- Email: [email protected]
ArgR directly inhibits lipA transcription in Pseudomonas protegens Pf-5
Biochimie 167 (2019) 34e41
Contents lists available at ScienceDirect
Biochimie journal homepage: www.elsevier.com/locate/biochi
Research paper
ArgR directly inhibits lipA transcription in Pseudomonas protegens Pf-5 Wei Ying, Xing-lian Wang, Hong-qiu Shi, Li-wei Yan, Bing-huo Zhang, Han-quan Li, Jian-yuan Yang, Dai-ming Zha* School of Pharmacy and Life Sciences, Jiujiang University, Jiujiang, 332000, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 18 February 2019 Accepted 30 August 2019 Available online 3 September 2019
ArgR, a transcriptional regulator belonging to the AraC/XylS family, plays a key role in arginine metabolism regulation. ArgR has also been found to repress the transcription of a lipase gene, but its molecular mechanism is still unknown. In this study, we investigated the molecular mechanism acting on the expression of intracellular lipase gene lipA regulated by ArgR in Pseudomonas protegens Pf-5 through knockout and overexpression of argR, detection of DNA-protein interaction in vivo, determining wholecell lipase activities of various strains derived from Pf-5, and examining b-galactosidase activities of various lacZ fusions. The results demonstrated that ArgR inhibits lipA expression at the transcriptional level. Further results showed that the inhibition of lipA transcription by ArgR is mediated by binding to the ArgR binding site of lipA promoter to produce steric hindrance, in which the common sequence, TGTCGC is crucial for the ArgR binding. Besides, arginine inhibits lipA expression in both wild-type and argR mutant, and shows a synergistic inhibition on lipA expression when combined with ArgR. To the best of our knowledge, this is the first report on ArgR directly repressing the transcription of a lipase gene. © 2019 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Keywords: Pseudomonas Lipase gene ArgR Transcriptional regulation
1. Introduction Lipases (triacylglycerol acylhydrolase, EC. 3.1.1.3), being ubiquitous enzymes, are isolated from various plants, animals and microorganisms. They hydrolyze various esters formed from longchain fatty acids and glycerol in the oil-water interface. In addition, they also catalyze other reactions, such as esterification, transesterification, alcoholysis, and aminolysis in organic solvents [1e3]. On account of the versatility of lipases, they have been widely utilized in food, detergents, biodiesel, fine chemicals and waste treatment, etc. [4e7]. Among various sources of lipases, the most widely used are those from the genus Pseudomonas due to their outstanding properties [8e11]. Our previous studies have demonstrated that LipA from P. protegens Pf-5, proved to be an intracellular lipase, shows good stability under moderate temperatures, alkaline conditions, exhibits high activity in wide ranges of temperatures and pH values, and displays high resistance against heavy metal ions, surfactants and organic solvents [12,13]. In view of this, the regulatory
mechanisms of lipA expression have been studied in the past few years. It is reported that the global Gac/Rsm system mainly and directly enhances lipA translation via RsmE and indirectly activates lipA transcription by RsmA [14]. Furthermore, lipA expression is strengthened by an RNA-binding protein Hfq and two twocomponent systems AlgZ/R and PmrA/B all mediated through the Gac/Rsm system [15e17]. Besides, some factors, such as quorum sensing system [18], two-component systems LipQ/R and EnvZ/ OmpR [9,19], ArgR [20], and GbdR [21] have been reported to regulate the expression of other lipase genes, but their molecular mechanisms have not been elucidated yet. ArgR, being a transcriptional regulator of the AraC/XylS family, plays a key part in controlling the expression of certain biosynthetic and catabolic arginine genes [20,22]. In P. aeruginosa, ArgR was found to inhibit the transcription of extracellular lipase gene lipA with an unknown mechanism [20]. In this study, we confirmed for the first time that ArgR directly repressed lipA transcription in P. protegens Pf-5 via its binding to the ArgR binding site of lipA promoter to generate steric hindrance through knockout and
* Corresponding author. E-mail address: [email protected] (D.-m. Zha). https://doi.org/10.1016/j.biochi.2019.08.018 0300-9084/© 2019 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
W. Ying et al. / Biochimie 167 (2019) 34e41
overexpression of argR, detection of DNA-protein interaction in vivo, determining whole-cell lipase activities of various strains derived from Pf-5, and examining b-galactosidase activities of various lacZ fusions. In addition, we also investigated the effect of arginine on lipA expression by detecting b-galactosidase activities of translational lipA’-‘lacZ fusion.
35
2. Materials and methods 2.1. Strains, plasmids, culture conditions and general methods Bacterial strains and plasmids utilized in this study were shown in Table 1. The strains of P. protegens (28 C) and E. coli (37 C) were cultured in liquid or solid (1.5% w/v agar) LB medium. For the
Table 1 Strains, plasmids and primers used in this study. Strain, plasmid and primer
Description
Strains E. coli DH5a BL21(DE3) ET12567(pUZ8002) P. protegens Pf-5 Pf4516
Rhizosphere isolate; Apr Partial deletion mutation of argR in Pf-5; Apr
Plasmids pJQ200SK pJQDargR
Suicide vector with sacB counter-selectable marker used for homologous recombination; Gmr pJQ200SK carrying a 1486-bp XbaI/BamHI insert with a partial deletion in the coding region of argR; Gmr
pBBR1MCS-5 pBBR1MCS-argR pET-28a pET-argR pBBR003 pBBR004 pJQ004 pJQ-lacZ pJQ-ArgR-BS-lacZ pJQ-ArgR-MBS-lacZ
Source
F, 4 80dlacZ DM15, D(lacZYA-argF)U169, deoR, recA1, endA1, hsdR17 (rK-, mKþ), phoA, supE44, l-, thi-1, gyrA96, relA1, used for cloning TaKaRa F, ompT hsdSB(rB-, mB-) dcm gal(DE3), used for expression TaKaRa dam-13TTn9 dcm-6 hsdM cmlR, kanR, used for biparental mating [23] [24] This study
[25] This study r Broad-host-range vector; Gm [26] r pBBR1MCS-5 with a 1001-bp HindIII/BamHI fragment harboring the coding region of argR; Gm This study Expression vector carrying an N-terminal His-Tag/thrombin/T7-Tag configuration plus an optional C-terminal His-Tag sequence; Novagen Kmr This pET-28a carrying a 1001-bp NdeI/BamHI fragment harboring the coding region of argR; Kmr study r pBBR1MCS-5 with a translational lipA’-‘lacZ fusion; Gm [14] r pBBR1MCS-5 with a transcriptional lipA-lacZ fusion; Gm [14] pJQ200SK with a transcriptional lipA-lacZ fusion; Gmr [14] pJQ200SK with a transcriptional lacZ fusion; Gmr This study pJQ200SK with a transcriptional ArgR-BS-lacZ fusion; Gmr This study r pJQ200SK with a transcriptional ArgR-MBS-lacZ fusion; Gm This study
pBBR-lacZ
pBBR1MCS-5 with a transcriptional lacZ fusion; Gmr
pBBR-ArgR-BS-lacZ
pBBR1MCS-5 with a transcriptional ArgR-BS-lacZ fusion; Gmr
pBBR-ArgR-MBS-lacZ
pBBR1MCS-5 with a transcriptional ArgR-MBS-lacZ fusion; Gmr
Primers argRU-U-XbaI
5’-catctagaCCTGCTGAACAACGAAGAG-30
argRU-L-KpnI
50 -aaggtacCGAAAACAAGGTGAGAAGC-30
argRD-U-KpnI
50 -atggtaccTGACCACCGACGAGATTG-30
argRD-L-BamHI
50 -ttggatccATCAGTTCCCGACCCG-30
argRF-HindIII
50 -ccaaagcttATGACTGCCCATCGAA-30
argRF-NdeI
50 -ctacatATGACTGCCCATCGAA-30
argRR-BamHI
50 -ctggatCCGCCTCTTACAATACG-30
lacZF-XhoI
50 -gaactcgagCGAAATACGGGCAGACAT-30
lacZR-BamHI
50 -cttggatccTTTCACACAGGAAACAGC-30
argR-BS-XbaI
50 -ctagGGTTTGTCGCCAAAGCGTCATGGGGGCTGA-30
argR-BS-BamHI
50 -gatcTCAGCCCCCATGACGCTTTGGCGACAAACC-30
argR-MBS-XbaI
50 -ctagGGTTaaaaaaCAAAGCGTCATGGGGGCTGA-30
argR-MBS-BamHI
50 -gatcTCAGCCCCCATGACGCTTTGttttttAACC-30
This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study
36
W. Ying et al. / Biochimie 167 (2019) 34e41
strains of P. protegens, the concentrations of ampicillin, gentamicin and kanamycin were respectively 100 mg/mL, 50 mg/mL and 50 mg/ mL, and for the strains of E. coli, gentamicin and kanamycin were respectively 50 mg/mL and 50 mg/mL. PrimeSTAR Max DNA polymerase, restriction enzymes, T4 DNA ligase and T4 polynucleotide kinase were purchased from TaKaRa Biotechnology (Dalian) Co., Ltd. (Dalian, China). DNA gel extraction and plasmid preparation were performed according to the protocols of commercial kits (Omega Bio-Tek, Doraville, GA). Oligonucleotide primers and DNA sequencing were implemented by Wuhan Tianyi Huiyuan Bioscience and Technology Inc. (Wuhan, China). Standard methods were used for all other routine manipulations [27].
2.3. Construction of strains According to a previously described method [12], the markerless deletion mutant Pf4516 of coding region of argR was constructed by a gene replacement system with pJQDargR through a doublecrossover recombination event, and Pf4516 colonies were confirmed through colony PCR and sequencing. All plasmids used in this study were introduced into the strains of P. protegens through biparental mating mediated by ET12567(pUZ8002) [23], while transformed into the competent cells of E. coli strains via the heat-shock method. 2.4. Lipase activity assay
2.2. Construction of plasmids 2.2.1. Construction of suicide plasmid pJQDargR The 682-bp upstream homologous arm argRU (bp 698 to 17 relative to the translational start site) and the 804-bp downstream homologous arm argRD (bp þ674 to þ1477 relative to the translational start site) of argR were amplified by PCR with primers argRU-U-XbaI/argRU-L-KpnI and argRD-U-KpnI/argRD-L-BamHI (Table 1), respectively. XbaI/KpnI digested argRU, KpnI/BamHI digested argRD and XbaI/BamHI digested suicide plasmid pJQ200SK (Table 1) were ligated using T4 DNA ligase, and then the ligation products were transformed into E. coli DH5a competent cells through the heat-shock method. Transformants were cultured on the LB plate with gentamicin and screened by colony PCR. Finally, the recombinant plasmids were isolated and sequenced, and the correct plasmid was designated as pJQDargR (Table 1). 2.2.2. Construction of expression plasmids The 1001-bp DNA fragment containing the argR coding region was obtained by PCR amplification using primers argRF-HindIII/ argRR-BamHI (Table 1), then digested with HindIII and BamHI, and cloned into the broad-host-range plasmid pBBR1MCS-5 (Table 1) to create the recombinant plasmid pBBR1MCS-argR (Table 1). Similarly, the 1001-bp DNA fragment with the argR coding region, amplified by PCR using primers argRF-NdeI/argRR-BamHI (Table 1), was cloned into the expression plasmid pET-28a (Table 1) to make the recombinant plasmid pET-argR (Table 1). 2.2.3. Construction of lacZ fusion plasmids The PCR fragment with a wild-type lacZ sequence and its own SD sequence (bp 19 to þ3109 relative to the start site of translation) were amplified from E. coli BL21(DE3) genomic DNA using primers lacZF-XhoI/lacZR-BamHI (Table 1). Next, this fragment was digested by XhoI and BamHI, and respectively cloned into pJQ200SK and pBBR1MCS-5 for creating the transcriptional fusion plasmid pJQ-lacZ and pBBR-lacZ (Table 1). The sense oligonucleotide argR-BS-XbaI and the antisense oligonucleotide argR-BS-BamHI (Table 1), containing the ArgR binding site of lipA promoter, were respectively diluted at 20 mM in nuclease-free water. Subsequently, the reaction, which included 4 mL argR-BS-XbaI, 4 mL argR-BS-BamHI, 1 mL 10 T4 ligation buffer and 1 mL T4 polynucleotide kinase, was prepared and run in the following program: 37 C for 30 min, 95 C for 5 min, then ramp to 25 C at a rate of 1 C/cycle. Lastly, these reaction products were respectively cloned into pJQ-lacZ and pBBR-lacZ to generate the recombinant plasmid pJQ-ArgR-BS-lacZ and pBBR-ArgR-BS-lacZ (Table 1). In the same way, the recombinant plasmid pJQ-ArgRMBS-lacZ and pBBR-ArgR-MBS-lacZ (Table 1) were constructed with the sense oligonucleotide argR-MBS-XbaI and the antisense oligonucleotide argR-MBS-BamHI (Table 1) including the mutant ArgR binding site of lipA promoter.
LipA has been proved to be an intracellular lipase [13], so its lipase activity was characterized by whole-cell lipase activity. Cultures of various P. protegens strains carrying pBBR1MCS-5 or pBBR1MCS-argR were inoculated in 50 mL LB broth with 50 mg/mL gentamicin and 0.1 mM isopropyl-b-D-thiogalactopyranoside (IPTG) inducing argR expression, and then they were grown at 28 Cfor 12 h. After that, whole-cell samples were prepared and their lipase activities on the substrate of p-nitrophenyl caprylate were determined in accordance with a previously described method [12]. One activity unit was defined as the amount of lipase needed to release 1 mmol of p-nitrophenol per minute by 1.0 mL samples with OD600 ¼ 1.0, and the activity was expressed as U/ mL$OD600. 2.5. b-galactosidase activity assay
b-galactosidase activities from the strains of P. protegens or E. coli with the different lacZ fusion plasmids cultivated in 50 mL LB broth with 50 mg/mL gentamicin on ο-nitrophenyl-b-D-galactopyranoside (ONPG) were measured according to the Miller method [28], normalized to the OD600 of the bacterial culture and expressed in Miller units. At the beginning of cultivation, 0.1 mM IPTG was added to cultures of E. coli strains carrying pET-28a or pET-argR in order to induce argR expression. To investigate the effect of arginine on lipA expression, the strains of P. protegens with a translational lipA’-‘lacZ fusion plasmid pBBR003 were grown in 50 mL M9 broth containing 50 mM Na2HPO4, 20 mM KH2PO4, 10 mM NaCl, 20 mM NH4Cl, 2 mM MgCl2, 0.1 mM CaCl2, and 2% olive oil emulsion (25 mL of olive oil and 75 mL of 2.0% polyvinyl alcohol solution), supplemented with 10 mM arginine when necessary. 2.6. Statistical analysis All experiments were implemented in triplicate, and statistical analysis was executed by SPSS program and results were expressed as the mean values ± SD. The one-way ANOVA followed by Dunnett's multiple comparison test was utilized to calculate the P values for statistical significance, and differences with a P value of <0.05 were considered statistically significant. 3. Results and discussion 3.1. ArgR inhibits lipA expression In P. aeruginosa PAO1, ArgR has been reported to repress the expression of extracellular lipase gene lipA at the transcriptional level [20], but so far, its molecular mechanism is still unknown. Here, to investigate the effect of ArgR on the expression of intracellular lipase gene lipA in P. protegens Pf-5 and clarify its molecular mechanism regulating lipA expression, the argR knockout mutant Pf4516 was constructed by a previously described method [12]. The
W. Ying et al. / Biochimie 167 (2019) 34e41
37
Fig. 1. ArgR negatively regulates lipA expression. (A) Effect of argR knockout on the expression of lipA’-‘lacZ translational fusion and the growth in different P. protegens strains. bgalactosidase activities (solid) and growth curve (open) were determined in the wild-type strain Pf-5 (squares) and the argR mutant Pf4516 (circles) at various time points. (B) Effect of argR overexpression on the relative whole-cell lipase activities of different P. protegens strains. Pf-5 MCS-5, Pf-5 with pBBR1MCS-5; Pf4516 MCS-5, Pf4516 with pBBR1MCS-5; Pf-5 MCS-argR, Pf-5 with pBBR1MCS-argR; Pf4516 MCS-argR, Pf4516 with pBBR1MCS-argR. **P < 0.01, ***P < 0.001, compared with control.
38
W. Ying et al. / Biochimie 167 (2019) 34e41
transcriptional lipA-lacZ fusions was investigated under backgrounds of Pf-5 and Pf4516. As displayed in Fig. 2, argR knockout significantly strengthened the expression of lipA’-‘lacZ and lipA-lacZ fusions, indicating that ArgR transcriptionally represses lipA expression, which is consistent with ArgR being a transcriptional regulator. Similarly, lipA transcription suppressed by ArgR has also been reported in PAO1 [20]. 3.3. ArgR represses lipA transcription through binding to the ArgR binding site of lipA promoter
Fig. 2. ArgR inhibits lipA transcription. b-galactosidase activities of lipA’-’lacZ translational fusion and lipA-lacZ transcriptional fusion in the wild-type strain Pf-5 and the argR mutant Pf4516 were detected at the stationary phase. *P < 0.05, compared with control.
influence of ArgR on lipA expression was examined via detecting bgalactosidase activities of lipA’-‘lacZ translational fusion. As displayed in Fig. 1A, argR knockout increased the b-galactosidase activities of lipA’-‘lacZ translational fusion at all stages of growth and displayed a significant increase of about 20% at maximum. However, it knockout did not change the expression kinetics of lipA’‘lacZ translational fusion, which exhibited sharp boost in the late exponential phase and peak in the stationary phase. In addition, its knockout did not affect the growth of Pf4516. In a word, these results demonstrate that ArgR depresses lipA expression, which has also been found for lipA expression in PAO1 [20]. To further explore the influence of argR overexpression on lipA expression under backgrounds of Pf-5 and Pf4516, argR overexpression in both Pf-5 and Pf4516 was implemented by expressing pBBR1MCS-argR with strains Pf-5 MCS-5 and Pf4516 MCS-5 as the controls, and then their whole-cell lipase activities were measured. As displayed in Fig. 1B, whole-cell lipase activities of Pf-5 and Pf4516 with pBBR1MCS-argR were lower than that of Pf-5 and Pf4516 with pBBR1MCS-5. Moreover, whole-cell lipase activity in Pf4516 MCS-argR was higher than that in Pf-5 MCS-argR but their difference was not significant. Similarly, Pf4516 MCS-5 displayed higher whole-cell lipase activity than Pf-5 MCS-5 and their difference was notable. These results indicated that argR overexpression made lipA expression not only restore to wild-type status but also further inhibition. In brief, ArgR suppresses lipA expression and then leads to the reduction of whole-cell lipase production.
3.2. ArgR regulates lipA expression at the transcriptional level ArgR which belongs to the AraC/XylS family of transcriptional regulator, serves as the repressor in arginine biosynthetic metabolism [20,22,29,30], which suggests that ArgR acts as a transcriptional regulator to control lipA expression in Pf-5. To test this hypothesis, the expression of translational lipA’-‘lacZ and
It has been reported that ArgR mediated transcriptional repression involves its binding to the promoter containing the ArgR binding site(s), whose consensus sequence is TGTCGCN8AAN5, thus exerting its inhibition on the gene transcription by steric hindrance. Among the consensus sequence, a common sequence, TGTCGC, is crucial for ArgR binding [22,29]. It is worth noting that the TGTCGCCAAAGCGTCATGGGG sequence comprised in lipA promoter highly matches the consensus sequence. To investigate the interaction between ArgR and lipA promoter in vivo, a lipA-lacZ transcriptional fusion plasmid pJQ004 was transformed into the competent cells of BL21(DE3) pET-28a and BL21(DE3) pET-argR, respectively, and their b-galactosidase activities were measured for observing the effect of ArgR on the expression of lipA-lacZ transcriptional fusion in E. coli. As displayed in Fig. 3A, ArgR significantly repressed the expression of lipA-lacZ transcriptional fusion, suggesting that lipA promoter bound by ArgR leads to the inhibition of lipA-lacZ transcriptional fusion expression. To further determine the binding of ArgR to lipA promoter mediated by its ArgR binding site, ArgR binding site-lacZ fusion plasmid pJQ-ArgR-BS-lacZ was respectively transformed into the competent cells of BL21(DE3) pET-28a and BL21(DE3) pET-argR. The results of their b-galactosidase activities demonstrated that the expression of ArgR-BS-lacZ transcriptional fusion was notably inhibited by ArgR (Fig. 3B), supporting that ArgR binds to lipA promoter via its ArgR binding site. Furthermore, the common sequence, TGTCGC, mutated into AAAAAA on ArgR binding site of lipA promoter cancelled the binding of ArgR and then completely relieved the suppression of ArgR on the expression of ArgR-MBSlacZ transcriptional fusion (Fig. 3B). As expected, the same result was also obtained in P. protegens (Fig. 3C). Therefore, from these results it can be concluded that ArgR binds to the ArgR binding site of lipA promoter and then inhibits lipA transcription by steric hindrance, in which the common sequence, TGTCGC, contained in the ArgR binding site is decisive for the binding of ArgR to lipA promoter. To an intuitive degree, the EMSA experiments may be the best choice to investigate the interaction. 3.4. Arginine suppresses lipA expression in both wild-type and argR mutant As we know, ArgR plays an important role in arginine metabolism [20,22]. Moreover, arginine has been reported to inhibit lipase production in P. fluorescens 32A [31] and P. aeruginosa PAO1 [20]. Notably, arginine was further found to repress lipA transcription in wild-type PAO1 while enhance lipA transcription in argR mutant PAO501 [20]. Therefore, b-galactosidase activities of translational lipA’-‘lacZ fusion in Pf-5 and Pf4516, cultivated in M9 broth with 10 mM arginine when necessary, were measured to inquire into the impact of arginine on lipA expression in both Pf-5 and Pf4516. As displayed in Fig. 4, arginine remarkably inhibited the expression of lipA’-‘lacZ translational fusion at all stages of growth in both Pf-5 and Pf4516, and arginine and ArgR synergistically repress the expression of lipA’-‘lacZ translational fusion, which means that arginine restrains lipA expression in both wild-
W. Ying et al. / Biochimie 167 (2019) 34e41
39
Fig. 3. ArgR binds to the ArgR binding site of lipA promoter. (A) ArgR represses the expression of lipA-lacZ transcriptional fusion in E. coli. (B) Inhibition of ArgR-BS-lacZ transcriptional fusion through ArgR is abolished by the mutation of ArgR binding site in E. coli. lacZ transcriptional fusion was inserted into the plasmid pJQ200SK. (C) Inhibition of ArgRBS-lacZ transcriptional fusion through ArgR is abolished by the mutation of ArgR binding site in P. protegens. lacZ transcriptional fusion was inserted into the plasmid pBBR1MCS-5. **P < 0.01, compared with control.
type and argR mutant, and exerts a synergistic inhibition on lipA expression when combined with ArgR. However, lipA expression, under background of argR mutant in P. aeruginosa PAO1, is induced by arginine [20]. These results in this study suggests that arginine inhibits lipA expression in a different way from ArgR with undiscovered molecular mechanism, and plays an unknown physiological significance in lipid metabolism. There are two possible explanations for the regulation of lipA expression by arginine: one is that the accumulation of metabolic intermediate(s) may cause
repression of lipase production [31], another is that the rare codon AGA may involve in regulation of regulator(s) inhibiting lipA expression [32].
4. Conclusions Here, our results demonstrated that ArgR, the arginineresponsive regulator protein, inhibited the transcription of intracellular lipase gene lipA in P. protegens Pf-5 through binding to the
40
W. Ying et al. / Biochimie 167 (2019) 34e41
Fig. 4. Arginine inhibits lipA expression in both wild-type and argR mutant. b-galactosidase activities of lipA’-’lacZ translational fusion in the wild-type strain Pf-5 (squares) and the argR mutant Pf4516 (circles) cultivated in M9 broth (solid) and M9 broth with 10 mM arginine (Arg) (open) were determined at various time points.
ArgR binding site of lipA promoter to generate steric hindrance, which is the first to notify the direct regulation of lipase gene expression by ArgR. In addition, arginine represses lipA expression in both wild-type Pf-5 and argR mutant Pf4516, and exhibits a synergistic inhibition on lipA expression when combined with ArgR. Conflict of interest None. Author contributions DMZ conceived and supervised the study; DMZ, HQS, BHZ, HQL and JYY designed experiments; DMZ, WY, XLW and LWY performed experiments; DMZ, WY, XLW and BHZ analyzed the data; DMZ and HQS wrote the manuscript; All authors made critical revisions of the manuscript and approved the final article. Declaration of interests The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Acknowledgements This work was supported by the National Natural Science Foundation of P. R. China (31760534) to Dai-ming Zha. References [1] C. Angkawidjaja, S. Kanaya, Family I.3 lipase: bacterial lipases secreted by the type I secretion system, Cell. Mol. Life Sci. 63 (2006) 2804e2817. [2] R. Gupta, N. Gupta, P. Rathi, Bacterial lipases: an overview of production, purification and biochemical properties, Appl. Microbiol. Biotechnol. 64
(2004) 763e781. [3] A. Gog, M. Roman, M. Tos¸a, C. Paizs, F.D. Irimie, Biodiesel production using enzymatic transesterification: current state and perspectives, Renew. Energy 39 (2012) 10e16. [4] A. Ghasemian, Z. Moradpour, Production of recombinant microbial thermostable lipases, in: New and Future Developments in Microbial Biotechnology and Bioengineering, Elsevier, 2019, pp. 133e150. [5] S. Javed, F. Azeem, S. Hussain, I. Rasul, M.H. Siddique, M. Riaz, M. Afzal, A. Kouser, H. Nadeem, Bacterial lipases: a review on purification and characterization, Prog. Biophys. Mol. Biol. 132 (2018) 23e34. [6] F. Xiao, Z. Li, L. Pan, Application of microbial lipase and its research progress, Progress Appl. Microbiol. (2017) 8e14. [7] P. Priyanka, Y. Tan, G.K. Kinsella, G.T. Henehan, B.J. Ryan, Solvent stable microbial lipases: current understanding and biotechnological applications, Biotechnol. Lett. (2018) 1e18. [8] J.L. Arpigny, K.E. Jaeger, Bacterial lipolytic enzymes: classification and properties, Biochem. J. 343 (1999) 177e183. [9] J. Krzeslak, G. Gerritse, R. van Merkerk, R.H. Cool, W.J. Quax, Lipase expression in Pseudomonas alcaligenes is under the control of a two-component regulatory system, Appl. Environ. Microbiol. 74 (2008) 1402e1411. [10] J.H. Lee, R.D. Ashby, D.S. Needleman, K.T. Lee, D.K. Solaiman, Cloning, sequencing, and characterization of lipase genes from a polyhydroxyalkanoate (PHA)-synthesizing Pseudomonas resinovorans, Appl. Microbiol. Biotechnol. 96 (2012) 993e1005. [11] P. Panizza, N. Syfantou, F.I. Pastor, S. Rodriguez, P. Diaz, Acidic lipase Lip I.3 from a Pseudomonas fluorescens-like strain displays unusual properties and shows activity on secondary alcohols, J. Appl. Microbiol. 114 (2013) 722e732. [12] D. Zha, L. Xu, H. Zhang, Y. Yan, Molecular identification of lipase LipA from Pseudomonas protegens Pf-5 and characterization of two whole-cell biocatalysts Pf-5 and Top10lipA, J. Microbiol. Biotechnol. 24 (2014) 619e628. [13] D. Zha, H. Zhang, H. Zhang, L. Xu, Y. Yan, N-terminal transmembrane domain of lipase LipA from Pseudomonas protegens Pf-5: a must for its efficient folding into an active conformation, Biochimie 105 (2014) 165e171. [14] D. Zha, L. Xu, H. Zhang, Y. Yan, The two-component GacS-GacA system activates lipA translation by RsmE but not RsmA in Pseudomonas protegens Pf-5, Appl. Environ. Microbiol. 21 (2014) 6627e6637. [15] M. Li, J. Yan, Y. Yan, The Pseudomonas transcriptional regulator AlgR controls LipA expression via the noncoding RNA RsmZ in Pseudomonas protegens Pf-5, Biochem. Biophys. Res. Commun. 1 (2017) 173e180. [16] W. Liu, M. Li, J. Yan, Y. Yan, The role of Hfq in regulation of lipA expression in Pseudomonas protegens Pf-5, Sci. Rep. 1 (2017) 10356. [17] W. Liu, M. Li, L. Jiao, P. Wang, Y. Yan, PmrA/PmrB two-component system regulation of lipA expression in Pseudomonas aeruginosa PAO1, Front. Microbiol. 8 (2018) 2690. [18] C. Reimmann, M. Beyeler, A. Latifi, H. Winteler, M. Foglino, A. Lazdunski, D. Haas, The global activator GacA of Pseudomonas aeruginosa PAO positively controls the production of the autoinducer N-butyryl-homoserine lactone and the formation of the virulence factors pyocyanin, cyanide, and lipase, Mol. Microbiol. 2 (1997) 309e319. [19] C.N. Mccarthy, R.G. Woods, I.R. Beacham, Regulation of the aprX-lipA operon of Pseudomonas fluorescens B52: differential regulation of the proximal and distal genes, encoding protease and lipase, by ompR-envZ, FEMS Microbiol. Lett. 2 (2004) 243e248. [20] Z. Yang, C.D. Lu, Functional genomics enables identification of genes of the arginine transaminase pathway in Pseudomonas aeruginosa, J. Bacteriol. 11 (2007) 3945e3953. [21] K.J. Hampel, A.E. Labauve, J.A. Meadows, L.F. Fitzsimmons, A.M. Nock, M.J. Wargo, Characterization of the GbdR regulon in Pseudomonas aeruginosa, J. Bacteriol. 196 (2014) 7e15. [22] S.M. Park, C.D. Lu, A.T. Abdelal, Purification and characterization of an arginine regulatory protein, ArgR, from Pseudomonas aeruginosa and its interactions with the control regions for the car, argF, and aru operons, J. Bacteriol. 17 (1997) 5309e5317. [23] D.J. MacNiel, J.L. Occi, K.M. Gewain, T. MacNeil, P.H. Gibbons, C.L. Ruby, S.J. Danis, Complex organisation of the Streptomyces avermitilis genes encoding the avermectin polyketide synthase, Gene 115 (1992) 119e125. [24] C.R. Howell, R.D. Stipanovic, Control of Rhizoctonia solani on cotton seedlings with Pseudomonas fluorescens and with an antibiotic produced by the bacterium, Phytopathology 69 (1979) 480e482. [25] J. Quandt, M.F. Hynes, Versatile suicide vectors which allow direct selection for gene replacement in gram-negative bacteria, Gene 127 (1993) 15e21. [26] M.E. Kovach, P.H. Elzer, D.S. Hill, G.T. Robertson, M.A. Farris, R.N. Roop, K.M. Peterson, Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes, Gene 166 (1995) 175e176. [27] J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: a Laboratory Manual, second ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. [28] J.H. Miller, A Short Course in Bacterial Genetics: a Laboratory Manual and Handbook for Escherichia coli and Related Bacteria, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1992. [29] C.D. Lu, Z. Yang, W. Li, Transcriptome analysis of the ArgR regulon in Pseudomonas aeruginosa, J. Bacteriol. 12 (2004) 3855e3861.
W. Ying et al. / Biochimie 167 (2019) 34e41 [30] C. Cheng, Z. Dong, X. Han, J. Sun, H. Wang, L. Jiang, Y. Yang, T. Ma, Z. Chen, J. Yu, W. Fang, H. Song, Listeria monocytogenes 10403S arginine repressor ArgR finely tunes arginine metabolism regulation under acidic conditions, Front. Microbiol. 8 (2017) 145. [31] L. Fernandez, C. San Jose, R.C. McKellar, Repression of Pseudomonas fluorescens
41
extracellular lipase secretion by arginine, J. Dairy Res. 1 (1990) 69e78. [32] Q. Yan, B. Philmus, C. Hesse, M. Kohen, J. H Chang, J.E. Loper, The rare codon AGA is involved in regulation of pyoluteorin biosynthesis in Pseudomonas protegens Pf-5, Front. Microbiol. 7 (2016) 497.
Contents lists available at ScienceDirect
Biochimie journal homepage: www.elsevier.com/locate/biochi
Research paper
ArgR directly inhibits lipA transcription in Pseudomonas protegens Pf-5 Wei Ying, Xing-lian Wang, Hong-qiu Shi, Li-wei Yan, Bing-huo Zhang, Han-quan Li, Jian-yuan Yang, Dai-ming Zha* School of Pharmacy and Life Sciences, Jiujiang University, Jiujiang, 332000, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 18 February 2019 Accepted 30 August 2019 Available online 3 September 2019
ArgR, a transcriptional regulator belonging to the AraC/XylS family, plays a key role in arginine metabolism regulation. ArgR has also been found to repress the transcription of a lipase gene, but its molecular mechanism is still unknown. In this study, we investigated the molecular mechanism acting on the expression of intracellular lipase gene lipA regulated by ArgR in Pseudomonas protegens Pf-5 through knockout and overexpression of argR, detection of DNA-protein interaction in vivo, determining wholecell lipase activities of various strains derived from Pf-5, and examining b-galactosidase activities of various lacZ fusions. The results demonstrated that ArgR inhibits lipA expression at the transcriptional level. Further results showed that the inhibition of lipA transcription by ArgR is mediated by binding to the ArgR binding site of lipA promoter to produce steric hindrance, in which the common sequence, TGTCGC is crucial for the ArgR binding. Besides, arginine inhibits lipA expression in both wild-type and argR mutant, and shows a synergistic inhibition on lipA expression when combined with ArgR. To the best of our knowledge, this is the first report on ArgR directly repressing the transcription of a lipase gene. © 2019 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Keywords: Pseudomonas Lipase gene ArgR Transcriptional regulation
1. Introduction Lipases (triacylglycerol acylhydrolase, EC. 3.1.1.3), being ubiquitous enzymes, are isolated from various plants, animals and microorganisms. They hydrolyze various esters formed from longchain fatty acids and glycerol in the oil-water interface. In addition, they also catalyze other reactions, such as esterification, transesterification, alcoholysis, and aminolysis in organic solvents [1e3]. On account of the versatility of lipases, they have been widely utilized in food, detergents, biodiesel, fine chemicals and waste treatment, etc. [4e7]. Among various sources of lipases, the most widely used are those from the genus Pseudomonas due to their outstanding properties [8e11]. Our previous studies have demonstrated that LipA from P. protegens Pf-5, proved to be an intracellular lipase, shows good stability under moderate temperatures, alkaline conditions, exhibits high activity in wide ranges of temperatures and pH values, and displays high resistance against heavy metal ions, surfactants and organic solvents [12,13]. In view of this, the regulatory
mechanisms of lipA expression have been studied in the past few years. It is reported that the global Gac/Rsm system mainly and directly enhances lipA translation via RsmE and indirectly activates lipA transcription by RsmA [14]. Furthermore, lipA expression is strengthened by an RNA-binding protein Hfq and two twocomponent systems AlgZ/R and PmrA/B all mediated through the Gac/Rsm system [15e17]. Besides, some factors, such as quorum sensing system [18], two-component systems LipQ/R and EnvZ/ OmpR [9,19], ArgR [20], and GbdR [21] have been reported to regulate the expression of other lipase genes, but their molecular mechanisms have not been elucidated yet. ArgR, being a transcriptional regulator of the AraC/XylS family, plays a key part in controlling the expression of certain biosynthetic and catabolic arginine genes [20,22]. In P. aeruginosa, ArgR was found to inhibit the transcription of extracellular lipase gene lipA with an unknown mechanism [20]. In this study, we confirmed for the first time that ArgR directly repressed lipA transcription in P. protegens Pf-5 via its binding to the ArgR binding site of lipA promoter to generate steric hindrance through knockout and
* Corresponding author. E-mail address: [email protected] (D.-m. Zha). https://doi.org/10.1016/j.biochi.2019.08.018 0300-9084/© 2019 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
W. Ying et al. / Biochimie 167 (2019) 34e41
overexpression of argR, detection of DNA-protein interaction in vivo, determining whole-cell lipase activities of various strains derived from Pf-5, and examining b-galactosidase activities of various lacZ fusions. In addition, we also investigated the effect of arginine on lipA expression by detecting b-galactosidase activities of translational lipA’-‘lacZ fusion.
35
2. Materials and methods 2.1. Strains, plasmids, culture conditions and general methods Bacterial strains and plasmids utilized in this study were shown in Table 1. The strains of P. protegens (28 C) and E. coli (37 C) were cultured in liquid or solid (1.5% w/v agar) LB medium. For the
Table 1 Strains, plasmids and primers used in this study. Strain, plasmid and primer
Description
Strains E. coli DH5a BL21(DE3) ET12567(pUZ8002) P. protegens Pf-5 Pf4516
Rhizosphere isolate; Apr Partial deletion mutation of argR in Pf-5; Apr
Plasmids pJQ200SK pJQDargR
Suicide vector with sacB counter-selectable marker used for homologous recombination; Gmr pJQ200SK carrying a 1486-bp XbaI/BamHI insert with a partial deletion in the coding region of argR; Gmr
pBBR1MCS-5 pBBR1MCS-argR pET-28a pET-argR pBBR003 pBBR004 pJQ004 pJQ-lacZ pJQ-ArgR-BS-lacZ pJQ-ArgR-MBS-lacZ
Source
F, 4 80dlacZ DM15, D(lacZYA-argF)U169, deoR, recA1, endA1, hsdR17 (rK-, mKþ), phoA, supE44, l-, thi-1, gyrA96, relA1, used for cloning TaKaRa F, ompT hsdSB(rB-, mB-) dcm gal(DE3), used for expression TaKaRa dam-13TTn9 dcm-6 hsdM cmlR, kanR, used for biparental mating [23] [24] This study
[25] This study r Broad-host-range vector; Gm [26] r pBBR1MCS-5 with a 1001-bp HindIII/BamHI fragment harboring the coding region of argR; Gm This study Expression vector carrying an N-terminal His-Tag/thrombin/T7-Tag configuration plus an optional C-terminal His-Tag sequence; Novagen Kmr This pET-28a carrying a 1001-bp NdeI/BamHI fragment harboring the coding region of argR; Kmr study r pBBR1MCS-5 with a translational lipA’-‘lacZ fusion; Gm [14] r pBBR1MCS-5 with a transcriptional lipA-lacZ fusion; Gm [14] pJQ200SK with a transcriptional lipA-lacZ fusion; Gmr [14] pJQ200SK with a transcriptional lacZ fusion; Gmr This study pJQ200SK with a transcriptional ArgR-BS-lacZ fusion; Gmr This study r pJQ200SK with a transcriptional ArgR-MBS-lacZ fusion; Gm This study
pBBR-lacZ
pBBR1MCS-5 with a transcriptional lacZ fusion; Gmr
pBBR-ArgR-BS-lacZ
pBBR1MCS-5 with a transcriptional ArgR-BS-lacZ fusion; Gmr
pBBR-ArgR-MBS-lacZ
pBBR1MCS-5 with a transcriptional ArgR-MBS-lacZ fusion; Gmr
Primers argRU-U-XbaI
5’-catctagaCCTGCTGAACAACGAAGAG-30
argRU-L-KpnI
50 -aaggtacCGAAAACAAGGTGAGAAGC-30
argRD-U-KpnI
50 -atggtaccTGACCACCGACGAGATTG-30
argRD-L-BamHI
50 -ttggatccATCAGTTCCCGACCCG-30
argRF-HindIII
50 -ccaaagcttATGACTGCCCATCGAA-30
argRF-NdeI
50 -ctacatATGACTGCCCATCGAA-30
argRR-BamHI
50 -ctggatCCGCCTCTTACAATACG-30
lacZF-XhoI
50 -gaactcgagCGAAATACGGGCAGACAT-30
lacZR-BamHI
50 -cttggatccTTTCACACAGGAAACAGC-30
argR-BS-XbaI
50 -ctagGGTTTGTCGCCAAAGCGTCATGGGGGCTGA-30
argR-BS-BamHI
50 -gatcTCAGCCCCCATGACGCTTTGGCGACAAACC-30
argR-MBS-XbaI
50 -ctagGGTTaaaaaaCAAAGCGTCATGGGGGCTGA-30
argR-MBS-BamHI
50 -gatcTCAGCCCCCATGACGCTTTGttttttAACC-30
This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study This study
36
W. Ying et al. / Biochimie 167 (2019) 34e41
strains of P. protegens, the concentrations of ampicillin, gentamicin and kanamycin were respectively 100 mg/mL, 50 mg/mL and 50 mg/ mL, and for the strains of E. coli, gentamicin and kanamycin were respectively 50 mg/mL and 50 mg/mL. PrimeSTAR Max DNA polymerase, restriction enzymes, T4 DNA ligase and T4 polynucleotide kinase were purchased from TaKaRa Biotechnology (Dalian) Co., Ltd. (Dalian, China). DNA gel extraction and plasmid preparation were performed according to the protocols of commercial kits (Omega Bio-Tek, Doraville, GA). Oligonucleotide primers and DNA sequencing were implemented by Wuhan Tianyi Huiyuan Bioscience and Technology Inc. (Wuhan, China). Standard methods were used for all other routine manipulations [27].
2.3. Construction of strains According to a previously described method [12], the markerless deletion mutant Pf4516 of coding region of argR was constructed by a gene replacement system with pJQDargR through a doublecrossover recombination event, and Pf4516 colonies were confirmed through colony PCR and sequencing. All plasmids used in this study were introduced into the strains of P. protegens through biparental mating mediated by ET12567(pUZ8002) [23], while transformed into the competent cells of E. coli strains via the heat-shock method. 2.4. Lipase activity assay
2.2. Construction of plasmids 2.2.1. Construction of suicide plasmid pJQDargR The 682-bp upstream homologous arm argRU (bp 698 to 17 relative to the translational start site) and the 804-bp downstream homologous arm argRD (bp þ674 to þ1477 relative to the translational start site) of argR were amplified by PCR with primers argRU-U-XbaI/argRU-L-KpnI and argRD-U-KpnI/argRD-L-BamHI (Table 1), respectively. XbaI/KpnI digested argRU, KpnI/BamHI digested argRD and XbaI/BamHI digested suicide plasmid pJQ200SK (Table 1) were ligated using T4 DNA ligase, and then the ligation products were transformed into E. coli DH5a competent cells through the heat-shock method. Transformants were cultured on the LB plate with gentamicin and screened by colony PCR. Finally, the recombinant plasmids were isolated and sequenced, and the correct plasmid was designated as pJQDargR (Table 1). 2.2.2. Construction of expression plasmids The 1001-bp DNA fragment containing the argR coding region was obtained by PCR amplification using primers argRF-HindIII/ argRR-BamHI (Table 1), then digested with HindIII and BamHI, and cloned into the broad-host-range plasmid pBBR1MCS-5 (Table 1) to create the recombinant plasmid pBBR1MCS-argR (Table 1). Similarly, the 1001-bp DNA fragment with the argR coding region, amplified by PCR using primers argRF-NdeI/argRR-BamHI (Table 1), was cloned into the expression plasmid pET-28a (Table 1) to make the recombinant plasmid pET-argR (Table 1). 2.2.3. Construction of lacZ fusion plasmids The PCR fragment with a wild-type lacZ sequence and its own SD sequence (bp 19 to þ3109 relative to the start site of translation) were amplified from E. coli BL21(DE3) genomic DNA using primers lacZF-XhoI/lacZR-BamHI (Table 1). Next, this fragment was digested by XhoI and BamHI, and respectively cloned into pJQ200SK and pBBR1MCS-5 for creating the transcriptional fusion plasmid pJQ-lacZ and pBBR-lacZ (Table 1). The sense oligonucleotide argR-BS-XbaI and the antisense oligonucleotide argR-BS-BamHI (Table 1), containing the ArgR binding site of lipA promoter, were respectively diluted at 20 mM in nuclease-free water. Subsequently, the reaction, which included 4 mL argR-BS-XbaI, 4 mL argR-BS-BamHI, 1 mL 10 T4 ligation buffer and 1 mL T4 polynucleotide kinase, was prepared and run in the following program: 37 C for 30 min, 95 C for 5 min, then ramp to 25 C at a rate of 1 C/cycle. Lastly, these reaction products were respectively cloned into pJQ-lacZ and pBBR-lacZ to generate the recombinant plasmid pJQ-ArgR-BS-lacZ and pBBR-ArgR-BS-lacZ (Table 1). In the same way, the recombinant plasmid pJQ-ArgRMBS-lacZ and pBBR-ArgR-MBS-lacZ (Table 1) were constructed with the sense oligonucleotide argR-MBS-XbaI and the antisense oligonucleotide argR-MBS-BamHI (Table 1) including the mutant ArgR binding site of lipA promoter.
LipA has been proved to be an intracellular lipase [13], so its lipase activity was characterized by whole-cell lipase activity. Cultures of various P. protegens strains carrying pBBR1MCS-5 or pBBR1MCS-argR were inoculated in 50 mL LB broth with 50 mg/mL gentamicin and 0.1 mM isopropyl-b-D-thiogalactopyranoside (IPTG) inducing argR expression, and then they were grown at 28 Cfor 12 h. After that, whole-cell samples were prepared and their lipase activities on the substrate of p-nitrophenyl caprylate were determined in accordance with a previously described method [12]. One activity unit was defined as the amount of lipase needed to release 1 mmol of p-nitrophenol per minute by 1.0 mL samples with OD600 ¼ 1.0, and the activity was expressed as U/ mL$OD600. 2.5. b-galactosidase activity assay
b-galactosidase activities from the strains of P. protegens or E. coli with the different lacZ fusion plasmids cultivated in 50 mL LB broth with 50 mg/mL gentamicin on ο-nitrophenyl-b-D-galactopyranoside (ONPG) were measured according to the Miller method [28], normalized to the OD600 of the bacterial culture and expressed in Miller units. At the beginning of cultivation, 0.1 mM IPTG was added to cultures of E. coli strains carrying pET-28a or pET-argR in order to induce argR expression. To investigate the effect of arginine on lipA expression, the strains of P. protegens with a translational lipA’-‘lacZ fusion plasmid pBBR003 were grown in 50 mL M9 broth containing 50 mM Na2HPO4, 20 mM KH2PO4, 10 mM NaCl, 20 mM NH4Cl, 2 mM MgCl2, 0.1 mM CaCl2, and 2% olive oil emulsion (25 mL of olive oil and 75 mL of 2.0% polyvinyl alcohol solution), supplemented with 10 mM arginine when necessary. 2.6. Statistical analysis All experiments were implemented in triplicate, and statistical analysis was executed by SPSS program and results were expressed as the mean values ± SD. The one-way ANOVA followed by Dunnett's multiple comparison test was utilized to calculate the P values for statistical significance, and differences with a P value of <0.05 were considered statistically significant. 3. Results and discussion 3.1. ArgR inhibits lipA expression In P. aeruginosa PAO1, ArgR has been reported to repress the expression of extracellular lipase gene lipA at the transcriptional level [20], but so far, its molecular mechanism is still unknown. Here, to investigate the effect of ArgR on the expression of intracellular lipase gene lipA in P. protegens Pf-5 and clarify its molecular mechanism regulating lipA expression, the argR knockout mutant Pf4516 was constructed by a previously described method [12]. The
W. Ying et al. / Biochimie 167 (2019) 34e41
37
Fig. 1. ArgR negatively regulates lipA expression. (A) Effect of argR knockout on the expression of lipA’-‘lacZ translational fusion and the growth in different P. protegens strains. bgalactosidase activities (solid) and growth curve (open) were determined in the wild-type strain Pf-5 (squares) and the argR mutant Pf4516 (circles) at various time points. (B) Effect of argR overexpression on the relative whole-cell lipase activities of different P. protegens strains. Pf-5 MCS-5, Pf-5 with pBBR1MCS-5; Pf4516 MCS-5, Pf4516 with pBBR1MCS-5; Pf-5 MCS-argR, Pf-5 with pBBR1MCS-argR; Pf4516 MCS-argR, Pf4516 with pBBR1MCS-argR. **P < 0.01, ***P < 0.001, compared with control.
38
W. Ying et al. / Biochimie 167 (2019) 34e41
transcriptional lipA-lacZ fusions was investigated under backgrounds of Pf-5 and Pf4516. As displayed in Fig. 2, argR knockout significantly strengthened the expression of lipA’-‘lacZ and lipA-lacZ fusions, indicating that ArgR transcriptionally represses lipA expression, which is consistent with ArgR being a transcriptional regulator. Similarly, lipA transcription suppressed by ArgR has also been reported in PAO1 [20]. 3.3. ArgR represses lipA transcription through binding to the ArgR binding site of lipA promoter
Fig. 2. ArgR inhibits lipA transcription. b-galactosidase activities of lipA’-’lacZ translational fusion and lipA-lacZ transcriptional fusion in the wild-type strain Pf-5 and the argR mutant Pf4516 were detected at the stationary phase. *P < 0.05, compared with control.
influence of ArgR on lipA expression was examined via detecting bgalactosidase activities of lipA’-‘lacZ translational fusion. As displayed in Fig. 1A, argR knockout increased the b-galactosidase activities of lipA’-‘lacZ translational fusion at all stages of growth and displayed a significant increase of about 20% at maximum. However, it knockout did not change the expression kinetics of lipA’‘lacZ translational fusion, which exhibited sharp boost in the late exponential phase and peak in the stationary phase. In addition, its knockout did not affect the growth of Pf4516. In a word, these results demonstrate that ArgR depresses lipA expression, which has also been found for lipA expression in PAO1 [20]. To further explore the influence of argR overexpression on lipA expression under backgrounds of Pf-5 and Pf4516, argR overexpression in both Pf-5 and Pf4516 was implemented by expressing pBBR1MCS-argR with strains Pf-5 MCS-5 and Pf4516 MCS-5 as the controls, and then their whole-cell lipase activities were measured. As displayed in Fig. 1B, whole-cell lipase activities of Pf-5 and Pf4516 with pBBR1MCS-argR were lower than that of Pf-5 and Pf4516 with pBBR1MCS-5. Moreover, whole-cell lipase activity in Pf4516 MCS-argR was higher than that in Pf-5 MCS-argR but their difference was not significant. Similarly, Pf4516 MCS-5 displayed higher whole-cell lipase activity than Pf-5 MCS-5 and their difference was notable. These results indicated that argR overexpression made lipA expression not only restore to wild-type status but also further inhibition. In brief, ArgR suppresses lipA expression and then leads to the reduction of whole-cell lipase production.
3.2. ArgR regulates lipA expression at the transcriptional level ArgR which belongs to the AraC/XylS family of transcriptional regulator, serves as the repressor in arginine biosynthetic metabolism [20,22,29,30], which suggests that ArgR acts as a transcriptional regulator to control lipA expression in Pf-5. To test this hypothesis, the expression of translational lipA’-‘lacZ and
It has been reported that ArgR mediated transcriptional repression involves its binding to the promoter containing the ArgR binding site(s), whose consensus sequence is TGTCGCN8AAN5, thus exerting its inhibition on the gene transcription by steric hindrance. Among the consensus sequence, a common sequence, TGTCGC, is crucial for ArgR binding [22,29]. It is worth noting that the TGTCGCCAAAGCGTCATGGGG sequence comprised in lipA promoter highly matches the consensus sequence. To investigate the interaction between ArgR and lipA promoter in vivo, a lipA-lacZ transcriptional fusion plasmid pJQ004 was transformed into the competent cells of BL21(DE3) pET-28a and BL21(DE3) pET-argR, respectively, and their b-galactosidase activities were measured for observing the effect of ArgR on the expression of lipA-lacZ transcriptional fusion in E. coli. As displayed in Fig. 3A, ArgR significantly repressed the expression of lipA-lacZ transcriptional fusion, suggesting that lipA promoter bound by ArgR leads to the inhibition of lipA-lacZ transcriptional fusion expression. To further determine the binding of ArgR to lipA promoter mediated by its ArgR binding site, ArgR binding site-lacZ fusion plasmid pJQ-ArgR-BS-lacZ was respectively transformed into the competent cells of BL21(DE3) pET-28a and BL21(DE3) pET-argR. The results of their b-galactosidase activities demonstrated that the expression of ArgR-BS-lacZ transcriptional fusion was notably inhibited by ArgR (Fig. 3B), supporting that ArgR binds to lipA promoter via its ArgR binding site. Furthermore, the common sequence, TGTCGC, mutated into AAAAAA on ArgR binding site of lipA promoter cancelled the binding of ArgR and then completely relieved the suppression of ArgR on the expression of ArgR-MBSlacZ transcriptional fusion (Fig. 3B). As expected, the same result was also obtained in P. protegens (Fig. 3C). Therefore, from these results it can be concluded that ArgR binds to the ArgR binding site of lipA promoter and then inhibits lipA transcription by steric hindrance, in which the common sequence, TGTCGC, contained in the ArgR binding site is decisive for the binding of ArgR to lipA promoter. To an intuitive degree, the EMSA experiments may be the best choice to investigate the interaction. 3.4. Arginine suppresses lipA expression in both wild-type and argR mutant As we know, ArgR plays an important role in arginine metabolism [20,22]. Moreover, arginine has been reported to inhibit lipase production in P. fluorescens 32A [31] and P. aeruginosa PAO1 [20]. Notably, arginine was further found to repress lipA transcription in wild-type PAO1 while enhance lipA transcription in argR mutant PAO501 [20]. Therefore, b-galactosidase activities of translational lipA’-‘lacZ fusion in Pf-5 and Pf4516, cultivated in M9 broth with 10 mM arginine when necessary, were measured to inquire into the impact of arginine on lipA expression in both Pf-5 and Pf4516. As displayed in Fig. 4, arginine remarkably inhibited the expression of lipA’-‘lacZ translational fusion at all stages of growth in both Pf-5 and Pf4516, and arginine and ArgR synergistically repress the expression of lipA’-‘lacZ translational fusion, which means that arginine restrains lipA expression in both wild-
W. Ying et al. / Biochimie 167 (2019) 34e41
39
Fig. 3. ArgR binds to the ArgR binding site of lipA promoter. (A) ArgR represses the expression of lipA-lacZ transcriptional fusion in E. coli. (B) Inhibition of ArgR-BS-lacZ transcriptional fusion through ArgR is abolished by the mutation of ArgR binding site in E. coli. lacZ transcriptional fusion was inserted into the plasmid pJQ200SK. (C) Inhibition of ArgRBS-lacZ transcriptional fusion through ArgR is abolished by the mutation of ArgR binding site in P. protegens. lacZ transcriptional fusion was inserted into the plasmid pBBR1MCS-5. **P < 0.01, compared with control.
type and argR mutant, and exerts a synergistic inhibition on lipA expression when combined with ArgR. However, lipA expression, under background of argR mutant in P. aeruginosa PAO1, is induced by arginine [20]. These results in this study suggests that arginine inhibits lipA expression in a different way from ArgR with undiscovered molecular mechanism, and plays an unknown physiological significance in lipid metabolism. There are two possible explanations for the regulation of lipA expression by arginine: one is that the accumulation of metabolic intermediate(s) may cause
repression of lipase production [31], another is that the rare codon AGA may involve in regulation of regulator(s) inhibiting lipA expression [32].
4. Conclusions Here, our results demonstrated that ArgR, the arginineresponsive regulator protein, inhibited the transcription of intracellular lipase gene lipA in P. protegens Pf-5 through binding to the
40
W. Ying et al. / Biochimie 167 (2019) 34e41
Fig. 4. Arginine inhibits lipA expression in both wild-type and argR mutant. b-galactosidase activities of lipA’-’lacZ translational fusion in the wild-type strain Pf-5 (squares) and the argR mutant Pf4516 (circles) cultivated in M9 broth (solid) and M9 broth with 10 mM arginine (Arg) (open) were determined at various time points.
ArgR binding site of lipA promoter to generate steric hindrance, which is the first to notify the direct regulation of lipase gene expression by ArgR. In addition, arginine represses lipA expression in both wild-type Pf-5 and argR mutant Pf4516, and exhibits a synergistic inhibition on lipA expression when combined with ArgR. Conflict of interest None. Author contributions DMZ conceived and supervised the study; DMZ, HQS, BHZ, HQL and JYY designed experiments; DMZ, WY, XLW and LWY performed experiments; DMZ, WY, XLW and BHZ analyzed the data; DMZ and HQS wrote the manuscript; All authors made critical revisions of the manuscript and approved the final article. Declaration of interests The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Acknowledgements This work was supported by the National Natural Science Foundation of P. R. China (31760534) to Dai-ming Zha. References [1] C. Angkawidjaja, S. Kanaya, Family I.3 lipase: bacterial lipases secreted by the type I secretion system, Cell. Mol. Life Sci. 63 (2006) 2804e2817. [2] R. Gupta, N. Gupta, P. Rathi, Bacterial lipases: an overview of production, purification and biochemical properties, Appl. Microbiol. Biotechnol. 64
(2004) 763e781. [3] A. Gog, M. Roman, M. Tos¸a, C. Paizs, F.D. Irimie, Biodiesel production using enzymatic transesterification: current state and perspectives, Renew. Energy 39 (2012) 10e16. [4] A. Ghasemian, Z. Moradpour, Production of recombinant microbial thermostable lipases, in: New and Future Developments in Microbial Biotechnology and Bioengineering, Elsevier, 2019, pp. 133e150. [5] S. Javed, F. Azeem, S. Hussain, I. Rasul, M.H. Siddique, M. Riaz, M. Afzal, A. Kouser, H. Nadeem, Bacterial lipases: a review on purification and characterization, Prog. Biophys. Mol. Biol. 132 (2018) 23e34. [6] F. Xiao, Z. Li, L. Pan, Application of microbial lipase and its research progress, Progress Appl. Microbiol. (2017) 8e14. [7] P. Priyanka, Y. Tan, G.K. Kinsella, G.T. Henehan, B.J. Ryan, Solvent stable microbial lipases: current understanding and biotechnological applications, Biotechnol. Lett. (2018) 1e18. [8] J.L. Arpigny, K.E. Jaeger, Bacterial lipolytic enzymes: classification and properties, Biochem. J. 343 (1999) 177e183. [9] J. Krzeslak, G. Gerritse, R. van Merkerk, R.H. Cool, W.J. Quax, Lipase expression in Pseudomonas alcaligenes is under the control of a two-component regulatory system, Appl. Environ. Microbiol. 74 (2008) 1402e1411. [10] J.H. Lee, R.D. Ashby, D.S. Needleman, K.T. Lee, D.K. Solaiman, Cloning, sequencing, and characterization of lipase genes from a polyhydroxyalkanoate (PHA)-synthesizing Pseudomonas resinovorans, Appl. Microbiol. Biotechnol. 96 (2012) 993e1005. [11] P. Panizza, N. Syfantou, F.I. Pastor, S. Rodriguez, P. Diaz, Acidic lipase Lip I.3 from a Pseudomonas fluorescens-like strain displays unusual properties and shows activity on secondary alcohols, J. Appl. Microbiol. 114 (2013) 722e732. [12] D. Zha, L. Xu, H. Zhang, Y. Yan, Molecular identification of lipase LipA from Pseudomonas protegens Pf-5 and characterization of two whole-cell biocatalysts Pf-5 and Top10lipA, J. Microbiol. Biotechnol. 24 (2014) 619e628. [13] D. Zha, H. Zhang, H. Zhang, L. Xu, Y. Yan, N-terminal transmembrane domain of lipase LipA from Pseudomonas protegens Pf-5: a must for its efficient folding into an active conformation, Biochimie 105 (2014) 165e171. [14] D. Zha, L. Xu, H. Zhang, Y. Yan, The two-component GacS-GacA system activates lipA translation by RsmE but not RsmA in Pseudomonas protegens Pf-5, Appl. Environ. Microbiol. 21 (2014) 6627e6637. [15] M. Li, J. Yan, Y. Yan, The Pseudomonas transcriptional regulator AlgR controls LipA expression via the noncoding RNA RsmZ in Pseudomonas protegens Pf-5, Biochem. Biophys. Res. Commun. 1 (2017) 173e180. [16] W. Liu, M. Li, J. Yan, Y. Yan, The role of Hfq in regulation of lipA expression in Pseudomonas protegens Pf-5, Sci. Rep. 1 (2017) 10356. [17] W. Liu, M. Li, L. Jiao, P. Wang, Y. Yan, PmrA/PmrB two-component system regulation of lipA expression in Pseudomonas aeruginosa PAO1, Front. Microbiol. 8 (2018) 2690. [18] C. Reimmann, M. Beyeler, A. Latifi, H. Winteler, M. Foglino, A. Lazdunski, D. Haas, The global activator GacA of Pseudomonas aeruginosa PAO positively controls the production of the autoinducer N-butyryl-homoserine lactone and the formation of the virulence factors pyocyanin, cyanide, and lipase, Mol. Microbiol. 2 (1997) 309e319. [19] C.N. Mccarthy, R.G. Woods, I.R. Beacham, Regulation of the aprX-lipA operon of Pseudomonas fluorescens B52: differential regulation of the proximal and distal genes, encoding protease and lipase, by ompR-envZ, FEMS Microbiol. Lett. 2 (2004) 243e248. [20] Z. Yang, C.D. Lu, Functional genomics enables identification of genes of the arginine transaminase pathway in Pseudomonas aeruginosa, J. Bacteriol. 11 (2007) 3945e3953. [21] K.J. Hampel, A.E. Labauve, J.A. Meadows, L.F. Fitzsimmons, A.M. Nock, M.J. Wargo, Characterization of the GbdR regulon in Pseudomonas aeruginosa, J. Bacteriol. 196 (2014) 7e15. [22] S.M. Park, C.D. Lu, A.T. Abdelal, Purification and characterization of an arginine regulatory protein, ArgR, from Pseudomonas aeruginosa and its interactions with the control regions for the car, argF, and aru operons, J. Bacteriol. 17 (1997) 5309e5317. [23] D.J. MacNiel, J.L. Occi, K.M. Gewain, T. MacNeil, P.H. Gibbons, C.L. Ruby, S.J. Danis, Complex organisation of the Streptomyces avermitilis genes encoding the avermectin polyketide synthase, Gene 115 (1992) 119e125. [24] C.R. Howell, R.D. Stipanovic, Control of Rhizoctonia solani on cotton seedlings with Pseudomonas fluorescens and with an antibiotic produced by the bacterium, Phytopathology 69 (1979) 480e482. [25] J. Quandt, M.F. Hynes, Versatile suicide vectors which allow direct selection for gene replacement in gram-negative bacteria, Gene 127 (1993) 15e21. [26] M.E. Kovach, P.H. Elzer, D.S. Hill, G.T. Robertson, M.A. Farris, R.N. Roop, K.M. Peterson, Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes, Gene 166 (1995) 175e176. [27] J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: a Laboratory Manual, second ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. [28] J.H. Miller, A Short Course in Bacterial Genetics: a Laboratory Manual and Handbook for Escherichia coli and Related Bacteria, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1992. [29] C.D. Lu, Z. Yang, W. Li, Transcriptome analysis of the ArgR regulon in Pseudomonas aeruginosa, J. Bacteriol. 12 (2004) 3855e3861.
W. Ying et al. / Biochimie 167 (2019) 34e41 [30] C. Cheng, Z. Dong, X. Han, J. Sun, H. Wang, L. Jiang, Y. Yang, T. Ma, Z. Chen, J. Yu, W. Fang, H. Song, Listeria monocytogenes 10403S arginine repressor ArgR finely tunes arginine metabolism regulation under acidic conditions, Front. Microbiol. 8 (2017) 145. [31] L. Fernandez, C. San Jose, R.C. McKellar, Repression of Pseudomonas fluorescens
41
extracellular lipase secretion by arginine, J. Dairy Res. 1 (1990) 69e78. [32] Q. Yan, B. Philmus, C. Hesse, M. Kohen, J. H Chang, J.E. Loper, The rare codon AGA is involved in regulation of pyoluteorin biosynthesis in Pseudomonas protegens Pf-5, Front. Microbiol. 7 (2016) 497.