11–15]. In addition, arctigenin has also been shown to inhibit the replication of human immunodeficiency virus [16,17]. The anti-inflammatory actions of arctigenin seems to be closely related to the suppression of proinflammatory cytokines. There are reports that arctigenin inhibits LPS-induced NF-κB and c-Jun/AP-1 activation [18,19]. However, the mechanisms underlying interactions of arctigenin with these signaling pathways are still obscured. It is well known
1567-5769/$ – see front matter. Crown Copyright © 2011 Published by Elsevier B.V. All rights reserved. doi:10.1016/j.intimp.2011.03.005
1096
X. Kou et al. / International Immunopharmacology 11 (2011) 1095–1102
that many genes that are implicated in the initiation of immune, acute phase, and inflammatory responses are regulated at the level of transcription. Moreover, Galdiero et al. and Yeh et al. reported that STAT1 and STAT3 have been implicated to be key transcription factors in both immunity and inflammatory pathways [20,21]. Thus, we examined whether arctigenin inhibits the JAK-STAT pathways in LPSinduced RAW264.7 cells. In the present study, we investigated the effect of arctigenin on iNOS gene expression and determined the molecular mechanism of arctigenin action on the JAK-STAT signaling pathway. Our results demonstrate that arctigenin inhibits phosphorylation-STAT1 and phosphorylation-STAT3 by inactivation of JAK2 and reducing LPS-induced ROS production. 2. Material and methods 2.1. Antibodies and reagents Polyclonal antibodies against JAK2, phospho-JAK2, STTA1, phosphoSTAT1(tyr705), STAT3, phospho-STAT3(tyr705) were purchased from Cell Signaling Technology (Beverly, MA, USA). These antibodies were diluted at the ratio of 1:1000 according to protocol. Antibody to COX-2 (C20) was obtained from Santa Cruz Biotechnology (Santa Cruz, USA). Monoclonal antibody to iNOS was from BD Pharmingen (San Diego, CA, USA). All secondary antibodies used for Western blotting were purchased from Rockland Immunochemical. Arctigenin were purchased from Santa Cruz Biotechnology. LPS (from Escherichia coli 0111: B4) was purchased from sigma. Dimethyl sulfoxide (DMSO) and Cycloheximide were from Amersco (Solon, USA) and Calbiochem respectively. CM-H2DCFDA was obtained invitrogen (Camarillo, USA). 2.2. Cell culture RAW264.7 murine macrophage-like cells, purchased from the CBCAS (Cell Bank of the Chinese Academic of Sciences, Shanghai, PR China), were cultured in DMEM (Invitrogen) containing 10% (v/v) fetal bovine serum (Hyclone) and antibiotics (100 U/ml penicillin and 100 μg/ml streptomycin) (Hyclone) at 37 °C in an atmosphere of 5% CO2. 2.3. Western blotting Cells were rinsed twice with ice-cold PBS, and solubilized in lysis buffer containing 20 mM Tris (pH7.5), 135 mM NaCl, 2 mM EDTA,2mMDTT, 25 mMβ-glycerophosphate, 2 mMsodiumpyrophosphate, 10% glycerol, 1% Triton X-100, 1 mM sodium orthovanadate, 10 mM NaF, 10 μg/ml aprotinin, 10 μg/ml leupeptin, and 1 mM PMSF for 30 min on ice. Lysates were centrifuged (15,000 × g) at 4 °C for 10 min. Equal amounts of the soluble protein are denatured in SDS, electrophoresed on an 8–12% SDS-PAGE, and transferred to nitrocellulose membranes. Immunoblotting was performed as described previously [22]. The Irdye 800 conjugated IgG secondary antibodies were used against respective primary antibodies. The proteins were visualized using the Odyssey infrared imaging system (LI-COR). 2.4. Real-time quantitative PCR (qPCR) analysis The mRNA expression of iNOS was measured by real-time qPCR. Total RNA from RAW264.7 cells were extracted with Trizol reagent (Gibco, USA) as previously described [23]. Two micrograms of total RNA was reverse-transcribed into complementary DNA and GAPDH served as internal control. Real-time quantitative PCR was performed using SYBRR Green Master Mix. All reactions were performed in triplicate to confirm reproducibility. The amount of mRNA in each sample was normalized using that of the mean GAPDH levels. Primer sequences were as follows: iNOS:forward primer5′- CACCTTGGAGTTCACCCAGT -3′, reverse primer 5′- ACCACTCGTACTTGGGATGC -3′; Two iNOS primers were used to amplify a product 170 bp. GAPDH:
forward primer 5′- AACTTTGGCATTGTGGAAGG -3′, reverse primer 5′ACACATTGGGGGTAGGAACA -3′; Two GAPDH primers were used to amplify a product 223 bp. DEPC-water for the replacement of cDNA template was used as negative control. 2.5. Luciferase assay RAW264.7 cells cultured in 12-well plates were transiently cotransfected with iNOS-Luc plasmids together with the STAT3YF, STAT1YF plasmid. All clones were cotransfected with pCMV-β-galactosidase to normalize cell number and transcription variation. Twenty-four hours after transfection, the cells were incubated for arctigenin for 1 h or not and then treated with or without LPS (100 ng/ml) for another 24 h. Cell lysates were prepared to measure luciferase activities using the Luciferase Assay System (Promega, USA) and analyzed by the Luminometer TD-20/20 (Turner, USA). Luciferase activity was normalized toβ-gal activity. 2.6. Preparation of nuclear extracts Cells were washed with ice-cold PBS and then lysed with hypotonic buffer (20 mM Hepes (pH 7.9), 10 mM KCl, 1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 10% glycerol, 0.1 mM Na3VO4, 1 mM PMSF, protease inhibitor) with 0.2% NP-40 on ice for 10 min. After centrifugation at 13,000 g for 2 min at 4 °C, cell pellets were rinsed with hypotonic buffer and then resuspended in high-salt buffer (20 mM Hepes (pH 7.9), 0.42 M NaCl, 1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 0.1 mM Na3VO4, protease inhibitor) at 4 °C for 15 min. Nuclear extracts were collected from supernatants by centrifugation at 13,000 g for 5 min at 4 °C. 2.7. Cytokine measurement RAW264.7 cells were seeded in 12-well plates and were pretreated with various dose arctigenin or 50 μM AG490 for 1 h followed by incubating with LPS (100 ng/ml) for another 24 h, arctigenin or AG490 treatment, media were collected and centrifuged at 10,000 rpm for 5 min. IL-1β, IL-6, and MCP-1 ELISA level of the media were then determined by a quantitative sandwich enzyme-linked immunosorbent assay (ELISA) using respective mouse-specific ELISA (R&D Systems) according to the manufacturer's instructions. 2.8. ROS production According to previous report [24], RAW264.7 cells were treated with LPS for 30 min in the presence or absence of arctigenin and washed with PBS. Ten micromolar CM-H2DCFDA was then added and incubated for 30 min at 37 °C, and fluorescence was measured using a spectrofluorometer after excitation at 485 nm and emission at 535 nm. 2.9. Cell viability Cell viability was determined by using3-(4,5-dimethylthiazol-2-yl)2,5-diphenyltetrazolium bromide (MTT) assay. RAW264.7 cells were seeded into 96-well plates 24 h before treatment. The cells were then treated with various concentrations of arctigenin followed by incubating with 5 mg/ml of MTT working solution for 4 h at 37 °C. After being treated with 100 μl of DMSO to dissolve the crystals, the cells were detected under an Elx 800 Universal Microplate Reader (BIO-TEK, INC) to measure the absorbance at 570 nm. 2.10. Statistical analysis All experimental data obtained from cultured cells were expressed as mean ± SD. Western blotting analysis experiments were repeated 3 times with similar trends. A one-way repeated measure analysis of
X. Kou et al. / International Immunopharmacology 11 (2011) 1095–1102
1097
variance and a Student's t-test were used to determine the significance of the difference between two groups. 3. Results 3.1. Arctigenin inhibits LPS-induced iNOS gene expression but not COX-2 in Raw264.7 cells iNOS and COX-2 are two of the inflammatory factors which are correlated with LPS stimulation. To investigate the anti-inflammatory activity of arctigenin, Raw264.7 cells were treated with 100 ng/ml LPS for 16 h in the presence or absence of arctigenin, and total proteins were extracted and analyzed by Western blotting. As shown in Fig. 1, arctigenin significantly suppressed LPS-induced iNOS expression in a dose dependent manner. However, only high dose arctigenin can decrease COX-2 expression. 3.2. Arctigenin attenuated LPS-induced increase of iNOS mRNA As above results indicated that arctigenin inhibited the increase of iNOS but not COX-2 protein level induced by LPS, we then performed real-time qPCR to analyze effects of arctigenin on LPS-induced iNOS mRNA levels. RAW264.7 cells were pretreated with arctigenin (50 μM) 1 h before they were incubated with LPS (100 ng/ml). 6 h after LPS stimulation, total RNA were isolated, iNOS mRNA was determined by real-time qPCR. As shown in Fig. 2, significant decrease in iNOS mRNA levels was detected in pretreated cells, as compared with control cells. These findings suggested that arctigenin regulate iNOS protein levels through decreasing iNOS gene transcription. 3.3. Articgenin inhibits LPS-induced activation of STAT1 and STAT3 in RAW264.7 cells STAT1 has been reported to be an important transcription factor for iNOS [25] since previous studies [20,26] has shown that LPS and several cytokines, such as type I interferon, IL-10, and IL-6, activate the JAK-STAT pathway, leading to tyrosine and serine phosphorylation of either STATs. These processes are crucial for production of several cytokines in different cell types. The understanding of the arctigenin down-regulated iNOS pathways is important. Therefore, we tested the hypothesis that arctigenin down-regulates iNOS protein expression by suppressing the JAK-STAT-signaling cascade. In quiescent RAW264.7 cells, LPS induced a weak phosphorylation of STAT1 and STAT3. In contrast, phosphorylation of STAT1 (Tyr701) and STAT3 (Tyr705) was detectable at 30 min, peaked at about 4 h, and remained elevated for at
Fig. 2. Effects of Arctigenin on LPS-induced iNOS mRNA level in RAW264.7 cells. RAW264.7 cells were pretreated with 50 μM of arctigenin for 1 h or not followed by incubating with 100 ng/ml LPS for 6 h. Total RNA was isolated and iNOS mRNA was determined by realtime qPCR analysis. GAPDH mRNA was used as control. Data shown here are representative of three independent experiments. ##p b 0.01, compared with LPS.
least 6 h in RAW264.7 cells. In the current study, Raw264.7 cells were stimulated with 100 ng/ml LPS in the absence or presence arctingenin, and western blot analyses were performed using phosphotryosine STAT1(Tyr701). As shown in Fig. 3A, arctingein notably suppressed STAT1 tyrosine phosphorylation in a dose dependent manner. STAT3 is a key signaling molecule for many cytokines and growthfactor receptors. Therefore, we tested whether arctingenin also suppressed the activation of STAT3. As expected, arctingenin inhibited the phosphorylation of STAT3 in a dose dependent manner (Fig. 3A) because maximal transactivation of STAT3 requires serine phosphorylation by mitogen-activated protein kinase besides tyrosine phosphorylation. Next, we determine the serine phosphorylation of STAT3. However, arctigenin has almost no effect on them. In addition, we also found that arctigenin supressed LPS-induced phosphorylation of STAT1 and STAT3 during the whole experimental time-period from 1 h to 6 h (Fig. 4). As phosphorylated STATs dimerize and translocate into the nucleus to initiate transcription, to further investigate the role of STAT in the arctigenin induced effects, we measured the levels of STAT1 and STAT3 in nuclear extracts from LPS (100 ng/ml)-stimulated RAW264.7 cells. As a result from the elevated phosphorylation of STAT1 and STAT3, LPS induced the increase of STAT1 and STAT3 in the
Fig. 1. Effect of Arctigenin (Arc) on LPS-induced up-regulation of iNOS and COX-2 protein level in RAW264.7 cells. RAW264.7 cells were incubated with 5, 10, 50 μM of arctigenin or not for 1 h, and then were stimulated with LPS (100 ng/ml) for 16 h, the expression of iNOS and COX-2 was then detected by Western blotting. Data shown here are representatives of three independent experiments. #p b 0.05, ##p b 0.01 compared with LPS.
1098
X. Kou et al. / International Immunopharmacology 11 (2011) 1095–1102
Fig. 3. Arctigenin inhibits LPS-induced STAT tyrosine phosphorylation and then blocks the translocation of STAT to the nucleus. Western blot was performed using antibodies to phospho-STAT1, STAT1, phospho-STAT3, or STAT3, GAPDH and H3. (A). RAW264.7 cells were pretreated with arctigenin (5, 10, or 50 μM) for 1 h and then were stimulated with LPS (100 ng/ml) for 4 h. (B) RAW264.7 cells were pretreated with arctigenin (5, 10, or 50 μM) for 1 h and then nucleus extracts were stimulated with LPS (100 ng/ml) for 4 h. The data shown are representatives of three independent experiments. #p b 0.05, compared with LPS. p-stat1(Y) represents phosphorylation of Tyr701, p-stat3(Y) represents phosphorylation of Tyr705.
nucleus. The addition of arctigenin decreased the nuclear translocation of STAT1 and STAT3 (Fig. 3B). These data demonstrated that arctigenin decrease activated STAT1, STAT3 and nuclear P-STAT1 and P-STAT3 content in the setting of LPS exposure, implying that STAT-dependent inflammatory signaling may be related to the anti-inflammatory activity of arctingenin.
3.4. Arctigenin inhibits LPS-induced iNOS promoter activity by STAT inactivation To investigate whether the anti-inflammatory mechanism of arctigenin requires STAT1 and 3 tyrosine phosphorylation, RAW264.7 cells were transiently cotransfected with the iNOS reporter gene and STAT1YF and STAT3YF constructs. STAT1YF and STAT3YF are two dominant-negative form that have the tyrosine 705 mutated by phenylalanine to prevent their phosphorylation. After 24 h transfection, the cells were treated with various doses of arctigenin for 1 h followed by incubation with LPS (100 ng/ml) for 24 h, iNOS reporter activity increased by approximately 3-fold (Fig. 5). Pretreatment of these cells with arctigenin inhibited LPS-induced iNOS reporter activity in a dosedependent manner. Inhibition of iNOS reporter activity was significant when cells were incubated with 10 μM arctigenin, and incubation of the cells with 50 μM arctigenin inhibited reporter activity by approximately 60%. In addition, cells cotransfected with STAT1YF and STAT3YF also attentuated iNOS luciferase activity. These results show that STAT1 or STAT3 is a major molecule in regulating iNOS gene expression. Taken together, the findings show that arctigenin suppressed iNOS promoter
activity by inhibiting STAT1 or STAT3-dependent transcriptional activity. 3.5. Arctingenin suppresses STAT-responsive inflammatory gene expression Inflammatory responses are coordinated by the production of cytokines, chemokines, and reactive oxygen species [27]. Previously, it has been shown that STAT3 and STAT1 play a role in IL-1β and IL-6 production in response to diverse stimuli [28,29]. Our above results demonstrate arctigenin inhibited tyrosine phosphorylation of STAT1, STAT3, and the subsequent nuclear translocation of this protein. To further confirm the inhibitory effect of arctigenin on the JAK/STAT signaling pathway, we analyzed the expression levels of some inflammation-associated genes whose promoters have STAT binding sequences such as IL-1β, IL-6, and MCP-1. Cells were preincubated either in the presence or absence of arctigenin 1 h prior to LPS stimulation and the cytokine concentrations were measured with a commercially available ELISA kit at 24 h. To confirm the involvement of the JAK pathway, we used the AG490, which is an inhibitor of JAK2 as a positive control. Pretreatment with AG490 only partially inhibited LPS-mediated IL-1β, IL-6 and MCP-1 production. In contrast, compared with cells treated with AG490, arctigenin significantly dose-dependently suppressed mediator's production stimulated by LPS. Furthermore, 50 μM arctigenin almost completely abrogated both LPS mediated IL-1β (Fig. 6A), IL-6 (Fig. 6B) and MCP-1 production (Fig. 6C). These results are consistent with results shown in (Fig. 3). The findings indicate that JAK-STAT signaling is
X. Kou et al. / International Immunopharmacology 11 (2011) 1095–1102
1099
Fig. 4. Arctigenin inhibits LPS-induced STAT tyrosine phosphorylation in time-dependent manner. RAW264.7 cells were pretreated with 50 μM arctigenin for 1 h and then were stimulated with LPS (100 ng/ml) for the indicated time periods. Western blots were performed with Abs for phospho-STAT1, phospho-STAT3 and GAPDH. Data shown here are representatives of three independent experiments.
required for IL-1β, IL-6 and MCP-1 release and provide evidence of the critical functional involvement of JAK-STAT signaling in LPS-induced inflammation.
3.6. Arctigenin inhibits LPS-enhanced ROS Reactive oxygen species (ROS) are well documented to function as signaling molecules, stimulating cellular activities ranging from cytokine secretion to cell proliferation, and at higher concentrations, they can induce cell injury and death [30]. The iNOS/NO pathway is known to play an important role in inducing ROS production [31]. In order to further determine whether the anti-inflammatory effect of arctigenin is due to its antioxidant effects Raw264.7cells were preincubated with arctigenin for 1 h at different dose and then stimulated with LPS for 30 min. To measure LPS induced ROS, cells were incubated with oxygensensitive CM-H2DCFDA at 37 °C for 30 min, and intracellular ROS levels were then determined by spectrofluorometer. N-acetylcysteine is known to inhibit expression proinflammatory genes under some conditions. In the present study we used NAC as a positive control. As shown in (Fig. 7), arctigenin reduced ROS production in a dose dependent manner, suggesting that it has an antioxidant effect. 3.7. Arctigenin inhibits phosphorylation of JAK2
Fig. 5. Arctigenin suppresses LPS-induced iNOS promoter activity by STAT inactivation. RAW264.7 cells cultured in 12-well plates were transiently cotransfected with iNOS luciferase and STAT1YF or STAT3YF. Twenty-four hours after transfection, the cells were incubated for arctigenin for 1 h or not and then treated with or without LPS (100 ng/ml) for another 24 h. Cell lysates were prepared to measure luciferase activities using the Luciferase Assay System (Promega, USA) and analyzed by the Luminometer TD-20/20 (Turner, USA). Luciferase activity was normalized toβ-gal activity. (*p b 0.05, compared with control; #p b 0.05, ##p b 0.01 compared with LPS).
Phosphorylation of STATs depends on the activation of JAKs [32]. To gain insight into the inhibitory mechanism of arctigenin on the STAT signal cascade, we examined the effects of arctigenin on JAK activity. Raw264.7 cells were treated with LPS in the presence or absence of arctingenin and analyzed by western blotting. The data presented in Fig. 8 showed that following addition of LPS to cells, only phosphorylation of JAK2 occurred within 5 min. However, LPS did not activate JAK1. As expected, arctingenin completely inhibited the LPS-induced JAK2 phosphorylation but had no impact on total JAK2. These results indicate
1100
X. Kou et al. / International Immunopharmacology 11 (2011) 1095–1102
Fig. 7. Arctigenin reduces ROS production in LPS-stimulated RAW264.7 cells. RAW264.7 cells grown in 96-well plates were treated with LPS (100 ng/ml) in the presence or absence of EP (5, 10, or 50 μM) and then washed with PBS. CM-H2DCFDA (10 μM) was then added and incubated for 30 min at 37 °C. Fluorescence was measured by spectrofluorometer after excitation at 485 nm and emission at 535 nm. NAC was used as a positive control (*p b 0.05, compared with control; #p b 0.05, ##p b 0.01 compared with LPS).
affect cell viability, suggesting that no effective cytotoxicity of arctigenin was detected from dose of 5 to 50.0 μM (Fig. 9). 4. Discussion
Fig. 6. Arctigenin inhibits LPS-mediated IL-1β, IL-6 and MCP-1 production in Raw 264.7 cells. RAW264.7 cells were pretreated for 1 h with different dose arctigenin or without (−) AG490 (50 μM). After pre-incubation, cells were treated with (+) or without (−) LPS (100 ng/mL) for 24 h. IL-1β, IL-6 and MCP-1 immunoreactivity in supernatants was analyzed by ELISA. Data presented are mean values of 6 independent experiments; bars represent means±SD. Significance was determined using student's t-test (*pb 0.05, compared with control; #pb 0.05, ##pb 0.01 compared with LPS;). (A) Inhibition of LPS-induced IL-1β expression in the presence of stattic or AG490 in Raw246.7 cells. (B) Arctigenin or AG490 inhibits LPSinduced IL-6 production in RAW246.7 cells. (C) Arctigenin or AG490 inhibits LPS-induced MCP-1 production in RAW246.7 cells.
that arctingenin inhibits STAT1 and STAT3 phosphorylation via JAK2 inactivation in LPS-induced inflammatory condition. 3.8. Effects of arctigenin on cell viability The cytotoxic effects of arctigenin on RAW264.7 cells were evaluated by using the MTT assay. RAW264.7 cells were incubated with various doses of arctigenin for 24 h. The results of MTT assay showed that arctigenin, even at a concentration of 100 μM, did not
Min Kyung Cho and Feng Zhao et.al. have reported that arctigenin inhibits the expression of iNOS and some proinflammatory cytokines. Until now, the anti-inflammatory actions of arctigenin were attributed to the inhibition of NF-κB activation, a mediator involved in cytokine signaling and inflammation [14]. However, more and more evidence has suggested the possible existence of other functional regulators in LPS-stimulated signal transduction. Moreover, arctigenin appears to act at multiple steps in the signaling cascade underlying inflammation. Thus, in this paper, we describe another potent mechanism underlying the anti-inflammatory effect of arctigenin. Previous studies demonstrated the JAK-STAT signal pathway plays pivotal roles in immune and inflammatory responses [33–35]. For example, activation of STAT signal contributes to LPS-induced endotoxin shock in mice [36]. Components of the STAT signaling pathway are attractive molecular targets for treating various inflammatory diseases. Thus we tested whether the anti-inflammatory action of arctigenin is related to the suppression of JAK-STAT activation in RAW264.7 cells. To address this issue, we examined the effects of arctigenin on the expression iNOS in RAW264.7 cells, because arctigenin is reported to reduce iNOS, and iNOS has STATbinding sites in their promoters. As expected, arctigenin suppressed the up-regulation of iNOS in LPS-stimulated RAW264.7 cells, it is in agreement with previous reports and supporting our hypothesis that arctigenin suppresses inflammatory responses via inhibition of JAKSTAT signaling. In subsequent experiments, we found that arctigenin reduced the phosphorylation of STAT1 and STAT3. Furthermore, we investigated whether the inhibition of STAT1 and STAT3 phosphorylation by arctigenin subsequently prevents STAT1 and STAT3 translocation by inhibiting STAT1 and STAT3 tyrosine phosphorylation. As shown in Fig. 5, nuclear extracts of RAW264.7 cells strongly suggested that arctigenin prevent STAT1 and STAT3 translocation to the nucleus. This finding demonstrates that arctigenin inhibits the role of STAT1 and STAT3 as transcription factors. In addition, we want to know how arctigenin regulates the activation of STAT1 and STAT3. JAK plays critical roles in the immune system, but its clinical implications in infectious disorders remain undetermined. Thus, we tested the upstreams JAK family of STAT including JAK1 and JAK2 in LPS-activated
X. Kou et al. / International Immunopharmacology 11 (2011) 1095–1102
1101
Fig. 8. Arctigenin suppresses the phosphorylation of JAK2 in LPS-stimulated RAW264.7 cells. RAW264.7 cells were pretreated with arctigenin and stimulated with LPS for the indicated time periods. Western blot analysis was performed with Abs for phospho-JAK2. Data shown here are representatives of three independent experiments.
RAW264.7 cells, because JAK3 has been found only in leukocytes. As shown in Fig. 7, phosphorylation of JAK2 was significantly suppressed in LPS-activated RAW264.7 cells. Moreover, we propose that ROS scavenging by arctigenin possibly inhibits JAK-STAT signaling, as JAKSTAT signaling is ROS dependent [34,37] and arctigenin has antioxidant effects. In this study, we observed that arctigenin dosedependently reduced LPS-induced ROS production (Fig. 6). Lobelia Samavati et al. [38] reported that LPS-mediated IL-1β and IL-6 production was associated with tyrosine phosphorylation of STAT1 and STAT3 in a murine macrophage cell line as well as in primary murine bone marrow derived dendritic cells and peritoneal macrophages. Thus, to validate the functional importance of the inhibitory activity of arctigenin on the JAK-STAT inflammatory cascade in RAW264.7 cells we examined the expression of proinflammatory mediator such as IL-1β, IL-6 and MCP-1 that include a STAT binding site in their promoter region. Results showed that arctigenin significantly suppressed IL-1β, IL-6 and MCP-1 expression in LPS activated RAW264.7 cells (Fig. 7). To compare with arctigenin, AG490 was less effective in decreasing LPS-mediated IL-1β, IL-6 and MCP-1 production. STAT3 and NF-κB are central transcription factors in both innate and adaptive immunity. Previous report has shown that arctigenin can also suppress NF-κB activation [14]. Whether suppression of STAT3 activation by arctigenin is linked to inhibition of NF-κB activation is not clear. STAT3 and NF-kB are activated in response to LPS in RAW264.7 cells. The p65 subunit of NF-κB has been shown to interact with STAT3 [39]. Previous study indicates that unphosphorylated STAT3 can bind to NF-κB in competition with IκBα [40].
Fig. 9. Effects of Arctigenin on cell viability. RAW264.7 cells were treated with various concentrations of Arctigenin for 24 h. Cell viability was determined by MTT assay as described in Materials and methods. Cell viability in absence of Arctigenin treatment was taken as 100%. The results were expressed as mean ± SD of three independent experiments.
Inhibition of STAT3 tryosine phosphorylation by arctigenin results in more unphosphorylated STAT3 available to bind to NF-κB. In addition, a recent report indicated that STAT3 prolongs NF-κB nuclear retention through acetyltransferase p300-mediated RelA acetylation, thereby interfering with NF-κB nuclear export [41]. Thus, it is possible that suppression of STAT3 activation may mediate inhibition of NF-κB activation by arctigenin in inflammatory conditions. In conclusion, the results of this study provide initial evidence that arctigenin has anti-inflammatory effects by inhibiting activation of the JAK-STAT pathways. Furthermore, its antioxidant effect contributes to anti-inflammatory mechanisms of arctigenin. Our results provide a new insight for understanding the anti-inflammatory activities of arctigenin in macrophages. Further studies are needed to determine the full pharmacokinetics of arctigenin activity in vivo.
Acknowledgements We greatly thank Dr. Gautam Sethi (National University of Singapore) for providing pRc/CMV-STAT3YF plasmid. This work was supported by grants from the National Nature Science Foundation of China (Nos. 81072433, 31071000, 30770842 and 30771979) and a Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).
References [1] Hoffmann JA, Kafatos FC, Janeway CA, Ezekowitz RA. Science 1999;284:1313–8. [2] Aderem A, Underhill DM. Annu Rev Immunol 1999;17:593–623. [3] Guha M, Mackman N. LPS induction of gene expression in human monocytes. Cell Signal 2001;13:85–94. [4] Park Eun Jung, Soo Young Park, Eun-hye Joe. 15d-PGJ2 and rosiglitazone suppress janus kinase-STAT inflammatory signaling through induction of suppressor of cytokine signaling 1 (SOCS1) and SOCS3 in glia. J Biol Chem 2003;17:14747–52. [5] Levy DE, Darnell Jr. Stats: transcriptional control and biological impact. Nat Rev Mol Cell Biol 2002;3:651–62. [6] Murray PJ. The JAK–STAT signaling pathway: input and output integration. J Immunol 2007;178:2623–9. [7] Okugawa S, Ota Y, Kitazawa T, Nakayama K, Yanagimoto S, Tsukada K, et al. Janus kinase 2 is involved in lipopolysaccharide-induced activation of macrophages. Am J Physiol Cell Physiol 2003;285:C399–408. [8] Kovarik P, Mangold M, Ramsauer K, Heidari H, Steinborn R, Zotter A, et al. Specificity of signaling by STAT1 depends on SH2 and C-terminal domains that regulate Ser727 phosphorylation, differentially affecting specific target gene expression. EMBO J 2001;20:91–100. [9] Ganster RW, Taylor BS, Shao L, Geller DA. Complex regulation of human inducible nitric oxide synthase gene transcription by Stat1 and NF-kappa B. Proc Natl Acad Sci USA 2001;98:8638–43. [10] Wen Z, Zhong Z, Darnell Jr. Maximal activation of transcription by Stat1 and Stat3 requires both tyrosine and serine phosphorylation. Cell 1995;82:241–50. [11] Ayres DC, Loike JD. Lignan: chemical, biological and clinical properties. Cambridge: UK7 Cambridge Univ. Press; 1990. p. 402.
1102
X. Kou et al. / International Immunopharmacology 11 (2011) 1095–1102
[12] Bastos JK, Carvalho JC, De Souza GH, Pedrazzi AH, Sarti SJ. Anti-inflammatory activity of cubebin, a lignan from the leaves of Zanthoxyllum naranjillo Griseb. J Ethnopharmacol 2001;75:279–82. [13] Midori T, Takao K, Katsuko K, Harukuni T, Hoyoku N. Antitumor-promoting activity of lignans from the aerial part of Saussurea medusa. Cancer Lett 2000;158:53–9. [14] Jang YP, Kim SR, Choi YH, Kim J, Kim SG, Markelonis GJ, et al. Arctigenin protects cultured cortical neurons from glutamate-induced neurodegeneration by binding to kainate receptor. J Neurosci Res 2002;68:233–40. [15] Jang YP, Kim SR, Kim YC. Neuroprotective dibenzylbutyrolactonelignans of Torreya nucifera. Planta Med 2001;67:470–2. [16] Schroder HC, Merz H, Steffen R, Muller WE, Sarin PS, Trumm S, et al. Differential in vitro anti-HIV activity of natural lignans. Z Naturforsch 1990;45:1215–21. [17] Eich E, Pertz H, Kaloga M, Schulz J, Fesen MR, Mazumder A, et al. Arctigenin as a lead structure for inhibitors of human immunodeficiency virus type-1 integrase. J Med Chem 1996;39:86–95. [18] Cho MK, Park JW, Jang YP, Kim YC, Kim SG. Potent inhibition of lipopolysaccharideinducible nitric oxide synthase expression by dibenzylbutyrolactone lignans through inhibition of I-kBa phosphorylation and of p65 nuclear translocation in macrophages. Int Immunopharmacol 2002;2:105–16. [19] Feng Zhao, Lu Wang, Ke Liu. In vitro anti-inflammatory effects of arctigenin, a lignan from Arctium lappa L., through inhibition on iNOS pathway. J Ethnopharmacol 2009;122:457–62. [20] Galdiero M, Vitiello M, D'Isanto M, Raieta K, Galdiero E. STAT1 and STAT3 phosphorylation by porins are independent of JAKs but are dependent on MAPK pathway and plays a role in U937 cells production of interleukin-6. Cytokine 2006;36:218–28. [21] Yeh M, Gharavi NM, Choi J, Hsieh X, Reed E, Mouillesseaux KP, et al. Oxidized phospholipids increase interleukin 8(IL-8) synthesis by activation of the c-src/ signal transducers and activators of transcription (STAT)3 pathway. J Biol Chem 2004;279:30175–81. [22] Wu YF, Fan YM, Xue B, Luo L, Shen JY, Yin ZM. Human glutathione S-transferase P1-1 interacts with TRAF2 and regulates TRAF2-ASK1 signals. Oncogene 2006;25: 5787–800. [23] Liu Ziwen, Fan Yumei, Luo Lan, Yin Zhimin. Dipyrithione inhibits lipopolysaccharideinduced iNOS and COX-2 up-regulation in macrophages and protects against endotoxic shock in mice. FEBS Lett 2008;582:1643–50. [24] Kim HongSook, Cho IkHyun, Kim JaEun. Ethyl pyruvate has an anti-inflammatory effect by inhibiting ROS-dependent STAT signaling in activated microglia. Free Radic Biol Med 2008;45:950–63. [25] Ohmori Y, Hamilton TA. Requirement for STAT1 in LPS-induced gene expression in macrophages. J Leukoc Biol 2001;69:598–604. [26] Cho ML, Kang JW, Moon YM, Nam HJ, Jhun JY, Heo SB, et al. STAT3 and NF-kappaB signal pathway is required for IL-23-mediated IL-17 production in spontaneous
[27]
[28]
[29]
[30] [31]
[32] [33] [34]
[35]
[36]
[37] [38]
[39]
[40]
[41]
arthritis animal model IL-1 receptor antagonist-deficient mice. J Immunol 2006;176:5652–61. Kamijo R, Harada H, Matsuyama T, Bosland M, Gerecitano J, Shapiro D, et al. Requirement for transcription factor IRF-1 in NO synthase induction in macrophages. Science 1994;263:1612–5. Lee C, Lim HK, Sakong J, Lee YS, Kim JR, Baek SH. Janus kinase-signal transducer and activator of transcription mediates phosphatidic acid-induced interleukin IL-1βand IL-6 production. Mol Pharmacol 2006;69:1041–7. Sodhi A, Kesherwani V. Signaling molecules involved in production and regulation of IL-1beta bymurine peritoneal macrophages in vitro on treatment with concanavalin A. Int Immunopharmacol 2007;7:1403–13. Lum Hazel, Roebuck Kenneth A. Oxidant stress and endothelial cell dysfunction. Am J Physiol Cell Physiol 2001;280:C719–41. Liu MY, Cheng YJ, Chen CK, Yang BC. Coexposure of lead and lipopolysaccharideinduced liver injury in rats: involvement of nitric oxide-initiated oxidative stress and TNF-alpha. Shock 2005;23:360–4. Stark GR, Kerr IM, Williams BRG, Silvermann RH, Schreiber RD. Annu Rev Biochem 1998;67:227–64. Yasukawa H, Sasaki A, Yoshimura A. Negative regulation of cytokine signaling pathways. Annu Rev Immunol 2000;18:143–64. Kamezaki K, Shimoda K, Numata A, Matsuda T, Nakayama K, Harada M. The role of Tyk2. Stat1 and Stat4 in LPS-induced endotoxin signals. Int Immunol 2004;16: 1173–9. Kim HS, Ye SK, Cho IH, Jung JE, Kim DH, Choi S, et al. 8-Hydroxydeoxyguanosine suppresses NO production and COX-2 activity via Rac1/STATs signaling in LPSinduced brain microglia. Free Radic Biol Med 2006;41:1392–403. Dell'Albani P, Santangelo R, Torrisi L, Nicoletti VG, devellis J, Giuffrida Stella AM. JAK/STAT signaling pathway mediates cytokine-induced iNOS expression in primary astroglial cell cultures. J Neurosci Res 2001;65:417–24. hle JN. The Stat family in cytokine signaling. Curr Opin Cell Biol 2001;13:211–7. Samavati Lobelia, Rastogi Ruchi, Wenjin Du, Hüttemannc Maik, Fitea Alemu, Franchid Luigi. STAT3 tyrosine phosphorylation is critical for interleukin 1 beta and interleukin-6 production in response to lipopolysaccharide and live bacteria. Mol Immunol 2009;46:1867–77. Yu Z, Zhang W, Kone BC. Signal transducers and activators of STAT3 inhibits transcription of the inducible nitric oxide synthase gene by interacting with nuclear factor kappaB. Biochem J 2002;367:97–105. Yang J, Liao X, Agarwal MK, Barnes L, Auron PE, Stark GR. Unphosphorylated STAT3 accumulates in response to IL-6 and activates transcription by binding to NFkappaB. Genes Dev 2007;21:1396–408. lee H, Herrmann A, JH Deng, Kujawski M, Niu G, Li Z, et al. Persistently activated Stat3 maintains constitutive NF-kappaB activity in tumors. Cancer Cell 2009;15:283–93.