Are ineffective defence reactions potential target for induced resistance during the compatible wheat-powdery mildew interaction?

Plant Physiology and Biochemistry 96 (2015) 9e19

Contents lists available at ScienceDirect

Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy

Research article

Are ineffective defence reactions potential target for induced resistance during the compatible wheat-powdery mildew interaction? Ch. Tayeh a, 1, B. Randoux a, B. Tisserant a, G. Khong a, Ph. Jacques b, Ph. Reignault a, * a ^te d'Opale, Unit
Universit
e du Littoral Co e de Chimie Environnementale et Interactions sur le Vivant (UCEIV-EA4492), Univ. Lille-Nord de France, GIS PhyNoPi, B.P.699, F-62229 Calais Cedex, France b Universit
e de Lille, Institut R
egional de Recherche en Agroalimentaire et Biotechnologie Charles Viollette, Cit
e Scientifique, F-59655 Villeneuve d'Ascq Cedex, France

a r t i c l e i n f o

a b s t r a c t

Article history: Received 25 May 2015 Received in revised form 2 July 2015 Accepted 17 July 2015 Available online 18 July 2015

Powdery mildew caused by Blumeria graminis f.sp. tritici, an obligate aerial biotrophic fungus, would be one of the most damaging wheat (Triticum aestivum) diseases without the extensive use of conventional fungicides. In our study, the expression levels of some basal defence-related genes were investigated during a compatible interaction in order to evaluate wheat reactions to infection, along with the different stages of the infectious process in planta. As fungal conidia initiated their germination and developed appressorial germ tube (AGT), early defence reactions involved the expression of a lipoxygenase (LOX)and an oxalate oxidase (OXO)-encoding genes, followed by activations of corresponding LOX (EC 1.13.11.12) and OXO (EC 1.2.3.4) activities, respectively. When penetration of AGT took place, upregulation of chitinases (CHI) and PR1-encoding genes expression occurred along with an increase of CHI (EC 3.2.1.14) activity. Meanwhile, expression of a phenylalanine ammonia-lyase-encoding gene also took place. Up-regulation of a phospholipase C- and lipid transfer proteins-encoding genes expression occurred during the latest stages of infection. Neither the phi glutathione S-transferase (GST)-encoding gene expression nor the GST (EC 2.5.1.13) activity was modified upon wheat infection by powdery mildew. Whether these defence reactions during such a compatible interaction are markers of immunity or susceptibility, and whether they have the ability to contribute to protection upon modulation of their timing and their intensity by resistance inducers are discussed. © 2015 Elsevier Masson SAS. All rights reserved.

Keywords: Blumeria graminis f. sp. tritici Compatible interaction Defence reaction qRT-PCR Triticum aestivum

1. Introduction Powdery mildew caused by Blumeria graminis f.sp. tritici (DC.) E.O. Speer (Bgt), an obligate biotrophic ascomycete fungus that invades wheat (Triticum aestivum) aerial parts, is an important disease in wheat-growing areas worldwide. Corresponding yield losses ranged from 3 to more than 30% over the last 15 years ~ o-Felix et al., 2008). So far, the use of host plant resistance (Bricen has been the most cost-effective and environmentally safe method for the control of wheat powdery mildew (Hsam et al., 2002). However, the durability of wheat resistance conferred by some

* Corresponding author. E-mail addresses: [email protected] (Ch. Tayeh), [email protected] (Ph. Reignault). 1 Present address: French Agency for Food, Environmental and Occupational Health & Safety, Unit of Expertise in Biological Risks (ERB), Plant Health Laboratory,
ras, 49044 Angers, France. 7 rue Jean Dixme http://dx.doi.org/10.1016/j.plaphy.2015.07.015 0981-9428/© 2015 Elsevier Masson SAS. All rights reserved.

powdery mildew (Pm) major resistance genes is impaired since new virulence genes may arise within the pathogen population, resulting in the overcome of cultivar resistance (Jones, 2001). The consistency and the severity of the damage caused by Bgt therefore render necessary a systematic and extensive use of conventional fungicides. Again, powdery mildew populations can develop resistance, leading to the loss of efficacy of many systemic fungicides, such as strobilurins and sterol demethylation inhibitors (DMIs) (Hollomon and Wheeler, 2002). New strategies are currently being considered, that match the growing concern about the consequences of the use of fungicides on both health and environment. Among them, emerging alternative control strategies are based on the activation of the plant defence responses by the application of resistance inducers (Tayeh et al., 2014a). A given elicitor may trigger specific signal transduction pathways within the plant that could affect particular steps of the infectious process leading to a substantial level of resistance. Therefore, the knowledge of plant general defence responses, occurring in a susceptible

10

Ch. Tayeh et al. / Plant Physiology and Biochemistry 96 (2015) 9e19

wheat genotype but unable to confer total resistance on its own against powdery mildew, became of a crucial importance. Understanding corresponding mechanisms should lead to improved protection of plants from this agronomically important disease. However, all plants, whether they are resistant or susceptible, respond to a pathogen attack by the induction of a coordinated defence strategy. The innate ability of plants to detect pathogens is essential for their immunity (Altenbach and Robatzek, 2007). This is made possible by the recognition of nonself molecular structures termed pathogen/microbe-associated molecular patterns (PAMPs/ MAMPs) through pattern recognition receptors (PRR) (Nürnberger et al., 2004). As a result of PAMPs/MAMPs recognition, defence reactions are activated in the plant and the pathogen has to overcome the PAMP-triggered immunity (PTI) in order to establish a compatible interaction and successfully colonize the plant (Chisholm et al., 2006). The inactivation of defence mechanisms via the release of effectors that can suppress host immune responses is widely described as effector-triggered susceptibiliy (ETS) (Dry et al., 2010). However, it was not reported yet for Bgt. The time-course and the extent of the plant response to intracellular signaling resulting from infection determine the outcome of the interaction. The successful colonization of wheat by Bgt in susceptible genotypes is likely to be caused either by weak and/or delayed plant defence expression as suggested by Dixon et al. (1994). Furthermore, little attention has been paid so far to the plant genes expressed during the early phase of infection. Thereby, our work focused on the early phase of a compatible interaction between wheat and powdery mildew. The aims of our study are (a) to describe the wheat response to Bgt and (b) to find out markers of defence that could be involved in partial resistance to powdery mildew by examinating a set of defence-related genes. We studied by quantitative real-time PCR (RT-qPCR) the expression of 10 genes over a time-course experiment (including hours after inoculation) to identify defence signal transduction pathways and further activities targeting the pathogen. PR-proteins which accumulate under pathogen attack and inhibit pathogen growth were therefore investigated, such as chitinases (EC 3.2.1.14) and PR1protein. The chi gene (AY437443) expression was shown to be strongly induced in a wheat cultivar susceptible to Septoria tritici (Zymoseptoria tritici) (Shetty et al., 2009) and the expressions of chi1 and chi4 precursor genes (AB029934 and AF112966) were upregulated in response to methyl-jasmonate treatment and potentiated upon Tilletia laevis infection (Lu et al., 2006). The PR1 gene (HQ848391) was isolated by Chen et al. (2011) from wheat leaves infected by Puccinia triticina. Moreover, reactive oxygen species (ROS) metabolism was studied here at two levels: ROS-generating and -eliminating enzymes, encoded respectively by an oxalate oxidase (OXO, EC 1.2.3.4) and glutathione S-transferase (GST, EC 2.5.1.13) encoding genes. The gstF gene (AF387085) was chosen regarding the phi-GST it encodes (cdd 48602); the latter being involved in cellular detoxification of products of oxidative stress as well as in transport of flavonoid pigments. Transcripts of oxalate oxidase (M21962), a ROS-generating enzyme, accumulated in wheat resistant to Hessian fly attack 24 and 48 h after infection (Liu et al., 2010). Lipid metabolism was investigated at 3 levels: lipoxygenases (LOX, EC 1.13.11.12) involved in the synthesis of oxylipins such as jasmonic acid (JA) (Howe and Schilmiller, 2002), phospholipases C (PLC, EC 3.1.4.11) that allow a transient accumulation of phosphatidic acid (PA) (Testerink and Munnik, 2005) and Lipid Transfer Proteins (LTPs) leading to intracellular trafficking of phospholipids and may present antifungal activity (Kirubakaran et al., 2008). A lipoxygenase-encoding gene (U32428) was chosen regarding its early and high responsiveness to several elicitors in wheat tissues, and more specifically its involvement in defence € rlach et al., 1996). The wheat lipid transfer reactions against Bgt (Go

protein-encoding gene Ltp 3F1 (EF432573) encodes an LTP protein that exhibited a broad-spectrum antifungal activity in vitro. Moreover, transgenic tobacco expressing Ltp 3F1 gene showed fungal resistance to Bipolaris oryzae, Cylindrocladium scoparium and Alternaria sp. (Kirubakaran et al., 2008). The PI-PLC2 gene (HM754653) identified by Khalil et al. (2011) in wheat encodes a phosphoinositide-specific phospholipase C (PI-PLC). The activity and localization of PI-PLCs enzymes have also been shown to regulate membrane trafficking (Thole and Nielsen, 2008) and to play a role in signaling involved in disease resistance in tomato (Vossen et al., 2010). The phenylpropanoid pathway was also examined through the phenylalanine ammonia-lyase (PAL, EC 4.3.1.24) (Vlot et al., 2009). The pal gene tested in here was shown to play a key role in generating a successful response in wheat against Diuraphis noxia, the Russian wheat aphid (Van Eck et al., 2010). The expression of the corresponding genes and some enzymatic activities at different stages of early phase of pathogenesis is analyzed and discussed. Although these defence reactions turned to be of a little effectiveness during such a compatible interaction, the modulation of the amplitude and chronology of the examined markers may be conceivable in order to meet the features of an induced resistance. 2. Materials and methods 2.1. Biological materials Wheat (T. aestivum L.) cv. Orvantis provided by Benoits C.C. (Orgerus) was used throughout the experiments. The susceptibility level of Orvantis, a highly productive winter wheat cultivar, to powdery mildew was estimated at 5 on a scale ranging from 1
ge
tal (most susceptible) to 9 (most resistant) (Arvalis-Institut du Ve and CTPS, personal communication). The cultivar is susceptible to the MPEBgt1 powdery mildew isolate of Bgt used in previous studies (Renard-Merlier et al., 2007). The fungus was inoculated and maintained on Orvantis plants as described by Randoux et al. (2006). For our experiments, wheat caryopses were soaked overnight in water and then grown on compost in a growth chamber (18
C day temperature, 12
C night temperature, and 70% relative humidity) for a 12-h photoperiod. Ten-day-old wheat plantlets were sprayed with B. graminis f. sp. tritici conidia suspended in Fluorinert FC 43 (heptacosafluorotributhylamine) provided by 3 M. The inoculum concentration was adjusted to 5  105 spores mL1 and conidia were sprayed on leaves with a Preval Sprayer (Chicago Aerosol, Illinois, USA). 2.2. RNA extraction and quantification of gene expression by realtime PCR Non-inoculated (ni) and inoculated (i) wheat leaves were sampled at 0, 3, 6, 9, 12, 15, 18, 21, 24, 48, 72 and 96 h postinoculation (hpi) and stored at 80
C until use. Total RNA was extracted from 100 mg of plant tissue using RNeasy Plant Mini Kit (Qiagen, The Netherlands). Genomic DNA contaminating the samples was removed by treatment with DNase using RNase-Free DNase Set (Qiagen, The Netherlands). Reverse transcription of total RNA was carried out using High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA) according to the manufacturer's protocol. Real-Time qPCR was performed using ABI Prism 7300 detection system (Applied Biosystems, USA). The sequences of primers used are shown in Table 1. The primers pairs were designed using the Primer Express® program (Applied Biosystems, USA) and were tested for secondary structure using NetPrimer® program (Premier Biosoft). The tub (U76895) and act

Ch. Tayeh et al. / Plant Physiology and Biochemistry 96 (2015) 9e19

11

Table 1 Primers used in the quantitative real-time RT-qPCR studies. Gene

Accession number

Forward sequence (50 -30 )

Reverse sequence (50 -30 )

Gene description

chi chi1 chi4 precursor PR1 oxo gstF pal lox PI-PLC2 ltp tub act

AY437443 AB029934 AF112966 HQ848391 M21962.1 AF387085 AY005474 U32428 HM754653 EF432573 U76895 AB181991

GCACCGACCTGCTCAACAA GCCACGTCCCCACCATACTAT GTCGTCACCGATGCGTTCT CATGCACCTTCGTATGCCTAACT CAGGGTCGTGGAACTTCTCAAG CGAATCACGTGCTATTTGCAA CCCCCATTGGTGTCTCCAT GGGCACCAAGGAGTACAAGGA CCCGGAGAAAGCACGACAT TGAGCCCCTGCATCTCCTAT GGAGTACCCTGACCGAATGATG AACCTTCAGTTGCCCAGCAA

AGAACCACAACGCCGTCTTAA CCGGCAAGATCGTAGTTGGA AAACTGGCGCGTGTAAAAGC TGGCTTATTACGGCATTCCTTT TTATCATTTCAGGGAAGGCTCCTA GATGTCGCCCTCCTTCAACA ACTGCGCGAACATCAGCTT GCTCGTGATGGTGTGGATGA CCCAAGCTCATCCGAGACA GGGCTGAGCTGACTAGACTCCTAA AACGACGGTGTCTGAGACCTTT TGTTCGACCGCTGGCATAC

chitinase Class 1 basic chitinase Class 4 acidic chitinase PR1 Oxalate oxidase Class Phi-Glutathione-S transferase Phenylalanine ammonia lyase Lipoxygenase Phosphoinositide-specific phospholipase Lipid transfer protein Beta-tubulin Actin

(AB181991) genes, encoding respectively for tubulin and actin, were used as reference genes. The relative expression of the target genes was evaluated in B. graminis-inoculated and FC43-treated wheat leaves compared with non-inoculated leaves and normalized to the tub and act expression level. 2.3. Enzyme activities Enzyme activities were monitored on a time-course experiment. Samples were collected at 6, 12, 18, 24, 48, 72 and 96 hpi. Each sample consisted of a part of 3 first wheat leaves collected from 3 different plants. Total protein concentrations were measured using the method of Lowry et al. (1951). The standard curve was established with bovine serum albumin. Unless otherwise stated, chemicals were purchased from Sigma (Saint-Quentin Fallavier, France). 2.3.1. CHI activity The CHI (EC 3.2.1.14) assay was performed as described in Magnin-Robert et al. (2007). Briefly, 50 mg of first wheat leaves were ground in 1 mL extraction buffer (50 mM sodium acetate buffer, pH 5.0; 1 mM dithiothreitol and 0.2% PMSF). The homogenate was centrifuged at 10,000 g for 5 min at 4
C and the clarified supernatant was recovered. Chitinase activity was assayed using a commercial blue enzyme substrate, CM-chitin-RBV solution (Loewe Biochemica, Sauerlach, Germany). The reaction was started by mixing 200 mL of chitin (2 mg mL1), 200 mL of 200 mM sodium acetate buffer, pH 5.0, 350 mL extraction buffer and 50 mL of protein extract. The mixtures were incubated at 37
C for various times and the reactions were stopped by the addition of 200 mL of cold 1 M HCl and immediately kept on ice for 10 min. The undigested substrate was precipitated by centrifugation (4
C, 10,000 g for 10 min) and the absorbance of the supernatant was recorded at 550 nm. Results were expressed in mg of hydrolyzed chitin min1 mg1 proteins.

in acetic acid-ethanol (1/3, v/v) for a night to bleach the tissues. Samples were then allowed to rehydrate in distillated water for 2 h and stored in lactoglycerol (lactic acid/glycerol/water, 1/1/1, v/v/v). The staining procedure of fungal structures was undergone using trypan blue solution 0.1% (w/v in lactoglycerol). Light microscopy for Blumeria graminis f. sp. tritici detection using this method allowed us to differentiate 8 stages of development: ungerminated conidia (unC), conidia with a primary germ tube (C-PGT), conidia with both PGT and appressorial germ tube (C-AGT), conidia with a long AGT without any penetration peg (C-noPp), conidia with a long AGT with a penetration peg (C-Pp), conidia with haustorium in an early stage of development (C ~ H), conidia with fully-formed haustorium (C-ffH) and resulting fungal colony (FC). 2.5. Statistical analysis For gene expression studies, the relative expression level of the target genes was evaluated in B. graminis f. sp. tritici-inoculated material compared with noninoculated plants and normalized to the tub and act expression level. The analyses were performed using the relative expression software tool REST® as described by Pfaffl et al. (2002). Two biological repetitions were conducted with 3 technical replicates. Similar results were obtained and representative results are presented. All hypotheses were rejected at P < 0.05. In the following, all differences are significant at P < 0.05 unless specifically mentioned. Data from enzyme activities represent continuous variable; an analysis of variance (ANOVA) was performed assuming a normal distribution. Variances were stabilized by appropriate logarithmic transformation if necessary. The test of Tukey was used to refine results of ANOVA to reveal any significant differences between inoculated and noninoculated plants. All data were analyzed by STATGRAPHICS Centurion XVI (Sigma Plus, Levallois-Perret, France). 3. Results

2.3.2. Other enzymes activities LOX (EC 1.13.11.12), OXO (EC 1.2.3.4), GST (EC 2.5.1.13) and PAL (EC 4.3.1.24) activities were measured as described by Randoux et al. (2006), El-Chartouni et al. (2011) and Reignault et al. (2001) respectively. 2.4. Light microscopy for Blumeria graminis f. sp. tritici detection Inoculation-challenged plantlets were sprayed with B. graminis f. sp. tritici conidia suspended in Fluorinert FC43 at a concentration of 5  105 spores.mL1. The first leaf of three plantlets was randomly harvested at 3, 6, 9, 12, 15, 18, 21, 24, 48, 72 and 96 h postinoculation (hpi) with B. graminis f. sp. tritici. A 1.5 cm-length segment was cut within the main part of the leaves and transferred

The infectious process of Bgt on the wheat susceptible cultivar Orvantis was first established in order to characterize in our experimental conditions the time-course of fungal development and to further associate defence responses with specific fungal developmental stages. Therefore, the same sample collection pattern was followed for cytological and molecular approaches, every 3 h for the first 24 hpi (versus 6 h for the biochemical sampling) and then at 48, 72 and 96 h post-inoculation (hpi). 3.1. Infectious process of Blumeria graminis f. sp. tritici on wheat during 5 days after inoculation The fungal structures recorded on wheat leaves are presented in

12

Ch. Tayeh et al. / Plant Physiology and Biochemistry 96 (2015) 9e19

Fig. 1 and the time-course of the infectious process of Bgt in our experiments is presented in Fig. 2. At 3 hpi, 90.5% of the conidia were unC yet while the % of C-PGT and C-AGT were respectively 7.4 and 2.1%. At 6 hpi, the % of unC was reduced by half approximately (51.8%) since C-PGT frequently occurred (34.6%); the % of C-AGT also increased (13.6%). The 9 hpi time-point is characterized by the high frequency of C-AGT (55.8%). Between 12 and 24 hpi, most conidia were C-AGT (between 66.5% and 82.7%), whereas the remaining events were distributed among the following stages: unC (between 16.3% and 23.2%), C-PGT (between 0% and 6.9%), C-noPp (between 0.6 and 1%). In the same period of time, the average of C-Pp was about 3.1% with a maximum of 7.4% at 15 hpi. At 48 hpi, almost half of the initial conidial population (46.9%) were either C ~ H or C-ffH, 17.6 and 29.3% respectively. The remaining events were distributed mainly between still unC (13.5%) and C-AGT (37.6%). The 72 hpi time-point was characterized by a strong occurrence of FC (60.7%) while 9.2% of conidia reached the stage of C-ffH, 20.3% of conidia were still C-AGT and 9.3% remained unC. At the final 96 hpi time-point of our experimental time-course, 80% of the accounted events corresponded to FC being initiated. 3.2. Gene expression and specific enzymatic activities in wheat leaves infected with Blumeria graminis f. sp. tritici We monitored the expression of a set of defence genes, namely, chi (AY437443), chi1 (AB029934), chi4 precursor (AF112966), PR1

(HQ848391), lox (U32428), oxo (M21962.1), gst (AF387085), PI-PLC2 (HM754653), pal (AY005474) and ltp (EF432573) as well as CHI, OXO, GST, LOX and PAL enzymatic activities over a time course experiment on first wheat leaves inoculated (i) with Bgt compared to non-inoculated (ni) leaves. Significantly differentially expressed transcripts are discussed using strict selection criteria that included a 2.0-fold change threshold. The effect of FC43, the conidia suspension liquid (see Methods), was also examined in order to detect any possible artefactual modification by FC43 of the expression of the studied set of genes and the corresponding enzymatic activities. Unless otherwise specified, the expression level of genes didn't exceed a 2.0-fold increase under FC43 treatment, compared to (ni) leaves. Moreover, no significant change was observed for CHI, OXO, GST and LOX activities compared to the untreated control all over the time-course experiment (data not shown). 3.2.1. Wheat infection by B. graminis f. sp. tritici induces upregulation of the expression of 3 chitinase-encoding genes and chitinase activity In (i) wheat leaves, the chi gene expression was significantly induced at 6 hpi then from 12 till 24 hpi, to the most extent at 15 and 21 hpi. An additional late up-regulation was also observed at 72 and 96 hpi. An average 26.0-fold increase was recorded for these 3 up-regulation events (Fig. 3A). The chi1 expression was also significantly induced over the whole time-course experiment, except at 3 and 18 hpi, with 60.0 and 93.0-fold increases at 12 to 15 and 21 hpi, respectively (Fig. 3B). The chi4 precursor gene

Fig. 1. Stages of development of Blumeria graminis f.sp. tritici observed on wheat susceptible cv. Orvantis.Times corresponding to appearance and disappearance of each infectious stage are both indicated for each of them on the corresponding picture (A) unC: ungerminated conidia(Cd).(B) C-PGT: conidia with a primary germ tube (PGT).(C)C-AGT:conidia with both PGT and appressorial germ tube (AGT) (D)C-noPp:conidia with a long AGT without a penetration peg(Pp).(E)C-Pp:conidia with haustorium in early stage of development(~haus) and fully-formed haustorium (haus) respectively.(G) FC: fungal colony. Bars represent 30 mm.hpi:hours post inoculation.

Ch. Tayeh et al. / Plant Physiology and Biochemistry 96 (2015) 9e19

13

Fig. 2. Time-course of the frequencies of different stages of development of Blumeria graminis f. sp. tritici on wheat susceptible cv. Orvantis. Data represent means of 3 independent experiments. unC: ungerminated conidia. C-PGT: conidia with a primary germ tube (PGT). C-AGT: conidia with both PGT and appressorial germ tube (AGT). C-noPp: conidia with a long AGT without a penetration peg (Pp). C-Pp: conidia with a long AGT with a penetration peg (Pp). C ~ H: conidia with haustorium in early stage of development. C-ffH: conidia with fully-formed haustorium. FC: fungal colony.

expression significantly increased at 6, 9, 15 and 21 hpi, with a gradually raising fold increase: 2.5, 14.6, 18.1 and 25.3-fold increases, respectively. This gene expression was also induced, to a lesser extent, at 48, 72 and 96 hpi (Fig. 3C). Total chitinase activity (Fig. 3D) was also investigated in both (ni) and (i) wheat leaves. Leaves inoculation induced a significant 83% increase of CHI activity, compared to the (ni) wheat leaves at 24 hpi.

3.2.2. B. graminis f. sp. tritici induces several expression inductions of wheat PR1 gene over the whole time-course experiment The PR1 expression profile exhibited several significant upregulations at 3, 9, 12, 21 and 48 hpi, with 25.1, 48.9, 56.9, 43.3 and 29.4-fold increases respectively. An additional strong induction was observed at 15 hpi with a significant 111.0-fold increase, compared to (ni) wheat leaves (Fig. 4A). 3.2.3. gst gene expression e but not GST activity e is altered by B. graminis f. sp. tritici inoculation The gst gene expression was significantly up-regulated over the whole time-course experiment, except at 18 and 72 hpi. A maximum of 3.0-fold increase was observed at 12 and 21 hpi (Fig. 4B). However, (i) leaves showed no significant change in GST activity due to inoculation the whole time-course experiment (data not shown).

3.2.4. Late inductions of phospholipase and LTP-encoding genes The PI-PLC2 gene expression was significantly induced from 21 until 96 hpi. A maximum 4.0-fold increase was observed at 21 hpi and a stable and high expression level was maintained for the latest time points of the experiment. FC43 treatment induced here a slight but significant 2.3-fold increase, at 72 hpi (Fig. 4C). Minor significant changes of the ltp gene expression occurred during the first 24 h after inoculation with Bgt. A gradual transcript accumulation was observed from 48 till 96 hpi, with a maximum 3.0-fold increase (Fig. 4D). Again, FC43 treatment induced a significant upregulation of the ltp gene expression with a significant 4.3-fold increase at 12 hpi (Fig. 4D). 3.2.5. B. graminis f. sp. tritici enhances a unique up-regulation of pal gene A single peak of the pal gene expression was observed 21 hpi with a significant 29.0-fold increase. The gene expression was then significantly maintained at a reduced level, until 48 hpi, but no significant change occured at the remaining time points (Fig. 4E). At the enzymatic level, a significant induction of the PAL activity was observed with a 153.45% at 24 hpi compared to the (ni) control leaves (Fig. 4F). 3.2.6. The oxo gene expression and the corresponding OXO activity are up-regulated upon wheat infection with B. graminis f. sp. tritici The expression pattern of the oxo gene presented a significant

14

Ch. Tayeh et al. / Plant Physiology and Biochemistry 96 (2015) 9e19

Fig. 3. Real time RT-PCR analysis for chitinase-encoding genes expression and chitinase activity in susceptible Orvantis wheat cultivar during Blumeria graminis f. sp. tritici infection. Values with an asterisk are significantly different from corresponding control. Error bars represent SE. (A) chi, (B) chi1 and (C) chi4 precursor genes expression in inoculated (i) wheat and in FC43-treated plants. Gene expression at each point is represented relatively to the non-inoculated (ni) control and is normalized to tub and act genes' expression. Note the specific scale used for each gene. Similar results were obtained in a second independent experiment. (D) Specific chitinase (CHI) activity in inoculated (i) wheat leaves compared to the non-inoculated (ni) leaves. Data represent means of three independent series of duplicates.

peak of up-regulation, with a 40.0-fold increase, at 12 hpi. The gene expression was also significantly induced, but to a lesser extent, at 15, 21, 24, 48 and 96 hpi (Fig. 5A). OXO activity increased significantly in (i) leaves with a 123% increase compared to the (ni) leaves at 12 hpi. Inoculated leaves didn't exhibit any significant change in OXO activity at any of the remaining time points (Fig. 5B). 3.2.7. Early induction of LOX-encoding gene is followed by an increase in LOX activity The lox gene expression was significantly up-regulated at 3, 6 and 9 hpi, with 11, 7 and 33.8-fold increases respectively (at P ¼ 0.053 for the last value), and it decreased later, reaching its basal level. Later significant 4.0-fold inductions were recorded at 48 and 96 hpi (Fig. 5C). However, treatment of wheat leaves with FC43 induced several significant upregulations of the lox gene at 18, 72 and 96 hpi with 7, 5 and 22.0-fold increases respectively (Fig. 5C). LOX activity significantly increased e more than 504% compared to the (ni) leaves 18 hpi with Bgt (Fig. 5D). 4. Discussion 4.1. Time course profile of wheat defence reactions against powdery mildew The aim of our work was to characterize wheat defence responses to fungal infection, through a set of cytological, biochemical and molecular approaches. While most of the authors (Zheng et al., 2009; Wang et al., 2012) focused during compatible interactions on single and/or late dpi (5 dpi and 24 hpi, respectively), the goal of our study was to identify plant genes that are regulated

during a compatible interaction over the whole infectious process and more specifically during the first hpi. Moreover, in contrast to existing studies on the compatible wheat-Bgt interaction, gene expressions were measured regarding corresponding enzyme activities in order to confirm the involvement of genes products in the induction of wheat intrinsic defences. By analyzing altogether gene expression profiles with most of the corresponding enzymatic activities, but also simultaneously with the infection process, this work therefore presents for the first time a global view of the expression of defence markers triggered during a compatible interaction between wheat and a fungal pathogen such as Bgt. A comparison with a dataset of defence reactions that could have occurred in a resistant wheat cultivar in our experimental conditions would have allow to complete the scenery of the different wheat-powdery mildew interaction types, allowing a comparison between compatible and incompatible profiles of defence reactions. This was not achieved here since the objective of our study was to describe defence reaction of a susceptible wheat cultivar that could be afterwards modulated by resistance inducers to achieve satisfactory protection levels. At the cytological level, the complete infectious process of Bgt on the susceptible cultivar Orvantis corroborates the one described by Bushnell (2002) and the temporal development sequence of a successful infection event of Bgt on Orvantis cultivar is completed within 48 hpi. 4.1.1. FC43 has no significant incidence on most of studied wheat defences FC43 is widely used as a conidia suspension liquid for powdery mildew, but also stripe rust and leaf rust (Schuerger and Brown,

Ch. Tayeh et al. / Plant Physiology and Biochemistry 96 (2015) 9e19

15

Fig. 4. Real time RT-PCR analysis of (A) PR1, (B) gstF, (C) PI-PLC2, (D) ltp and (E) pal gene expression in susceptible Orvantis wheat cultivar during Blumeria graminis f. sp. tritici infection and in FC43-treated plants. Gene expression at each point is represented relatively to the non-inoculated (ni) control and is normalized to tub and act genes' expression. Note the specific scale used for each gene. Values with an asterisk are significantly different from corresponding control. Error bars represent SE. Similar results were obtained in a second independent experiment. (F) Specific phenylalanine ammonia lyase (PAL) activity in inoculated (i) wheat leaves compared to the non-inoculated (ni) leaves. Data represent means of three independent series of duplicates.

1997; Risk et al., 2012). We first investigated its effect on the expression of target genes in order to detect any possible incidence of this chemical on the measured expression levels. No effect of FC43 on either transcripts accumulation of the tested genes encoding chitinases, the PR1 protein, OXO, GST and PAL nor, when it could be measured, on the corresponding enzymatic activities was recorded over the time-course experiment. However, FC43 induced significant up-regulations of the LTP, PI-PLC2 and lox genes expression, with 4.3, 2.3 and 22.4-fold increases respectively at 12, 72 and 96 hpi. No change in the LOX activity was observed. Interestingly, these few genes are all related to lipid metabolism and physical or chemical properties of FC43 causing this effect should therefore be investigated at the lipid level since the markers and methods used in this study does not allow us to investigate how this alteration may affect the wheat-powdery mildew interaction.

Overall, our work shows that FC43 is a suitable suspension liquid for B. graminis f. sp. tritici conidia, since it has no effect on the expression of most of the tested genes and on any of the corresponding enzyme activities. A specific caution has to be taken regarding the FC43 effect on the expression of the set of lipidrelated genes. 4.1.2. Antifungal chitinases and PR1-encoding gene expressions are continuously up-regulated during the infectious process of Bgt In our experiments, chitinase-encoding genes' expression was mostly induced between 9 and 21 hpi and followed by an increase in CHI specific activity at 24 hpi. At this stage, 80.8% of the conidia were C-AGT and 3.1% were C-Pp (Fig. 2). Such an up-regulation cooccurred with the developmental sequence leading from conidia with PGT to conidia with AGT, and finally to penetration of the host

16

Ch. Tayeh et al. / Plant Physiology and Biochemistry 96 (2015) 9e19

Fig. 5. Real time RT-PCR analysis for (A) oxo and (C) lox genes expression in susceptible Orvantis wheat cultivar during Blumeria graminis f. sp. tritici infection and after FC43 treatment. Values with an asterisk are significantly different from corresponding control. Gene expression at each point is represented relatively to the non-inoculated (ni) control and is normalized to tub and act genes' expression. Similar results were obtained in a second independent experiment. (B) Specific oxalate oxidase (OXO) and (D) lipoxygenase (LOX) activity in inoculated (i) wheat leaves compared to the non-inoculated (ni) leaves. Data represent means of three independent series of duplicates.

by the AGT. It is likely that the chitinase hydrolytic activity, allowing the degradation of chitin, a major component of fungal cell wall (Kasprzewska, 2003), is induced once the fungal invasion is established, after AGT penetration. Since chi1 and chi4 precursor genes, which encode a vacuolar and an apoplatic chitinase respectively, have their expression induced simultaneously, the sequence of chitin hydrolysis does not match the one generally described, which first involves apoplastic, and then vacuolar chitinase (Kasprzewska, 2003). In the B. graminis f.sp. hordei (Bgh)barley interaction, a biphasic accumulation of chitinase transcript occurred in parallel to attempted penetration by PGT and AGT respectively, on both susceptible and resistant cultivars (Kruger et al., 2003) and in susceptible barley plants (Gjetting et al., 2007). Even though chitinase is initiated at both the transcriptional and enzymatic levels in compatible interaction studied in our work, it fails to suppress fungal growth, since 80% of the potential Bgt conidia developed colonies 96 hpi. Here, the PR1 gene expression was frequently up-regulated during the time-course experiment. Induction of PR1 gene expression followed the differenciation of new fungal infection structures: 90.5% of C-PGT at 3hpi, a mean of 79% of C-AGT between 9 and 21 hpi and finally 46.7% of conidia developing haustorium at ~nd C-ffH). Such a profile expression is in 48 hpi (both C ~ H a accordance with the one described by Bhuiyan et al. (2007), where the expression of the PR1b gene showed an induction from 6 hpi to 144 hpi in the Triticum monococcum-Bgt pathosystem. While Lu et al. (2011) characterized 23 PR1 genes in T. aestivum, the biochemical function of this protein remains elusive, despite some antifungal activity associated to PR1 purified from tobacco and broad bean. The continuous occurrence of tested PR1 gene

expression could thus be due to its hypothetical antifungal activity, during the period of time when Bgt is forming successive new fungal structures. Nevertheless, it also failed to stop the fungal growth during this particular compatible interaction. 4.1.3. Oxalate oxidase-encoding gene expression and corresponding activity occur before haustorium formation and phi GST-encoding gst gene is not involved in wheat defence OXO-encoding genes were recently listed as PR15 and PR16encoding genes for barley (Van Loon et al., 2006). The corresponding enzymes could participate in H2O2 generation, a ROS classically involved in papillae formation (Christensen et al., 2004) and described as a result of cellular metabolism activated during cytological responses of plant cells under attack by powdery mildews (Collinge et al., 2002). OXO-encoding genes' expression has been reported to be induced in both compatible and incompatible wheat-powdery mildew interactions and not earlier than 24 hpi (Hurkman and Tanaka, 1996; Wang et al., 2012). According to Gjetting et al. (2004), the induction of the GLP4 gene, encoding for an oxalate oxidase-like protein, in barley cells containing the haustoria of Bgh at 18 hpi may reflect oxidative activity resulting from either haustorial formation, feeding activity or from the production and construction of the haustorial neck collar. However, such hypotheses don't match with our results, since at least half a day occurs between (a) the oxo gene expression and corresponding enzymatic activity at 12 hpi and (b) the haustoria formation between 24 and 48 hpi. In our pathosystem, OXO-encoding gene expression and enzyme activity were recorded while the first events of AGT penetration took place in a proportion of 3.4% at 12 hpi. The transient ROS production could act as signal molecules

Ch. Tayeh et al. / Plant Physiology and Biochemistry 96 (2015) 9e19

generated upon penetration (Kotchoni and Gachomo, 2006) but unable here to lead to a successful wheat defence against Bgt. While Wang et al. (2012) showed that GST-encoding genes were up-regulated in response to Bgt infection in both compatible and incompatible interactions, Gjetting et al. (2007) reported a specific induction of a gst gene (HD02A06) expression only in Bhg-infected barley cells compared to resistant cells. This might be explained by the detoxification of ROS, potentially allowing the survival of stressed cells during a compatible interaction that does not involve an HR (Foyer and Noctor, 2005). However, neither the gst gene expression, that encodes a GST of the phi subfamily involved in the detoxification of toxic oxidative residues (Cummins et al., 2003), nor the GST activity tested in our conditions were induced upon Bgt inoculation. 4.1.4. JA and SA pathways are induced simultaneously with AGT formation and penetration, respectively In the pathosystem studied here, wheat lox gene expression was rapidly induced within 9 h upon inoculation with Bgt, followed by a € rlach unique increase of LOX specific activity at 18 hpi. However, Go et al. (1996) only reported late accumulation of this gene's transcripts between 3 and 12 days post-inoculation in a comparable compatible wheat-powdery mildew interaction. In addition, neither Mauch et al. (1997) nor Wang et al. (2012) recorded any accumulation of LOX-encoding transcripts in wheat during either compatible, incompatible or non-host interactions with powdery mildew. Here, while lox gene expression was induced when conidia were evolving from ungerminated ones to PGT and AGT-forming ones, within the first 9 hpi, LOX activity was significantly induced later, at 18hpi, after the peak of attempted penetration by conidia took place, at 15 hpi. One could suggest that AGT penetration enhanced the activation of LOX, leading to the transduction of the signal of infection, but obviously not to the establishment of successful defences. In our experiments, pal gene expression was up-regulated at 21 hpi, followed by the increase of the PAL activity at 24 hpi. This gene's expression occurred while most of the conidia were C-AGT and 3.1% have developed a penetration peg, suggesting a possible involvement in local defence at the penetration site against Bgt instead of the involvement in signal transduction. Deposition of phenylpropanoid-linked compounds, thought to be a part of the cell wall reinforcement that contributes to the restriction of pathogen invasion, seems to occur late. Similarly, Bhuiyan et al. (2009) showed that transcripts of TmPAL strongly accumulated at 24 hpi in the mesophyll of susceptible wheat cultivar. According to Zierold et al. (2005), a rise in the PAL enzyme activity, altogether with corresponding gene expression level, was reported in barley epidermis upon Bgh infection. However, this might not be sufficient to block further penetration of the AGT in the susceptible cultivar. Moreover, PAL is involved in the synthesis of SA, responsible for the signal transduction during systemic acquired resistance (SAR) establishment. Transcripts encoding PR1 protein and PAL were observed in the pathosystem studied here, indicating that the SA signaling pathway might be activated as described by Wang et al. (2012). Cao et al. (2006) reported that genes involved in the SA signaling pathway were up-regulated during an incompatible reaction in the wheat cultivar Cumaomai after inoculation with Bgt, whereas genes involved in the JA pathway were induced during a compatible one. In the present study, both SA and JA signaling pathways were induced during a compatible interaction. Moreover, the induction sequence of JA and SA pathways is interesting. One could suggest that the products synthesized upon the oxylipin pathway such as JA, a potent signaling molecule involved in the defence reactions in both animals and plants (La Camera et al., 2004) have signalization function towards the phenylpropanoid

17

pathway. The latter would be induced - still late in this case -, through the PAL gene and enzyme stimulation, in order to directly impair the Bgt infectious process. 4.1.5. The expression of PI-PLC2 and ltp genes, involved in lipid metabolism, are induced along with AGT penetration and haustorium differenciation, respectively Both PI-PLC2 and ltp exhibited low induction level, compared to the other tested genes. These low transcript abundance are frequent in wheat as it was described by Zhu et al. (2012) in wheat leaves during infestation by Hessian Fly. At 21 hpi, the phosphoinositide-phospholipase C (PI-PLC2) gene expression was induced with a 3.0-fold increase and could possibly lead to the accumulation of phosphatidic acid (PA), a recently considered plant lipid secondary messenger (Testerink and Munnik, 2005). The PLC pathway was found out in transgenic tobacco cells upstream the oxidative burst as described by De Jong et al. (2004) and after challenge with pathogens. While many studies reported the rapid accumulation of PA within minutes in response to stimuli (Testerink and Munnik, 2005), the induction of PI-PLC2 gene at 21 hpi during AGT penetration seems to occur late and may explain the lack of efficiency of this defence mechanism against Bgt. During later stages of the infectious process, the ltp gene expression occurred while 46.9% of conidia were developing haustoria (48 hpi) and subsequent fungal colonies were arising. LTP-encoding genes were found to be up-regulated in both compatible and incompatible wheat-powdery mildew interactions (Li et al., 2006; Testerink and Munnik, 2005). One could think that the timing of the gene expression is a determinant of the reduction of the propagation of fungal colonies since antifungal activity was assigned for wheat LTP (Kirubakaran et al., 2008). Moreover, LTPs are potentially good ligands to fatty acids such as linoleic C18:2 (Osman et al., 2001). One could suggest that these binding proteins are encoded lately to participate in the intracellular trafficking of phospholipids and the transport of cutin monomers by interacting with products of the early LOX activity. 4.2. From basal defence to induced resistance: can the expression of tested genes e features of either PTI or ETS e be modulated for efficient defence reactions? The gene expressions described below could be associated at first sight to basal defence responses or PTI. Since they are inefficient in protecting wheat from powdery mildew, one might think that they are markers of ineffective PTI due to an inappropriate defence nature or defence timing. Indeed, the comparison of the results presented here with the features of the same set of defence genes examined under resistance inducers treatments, namely salicylic acid (SA), heptanoyl salicylic acid (HSA) and trehalose (TR) highly supports this hypothesis. A specific trait of wheat protection by TR against powdery mildew, namely 38% protection, is the chitinase involvement in the early defence reaction. Very early increases of chi4 precursor gene expression were recorded in TRsprayed inoculated leaves during the first 9 hpi, followed by an induction of the CHI activity at 24 hpi (Tayeh et al., 2014b). These results were associated with a TR-induced resistance against Bgt, whom infectious process was impaired at the AGT stage. TR also induced the lox gene expression and LOX activity simultaneously not earlier than 72 and 96 hpi. These late molecular changes were strongly associated, according to a correspondence analysis, to reduced fungal colonies (Tayeh et al., 2014b). Moreover, the potentiation of the ltp gene occurred simultaneously with the one of lox gene at the final infectious stages in TR-sprayed inoculated wheat leaves (Tayeh et al., 2014b). Among the tested pathways, the oxylipin pathway turned out to be the most responsive one to

18

Ch. Tayeh et al. / Plant Physiology and Biochemistry 96 (2015) 9e19

resistance inducers. Indeed, both lox gene expression and LOX activity were continuously induced between 3 and 96 hpi in wheat by the exogenous application of SA and HSA (Tayeh et al., 2013), probably leading to a downstream production of oxylipins such as JA. Interestingly, both resistance inducers highly impaired the AGT penetration attempts of Bgt, resulting in 50% and 95% protection respectively (Renard-Merlier et al., 2007; Tayeh et al., 2013). Concerning HSA, an earlier induction of the PI-PLC2 gene by HSA was reported at 12 and 18 hai, (Tayeh et al., 2013) probably leading to an active synthesis of PA. Yet, some gene expressions remained unchanged or were even repressed by such resistant inducers. Indeed, the pal gene expression was significantly reduced by the resistance inducers HSA and TR (data not shown), suggesting that the pal gene expression could be considered as a marker of susceptibility in the wheat-powdery mildew interaction. These observations surely demonstrate that the defence reactions described during the compatible interaction are convenient for modulation by resistance inducers in order to achieve good protection levels. Meanwhile, in the absence of resistance inducers, such gene expression is initially induced upon infection, but then decline while the fungus continues its growth; this could be due to the suppression of the host response by the pathogen according to €psi et al. (2001), as the colonization of the host by the pathogen Wa continues. Blumeria species form PGT that has been shown to punch a hole into host cells walls very rapidly after landing on its surface and suggested to be important for water uptake and host recognition (Zhang et al., 2005). Recently, a conditioning by the PGT of B. graminis of barley epidermal cells for enhanced susceptibility to subsequent appressorial penetration and haustorium establishment has been reported (Yamaoka et al., 2007). This indicates a release of effectors by the PGT and suggests a role for effector proteins in the inhibition of very early defence responses, either at the pre-penetration phase or immediately after appressorial penetration pegs have breached walls. Further support for this hypothesis comes from the absence of fungal Avra10 and Avrk1 transcripts from isolated mature haustoria of Bgh at 7 days after inoculation (Godfrey et al., 2010). Bgt, which has a huge repertoire of homologues of these genes, could contain avirulence genes encoding proteins that may block host defences and contribute to successful infection as suggested by Ridout et al. (2006) for Bgh. Doing so, defence features described here would characterize Effector-Triggered Susceptibility rather than Pathogen-Triggered Immunity in wheat against powdery mildew. 5. Conclusion This study allowed us to draw a precise picture of the defence strategy kinetics of wheat against Bgt during a compatible interaction, regarding the nature and the timing of the events. Defence mechanisms and pathways such as the octadecanoid pathway involved in signal transduction, or direct inhibitory activities such as chitinases were not involved fast or strong enough or did not last for long enough to result in effective defence. Contributions CT, BR, PJ and PR: design and interpretation of all experiments. CT, BT and GK: carried out experimental work. CT, BR and PR: wrote the manuscript. Acknowledgments Christine TAYEH was supported by the French Ministry of National Education and Research.

References Altenbach, D., Robatzek, S., 2007. Pattern recognition receptors: from the cell surface to intracellular dynamics. Mol. Plant Microbe Interact. 20, 1031e1039. Bhuiyan, N.H., Liu, W., Liu, G., Selvaraj, G., Wei, Y., King, J., 2007. Transcriptional regulation of genes involved in the pathways of biosynthesis and supply of methyl units in response to powdery mildew attack and abiotic stresses in wheat. Plant Mol. Biol. 64, 305e318. Bhuiyan, N.H., Selvaraj, G., Wei, G., King, J., 2009. Gene expression profiling and silencing reveal that monolignol biosynthesis plays a critical role in penetration defence in wheat against powdery mildew invasion. J. Exp. Bot 60, 509e521. ~ o-Felix, G., Huerta-Espino, J., Torres, i, Ruiz, L., Betbese, J.A., Martín Bricen
nchez, J.A., 2008. Yield losses caused by powdery mildew on bread wheat Sa
dit., Se
rie A cultivars under irrigated Mediterranean conditions in Spain. Opt. Me 81, 183e185. Bushnell, W.R., 2002. The role of powdery mildew research in understanding hostparasite interaction: past, present and future. In: Belanger, R., Bushnell, W.R., Dik, A.J., Carver, T.L.W. (Eds.), The Powdery Mildews. A Comprehensive Treatise. American Phytopathological Society Press, St. Paul, MN, pp. 1e12. Cao, A.Z., Li, Q., Chen, Y.P., Zou, X.W., Wang, X.E., Chen, P.D., 2006. Screening resistance-related genes to powdery mildew in Haynaldia villosa using barley GeneChip and studying its mechanism of resistance. Acta Agron. Sin. 32, 1444e1452. Chen, Y.T., Chen, Y.F., Li, S.F., Gao, S.G., Yan, H.F., Yang, W.X., Liu, D.Q., 2011. Differential expression of near-isogenic line TcLr19 resistant to wheat leaf rust. Acta Physiol. Sin. 41, 445e448. Chisholm, S.T., Coaker, G., Day, B., Staskawicz, B.J., 2006. Host-microbe interactions: shaping the evolution of the plant immune response. Cell 124, 803e814. Christensen, A.B., Thordal-Christensen, H., Zimmermann, G., Gjetting, T., Lyngkjær, M.F., Dudler, R., Schweizer, P., 2004. The germinlike protein GLP4 exhibits superoxide dismutase activity and is an important component of quantitative resistance in wheat and barley. Mol. Plant Microbe Interact. 17, 109e117. Collinge, D.B., Gregersen, P.L., Thordal-Christensen, H., 2002. The nature and role of defense response genes in cereals. In: Belanger, R., Bushnell, W.R., Dik, A.J., Carver, T.L.W. (Eds.), The Powdery Mildews. A Comprehensive Treatise. American Phytopathological Society Press, St. Paul, MN, pp. 146e160. Cummins, I., O'hagan, D., Jablonkai, I., Cole, D.J., Hehn, A., Werck-Reichhar, D., Edwards, R., 2003. Cloning, characterization and regulation of a family of phi class gluthatione transferases from wheat. Plant Mol. Biol. 52, 591e603. De Jong, C.F., Laxalt, A.M., Bargmann, B.O.R., de Wit, P.J.G.M., Joosten, M.H.A.J., Munnik, T., 2004. Phosphatidic acid accumulation is an early response in the Cf4/Avr4 interaction. Plant J. 39, 1e12. Dixon, R.A., Harrison, M.J., Lamb, C.J., 1994. Early events in the activation of plant defense responses. Annu. Rev. Phytopathol. 32, 479e501. Dry, I.B., Feechan, A., Anderson, C., Jermakow, A.M., Bouquet, A., Adam-Blondon, A.F., Thomas, M.R., 2010. Molecular strategies to enhance the genetic resistance of grapevines to powdery mildew. Aust. Grape Wine Res. 16, 94e105. El Chartouni, L., Randoux, B., Duyme, E., Renard-Merlier, D., Tisserant, B.,
, J., Durand, R., Reignault, Ph, Halama, P., 2011. Bourdon, N., Pillon, V., Sanssene Correlation of cytological and biochemical parameters with resistance and tolerance to Mycosphaerella graminicola in wheat. Plant Biol. 14, 11e21. Foyer, C.H., Noctor, G., 2005. Oxidant and antioxidant signaling in plants: a reevaluation of the concept of oxidative stress in a physiological concept. Plant Cell Environ. 28, 1056e1071. Gjetting, T., Carver, T.L.W., Skøt, L., Lyngkjær, M.F., 2004. Differential gene expression in individual papilla-resistant and powdery mildew-infected barley epidermal cells. Mol. Plant Microbe Interact. 17, 729e738. Gjetting, T., Hagedorn, P.H., Schweizer, P., Thordal-Christensen, H., Carver, T.L.W., Lyngkjær, M.F., 2007. Single-Cell transcript profiling of barley attacked by the powdery mildew fungus. Mol. Plant Microbe Interact. 20, 2235e2246. €hlenius, H., Pedersen, C., Zhang, Z., Emmersen, J., ThordalGodfrey, D., Bo Christensen, H., 2010. Powdery mildew fungal effector candidates share Nterminal Y/F/WxC-motif. BMC Genomics 11, 317. €rlach, J., Volrath, S., Kanuf-Beiter, G., Hengy, G., Bechove, U., Kogel, K.H., Go Oostendorp, M., Staub, T., Ward, E., Kessman, H., Ryals, J., 1996. Benzothiadiazole, a novel class of inducers of systemic acquired resistance, activates gene expression and disease resistance in wheat. Plant Cell. 8, 629e643. Hollomon, D.W., Wheeler, I.E., 2002. Controlling powdery mildews with chemistry. In: Belanger, R., Bushnell, W.R., Dik, A.J., Carver, T.L.W. (Eds.), The Powdery Mildews. A Comprehensive Treatise. American Phytopathological Society Press, St. Paul, MN, pp. 249e267. Howe, G.A., Schilmiller, A.L., 2002. Oxylipin metabolism in response to stress. Curr. Opin. Plant Biol. 5, 230e236. Hsam, S.L.K., Zeller, F.J., 2002. Breeding for powdery mildew resistance in common wheat. In: Belanger, R., Bushnell, W.R., Dik, A.J., Carver, T.L.W. (Eds.), The Powdery Mildews. A Comprehensive Treatise. American Phytopathological Society Press, St. Paul, MN, pp. 219e238. Hurkman, W.J., Tanaka, C.K., 1996. Germin gene expression is induced in wheat leaves by powdery mildew infection. Plant Physiol. 111, 735e739. Jones, J.D.J., 2001. Putting knowledge of plant disease resistance genes to work. Curr. Opin. Plant Biol. 4, 281e287. Kasprzewska, A., 2003. Plant chitinases e regulation and function. Cell. Mol. Biol. Lett. 8, 809e824.

Ch. Tayeh et al. / Plant Physiology and Biochemistry 96 (2015) 9e19 Khalil, H.B., Wang, Z., Wright, J.A., Ralevski, A., Donayo, A.O., Gulick, P.J., 2011. Heterotrimeric Ga subunit from wheat (Triticum aestivum), GA3, interacts with the calcium-binding protein, Clo3, and the phosphoinositide-specific phospholipase C, PI-PLC1. Plant Mol. Biol. 77, 145e158. Kirubakaran, I.S., Begum, S.M., Ulaganathan, K., Sakthivel, N., 2008. Characterization of a new antifungal lipid transfer protein from wheat. Plant Physiol. Biochem. 46, 918e927. Kotchoni, S.O., Gachomo, E.A., 2006. The reactive oxygen species network pathways: an essential prerequisite for perception of pathogen attack and the acquired disease resistance in plants. J. Biosci. 31, 389e404. Kruger, W.M., Szabo, L.J., Zeyen, R.J., 2003. Transcription of the defense response genes chitinase IIb, PAL and peroxidase is induced by the barley powdery mildew fungus and is only indirectly modulated by R genes. Physiol. Mol. Plant Path 63, 167e168. La Camera, S., Gouzerh, G., Dhondt, S., Hoffmann, L., Fritig, B., Legrand, M., Heitz, T., 2004. Metabolic reprogramming in plant innate immunity: the contributions of phenylpropanoid and oxylipin pathways. Immunol. Rev. 198, 267e284. Li, A.L., Meng, C.S., Zhou, R.H., Ma, S.Y., Jia, J.Z., 2006. Assessment of Lipid Transfer Protein (LTP1) gene in wheat powdery mildew resistance. Agric. Sci. China 5, 101e105. Liu, X., Williams, C.E., Nemacheck, J.A., Wang, H., Subramanyam, S., Zheng, C., Chen, M.S., 2010. Reactive oxygen species are involved in plant defense against gall midge. Plant Physiol. 152, 985e999. Lowry, O.H., Rosebroughi, N.J., Farr, A.L., Randall, R.J., 1951. Protein measurement with the folin phenol reagent. J. Biol. Chem. 193, 265e275. Lu, S., Friesen, T., Faris, J., 2011. Molecular characterization and genomic mapping of the pathogenesis-related protein 1 (PR-1) gene family in hexaploid wheat (Triticum aestivum). Mol. Gen. Genom 285, 485e503. Lu, Z.X., Gaudet, B., Puchalski, B., Despins, T., Frick, M., Laroche, A., 2006. Inducers of resistance reduce common bunt infection in wheat seedlings while differentially regulating defence-gene expression. Physiol. Mol. Plant Pathol. 67, 138e148. Magnin-Robert, M., Trotel-Aziz, P., Quantinet, D., Biagianti, S., Aziz, A., 2007. Biological control of Botrytis cinerea by selected grapevine-associated bacteria and stimulation of chitinase and b-1,3 glucanase activities under field conditions. Eur. J. Plant Pathol. 118, 43e57. €rlach, J., Ward, E., Ryals, J., Mauch, F., Kmecl, A., Schaffrath, U., Volrath, S., Go Dudler, R., 1997. Mechanosensitive expression of a lipoxygenase gene in wheat. Plant Physiol. 114, 1561e1566. Nürnberger, T., Brunner, F., Kemmerling, B., Piater, L., 2004. Innate immunity in plants and animals: striking similarities and obvious differences. Immunol. Rev. 198, 249e266.
, T., Maume, B.F., Osman, H., Mikes, V., Milat, M.L., Ponchet, M., Marion, D., Prange Vauthrin, S., Blein, J.P., 2001. Fatty acids bind to fungal elicitor cryptogein and compete with sterols. FEBS Lett. 489, 55e58. Pfaffl, M.W., Horgan, G.W., Dempfle, L., 2002. Relative expression software tool (REST©) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 30, e36.
, J., Courtois, J., Durand, R., Randoux, B., Renard, D., Nowak, E., Sanssene Reignault, Ph, 2006. Inhibition of Blumeria graminis f. sp. tritici germination and partial enhancement of wheat defenses by Milsana. Phytopathology 96, 1278e1286. Reignault, Ph, Cogan, A., Muchembled, J., Lounes-Hadj Sahraoui, A., Durand, R., Sancholle, M., 2001. Trehalose induces resistance to powdery mildew in wheat. New Phytol. 149, 529e529. Renard-Merlier, D., Randoux, B., Nowak, E., Farcy, F., Durand, R., Reignault, Ph, 2007. Iodus 40, salicylic acid, heptanoyl salicylic acid and trehalose exhibit different efficacies and defence targets during a wheat/powdery mildew interaction. Phytochemistry 68, 1156e1164. Ridout, Ch, Skamnioti, P., Porritt, O., Sacristan, S., Jones, J., Brown, J., 2006. Multiple

19

avirulence paralogues in cereal powdery mildew fungi may contribute to parasite fitness and defeat of plant resistance. Plant Cell. 18, 2402e2414. Risk, J.M., Selter, L.L., Krattinger, S.G., Viccars, L.A., Richardson, T.M., Buesing, G., Herren, G., Lagudah, E.S., Keller, B., 2012. Functional variability of the Lr34 durable resistance gene in transgenic wheat. Plant Biotech. J. 10, 477e487. Schuerger, A.C., Brown, C.S., 1997. Spectral quality affects disease development of three pathogens on hydroponically grown plants. HortScience 32, 96e100. Shetty, N.P., Jensen, J.D., Knudsen, A., Finnie, C., Geshi, N., Blennow, A., Collinge, D.B., Jørgensen, H.J., 2009. Effects of beta-1,3-glucan from Septoria tritici on structural defence responses in wheat. J. Exp. Bot. 60 (15), 4287e4300. Tayeh, Ch, Randoux, B., Bourdon, N., Reignault, Ph, 2013. Lipid metabolism is differentially modulated by salicylic acid and heptanoyl salicylic acid during the induction of resistance in wheat against powdery mildew. J. Plant Physiol. 170, 1620e1629. Tayeh, Ch, Siah, A., Randoux, B., Halama, P., Walters, D., Reignault, Ph, 2014a. Topical application of inducers for disease control. In: Walters, A., Newton, D., Lyon, G. (Eds.), Induced Resistance for Plant Defence, second ed. Blackwell Publishing http://onlinelibrary.wiley.com/doi/10.1002/9781118371848.ch10/summary. Tayeh, Ch, Randoux, B., Vincent, D., Bourdon, N., Reignault, Ph, 2014b. Exogenous trehalose induces defences in wheat before and during a biotic stress caused by powdery mildew. Phytopathology 104, 293e305. Testerink, C., Munnik, T., 2005. Phosphatidic acid: a multifunctional stress signaling lipid in plants. Trends Plant Sci. 10, 368e375. Thole, J.M., Nielsen, E., 2008. Phosphoinositides in plants: novel functions in membrane trafficking. Curr. Opin. Plant N. Biol. 11, 620e631. Van Eck, L., Schultz, T., Leach, J.E., Scofield, S.R., Peairs, F.B., Botha, A.M., Lapitan, N.L.V., 2010. Virus-induced gene silencing of WRKY53 and an inducible phenylalanine ammonia-lyase in wheat reduces aphid resistance. Plant Biotech. J. 8 (9), 1023e1032. Van Loon, L.C., Rep, M., Pieterse, C.M., 2006. Significance of inducible defenserelated proteins in infected plants. Annu. Rev. Phytopathol. 44, 135e162. Vlot, A.C., Dempsey, D.M.A., Klessig, D.F., 2009. Salicylic acid, a multifaceted hormone to combat disease. Annu. Rev. Phytopathol. 47, 177e206. Vossen, J.H., Abd-El-Haliem, A., Fradin, E.F., van den Berg, G.C., Ekengren, S.K., Meijer, H.J., Seifi, A., Bai, Y., ten Have, A., Munnik, T., Thomma, B.P., Joosten, M.H., 2010. Identification of tomato phosphatidylinositol-specific phospholipase-C (PI-PLC) family members and the role of PLC4 and PLC6 in HR and disease resistance. Plant J. 62, 224e239. Wang, J.M., Liu, H.Y., Xu, H.M., Li, M., Kang, Z.S., 2012. Analysis of differential transcriptional profiling in wheat infected by Blumeria graminis f. sp. tritici using GeneChip. Mol. Biol. Rep. 39, 381e387. €psi, U., Schweizer, O., Dudler, R., 2001. Syringolin reprograms wheat to undergo Wa hypersensitive cell death in a compatible interaction with powdery mildew. Plant Cell. 13, 153e161. Yamaoka, N., Ohta, T., Danno, N., Taniguchi, S., Matsumoto, I., Nishiguchi, M., 2007. The role of primary germ tubes in the life cycle of Blumeria graminis: the primary germ tube is responsible for the suppression of resistance induction of a host plant cell. Physiol. Mol. Plant Path 71, 184e191. Zhang, Z., Henderson, C., Perfect, E., Carver, T.L.W., Thomas, B.J., Skamnioti, P., Gurr, S.J., 2005. Of genes and genomes, needles and haystacks: Blumeria graminis and functionality. Mol. Plant Pathol. 6, 561e575. Zheng, L., Huang, J., Yu, D., 2009. Isolation of genes expressed during compatible interactions between powdery mildew (Blumeria graminis) and wheat. Physiol. Mol. Plant Path 73, 61e66. Zhu, L., Liu, X., Wang, H., Khajuria, C., Reese, J., Whitworth, R.J., Welti, R., Chen, M.S., 2012. Rapid mobilization of membrane lipids in wheat leaf-sheaths during incompatible interactions with Hessian Fly. Mol. Plant Microbe Interact. 25, 920e930. Zierold, U., Scholz, U., Schweizer, P., 2005. Transcriptome analysis of mlo-mediated resistance in the epidermis of barley. Mol. Plant Pathol. 6, 139e151.