Arsenate induces the expression of fungal genes involved in As transport in arbuscular mycorrhiza

f u n g a l b i o l o g y 1 1 5 ( 2 0 1 1 ) 1 1 9 7 e1 2 0 9

journal homepage: www.elsevier.com/locate/funbio

Arsenate induces the expression of fungal genes involved in As transport in arbuscular mycorrhiza a

Ma. del Carmen A. GONZALEZ-CH AVEZ , Mar
ıa del Pilar ORTEGA-LARROCEAb, a c,1

, Melina LOPEZ-MEYER , Rogelio CARRILLO-GONZALEZ d e,2
Beatriz XOCONOSTLE-CAZARES , Susana K. GOMEZ , Maria J. HARRISONe, c
, Ignacio E. MALDONADO-MENDOZAc,* Alejandro Miguel FIGUEROA-LOPEZ

Programa de Edafolog
ıa, Instituto de Recursos Naturales, Colegio de Postgraduados en Ciencias Agr
ıcolas, Campus Montecillo, Carretera M
exico-Texcoco Km 36.5, Texcoco, M
exico 56230, Mexico b Departamento de Edafolog
ıa, Instituto de Geolog
ıa, Universidad Nacional Aut
onoma de M
exico, Circuito Exterior s.n, Ciudad Universitaria 04510, Ciudad de M
exico, DF, Mexico c Departamento de Biotecnolog
ıa Agr
ıcola, Instituto Polit
ecnico Nacional, Centro Interdisciplinario de Investigaci
on para el Desarrollo
tiz Paredes No. 250, Guasave, Sinaloa 81101, Mexico Integral Regional-IPN Unidad Sinaloa, Blvd. Juan de Dios Ba d Departmento de Biotecnolog
ıa y Bioingenier
ıa, Centro de Investigaci
on y de Estudios Avanzados del Instituto Polit
ecnico Nacional, Av. IPN 2508, Zacatenco 07360, Ciudad de M
exico, DF, M
exico e Boyce Thompson Institute for Plant Research, Tower Road, Ithaca, NY 14853-1801, USA a

article info

abstract

Article history:

We utilized the two-compartment system to study the effect of arsenic (As) on the expression

Received 24 May 2011

of the Glomus intraradices high-affinity phosphate transporter GiPT, and the GiArsA gene,

Received in revised form

a novel protein with a possible putative role as part of an arsenite efflux pump and similar

18 August 2011

to ArsA ATPase. Our results show that induction of GiPT expression correlates with As(V)

Accepted 19 August 2011

uptake in the extra-radical mycelium of G. intraradices. We showed a time-concerted induction

Available online 1 September 2011

of transcript levels first of GiPT, followed by GiArsA, as well as the location of gene expression

Corresponding Editor: Simon V. Avery

using laser microdissection of these two genes not only in the extra-radical mycelium but also in arbuscules. This work represents the first report showing the dissection of the molecular

Keywords:

players involved in arbuscular mycorrhizal fungus (AMF)-mediated As tolerance in plants,

Arsenate exclusion

and suggests that tolerance mediated by AMF may be caused by an As exclusion mechanism,

Arbuscular mycorrhizal fungus

where fungal structures such as the extra-radical mycelium and arbuscules may be playing an

tolerance to Arsenic

important role. Our results extend knowledge of the mechanisms underlying As efflux in

GiArsA gene

arbuscular mycorrhizal fungi and mechanisms related to As tolerance.

High-affinity Pi/As transporter

ª 2011 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Introduction Arbuscular mycorrhizal fungi (AMFs) are the most widespread beneficial fungi that colonize roots of plants in all soil systems

(Smith & Read 2008). The importance of the resultant symbiosis is highly recognized in natural ecosystems and agroecosytems because of the several benefits of AMF to the plantesoil system. In metal (loid) polluted soils, many plant species

* Corresponding author. Tel./fax: þ52 (687) 8729626/25x87652. E-mail address: [email protected] 1 Tel./fax: þ52 (687) 8729626/25x87652. 2 Present address: The University of Texas at Tyler, Department of Biology, 3900 University Blvd, Tyler, TX 75799, USA. 1878-6146/$ e see front matter ª 2011 British Mycological Society. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.funbio.2011.08.005

1198

adapted to grow on these sites are colonized by these fungi possibly playing a central role in ameliorating toxicity of these pollutants (Pawlowska et al. 1996; Orlowska et al. 2002; Chen
lez-Cha
vez et al. 2009; et al. 2005; Zarei et al. 2008; Gonza Ortega-Larrocea et al. 2010). Some authors have suggested that populations of AMF are the key factor in soil development and successful plant establishment in these sites (Shetty et al.
lez-Cha
vez et al. 2009). Since 1994; Khan et al. 2000; Gonza AMFs have a predominant role in acquiring phosphate during mycorrhizal associations and arsenate is a chemical analogue, it might result paradoxical that while AMFs may potentially enhance arsenate uptake they also may help to achieve arse
lez-Cha
vez et al. 2002; nate tolerance to the plant host (Gonza Smith et al. 2010). Arsenic (As), despite its toxicity, is readily used by a great diversity of prokaryotes for cell growth and metabolism. Stolz et al. (2006) pointed out that the basic processes of microbial arsenic transformation include methylation, demethylation, oxidation, and reduction. As uptake as arsenate can be fatal to non-resistant plants, by ultimately disrupting ATP formation (Ullrich-Eberius et al. 1989), and arsenite reacts with sulphydril groups of enzymes and proteins. Research on AMFeAs interactions has increased rapidly since the first publication at the beginning of this decade
lez-Cha
vez et al. 2002). However, investigation has (Gonza been mainly focused on the effect of As on the growth of mycorrhizal plants compared with non-mycorrhizal plants, its effects on fungal colonization and AMF-decreased As plant accumulation (Ahmed et al. 2006; Leung et al. 2006; Xia et al. 2007; Chen et al. 2007a, b; Bai et al. 2008; Dong et al. 2008; Jankong & Visoottiviseth 2008; reviewed in Smith et al. 2010). Mycorrhizal association has also been reported to stimulate As accumulation by the host (Liu et al. 2005a, b; Al Agely et al. 2005; Leung et al. 2006; Trotta et al. 2006) or to inhibit its effects (Knudson et al. 2003; Chen et al. 2006). The basic mechanisms on the protective effects of AMF on host plants to As, arsenate/phosphate uptake, and/or As detoxification are still unknown and more studies are needed (Meharg & Hartley-Whitaker 2002; Smith et al. 2010). Certain prokaryotes and eukaryotes are tolerant to As because they have developed detoxification mechanisms. After uptake of arsenate [As(V)] by phosphate transporters, the common detoxification pathway within the cell includes the reduction to arsenite [As(III)] by arsenate reductases, followed by exclusion or sequestration of As(III) (Reviewed by Rosen 2002a). In plant tissues, arsenic mainly enters as As(V) or As(III). Then, intracellular As(V) is reduced to As(III), which is either chelated by organic compounds, or deposited into vacuoles in this form. There is some evidence that As(V) uptake is mediated by phosphate transporters. Research using mutants in Arabidopsis thaliana showed that a double knockout Pht1; 1D4D mutant exhibited increased arsenate tolerance (up to 200 mM) compared to wild-type plants. The wild-type Pht1;1 and Pht1;4 are high-affinity transporters whose transcripts are highly expressed in roots. These results provide evidence that Pht1;1 and Pht1;4 mediate arsenate uptake in Arabidopsis (Shin et al. 2004). Reduction of arsenate followed by efflux of arsenite is an important active mechanism of arsenic tolerance employed by microorganisms (reviewed by Zhao & McGrath 2007). An As resistance mechanism found in S. cerevisiae is mediated by the products of three contiguous genes,


lez-ha
vez et al. Ma. del C. A. Gonza

ACR1 (encoding a transcriptional regulator), ACR2 (an arsenate reductase) and ACR3 (a plasma membrane arsenite efflux pump) (reviewed by Rosen 2002a). Arsenic resistance mechanisms involve overproduction of intracellular thiols and removal from the cytosol, usually by exclusion from the cell. In fungi, intercellular sequestration in the vacuole was also reported (Rosen 2002b; Rosen & Liu 2009). Another mechanism for As resistance in different fungi, such as Scopulariopsis brevicaulis, Candida humicola (Cullen & Reimer 1989), and Neosartorya fischeri (Cernansky et al. 2009) involves the methylation of inorganic arsenic to produce volatile derivatives. Branco et al. (2008) demonstrated a strategy for bacterial As resistance. Two operons were found in the same bacterial strain of Ochrobactrum tritici SCII24T: one provides resistance to As(III) and Sb, and the other to As(V). Meharg (2003) suggested that mycorrhizal fungi (MF) possess the same constitutive mechanisms found in other microorganisms in order to deal with As. For example, Sharples et al. (2000a, b) reported that the ericoid mycorrhizal fungus Hymenoscyphus ericae improved As resistance of Calluna vulgaris through an As exclusion mechanism. The fungus achieves arsenate resistance by reducing As(V) to As(III), and pumping As(III) out of the fungal cells. A similar mechanism has been hypothesized for AMF. In a study on arsenate resistance of
lez-Cha
vez et al. Holcus lanatus conferred by AMF, Gonza (2002) found that regardless of the plant host genotype for arsenate tolerance, all the AMF strains tested conferred additional As tolerance and they suggested that arsenate influx was reduced into H. lanatus plant roots by the suppression of high-affinity arsenate/phosphate transporters which decreased arsenate uptake. However, separate host and fungal participation in this mechanism could not be addressed in this work. In a more recent study Ultra et al. (2007) mentioned that AMF seemed to be involved in the transformation of inorganic As into less toxic organic forms which consequently led to decreased As uptake by sunflower plants. Enhanced resistance/tolerance to As mediated by AMF has been reported in the arsenic-hyperaccumulator fern Pteris vittata (Trotta et al. 2006; Chen et al. 2007a, b). Bona et al. (2010) found by proteomic analysis of the fern frond that hyperaccumulation could be linked to the up-accumulation of the porin PgPOR29 in response to As treatment in non-colonized plants and in Glomus mosseae-colonized plants. Another form of the PgPOR29 was up-regulated in both G. mosseae and Gigaspora margarita colonized plants by As treatment. This type of porin may confer As resistance in P. vittata by increased arsenic uptake or by arsenite efflux into the vacuole in the frond of this fern. The suppression of high-affinity P-transport have been previously demonstrated by Smith et al. (2003), who showed that P-transport in some mycorrhizal associations can be mediated through a mycorrhizal P-uptake pathway. In addition to these physiological studies, high-affinity phosphate transporter gene expression in roots has been shown to be negatively regulated in Medicago truncatula/Glomus versiforme mycorrhizal associations in response to AMF colonization (Liu et al. 1998; Chiou et al. 2001; Burleigh et al. 2002; Liu et al. 2008). A high-affinity phosphate transporter of Glomus intraradices (GiPT ) (recently renamed as Rhizophagus intraradices € ßler comb. (N.C. Schenck & G.S. Sm.) C. Walker & A. Schu

Arsenic transport mechanism in arbuscular mycorrhizal fungi

1199

€ ßler & Walker 2010) from the extra-radical mycenov.; Schu lium was studied using a two-compartment in vitro culture system (Maldonado-Mendoza et al. 2001). This study showed that micromolar levels of phosphate induce the high-affinity P-uptake system but it is irresponsive at phosphate millimolar levels. Vanadate, another chemical analogue of orthophosphate and arsenate induced the expression of the GiPT high-affinity phosphate transporter when added at micromolar concentrations similarly to phosphate addition. Based on this information our hypothesis is that arsenate, similarly to phosphate and vanadate, induces the expression of GiPT and the mechanism of P-uptake of the fungus which may, at the same time, affect arsenate uptake. The objectives of this research were: 1) to analyze the expression of the high-affinity phosphate transporter GiPT by arsenate and its relationship to As uptake; 2) to clone and analyze the expression of GiArsA gene, which may encode a putative arsenite efflux pump; 3) to analyze the GiPT and GiArsA transcripts in the extra-radical mycelium and in arbuscules. There is limited information on the molecular basis of the AM arsenate tolerance mechanism. Our data suggest that arsenate tolerance mediated by extra-radical hyphae of AMF may be caused by an As exclusion mechanism.

Materials and methods Experimental strategy Two-compartment plates of transformed carrot rootseGlomus intraradices arbuscular mycorrhizal cultures were used containing a plant/fungal compartment and a second fungal compartment (St-Arnaud et al. 1996). This plate system was modified according to Maldonado-Mendoza et al. (2001). The modification consisted in setting up the fungal compartment with liquid M medium instead of solid agar M medium. The plates were cultured until phosphate was depleted and undetectable levels of phosphate in the fungal compartment (0 mM Pi) were obtained. Once the plates were depleted from phosphate, new liquid medium was added to the fungal compartment with different arsenate/phosphate treatments as indicated in the sections below. Liquid medium was taken to measure the amount of phosphate/arsenate left in the medium, while fungal tissue was sampled at different times to conduct different arsenate/phosphate treatment experiments and doseeresponse experiments. In experiments in which different concentrations of arsenate/phosphate were used, three plates were sampled per point. In doseeresponse experiments, the fungal tissue was obtained from a single plate, and three plates total were analyzed. For each plate and time point a liquid medium aliquot (1/0.3 mL) was taken to measure arsenate/phosphate concentrations. Each individual experiment was conducted at least twice. Fungal tissue was processed to obtain total RNA, which was used to synthesize cDNA by reverse transcription. Transcript levels of two genes were measured by RT-PCR: 1) GiPT, which is involved in phosphate, and putatively in arsenate [As(V)] uptake, and 2) GiArsA, which is putatively involved in the efflux of arsenite [As(III)] (Fig 1A).

Fig 1 e Outline of the experimental strategy used in this work. A) Experiments performed using two-compartment plates containing hairy root carrot cultures colonized with G. intraradices. B) Experiments involving the use of AMF colonized Medicago truncatula roots.

Medicago truncatula plant roots colonized with Glomus versiforme or G. intraradices (37 days post-inoculation) were harvested. Root systems were collected to measure arbuscular mycorrhiza colonization after Trypan blue staining using the grid-intersect method (McGonigle et al. 1990). Sections of well-colonized MtGi roots were selected to conduct laser microdissection (LM) and harvest cortical cells with and without arbuscules (Gomez et al. 2009). Cortical cells were used to

1200

obtain cDNA and measure GiPT and GiArsA gene expression. Roots of both MtGv and MtGi plants were used to extract RNA and construct cDNA libraries. After screening of 500 000 pfus full-length ArsA cDNA clones were obtained from G. versiforme and only partial cDNA clones from G. intraradices. Phylogeny analysis was performed on GiArsA and GvArsA cDNA sequences and virtual modelling was performed on the full-length GvArsA cDNA clone (Fig 1B).


lez-ha
vez et al. Ma. del C. A. Gonza

No. BI246187) according to standard molecular biology procedures (Sambrook et al. 1989). Clone BI246187 was kindly donated by Dr Y. Schachar-Hill. A full-length cDNA clone of the GvArsA gene was obtained (GenBank accession No. JF830015). Several attempts were performed to obtain a fulllength cDNA from Glomus intraradices utilizing different M. truncatulaeG. intraradices cDNA libraries. Only partial cDNA clones were found. Virtual functional analysis was performed with the full-length cDNA clone of the GvArsA gene.

Transformed carrot rootseGlomus intraradices arbuscular mycorrhizal cultures

DNA sequencing and analysis

Plant material used in this study was hairy root cultured Dau
card & Piche
1992), while the AM fungal cus carota clone DC2 (Be species was G. intraradices (DAOM 181602; St-Arnaud et al. 1996). Glomus intraradices was established in culture with
card & Fortin transformed carrot roots as described by Be
card (1991). (1988) and Doner & Be The detailed procedure for plates set up is described in Maldonado-Mendoza et al. (2001). Briefly, two-compartment Petri dishes containing transformed carrot rooteG. intraradices arbuscular mycorrhiza were established. The plant compartment containing solid M medium (St-Arnaud et al. 1996) was inoculated with roots and 2 weeks later, they were inoculated with G. intraradices spores. At 3 weeks after inoculation, M liquid medium without sucrose was added to the second compartment. The plates were incubated in the darkness at 25  C. After 4 weeks, extra-radical hyphae developed around the roots in the first compartment and grew into the liquid media in the second compartment. At this stage, colonization of the roots was estimated by the modified grid-intersect method (McGonigle et al. 1990), and the average colonized root length was 56 %, with an average deviation from the mean of 10 %. At this point (10 weeks of culture), phosphate was depleted from the liquid and solid media (MaldonadoMendoza et al. 2001). Plates of this age and phosphate condition were used in all four experiments (see below).

The dideoxy sequencing method using the Taq Dye Deoxy terminator cycle sequencing kit (Applied Biosystems, Foster City, CA, USA) was utilized. An ABI373A automated DNA sequencer (Applied Biosystems) was used to process the sequencing reactions. Sequence comparisons were performed with GCG Wisconsin Package (Accelrys, San Diego, CA, USA) and Lasergene DNA Star (DNA STAR, Madison, WI, USA) alignment programs. Protein sequence multiple alignment, selection of amino acid substitution model and phylogenetic analysis were performed in MEGA 5 (Tamura et al. in press). The alignment was done with ClustalW (Thompson et al. 1994) using the BLOSUM matrix implemented in MEGA 5. Neighbour joining analysis (Saitou & Nei 1987) was performed using the JonesTaylor-Thornton model (JTT) (Jones et al. 1992), the frequencies of amino acids were estimated from the data set and rate heterogeneity across sites was modelled by four gamma rate categories. Statistical support was assessed by bootstrap test using 1000 replicates. BLAST-P analysis of GvArsA was performed in the NCBI web site (www.ncbi.nlm.nih.gov/ BLAST/) using the BLAST-P algorithm. Conserved domains of the protein were reported by the BLAST-P analysis through the conserved domain database (CDD) (Marchler-Bauer et al. 2011). Virtual modelling of GvArsA was performed by the TMpred program from ISREC-Server (www.isrec.isb-sib.ch/ software/TMPRED%20form.html).

Medicago truncatulaeGlomus versiforme pot cultures

Manipulation of the arsenate/phosphate concentrations surrounding the extra-radical hyphae

Medicago truncatula cv. A17 and G. versiforme (INVAM IT104) mycorrhiza were established in pot cultures, as described previously (van Buuren et al. 1999). Roots were harvested at 35 days post-inoculation and colonization levels assessed by the gridline intersect method (McGonigle et al. 1990). Samples used for LM and RT-PCR analysis showed between 60 % and 70 % root length colonized. For RT-PCR analysis, plants were harvested and the roots frozen at 80  C.

Cloning a full-length cDNA clone from GvArsA RNA was prepared from Medicago truncatulaeGlomus versiforme mycorrhizal roots at 35 days post-inoculation as described previously (Harrison & Dixon 1993). mRNA was prepared from total RNA via an Oligotex mRNA kit (Qiagen, Valencia, CA, U.S.A.). cDNA was prepared with the Uni-ZAP XR synthesis system (Stratagene, La Jolla, CA, U.S.A.) and cloned into the Lambda-ZAP II vector (Stratagene). The library was screened with a 32P-labelled probe corresponding to 527 bp at the 30 end coding region of the GiArsA gene (Genbank Accession

Plates containing extra-radical hyphae in the second compartment were established. The phosphate-depleted medium surrounding the extra-radical hyphae was then removed, and the hyphae rinsed twice with fresh M medium lacking phosphate. Phosphate/arsenate treatments were applied to the compartment containing the extra-radical mycelium in 15 mL of M media. In four experiments involving a series of treatments, the extra-radical mycelium was washed with M medium lacking phosphate or arsenate between treatments. The residual amounts of phosphate/arsenate after washing were taken into account before proceeding to the next treatment. The extra-radical hyphae were sampled by cutting small sections of hyphae with a small pair of scissors or scalpel and holding the rest of the hyphal network with a fine forceps to avoid separating the hyphal connection to the root system. Care was taken to minimize the disturbance to the system. Vital staining of fungal hyphae was carried out in all the experiments by nitro blue tetrazolium (NBT)-succinate test (Schaffer & Peterson 1993).

Arsenic transport mechanism in arbuscular mycorrhizal fungi

Experiments were performed twice using three biological replicates each time with similar results. Data sets from a single experiment are shown. The four different experiments carried out were: 1) Arsenate uptake and doseeresponse in the extra-radical hyphae in the in vitro monoxenic carroteGlomus intraradices (Gi) mycorrhizal cultures after 24 h of exposure to different arsenate concentrations (0e3500 mM) followed by detection of transcripts by RT-PCR in the extraradical hyphae of carroteG. intraradices mycorrhiza following arsenate treatments; 2) time course transcripts accumulation (0e24 h) under 35 mM arsenate/phosphate exposure; 3) detection of transcripts of the extra-radical hyphae of carrote G. intraradices mycorrhizas exposed to phosphate or arsenate in single (35 mM) and equimolar amounts (17.5 phosphate/ 17.5 arsenate [mM]).

Arsenate and phosphate measurements The phosphate-depleted liquid medium was removed and then replaced with new M liquid medium containing arsenate in concentrations from 0 to 3500 mM. The amount of arsenate taken by the fungus was measured indirectly by analyzing the amount of arsenate left in the medium after 24 h. Arsenate concentrations in liquid M medium were quantified using Induction Coupled Plasma Mass Spectrometry (ICPMS Agilent 7500ce) with direct calibration using In and Ge as internal standards for V and As, respectively. 51V and 75As were determined, making sure that the contribution of molecular species type 35Cl, 16O and 40Ar would not cause any interference with the measurements. A 1:1000 dilution in 2 % HNO3 was used to lower Cl concentration to a minimum and to avoid the formation of interfering molecular species. M medium samples required a supra-distilled high purity HNO3 digestion until any trace materials were eliminated, and another 1:200 dilution in 2 % HNO3 was also used. The phosphate content of the medium was measured in samples in which only phosphate was added before and after the addition of new medium and, at the time of harvest, with the use of a phosphomolybdate colorimetric reaction, according to Ames (1960). Doseeresponse and time course experiments were performed using triplicate plates and the experiments were repeated thrice showing consistency between replicates and experiments. Figures represent an independent experiment.

RT-PCR conditions RT-PCR analyses were carried out according to standard procedures. The primer sets used were as it follows. For GiPT: GiPTFor (50 GGTGTCGGTATTGGAGGAGA 30 ); and GiPT-Rev (50 GAGGACAGCGAAACCCATTA 30 ) (PCR product size of 750 bp); for GiArsA: GiArsA-For (50 GGGTATGATGGGATTGAACG 30 ); and GiArsA-Rev (50 TTCCGCGGGAATAATAGTTG 30 ) (PCR product size of 310 bp). Gi18SrRNA (GiITS4/GiITS5) (White et al. 1990), and GiGAPDH: GiGAPDH-For (50 GACGTCTCAGTTGTTGATTTA 30 ); GiGAPDH-Rev (50 TTTGGCATCAAAAATACTAGA 30 ) (PCR product size of 250 bp) were amplified as loading controls for each reverse transcription reaction. PCR conditions were as follows: a total of 30 PCR cycles were used for Gi18SrRNA and 35 for GiPT, GiArsA and GiGAPDH. Denaturation was performed at 95  C for 1 min, after an initial denaturation

1201

step of 3 min. Annealing temperature was 55  C and elongation temperature was 72  C with both steps performed for 1 min.

cDNA synthesis and PCR conditions for LM samples LM samples of mycorrhizal and non-mycorrhizal cortical cells from Medicago truncatula roots were obtained as reported by Gomez et al. (2009). For RT-PCR of the LM RNA samples, the cDNA was generated using gene-specific primers. 75 ng of RNA was mixed with 1 mL 10 mM dNTP mix and 0.25 mL of gene-specific forward primer (10 mM), and incubated at 65  C for 5 min. Moreover, we added 4 mL 5 first-strand buffer, 1 mL 0.1 M DTT, 10 Units of RNase OUT, 5 Units of SuperScript III reverse transcriptase and DEPC-treated autoclaved water up to 20 mL. cDNA synthesis was performed at 50  C for 2 h, followed by inactivation at 70  C for 15 min. Each 20 mL PCR reaction was carried out by using 5 mL of cDNA, 2 mL 10 PCR buffer, 0.4 mL 10 mM dNTP mix, 0.4 mL each primer (10 mM), 0.5 Units of Hot Start Taq DNA polymerase (Qiagen) and autoclaved water. In order to minimize non-specific priming during amplification, we used touchdown PCR as described by Don et al. (1991). The annealing step was carried out at 5  C above and 3  C below the primer’s melting temperature. The touchdown thermal profile consisted of a 15 min heat activation step at 95  C, followed by 10 cycles at 94  C for 30 s, a ramp of 0.8  C per cycle for 30 s, 72  C for 1 min. Additional 38 cycles at 94  C for 30 s, minimum annealing temperature for 30 s, 72  C for 1 min, and a final incubation at 72  C for 10 min. All the PCR products were visualized using 2 % TAE-agarose gels stained with ethidium bromide. Primers used to amplify GiPT were GiPT-ARB forward (50 TTTTAATCTTTGCCGCATGG 30 ) and GiPT-ARB reverse (50 TGCTTCCGCCTTTACTCTTT 30 ) (PCR product size of 136 bp). Primer set for GiArsA was GiArsA-ARB forward (50 TCGACATAAGATGCAACGAAA 30 ); and GiArsA-ARB reverse (50 CCAACATTTCCGAAAATTCC 30 ) (PCR product size of 148 bp). EF1-a was used as an internal standard loading control (Gomez et al. 2009).

Results Cloning of GvArsA A Glomus intraradices EST partial cDNA clone (BI246187) homologous to an arsenite translocating ATPase of Schizosaccharomyces pombe was identified from the NCBI Genbank EST accessions from germinating spores. With the aim of obtaining a full-length clone of this gene product, 500 000 pfus were screened from a cDNA library constructed from Glomus versiforme colonized Medicago truncatula roots (Liu et al. 2003) using the EST partial cDNA clone from G. intraradices as heterologous probe. Thirteen positive clones were selected for secondary screening and four clones were purified, re-screened, in vivo excised, and sequenced. Two of these clones were considered full length and shared the exactly same sequence. These clones contained an 1170 bp insert whose sequence shared 69 % identity at the nucleotide level with a 320 amino acid putative arsenite translocating ATPase (ArsA), from Cryptococcus neoformans var. neoformans B-3501A (Genbank accession number XM_767623.1). When GvArsA was compared at

1202

the protein level to the partial GiArsA encoded by the EST sequence the identity was 90 % and similarity was 94 % confirming the efficiency of the EST used as a probe to pull out the complete GvArsA cDNA clone. GvArsA is a 288 amino acids protein of approximately 32 kDa (Fig 2) belonging to the superfamily of Ras-like GTPase proteins. It consists of several families with an extremely high degree of structural and functional similarity. GvArsA is more closely related to the oxyanion-translocating ATPase (ArsA) members inside this superfamily (Fig 2). At the protein level the highest homology (85 %) shown was with similar proteins described as arsenite translocating ATPases from Moniliophthora perniciosa FA553 (Genbank accession number EEB92181.1), Coprinopsis cinerea Okayama 7#130 (Genbank accession number EAU93342.1), and Schizophyllum commune H4-8 (Genbank accession number EFI91613.1). BLAST-P search and CDD (Marchler-Bauer et al. 2011) matches showed its highest homology to putative ArsA ATPases. The presence in GvArsA of the conserved domains of an ATP-binding site (7 out of 7 conserved sites), a metal binding site (2 out of 2 conserved sites), and the dimerization interface (9 out of 14


lez-ha
vez et al. Ma. del C. A. Gonza

conserved sites), suggests that this protein behaves as an ArsA ATPase. GvArsA contains a putative trans-membrane domain which might anchor it to the cell membrane, and by virtual modelling (TMpred program from ISREC-Server) it is predicted to be a membrane anion transporting protein, with the N-terminus predicted to be facing the cytoplasm. BLAST-P analysis results showed the homology of GvArsA to a group of closely related proteins from different basidiomycetes. GvArsA showed the closest homology to the partial sequence encoded by GiArsA EST followed by several peptide sequences from basidiomycetes (71e79 % identity, 82e88 % similarity), followed by Caenorhabditis elegans ASNA-1 protein (54 % identity and 69 % similarity) and yeast Arr4 (GET complex ATPase subunit) protein (48 % identity and 67 % similarity). The homology of GvArsA to the well-characterized arsenite efflux pump from Escherichia coli ArsA ATPase is considered low compared to the eukaryotic ones (29 % identity; 46 % similarity at the protein level). A phylogenetic tree was constructed utilizing diverse ArsA ATPase peptide sequences (Fig 3). Sequences included the GvArsA cDNA, the EST sequence from G. intraradices, as well as close ArsA ATPases from basidiomycetes, C.

Fig 2 e Physical map of a full-length cDNA clone of G. versiforme arsenite efflux pump (GvArsA). First methionine (ATG in bold) indicates the site for translation initiation. Grey highlighted amino acid residues indicate possible S or T phosphorylation sites (Netphos 2.0). Bold underlined amino acid residues indicate a strong predicted trans-membrane domain with a preferred model having the N-terminus inside the cell as predicted by the TMpred software.

Arsenic transport mechanism in arbuscular mycorrhizal fungi

1203

Cryptococcus_neoformans_var._neoformans_JEC21 99.9% Cryptococcus_gattii_WM276 Puccinia_graminis_f._sp._tritici_CRL_75-36-700-3 GiArsA 97.8% GvArsA Schizophyllum_commune_H4-8 96.3% Coprinopsis_cinerea_okayama7130 94%

96.7% Laccaria_bicolor_S238N-H82 61.6% Moniliophthora_perniciosa_FA553

Malassezia_globosa_CBS_7966 99.6% Ustilago_maydis_521 Caenorhabditis_elegans 72.9%

Sclerotinia_sclerotiorum_1980 Schizosaccharomyces_japonicus_yFS275 Saccharomyces_cerevisiae_EC1118

Escherichia_coli_FVEC1412 0.2 Fig 3 e Phylogenetic tree analysis of GvArsA, GiArsA, basidiomycete sequences with the highest homology to GvArsA and sequences from functional ArsA ATPases described in E. coli, yeast and C. elegans.

elegans, yeast and E. coli. The tree showed that GvArsA branches together with the EST sequence from G. intraradices. The Glomeromycota ArsA ATPase branch showed closest homology to similar proteins from basidiomycetes and branched together in the phylogenetic tree. GvArsA is more closely related to C. elegans ArsA ATPase than to Ascomycetes including yeast. The more distant ArsA ATPases was the one from E. coli.

Arsenate uptake by the extra-radical hyphae in the in vitro monoxenic carroteGlomus intraradices mycorrhizal cultures M medium contained 35 mM phosphate and after 4 weeks of hyphal growth on the fungal side of a two-compartment plate system the phosphate was depleted. After measurements of phosphate levels left on the liquid medium, experiments were performed with the plates showing the complete absence of phosphate (0 mM Pi). The arsenate uptake in the extra-radical hyphae of carroteG. intraradices after 24 h exposure to different concentrations of arsenate was determined using a phosphate-depleted two-compartment system. When hyphae were maintained at 1e2 mM of arsenate, they achieved the complete disappearance of As in the external M medium without phosphate (Table 1). When hyphae were

kept at 20 and 35 mM As, about 26 % of total arsenate was used in each case (0.87 and 1.52 mg L1 d1). At 350 mM, 1 and 3.5 mM concentrations of arsenate present in the medium the uptake was 12, 3.8, and 1.6 % respectively (7.05, 6.43, and 9.49 mg L1 d1) (Table 1). Although the arsenate that disappears at 350 mM to 3.5 mM represents a low percentage (12e1.6 %), the amount in mg L1 taken up is higher at this concentration than at lower concentrations of arsenate ranging from 1 to 35 mM.

Transcript levels of GiPT and GiArsA in extra-radical hyphae of carroteGlomus intraradices mycorrhiza in response to arsenate exposure at different concentrations GiPT and GiArsA gene expression was analyzed in a doseeresponse experiment ranging from 1 to 35 mM of arsenate, and showed that the high-affinity phosphate transport system in the extra-radical hyphae was activated by As. High As concentrations in the medium (350 and 3500 mM) were also tested in a different experiment and gene expression was determined showing a continuous increase in transcript levels even at the highest As concentrations tested (Fig 4). No signs of toxicity in terms of NBT vital staining were


lez-ha
vez et al. Ma. del C. A. Gonza

1204

Table 1 e Arsenate uptake in extra-radical hyphae of carroteG. intraradices mycorrhizas following exposure to arsenate at different concentrations for 24 h. [Arsenate (mM) at 0 h] 1 2 5 10 20 35 350 1000 3500

[Arsenate (mM) at 24 h]  SD 0 0 0.52  4.84  14.8  26.0  308  962  3 444 

0.43 1.69 1.19 3.84 27.8 57.4 256.2

Percentage of uptake

Uptake (mg L1 d1)

100 100 89.6 51.6 25.8 25.8 12 3.8 1.6

0.17 0.34 0.75 0.87 0.87 1.52 7.07 6.42 9.42

SD ¼ standard deviation. Mean values are the result of an experiment made with three biological replicates.

exhibited by the fungal hyphae in the As experiments, nor the host plant (data not shown). Transcript accumulation was detected for GiPT at levels as low as 2 mM As (Fig 4). GiArsA showed induction of expression at concentrations of 5 mM. We also corroborated in this work that addition of another phosphate analogue, vanadate, at a concentration of 35 mM induced both GiPT and GiArsA (data not shown). GiArsA expressed under arsenate concentrations between 5 and 3 500 mM (Fig 4), which suggests that this gene is turned on when the fungal hyphae are actively taking up arsenate from the external medium.

Transcript accumulation of GiPT and GiArsA mRNAs shows a time-concerted accumulation The addition of 35 mM arsenate to phosphate-depleted hyphae as a control during a time course experiment that lasted 24 h caused the accumulation of both GiPT and GiArsA mRNAs (Fig 5). Transcript accumulation of GiPT started being detected at 3 h. Low levels of GiArsA mRNA were barely detected at 3 h, but transcripts were detected by 12 h suggesting an induction response over time.

Fig 5 e Time course experiment showing the response on transcript accumulation of the G. intraradices phosphate transporter gene (GiPT ) and the putative arsenite efflux pump (GiArsA) in extra-radical hyphae of carroteGlomus intraradices mycorrhizas following exposure to 35 mM arsenate.

was added at a concentration of 20 mM, nearly 74 % remained in the medium after 24 h (Table 1). In an experiment using equimolar amounts of phosphate and arsenate at a concentration close to 20 mM (17.5 mM each), the arsenate uptake occurred similarly as observed when it is alone, as 73 % of the arsenate remained in the medium (measured in the experiment shown on Fig 6). In order to learn about the effect of arsenate and phosphate on GiPT and GiArsA expression, these were analyzed at the mRNA level (Fig 5). GiPT and GiArsA gene expression was analyzed in extra-radical hyphae under phosphate (35 mM) or arsenate (35 mM) in the medium, as well as a mix of equimolar amounts of both molecules (17.5 mM each). GiPT and GiArsA transcripts accumulated after 24 h when either phosphate or arsenate was exclusively present in the medium. The presence of equimolar concentration of both molecules did not inhibit the expression of neither of these genes (Fig 6).

LM confirms that GiPT and GiArsA transcripts are present in arbuscules during the AM symbiosis The spatial gene expression of GiPT and GiArsA was investigated using LM in non-mycorrhizal and arbuscule-containing

GiPT and GiArsA transcript levels in response to equimolar amounts of phosphate and arsenate Chemical analogy of arsenate and phosphate might suggest competition for common transporters. When arsenate alone

Fig 4 e Transcript levels of the G. intraradices phosphate transporter gene (GiPT ) and the putative arsenite efflux pump (GiArsA) in extra-radical hyphae of carroteG. intraradices mycorrhizas following exposure to arsenate at different concentrations. Doseeresponse of arsenate from 0 to 3500 mM showing the induction of GiPT and GiArsA transcript accumulation.

Fig 6 e Arsenate uptake by extra-radical hyphae from the fungal compartment assay detects transcripts of the phosphate transporter gene from Glomus intraradices (GiPT ) in extra-radical hyphae of carroteG. intraradices mycorrhizas exposed to phosphate, arsenate or phosphate/arsenate 1:1. Extra-radical hyphae were sampled at 24 h following addition of phosphate or arsenate. CTL means control.

Arsenic transport mechanism in arbuscular mycorrhizal fungi

cortical cells in Medicago truncatula (Mt). This analysis showed that both GiPT and GiArsA genes were expressed in arbuscule-containing cells (Fig 7). Our LM data provide evidence that both GiPT and GiArsA transcripts accumulate in arbuscule-containing cells, in addition to extracellular hyphae (Figs 4e6).

Discussion Molecular analysis of GvArsA ATPase suggests that this protein might be involved in arsenite efflux in AMF The presence in GvArsA of conserved domains common to ArsA ATPases such as an ATP-binding site, a metal binding site, and the dimerization interface, suggests strongly that this protein may act as an ArsA ATPase. ArsA ATPases are involved in transport of As(III), Sb(III) or other oxyanions across biological membranes in all Kingdoms of life. The maintenance of a low intracellular concentration of oxyanion produces resistance to the toxic agents. ArsA ATPases are well studied in bacteria, in particular in Escherichia coli. Bacterial ArsA ATPase functions as an efflux pump located on the inner membrane of the cell. The pump is composed of two subunits, the catalytic ArsA subunit and the membrane subunit ArsB, which are encoded by the ArsA and ArsB genes, respectively. Arsenic efflux in bacteria is catalyzed by either ArsB alone or by ArsAB complex. The ATP-coupled pump, however, is more efficient. ArsA is composed of two homologous halves, A1 and A2, connected by a short linker to form a functional ATP-driven pump. It has been shown that ArsA interacts with chaperone ArsD. ArsA/ArsD seem to form an interface in their metal binding sites according to in silico docking and mutant analysis (Ye et al. 2010; Yang et al. 2011). This interaction increases the affinity of the ArsA ATPase to As(III) allowing As(III) channelling through ArsA ATPase. ArsA undergoes allosteric activation by its transport substrates. A divalent cation, typically Mg2þ, is required for its enzymatic activity. A comparison between GvArsA to the biochemically functional ArsA ATPase from E. coli shows a low degree of homology at the protein level (Fig 3), although the closest proteins to GvArsA belong to putative ArsA ATPases, a higher degree of

Fig 7 e Laser microdissection demonstrates that GiPT and GiArsA are only expressed in cortical cells when they contain arbuscules. CTL [ RT-PCR of cortical cells without arbuscules; Darb [ RT-PCR of cortical cells containing arbuscules. Lane numbers refer to three independent samples for each type of cells.

1205

homology is exhibited with Caenorhabditis elegans ASNA-1 protein which is the only eukaryotic homologue of ArsA ATPases that has been proven to act as a functional ArsA ATPase (Tseng et al. 2007). Alignment and phylogenetic analysis also showed conservation in the yeast Arr4 (GET complex ATPase subunit) protein. Arr4 gene disruption causes yeast to become more sensitive to As(III), As(V) and other metals (Shen et al. 2003). The homology at the protein level to ASNA-1, as well as to Arr4 (ArsA form yeast), together with the presence of the ATP-binding site, metal binding site and dimerization interface conserved domains in GvArsA support the idea that this protein functions as part of a Glomus versiforme efflux arsenite pump. The GvArsA gene exhibited the highest degree of conservation with GiArsA at the peptide level (94 % similarity), which makes possible to extrapolate the in silico analysis used with GvArsA to the GiArsA gene, characterized transcriptionally in the two-compartment plates.

An exclusion mechanism for arsenic in arbuscular mycorrhiza? The identification of a gene with high similarity to a putative As efflux pump suggests the presence of an arsenate transport mechanism in AMF which could involve uptake of As(V), followed by its reduction to As(III) and possibly efflux as such. The main findings in this work are that after the addition of 35 mM arsenate to a phosphate-depleted AM system, arsenate is taken up from the medium, which induces the accumulation of high-affinity phosphate transporter (GiPT ) transcript levels, and a putative arsenite efflux pump (GiArsA) expressed in the extra-radical hyphae of Glomus intraradices. Also, it was shown that the induction in a time course experiment of these two genes is concerted, GiPT is first induced and hours later GiArsA. These data allow us to propose a model for As transport mechanism (Fig 8), in which arsenate [As(V)] at concentrations 1e3 500 mM is taken by AMF hyphae using a similar mechanism to the one used by phosphate (Maldonado-Mendoza et al. 2001). At increasing arsenate concentrations (20e35 mM), uptake became less efficient (25.8 %) than the one reported for phosphate (>95 %) (Maldonado-Mendoza et al. 2001). When arsenate was present at 3 500 mM, the uptake was 1.6 % (Table 1), whereas using the same concentration of phosphate; the uptake was 17 % (Maldonado-Mendoza et al. 2001). It could be argued that the As transport system saturates at a lower concentration than the phosphate system, or that is not as efficient as phosphate at high concentrations. Since hyphae remained viable even at prolonged periods of time (up to 120 h) at 3.5 mM As (data not shown), a toxicity effect can be ruled out. It has been suggested that substantial amounts of arsenate taken up by the roots are influenced by AMF (Gonzaga et al. 2006), and that some As taken up from AMF hyphae may be transferred to the plant (Chen et al. 2007a). Our results demonstrate that extra-radical hyphae are able to uptake arsenate; however, the uptake is lower for As than for phosphate in about an order of magnitude when As or P is above 35 mM. We suggest that, when extra-radical hyphae encounters low levels (1e35 mM) of phosphate, arsenate, or vanadate in the soil, the high-affinity phosphate transporter might induce the same mechanism independently of the chemical analogue that is present. This transporter

1206

Fig 8 e Proposed model for arsenic transport mechanism on arbuscular mycorrhiza. When arsenate [As(V)] is present in the soil it can enter the AMF hypha via the high-affinity phosphate transporter (GiPT ). Once inside the hypha, As(V) is reduced to arsenite [As(III)] by a putative arsenate reductase (?) still unknown. As(III) is pumped out of the cell and back to the soil in order to avoid As toxicity via an arsenite efflux pump (GiArsA). A possible GiArsB (?) still not described, which would complement the dimeric GiArsAB ATPase efflux pump complex, is postulated to be located at the plasmalemma. Arsenite pumped out to the soil might be oxidized back to arsenate by the soil microorganisms or soil conditions which decreases its toxicity.

mechanism would induce its own expression in order to mobilize these chemicals into the hyphae. This hypothesis is supported by our observations on hypha-mediated arsenate uptake (Table 1), in which arsenate or phosphate uptake causes an induction on the high-affinity phosphate transporter (GiPT ) transcript levels. The pattern of GiPT expression obtained at concentrations up to 35 mM arsenate is in agreement with previous observations made either in the presence of phosphate or vanadate, both chemical analogues of arsenate (Maldonado-Mendoza et al. 2001). GiPT expression obtained at millimolar concentrations of arsenate were unexpected, since previous experiments indicated that the high-affinity phosphate transport system is shut down at mM concentrations of phosphate. This suggests that the low affinity system might be taking care of the phosphate uptake under these conditions (Maldonado-Mendoza et al. 2001). Since the high-affinity phosphate transporter (GiPT ) remained expressed at high arsenate concentrations (Fig 4), it is possible that the low affinity phosphate transporter system is not involved in arsenate transport and that all the arsenate that the fungal hyphae take up enter the cell via high-affinity transporters. Once As(V) is within the fungal hyphae we propose the existence of an arsenate reductase which reduces As(V) to As(III). We tried several procedures to amplify by RT-PCR, diverse conserved regions of arsenate reductases based on conserved or degenerate primers designed according to sequences from other fungi or yeast, without success. A yeast heterologous probe was also used to try to clone this gene using an MtGv cDNA library unsuccessfully. One possible


lez-ha
vez et al. Ma. del C. A. Gonza

explanation for these failures is that the arsenate reductase from AMF differs extensively in sequence to other reported sequences. This is one point which still needs to be further investigated in the future. Once arsenite (AsIII) is formed inside the hyphae, a membrane-bound protein denominated arsenite efflux pump (GiArsA/B) should take care of pumping out the arsenite to the surrounding medium, in order to avoid intracellular toxicity since this is a highly toxic form of arsenic. Induction of GiArsA gene (Fig 4) might represent a strategy used for AMF to avoid consequent toxic effects by As. Similar mechanisms of arsenate reduction to arsenite and its efflux to soil have been reported in tomato and rice (Xu et al. 2007). Arsenite in the soil might be oxidized back to arsenate by the soil microorganisms or soil conditions, which decreases its toxicity (Smith et al. 2010). This theoretical possibility has not yet been tested for AMF. Protein sequence similarity of GvArsA with GiArsA suggests that both genes encode for putative arsenite efflux pumps. GiArsA was studied in the two-compartment monoxenic system and its transcripts accumulated in a concerted way after the addition of arsenate and the induction of GiPT transcripts (Fig 5). Despite of its similarity to other putative arsenite efflux ATPases and its similarity to yeast and Caenorhabditis elegans ArsA ATPases, further evidence is needed to clearly demonstrate the GiArsA function in this mechanism, such as the biochemical confirmation of its activity as an arsenite efflux pump. Under this possible scenario the AMF may be acting as a sort of As avoidance mechanism for the plant host, and using the pumping of As(III) as an internal AMF detoxification mechanism. High-affinity fungal transporters GiPT (MaldonadoMendoza et al. 2001) and GvPT are expressed in the extracellular hyphae and in low levels in root tissue possibly due to the presence of internal hyphae (Harrison & van Buuren 1995). The high-affinity phosphate transporter from G. mosseae (GmosPT) has been shown to be located in cortical cells containing arbuscules (Balestrini et al. 2007), similarly to our observations with GiPT (Fig 7). GiArsA transcripts accumulate also in cortical cells containing arbuscules; however, the meaning of its location relative to its possible involvement in As transport still remains to be explained. Assuming that the GiArsA protein localization is in plasmalemma, like the bacterial ArsAB ATPase, it is possible to suggest that it may efflux arsenite to the periarbuscular space. Intracellular localization of GiArsA needs to be addressed in the future since it is confusing in eukaryotes. A GFP::Arr4 (yeast ArsA ATPase homologue) gene fusion resulted in the detection of Arr4 protein in the cytoplasm; however, under metal or heat stress the protein became membrane-bound and localized to punctate bodies resembling endosomes inside the cell (Shen et al. 2003). On the other hand, in C. elegans, cell fractionation studies showed that the ASNA-1 protein (ArsA ATPase) homologue is part of a cytosolic TMD (single trans-membrane domain) recognition complex (TRC) that targets tail-anchored proteins for insertion into the ER membrane (Stefanovic & Hegde 2007). Subsequent release from ASNA-1 and insertion into the membrane depends on ATP hydrolysis mediated by the ATPase activity of the ASNA-1 protein. Not only cell location of GiArsA, but also

Arsenic transport mechanism in arbuscular mycorrhizal fungi

its function still needs to be further investigated in eukaryotic organisms. Asna-1 gene from C. elegans has also been demonstrated to encode a functional ArsA ATPase whose activity is stimulated by As(III) and Sb(III) and is critical for As(III) and Sb(III) tolerance in the intact organism (Tseng et al. 2007). A combination of fungal and plant mechanisms in an arbuscular mycorrhiza might be regulating a specific transport system of arsenic in this symbiotic association, in addition to the arsenate uptake and putative exclusion mechanism discussed in this work.

Acknowledgements
mez-Flores for her technical assistance. This We thank L. Go project was supported by a competitive grant from the SEMARNAT-CONACyT Fund (SEMARNAT-2002-C01-0095) and Collaborative Research Grant Program Texas A&M-CONACyT
mez and (2009-021). We also thank M.Sc. R. Cervantes Ga K.Y. Leyva-Madrigal for technical assistance with RT-PCR and phylogenetic analysis, respectively. Dr J.P. Bernal helped with the ICP determinations. AMFL had a fellowship from CONACyT for his undergraduate studies and is currently a PIFI scholar from IPN.

references

Ahmed FRS, Killman K, Alexander I, 2006. Influences of arbuscular mycorrhizal fungus Glomus mosseae on growth and nutrition of lentil irrigated with arsenic contaminated water. Plant and Soil 258: 33e41. Al Agely AA, Sylvia DM, Ma LQ, 2005. Mycorrhizae increase arsenic uptake by the hyperaccumulator Chinese brake fern (Pteris vittata L.). Journal of Environmental Quality 34: 2181e2186. Ames BM, 1960. Phosphorus estimation. In: Elizabeth FN, Ginsburg V (eds), Methods in Enzymology, vol. 8. Academic Press, New York,, pp. 115e116. Bai J, Lin X, Yin R, Zhang H, Junhua W, Xueming C, Yongming L, 2008. The influence of arbuscular mycorrhizal fungi on As and P uptake by maize (Zea mays L.) from As-contaminated soils. Applied Soil Ecology 38: 137e145.
mez-Ariza J, Lanfranco L, Bonfante P, 2007. Laser Balestrini R, Go microdissection reveals that transcripts for five plant and one fungal phosphate transporter genes are contemporaneously present in arbusculated cells. Molecular PlanteMicrobe Interactions 20: 1055e1062.
card G, Fortin JA, 1988. Early events of vesicularearbuscular Be mycorrhiza formation on Ri T-DNA transformed roots. New Phytologist 108: 211e218.
card G, Piche
Y, 1992. Establishment of vesicular-arbuscular Be mycorrhiza in root organ culture: review and proposed methodology. In: Norris J, Read D, Varma A (eds), Techniques for the study of mycorrhiza. Academic Press, New York, pp. 89e108. Bona E, Cattaneo C, Cesaro P, Marsano F, Lingua G, Cavaletto M, Berta G, 2010. Proteomic analysis of Pteris vittata fronds: two arbuscular mycorrhizal fungi differentially modulate protein expression under arsenic contamination. Proteomics 10: 3811e3834. Branco R, Chung AP, Morais PV, 2008. Sequencing and expression of two arsenic resistance operons with different functions in

1207

the highly arsenic-resistant strain Ochrobactrum tritici SCII24T. BMC Microbiology 8: 95e106. van Buuren ML, Maldonado-Mendoza IE, Trieu AT, Blaylock LA, Harrison MJ, 1999. Novel genes induced during an arbuscular mycorrhizal (AM) symbiosis formed between Medicago truncatula and Glomus versiforme. Molecular PlanteMicrobe Interactions 12: 171e181. Burleigh SH, Cavagnaro TR, Jakobsen I, 2002. Functional diversity of arbuscular mycorrhizas extends to the expression of plant genes involved in P nutrition. Journal of Experimental Botany 53: 1593e1601. Cernansky S, Kolencik M, Sevc J, Urik M, Hiller E, 2009. Fungal volatilization of trivalent and pentavalent arsenic under laboratory conditions. Bioresource Technology 100: 1037e1040. Chen BD, Tang XY, Zhu YG, Christie P, 2005. Metal concentrations and mycorrhizal status of plants colonizing copper mining tailings: potential for revegetation. Science in China Series C: Life Sciences 48: 156e164. Chen BD, Zhu YG, Smith FA, 2006. Effects of arbuscular mycorrhizal inoculation on uranium and arsenic accumulation by Chinese brake fern (Pteris vittata L.) from a uranium miningimpacted soil. Chemosphere 62: 1464e1473. Chen BD, Xiao X, Zhu YG, Smith FA, Xie ZM, Smith SE, 2007a. The arbuscular mycorrhizal fungus Glomus mosseae gives contradictory effects on phosphorus and arsenic acquisition by Medicago sativa Linn. Science of the Total Environment 379: 226e234. Chen BD, Zhu Y-G, Duan J, Xiao XY, Smith SE, 2007b. Effects of the arbuscular mycorrhizal fungus Glomus mosseae on growth and metal uptake by four plant species in copper mine tailings. Environmental Pollution 147: 374e380. Chiou T-J, Liu H, Harrison MJ, 2001. The spatial expression patterns of a phosphate transporter (MtPT1) from Medicago trunculata indicate a role in phosphate transport at the root/soil interface. Plant Journal 25: 281e295. Cullen WR, Reimer KJ, 1989. Arsenic speciation in the environment. Chemical Reviews 89: 713e764. Don RH, Cox PT, Wainwright BJ, Baker K, Mattick JS, 1991. “Touchdown” PCR to circumvent spurious priming during gene amplification. Nucleic Acids Research 19: 4008.
card G, 1991. Solubilization of gellan gels by chelaDoner LW, Be tion of cations. Biotechnology Techniques 5: 25e29. Dong Y, Zhu Y-G, Smith FA, Wang Y, Chen B, 2008. Arbuscular mycorrhiza enhanced arsenic resistance of both white clover (Trifolium repens Linn.) and ryegrass (Lolium perenne L.) plants in an arsenic-contaminated soil. Environmental Pollution 155: 174e181. Gomez SK, Javot H, Deewatthanawong P, Torres-Jerez I, Tang Y, Blancaflor EB, Udvardi MK, Harrison MJ, 2009. Medicago truncatula and Glomus intraradices gene expression at the arbuscule-cortical cell interface in arbuscular mycorrhizal symbiosis. BMC Plant Biology 22: 9e10. Gonzaga MIS, Santos JAG, Ma LQ, 2006. Arsenic phytoextraction and hyperaccumulation by fern species. Scientia Agricola (Piracicaba, Brazil) 63: 90e101.
lez-Cha
vez MC, Carrillo-Gonzalez R, GutierrezGonza Castorena MC, 2009. Natural attenuation in a slag heap contaminated with cadmium: the role of plants and arbuscular mycorrhizal fungi. Journal of Hazardous Materials 161: 1288e1298.
lez-Cha
vez C, Harris PJ, Dodd J, Meharg AA, 2002. ArbusGonza cular mycorrhizal fungi confer enhanced arsenate resistance on Holcus lanatus. New Phytologist 155: 163e171. Harrison MJ, Dixon RA, 1993. Isoflavonoid accumulation and expression of defense gene transcripts during the establishment of vesicularearbuscular mycorrhizal associations in roots of Medicago truncatula. Molecular PlanteMicrobe Interactions 6: 643e654. Harrison MJ, van Buuren ML, 1995. A phosphate transporter from the mycorrhizal fungus Glomus versiforme. Nature 378: 626e629.

1208

Jankong P, Visoottiviseth P, 2008. Effects of arbuscular mycorrhizal inoculation on plants growing on arsenic contaminated soil. Chemosphere 72: 1092e1097. Jones DT, Taylor WR, Thornton JM, 1992. The rapid generation of mutation data matrices from protein sequences. Computer Applications in the Biosciences 8: 275e282. Khan AG, Kuck C, Chandhry TM, 2000. Role of plants, mycorrhizae and phytochelators in heavy metal contaminated land remediation. Chemosphere 41: 197e207. Knudson JA, Meikle T, DeLuca TH, 2003. Role of mycorrhizal fungi and phosphorus in the arsenic tolerance of Basin Wildrye. Journal of Environmental Quality 32: 2001e2006. Leung HM, Ye ZH, Wong MH, 2006. Interactions of mycorrhizal fungi with Pteris vittata (As hyperaccumulator) in Ascontaminated soils. Environmental Pollution 139: 1e8. Liu H, Blaylock L, Endre G, Chok J, Town CD, VandenBosch KA, Harrison MJ, 2003. Transcript profiling coupled with spatial expression analyses reveals genes involved in distinct developmental stages of the arbuscular mycorrhizal symbiosis. Plant Cell 15: 2106e2123. Liu H, Trieu AT, Blaylock LA, Harrison MJ, 1998. Cloning and characterization of two phosphate transporters from Medicago truncatula roots: regulation in response to phosphate and response to colonization by arbuscular mycorrhizal (AM) fungi. Molecular PlanteMicrobe Interactions 11: 14e22. Liu J, Versaw WK, Pumplin N, Gomez SK, Blaylock LA, Harrison MJ, 2008. Closely related members of the Medicago truncatula PHT1 phosphate transporter gene family encode phosphate transporters with distinct biochemical activities. Journal of Biological Chemistry 283: 24673e24681. Liu Y, Zhu YG, Chen BD, Christie P, Li XL, 2005a. Influence of the arbuscular mycorrhizal fungus Glomus mosseae on uptake of arsenate by the As hyperaccumulator fern Pteris vitata L. Mycorrhiza 15: 187e192. Liu Y, Zhu YG, Chen BD, Christie P, Li XL, 2005b. Yield and arsenate uptake of arbuscular mycorrhizal tomato colonized by Glomus mosseae BEG167 in As spiked soil under glasshouse conditions. Environment International 31: 867e873. Maldonado-Mendoza IE, Dewbre GR, Harrison MJ, 2001. A phosphate transporter gene from the extraradical mycelium of an arbuscular mycorrhizal fungus Glomus intraradices is regulated in response to phosphate in the environment. Molecular PlanteMicrobe Interactions 14: 1140e1148. Marchler-Bauer A, Lu S, Anderson JB, Chitsaz F, Derbyshire MK, DeWeese-Scott C, Fong JH, Geer LY, Geer RC, Gonzales NR, Gwadz M, Hurwitz DI, Jackson JD, Ke Z, Lanczycki CJ, Lu F, Marchler GH, Mullokandov M, Omelchenko MV, Robertson CL, Song JS, Thanki N, Yamashita RA, Zhang D, Zhang N, Zheng C, Bryant SH, 2011. CDD: a Conserved Domain Database for the functional annotation of proteins. Nucleic Acids Research 39(D): 225e229. McGonigle TP, Miller MH, Evans DG, Fairchild GL, Swan JA, 1990. A new method which gives an objective measure of colonization of roots by vesicularearbuscular mycorrhizal fungi. New Phytologist 115: 495e501. Meharg AA, Hartley-Whitaker J, 2002. Arsenic uptake and metabolism in arsenic resistant and nonresistant plant species. New Phytologist 154: 29e43. Meharg AA, 2003. The mechanistic basis of interactions between mycorrhizal associations and toxic metal cations. Mycological Research 107: 1253e1265. Orlowska E, Zubek S, Jurkiewicz A, Szarek-£ukaszewska G, Turnau K, 2002. Influence of restoration on arbuscular mycorrhiza of Biscutella laevigata L. (Brassicaceae) and Plantago lanceolata L. (Plantaginaceae) from calamine spoil mounds. Mycorrhiza 12: 153e160.
zares B, MaldonadoOrtega-Larrocea MP, Xoconostle-Ca
lez R, Herna
ndez-Herna
ndez J, Mendoza IE, Carrillo-Gonza


lez-ha
vez et al. Ma. del C. A. Gonza

~ o M, Lo
pez-Meyer M, Go
mez-Flores L, Gonza
lezD
ıaz Gardun
vez MC, 2010. Plant and fungal biodiversity from metal Cha mine wastes under remediation at Zimapan, Hidalgo, Mexico. Environmental Pollution 158: 1922e1931. € hling A, 1996. The mycorrhizal Pawlowska TE, Blaszkowski J, Ru status of plants colonizing a calamine spoil mound in southern Poland. Mycorrhiza 6: 499e505. Rosen BP, 2002a. Biochemistry of arsenic detoxification. FEBS Letters 529: 86e92. Rosen BP, 2002b. Transport and detoxification system for transition metals, heavy metals and metalloids in eukaryotic and prokaryotic microbes. Comparative Biochemistry and Physiology Part A 133: 689e693. Rosen BP, Liu Z, 2009. Transport pathways for arsenic and selenium: a minireview. Environment International 35: 512e515. Saitou N, Nei M, 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution 4: 406e425. Sambrook J, Fritsch EF, Maniatis TA, 1989. Molecular Cloning: a laboratory manual, 2nd edn. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Schaffer GF, Peterson RL, 1993. Modifications to clearing methods used in combination with vital staining of roots colonized with vesicularearbuscular mycorrhizal fungi. Mycorrhiza 4: 29e35. € ßler A, Walker C, 2010. The Glomeromycota. A species list with Schu new families and new genera. The Royal Botanic Garden Edinburgh, The Royal Botanic Garden Kew, Botanische Staatssammlung Munich, and Oregon State University. Sharples JM, Meharg AA, Chambers SM, Cairney JWG, 2000a. Symbiotic solution to arsenic contamination. Nature 404: 951e952. Sharples JM, Meharg AA, Chambers SM, Cairney JWG, 2000b. Mechanism of arsenate resistance in the ericoid mycorrhizal fungus Hymenoscyphus ericae. Plant Physiology 124: 1327e1334. Shen J, Hsu CM, Kang BK, Rosen BP, Bhattacharjee H, 2003. The Saccharomyces cerevisiae Arr4p is involved in metal and heat tolerance. BioMetals 16: 369e378. Shetty KG, Hetrick BAD, Figge DAH, Schwab AP, 1994. Effects on mycorrhizae and other soil microbes on revegetation of heavy metal contaminated mine spoil. Environmental Pollution 86: 181e188. Shin H, Shin H-S, Dewbre GR, Harrison MJ, 2004. Phosphate transport in Arabidopsis: Pht1;1 and Pht1;4 play a major role in phosphate acquisition from both low- and high-phosphate environments. Plant Journal 39: 629e642. Smith SE, Read DJ, 2008. Mycorrhizal Symbiosis, 3rd edn. Academic Press, Cambridge, UK. Smith SE, Christophersen HM, Pope S, Smith FA, 2010. Arsenic uptake and toxicity in plants: integrating mycorrhizal influences. Plant and Soil 327: 1e21. Smith SE, Smith FA, Jakobsen I, 2003. Mycorrhizal fungi can dominate phosphate supply to plants irrespective of growth responses. Plant Physiology 133: 16e20. St-Arnaud MC, Hamel C, Vimard B, Caron M, Fortin JA, 1996. Enhanced hyphal growth and spore production of the arbuscular mycorrhizal fungus Glomus intraradices in an in vitro system in the absence of host roots. Mycological Research 100: 328e332. Stefanovic S, Hegde RS, 2007. Identification of a targeting factor for posttranslational membrane protein insertion into the ER. Cell 128: 1147e1159. Stolz JF, Basu P, Santini JM, Oremland RS, 2006. Arsenic and selenium in microbial metabolism. Annual Review of Microbiology 60: 107e130. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S, 2011. MEGA5: Molecular Evolutionary Genetics Analysis using Maximum Likelihood, Evolutionary Distance, and Maximum Parsimony Methods. Molecular Biology and Evolution, in press,

Arsenic transport mechanism in arbuscular mycorrhizal fungi

doi:10.1093/molbev/msr121. [E-pub ahead of print August 18, 2011]. Thompson JD, Higgins DG, Gibson TJ, 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22: 4673e4680. Trotta A, Falaschi P, Cornara L, Minganti V, Fusconi A, Drava G, Berta G, 2006. Arbuscular mycorrhiza increases the arsenic translocation factor in the arsenic hyperaccumulating fern Pteris vittata. Chemosphere 65: 74e81. Tseng YY, Yu CW, Liao VHC, 2007. Caenorhabditis elegans expresses a functional ArsA. FEBS Journal 274: 2566e2572. Ullrich-Eberius CI, Sanz A, Novacky AJ, 1989. Evaluation of arsenate- and vanadate-associated changes of electrical membrane potential and phosphate transport in Lemna gibba L. Journal of Experimental Botany 40: 119e128. Ultra VUY, Tanaka S, Sakurai K, Iwasaki K, 2007. Arbuscular mycorrhizal fungus (Glomus aggregatum) influences biotransformation of arsenic in the rhizosphere of sunflower (Helianthus annus L.). Soil Science and Plant Nutrition 53: 499e508. White TJ, Bruns T, Lee S, Taylor JW, 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ (eds), PCR

1209

Protocols: a guide to methods and applications. Academic Press, Inc., New York, pp. 315e322. Xia YS, Chen BD, Christie P, Smith FA, Wang YS, Li XL, 2007. Arsenic uptake by arbuscular mycorrhizal maize (Zea mays L.) grown in an arsenic-contaminated soil with added phosphorus. Journal of Environment Sciences 19: 1245e1251. Xu XY, McGrath SP, Zhang FJ, 2007. Rapid reduction of arsenate in the medium mediated by plant roots. New Phytologist 176: 590e599. Yang J, Ajees AA, Salam A, Rosen BP, 2011. Genetic mapping of the interface between the ArsD metallochaperone and the ArsA ATPase. Molecular Microbiology 79: 872e881. Ye J, Ajees AA, Yang J, Rosen BP, 2010. The 1.4 A crystal structure of the ArsD arsenic metallochaperone provides insights into its interaction with the ArsA ATPase. Biochemistry 49: 5206e5212. € nig S, Hempel S, Khayam Nekouei M, Gh Savaghebi, Zarei M, Ko Buscot F, 2008. Community structure of arbuscular mycorrhizal fungi associated to Veronica rechingeri at the Anguran zinc and lead mining region. Environmental Pollution 156: 1277e1283. Zhao FJ, McGrath SP, 2007. Arsenic efflux. In: Arsenic: unraveling its metabolism and speciation in plants. 20th New Phytologist Symposium, Aberdeen, Scotland, UK. p. 10.