Arsenic, chromium and NaCl induced artemisinin biosynthesis in Artemisia annua L.: A valuable antimalarial plant

Ecotoxicology and Environmental Safety 98 (2013) 59–65

Contents lists available at ScienceDirect

Ecotoxicology and Environmental Safety journal homepage: www.elsevier.com/locate/ecoenv

Arsenic, chromium and NaCl induced artemisinin biosynthesis in Artemisia annua L.: A valuable antimalarial plant Shilpi Paul n, Kanika Shakya G.B. Pant Institute of Himalayan Environment and Development, Kosi-Katarmal, Almora 263643, Uttarakhand, India

art ic l e i nf o

a b s t r a c t

Article history: Received 21 March 2013 Received in revised form 19 September 2013 Accepted 20 September 2013 Available online 26 October 2013

Effect of As(III), Cr(VI) and NaCl on plant growth, antioxidant enzymes, SOD, TBRAS, protein, cDNA amplification of key genes of artemisinin pathway and artemisinin biosynthesis have been investigated to explore the actual changes in total herb and artemisinin yield in a crop cycle of Artemisia annua. Enhanced TBARS and SOD activity (4 U mg
1), decreased catalase activity and total cholorophyll content were observed under metal(loid) and NaCl stress. Accumulation of As (III; mg mg
1 DW) was higher in roots (10.75 7 0.00) than shoot (0.43 7 0.00) at 10 mg ml
1. While Cr(VI; mg ml
1 DW) accumulated more in shoots (37 7 9.6, 41.1 7 7.2 and 52.71 719.6). cDNA template of these treated plants along with control were amplified with HMGR, ADS and CYP71AV1 genes (artemisinin biosynthetic pathway genes); showed very low expression with Cr(VI) while As(III) (5 and 7.5 mg ml
1) showed higher expression than control. The results obtained from this study suggest that A. annua can grow well with favoring artemisinin biosynthesis with treatment of As(III) 5, 7.5 mg ml
1 and NaCl, while 10 mg ml
1 As(III) and all doses of Cr(VI) affect artemisinin synthesis. Finally some evidence also suggests that As(III), Cr(VI) and NaCl induces stress affects on total herb yield of plant. & 2013 Elsevier Inc. All rights reserved.

Keywords: Artemisia annua Artemisinin biosynthesis Heavy metals Oxidative stress Superoxide dismutase

1. Introduction Artemisinin (a sesqueterpene lactone containing natural endoperoxide), is an effective antimalarial drug extracted from leaves of Chinese medicinal herb Artemisia annua L. (Asteraceae; Lui et al., 1979). Because of increasing resistance of Plasmodium falciparum to traditional antimalarial drugs (quinine and chloroquine), artemisinin and its derivatives have become the most important agents in the treatment of cerebral malaria. It is a single drug which can be used against sensitive and resistance malaria particularly in the form of artemisinin-based combination therapies (ACTs). A. annua is the only source of artemisinin but low content (0.01–1.0 percent) of artemisinin makes it a relatively expensive drug and also received attention for enhancement by

Abbreviations: As(III), arsenic; Cr(VI), chromium; HNS, Hoagland's nutrient solution; NaCl, sodium choloride; TBARS, 2-thiobarbituric acid reactive substances; MDA, malondialdehyde; TCA, trichloroacetic acid; TBA, thiobarbituric acid; SOD, superoxide dismutase; NBT, nitroblue tetrazolium salt; HMGR, 3-hydroxy-3methylglutaryl-CoA reductase gene; ADS, amorpha-4, 11-diene synthase gene; CYP71AV1, amorpha-4, 11-diene 12-hydroxylase gene; DMRT, Duncan's multiple range test; DW, dry weight; FW, fresh weight n Correspondence to: Biotechnological Applications, G.B. Pant Institute of Himalayan Environment and Development, Kosi-Katarmal, Almora 263 643, Uttarakhand, India. Fax: þ 91 5962 241014, þ91 5962 241150. E-mail addresses: [email protected], [email protected] (S. Paul). 0147-6513/$ - see front matter & 2013 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.ecoenv.2013.09.025

using different breeding (Paul et al., 2010) and biotechnological tools. Artemisinin is also effective against a variety of other diseases, such as hepatitis B (Romero et al., 2005), parasites that cause schistosomiasis (Borrmann et al., 2001), and a range of cancer cell lines (Efferth et al., 2001; Singh and Lai, 2001). A number of reports on food crops, vegetables, medicinal plants and agricultural/fertile lands showing gradual and persistent effect of heavy metal toxicity. Higher or excess uptake of heavy metals may affect the natural resistance of plants to disease and secondary metabolite synthesis (Nasim and Dhir, 2010). Moreover, some research results suggest that heavy metals may play an important role in triggering plant genes to alter the nature of secondary metabolites, although the exact mechanism by which this happens is still unclear. Toxic effects of heavy metal on plant growth, development and metabolism were reported by many workers, which may affect total dry mass production and yield (Nasim and Dhir, 2010; Manara, 2012). Heavy metals like As, Cr, Pb etc. causes deleterious effects on plant physiological processes such as photosynthesis, water relations and mineral nutrition. Metabolic alterations due to Cr exposure have also been described in plants by a direct effect on enzymes or other metabolites or by its ability to generate reactive oxygen species which may cause oxidative stress. Formation of stress proteins is induced by any stress factors including toxic metals (Manara, 2012). Alternatively there are also reports of increase of secondary metabolites in plant under stress conditions (Ramakrishna and Ravishankar, 2011).

60

S. Paul, K. Shakya / Ecotoxicology and Environmental Safety 98 (2013) 59–65

African and some Asian countries are prone to malaria and heavy metal contaminations are also reported from these areas especially Pb, As, Cr and Cd etc. It is reported that secondary metabolite synthesis is affected when plant is growing under different biotic, abiotic (including heavy metal) and environmental stress. A dose of arsenic may enhance artemisinin biosynthesis (Rai et al., 2011) but higher dose may affect plant growth and metabolism. Similarly under salinity stress (NaCl) artemisinin content has also been enhanced (Qian et al., 2007) but there were no reports on the effect of these metals in total herb and artemisinin yield in a crop cycle which was grown in such contaminated areas. Hence, an attempt has been made with the following objectives. (1) To determine the impact of As(III), Cr(VI) and NaCl on the growth and overall physiological changes in plants, (2) effect of these compounds (at different doses) in artemisinin and total herb yield in a crop cycle and (3) study on comparative cDNA amplification with artemisinin biosynthetic pathway genes in treated and untreated plants.

2. Materials and methods 2.1. Plant material and experimental procedure and design The plant material was collected from institute's experimental field where population of A. annua have been maintained and material of parent plants were taken from arboretum of the Institute (GBPIHED Kosi-Katarmal, Almora, Uttarakhand, India) and analyzed for artemisinin content. The experiments were carried out at poly house of Institute (1150 m amsl 29o38'15” N and 79o38'10” E). Based on artemisinin content, seeds of high yielding (0.3–0.5 percent) A. annua plants were disinfected with 0.1 percent HgCl2 for 1 min and washed thoroughly for 5 times. Seeds were transferred in a tray between moist filter paper for 15–20 d in dark with 257 2 1C. Then seedlings were transferred in acid treated sand with continuous supply of 30 percent Hoagland's nutrient solution (HNS) for 2 months before treatment. Three arsenic {As (III)}, chromium {Cr(VI)} and two NaCl treatments were made using K2Cr2O7, As2O3 (5.0, 7.5, and 10 mg ml
1) and NaCl (2 and 4 g l
l) along with control were used, respectively. The experiment was conducted with five replicates for 180 d. Fresh leaves were used for biochemical analysis.

2.2. Plant growth parameters Quantitative characters in the form of plant height (cm), number of primary and secondary branches, leaf length (cm), leaf width (cm), fresh weight (mg) and root length (cm) were recorded at the time of harvesting of each replicates. The harvested root and shoot biomass were subjected to different biochemical and molecular analysis and air shade dried leaf (approximately 15–20 percent moisture) material was subjected for chemical analysis (artemisinin).

2.3. Chlorophyll content Total chlorophyll content in fresh leaves was estimated following method of Lichtenthaler and Buschmann (2001). The fresh tissue of leaf was ground using a mortar and pestle containing 2 ml of 80 percent acetone. The absorbance of solution was recorded at 662 and 645 nm for chlorophyll estimation using spectrophotometer (Amersham Biosciences, Ultrospec 2100 pro, USA).

2.4. Lipid peroxidation (TBARS) and protein content Oxidative damage in leaf lipids was estimated by content of total 2-thiobarbituric acid reactive substances (TBARS; nmol g
1) expressed as equivalents of malondialdehyde (MDA). TBARS content (fresh weight) was estimated by method of Cakmak and Horst (1991). TBARS was extracted from 0.5 g fresh leaves, ground in 5 ml of 0.1 percent (w/v) trichloroacetic acid (TCA). Ground material was centrifuged at 12000g for 5 min, 1 ml from supernatant was taken and added to 4 ml of 0.5 percent (w/v) TBA in 20 percent (w/v) TCA. Samples were incubated at 90 1C for 30 min. The reaction was stopped in ice bath and centrifuged at 10000g for 5 min. Absorbance of the supernatant was taken at 532 nm on a spectrophotometer (Amersham Biosciences, Ultrospec 2100 pro, USA) and corrected for non-specific turbidity by subtracting the absorbance at 600 nm. Protein was isolated following the protocol of Ni et al. (1996) using QB buffer and estimated with Bradford (1976) method.

2.5. Antioxidant enzymes assay Catalase activity was measured following method of Chandlee and Scandalios (1984) with small modification. The assay mixture contained 2.6 ml of 50 mM potassium phosphate buffer (pH 7.0), 0.4 ml of 15 mM H2O2 and 0.04 ml of enzyme extract. The decomposition of H2O2 was followed by decline in absorbance at 240 nm. The enzyme activity was expressed in U mg
1 protein (U ¼ 1 mM of H2O2 reduction min
1 mg
1 protein). Superoxide dismutase activity was assayed as given by Beauchamp and Fridovich (1971). The reaction mixture contained 1.17  10
6 M riboflavin, 5.6  10
5 M nitroblue tetrazolium salt (NBT) dissolved in 3 ml of 0.05 M sodium phosphate buffer (pH 7.8) and 3 ml of reaction medium was added to 1 ml of enzyme extract. The mixtures were kept under fluorescent light (Philips 40 W). The reaction was initiated at 30 1C for 1 h. Identical solutions that were kept under dark served as blanks. The absorbance was taken at 560 nm in spectrophotometer against the blank and the activity of SOD has been measured in U/mg FW. 2.6. Extraction of artemisinin Artemisinin content was estimated at three different stages (before treatment, 7 d after treatment and at time of harvesting i.e., 180 d). Air shade dried plant material of all plants were powdered and 0.1 g each were extracted in 10 ml hexane by initial heating at 50 1C for 3 min and left overnight at room temperature. The extract was then filtered and evaporated on water bath at 50 1C. After evaporation, extract was dissolved in 1 ml acetonitrile and 20 ml was injected in HPLC (Kontron Instruments, Milan, Italy) using RP18 column (Lichrosort, 250  4.6 mm2 id, 5 mm) and eluted isocratically with acetonitrile and water (70:30 v/v, flow rate 0.75 ml/min). Detection was carried out at 210 nm using an online UV detector, the results were compared and level of artemisinin was estimated using a dose response curve made with standard Artemisinin (Sigma, USA). 2.7. Metal accumulation The oven-dried tissue samples were ground and acid digested and As(III) and Cr(VI) were estimated following the method of Sinha et al. (2010). 2.8. Isolation and amplification of RNA Total RNA was isolated from leaf tissue of treated along with control plants by using total RNA isolation kit (Merck Biosciences Germany). First strand cDNA synthesis was done following the manufacturer's protocol (Biorad, USA). Primers of three key genes of artemisinin biosynthetic pathway (encoding HMGR, 3-hydroxy3-methylglutaryl-CoA reductase Chen et al., 2000 Gene bank no AF142473) of Mevalonate (MVA) pathway, ADS (amorpha-4,11-diene synthase; Mercke et al., 2000, Gene bank no EF197888), and CYP71AV1 (CYP71AV1, amorpha-4,11-diene 12hydroxylase enzymes; Ro et al., 2005 and Teoh et al., 2006; Gene bank no DQ268763) were used for amplification. Polymerase chain reactions (PCR) were carried out in 25 μl volume. A reaction tube contained 1 mg of cDNA, 0.3 units of Taq DNA polymerase, 5 mM of each dNTPs, 1.5 mM MgCl2 and 10 pmol of HMGR (F (forward)-5′GGTCAGGATCCGGCCCAAAACATT3′; R (reverse)-5′CCAGCCAACACCGAA CCAGCAACT3′), ADS (F-5′ATACAACGGGCACTAAAGCAAC C3′; R-5′GAAAACTCTAGC CCGGGAATACTG3′) and CYP71AV1 (F-5′GGTCAGGATCCG GCCCAAAACATT3′; R-5′C CAGCCAACACCGAACCAGCAACT3′) primers. The amplification was carried out using 94 1C for 5 min, 94 1C for 30 s, 56 1C for 30 s, 72 1C for 2 min and final extension was 72 1C for 8 min for 35 cycles in thermal cycler (Biometra, Germany). Further quantification of different genes was determined by comparing with equal amount of cDNA template on formaldehyde gel. 2.9. Statistical analysis Each plant in pot was treated as one replication and all treatments were replicated five times. The data was analyzed statistically using SPSS-17 statistical software (SPSS Inc., Chicago, IL, USA). Mean values were statistically compared by Duncan's Multiple Range Test (DMRT) at p o 0.05 percent level using different letters.

3. Results 3.1. Plant growth parameters The presence of As(III) and Cr(VI) in acid wash sand supplemented with Hoaglands solutions showed significantly lower plant height, branching pattern in terms of number of primary and secondary branches and leaf morphology than the control.

S. Paul, K. Shakya / Ecotoxicology and Environmental Safety 98 (2013) 59–65

Arsenic treated plants showed reverse trend in plant height (72 719.28, 69 712.66, and 60.337 17.61), number of primary branches (87.5 727.18, 79.337 35.90 and 72 714.79) and leaf width with increase in As(III) supplementation and increasing trend with number of secondary branches (20 78.54, 21.66 75.5, and 28 72.64) and leaf length (5.66 70.57, 6.0 71 and 7.37 1.5). No specific trend was observed in Cr(VI) exposed plants. Root length was severely affected with supplementations of both heavy metals. Similarly, with the supplement of NaCl (2 and 4 g l
l), at a dose of 4 g l
l showed only 47 cm of plant height which was almost half of the control, while no change was observed in root

61

length. Significant effect was also found in growth parameters (plant height, number of primary and secondary branches, leaf morphology and fresh weight) of plants treated with 4 gm l
l NaCl (Fig. 1a, b and c). The presence of As(III) and Cr(VI) in sand medium significantly lowered the values for growth attributes (herb parameters). Shoot length noted in all As(III) and Cr(VI) treated plants was more than 25 percent lower than control plants suggesting reduced growth under toxic effect. The total herb yield and root length were also affected by both the metal toxicity compared to other phenotypic attributes. 3.2. Metal accumulation Arsenic level was significantly high (10.75) in roots at a dose of 10 mg ml
1. A dose of 5 mg ml
1 was not affect the stem and leaf, while 0.43 and 0.56 mg mg
1 (dry weight) was observed when supplemented with 10 mg ml
1. Although very little amount (0.1570) was found in stem supplemented with As(III) 7.5 mg ml
1. Accumulation of Cr(VI) was higher (3779.6, 41.177.2 and 52.7719.6) in treated shoot than roots and control (Fig. 2). 3.3. Artemisinin content As A. annua is open pollinated crop hence artemisinin content is differs from plant to plant. Before treatment estimation of artemisinin content was required to determine the actual effect of dose in artemisinin synthesis. Therefore, artemisinin content was estimated at three different stages. Increased artemisinin content was observed in As(III) 5 and 7.5 mg ml
1 (0.3–0.37–0.3 and 0.48–0.50–0.45 percent) from before treatment to 7 d after treatment, while slightly decreased at the time of harvesting i.e. 180 d. Decreasing trend was observed in As(III) 10 mg ml
1(0.4– 0.37–0.37 percent) as compared with the control. Cr(VI) showed very low artemisnin content in all the treated plants in every stage of treatment. Interestingly, increasing trend was observed in NaCl treated (Fig. 3). 3.4. Biochemical activity Plants have evolved a well regulated mechanism which effects the general production of antioxidant enzymes (SOD and catalase), TBARS, total protein and chlorophyll. Catalase activity was decreased with increase amount of As(III), while with Cr(VI), it was on higher side at 7.5 mg ml
1. When plants were treated with 2 and 4 g l
l NaCl, increasing trend was observed while control had high catalase activity (Fig. 4A and A1). Compared to control, the activity of SOD was significantly increased with 5 and 7.5 mg ml
1 dose of As(III) and NaCl (4 g l
l) while significantly

Fig. 1. (a) Effect of different doses of As(III) on morphological characters of plants, (b) effect of different doses of Cr(VI) on morphological characters of plants and (c) morphological variations in NaCl treated and control plants. Note: PH — plant height; NPB — number of primary branches; NSB — number of secondary branches; LL — leaf length; LW — leaf width; FW — fresh weight of plant; RL — root length. All values are mean of five replicates ±SD and values marked with similar letters are not significantly different (Duncan’s test, p o 0.05).Values with same Letters are not significantly different (po 0.05, DMRT).

Fig. 2. Accumulation of As(III) and Cr(VI) (µg mg-1) in different parts of treated and control plants. All values are mean of five replicates ±SD and values marked with similar letters are not significantly different (Duncan’s test, p o0.05).Values with same Letters are not significantly different (p o0.05, DMRT).

62

S. Paul, K. Shakya / Ecotoxicology and Environmental Safety 98 (2013) 59–65

decreased in all the doses of Cr(VI) treated plants (Fig. 4B and B1). Unlike the above parameters, values of TBARS content and antioxidant enzymes were significantly enhanced in plants subjected to As(III), Cr(VI) and NaCl stress. The TBARS content was measured as an indicator of oxidative stress/membrane damage and it increased progressively in plants treated with different concentrations of As(III) and Cr(VI). There was high TBARS activity in plants receiving 10 mg ml
1 As(III) and Cr(VI) treatments (89.94 and 88.7

percent), most pronounced effect was found on 10.0 mg ml
1 concentration. Similar observation was also noted with NaCl treated plants (Fig.4C and C1). Chlorophyll content was also reduced in As(III) and Cr(VI) stressed plants and the most toxic effect was noted at 10.0 mg mg
1 concentration (Fig.5A and A1). The total soluble protein slightly (12.5 percent) decreased with increase in all the concentration of As(III) and Cr(VI) used in the study. Parallely increasing trend was also found in plants supplemented with 2–4 gm l
l NaCl (Fig. 5B and B1). 3.5. RNA analysis RNA amplification showed deferent level of amplification HMGR, ADS, CYP71AV1 genes with different treatments of heavy metals and NaCl. Arsenic (5 and 7.5 mg ml
1) and NaCl showed more expressions as compared with control while low expressions was observed with As(III) 10 mg ml
1. Similarly significantly low expressions were observed with Cr(VI) treated plants (Fig. 6).

4. Discussion Fig. 3. Effect of As(III), Cr(VI) and NaCl doses on artemisinin content (% dry wt) in plants. Note: 7 d: seventh day after treatment, 180 d: after 180 days of treatment or at the time of harvesting. All values are mean of five replicates ±SD and values marked with similar letters are not significantly different (Duncan’s test, po 0.05). Values with same Letters are not significantly different (po 0.05, DMRT).

These days contamination of ecosystems and metal (loids) toxicity to plants are one of the major problems in many places of world. As a consequence of geological and/or anthropogenic activities and other sources most of these metals are present in

Fig. 4. Effect of different concentrations of As(III), Cr(VI) and NaCl treatment on the activities of different antioxidant enzymes in A. annua. (A and A1) catalase activity; (B and B1) SOD; (C and C1) TBARS. All values are mean of five replicates ±SD and values marked with similar letters are not significantly different (Duncan’s test, p o0.05).Values with same Letters are not significantly different (p o0.05, DMRT).

S. Paul, K. Shakya / Ecotoxicology and Environmental Safety 98 (2013) 59–65

63

Fig. 5. Effect of different concentrations of As(III), Cr (VI) and NaCl treatment on the activities of total chlorophyll and soluble proteins in A. annua. ((A and A1) total chlorophyll (mg g
1 FW) and (B and B1) total soluble protein (mg g
1 FW). All values are mean of five replicates 7 SD and values marked with similar letters are not significantly different (Duncan's test, p o 0.05). Values with the same letters are not significantly different (p o 0.05, DMRT).

As(III) HMGR

1

2

3

4

As(III) ADS

1

CYP71AV1

1

2

3

4

NaCl 1 2 3

As(III) 2

3

4

Cr(VI)

NaCl 1 2 3

1

NaCl 2 3

1

2

3

4

Cr(VI) 1

2

3

4

Cr(VI) 1 2 3

4

Fig. 6. cDNA amplification of key genes of artemisinin biosynthetic pathway in treated and non treated plants. As:- Arsenic: – 1:- 5 mg ml
1; 2:- 7.5 mg ml
1; 3:- 10 mg ml
1; 4:- Control. NaCl:- 1:- 2 g l
1; 2:- 4 g l
1; 3:- Control. Cr:- Chromium: – 1:- 5 mg ml
1; 2:- 7.5 mg ml
1; 3:- 10 mg ml
1; 4:- Control.

environment. In plant, uptake of metal and its accumulations are different characteristics which can affect metabolism of plants. Heavy metals can affect secondary metabolite synthesis; sometimes they produce specific metabolites which can detoxify some of toxic metals (Nasim and Dhir, 2010). These days a number of heavy metals are reported which can play specific role in plant growth and essential plant mineral transport system (Shanker et al., 2005). Since plants do not have defined transport system for toxic metals hence it is transported by various transporters of essential ions such as sulfate or iron and phosphorous. Toxic effects of Cr(VI) on plant growth and development include alterations in the germination process as well as the growth of roots,

stems and leaves, which may affect total production and artemisinin yield. However Cr(VI) has also been reported to increase secondary metabolites in Datura inoxia (Vernay et al. 2008). Another important threat of agricultural ecosystem world over is the presence of salt in soil. Based on FAO/ UNESCO report about 394 million hectare land is saline and 434 million hectare land is sodic (Massoud, 1977). The present investigation is preliminary study on effect of major heavy metal in artemisinin biosynthesis. Although, Rai et al. (2011) studied the effect of As(III) in biosynthesis of artemisinin but they have not reported the effect on the plant growth, total herb and artemisinin yield in a complete crop cycle. In the present study a dose dependent decrease in artemisinin content was observed in plants; however, accumulation was not proportional to supplied As(III). This phenomenon may not be attributed solely to unavailability of As(III) due to adsorption of this metal to sand which affect the level of biochemical parameters like lipid peroxidation, SOD catalase activity etc. Similar observations were also made by Gulz et al. (2005) in common plants from contaminated soil. Higher accumulation of As(III) in the roots of A. annua did not affect significantly in artemisinin biosynthesis at the time of harvesting however a decreasing trend was observed. Accumulation of As in different parts of plants may vary in different genotypes in Holcus lantus (Meharg and Macnair, 1992). When plants are exposed to toxic metals, tolerance mechanism exhibited by the plant stops uptake of metal, hence as a results metal gets accumulated in roots (Artus, 2006). Decline in growth parameters has been considered to be a measure of toxicity of heavy metal and salinity doses, as no other stress was provided. The percentage decline in fresh weight and root length in presence of NaCl was more than As(III) and Cr(VI).

64

S. Paul, K. Shakya / Ecotoxicology and Environmental Safety 98 (2013) 59–65

The decrease in total chlorophyll was more in As(III) than Cr(VI) after 180 d, which demonstrates that As(III) and Cr(VI) casted more biochemical, affect while NaCl casted more morphological affect on plants. Very low concentrations of As may not affect plant growth and pigments, which has been reported in several plants like tomato (Carbonell-Barrachina et al., 1998) and bean (Carbonell-Barrachina et al., 1997) etc. However, with further increased As(III) concentration, it becomes toxic to whole plant causing chlorosis, necrosis, inhibition of growth and finally death. Hence, the observed higher As(III) and Cr(VI) doses leading to declining the total chlorophyll content in the fresh weight and root length after 180 d indicates that plants were significantly affected by these metalloids. Lipid peroxidation has been identified as a sensitive indicator of heavy metal (loid) toxicity, and is being used as a toxicity bioassay for plants. It is suggested that inhibition of key enzyme systems, together with electron leakage during conversion of As(V)–As(III), leads to formation of ROS, which in turn causes lipid peroxidation (Zhao et al., 2009). Both levels of TBARS and SOD are indicative of status of oxidative stress prevalent in all treated plant. The higher levels of TBARS and SOD in plants were suggestive of the fact that plant was undergoing through a higher oxidative stress, which was in agreement with other parameters, i.e. heavy metal uptake and its accumulation, chlorophyll and growth parameters. Similarly, Gunes et al. (2009) observed concentrations of H2O2 and lipid peroxidation increase in chickpea plants against As(III) treatment. Singh et al. (2007) observed increase in MDA content in Phaseolus aureus exposed to 10.0 and 50.0 mM of As(V) without any significant change in H2O2 content. It has been well documented that exposure of plants to As(III) and As(V) induces production of ROS, including superoxide (O2
), hydroxyl radical (OH), and H2O2 (Hartley-Whitaker et al., 2001; Singh et al., 2006; Mallick et al., 2011). ROS can damage proteins, amino acids, purine and nucleic acids and also cause peroxidation of membrane lipids (Moller et al., 2007). Arsenic(III) is 10 times more toxic than As(V) hence the observed changes were reduction in size of plants, mainly in As(III) treated plants; however, there were no visible sign of As toxicity in plants at 5.and 7.5 mg ml
1 concentration. PCs synthase gene may affect the artemisinin biosynthesis which was measured after 7 d of treatment (Rai et al., 2011). Significant increase in the levels of thiols, GSH, and pcs gene transcript up to 3,000 μg l
1 and level of expression of artemisinin biosynthetic pathway gene like HMGR, FDS, ADS, and CYP71AV1 were reported. In the present investigation artemisinin content was increase with the increase of As(III) at 5 and 7.5 µg ml-1 level but the total herb yield was decreased with increase of artremisinin content along with the expression of these genes. It was observed in the present investigation artemisinin and herb yield were severely affected with Cr(VI) doses. It also affects mechanisms of metabolism of alkaloids derivative of quinolizidine, tropane, isoquinoline, and indole. Some of the approaches related to the physical stress have been previously attempted to enhance artemisinin production (Mannan et al., 2010). Chromium uptake and transport are dependent on its chemical form and hexavalent species is more mobile than the trivalent one. (de la Rosa et al., 2005; Han et al., 2004). De la Rosa et al. (2005) reported that accumulation of Cr(VI) in the upper plant parts was 12–18 times higher for hexavalent than for trivalent Cr. The uptake of Cr(VI) is passive diffusion and this ion interacts with cell walls through cation-exchange sites (Han et al., 2004). Absorption moves more easily from roots to upper plants tissues and probably correlates with sulfate transport system located in plasma membrane (Kim et al., 2006). Being a non-essential element and also toxic for plants, there is no specific mechanism for Cr(VI) transport through plants and this metal is known to compete with iron and manganese for transport binding sites. In Bacopa, DNA damage

was observed in presence of Cr (Saikia et al., 2012) which affects the level of expression of genes. There were a number of reports on other nutrient compounds like NO3/NH4, NaCl etc. which affects artemisinin biosynthesis. In hairy root culture; Wang and Tan (2002) has regulated the ratio of NO3/NH4 and total initial nitrogen concentration to increase the artemisinin concentration (57 percent). The enhancement of artemisinin content caused by 2 g l
1 NaCl stress was not significantly compared to control, but enhancement caused by 4 g l
1 NaCl stress was extremely significant (Po0.01) compared to the control (Qian et al., 2007). Salinity stress may inhibit the development of A. annua plants, but influences the contents of artemisinin in plants while low level salinity stress (2–4 g l
l) does not hamper much growth and metabolism of plants.

5. Conclusions Artemisinin content is major concern in A. annua cultivation, studies on heavy metal and salinity stress tolerant plants can provide information on total artemisinin and herb yield for large scale production especially for African and Asian countries, where malaria is prone and lands were affected with heavy metal and salinity. The inference drawn from this study is that artemisinin biosynthesis is affected with application of 10 mg ml
1 As (III), 5, 7.5 and 10 mg ml
1 Cr(VI). Whereas NaCl and As(III) 5, 7.5 mg ml
1 may help to enhance artemisinin biosynthesis. Plant growth was affected with all the doses of heavy metal and NaCl. This suggested that where arsenic toxicity is near/more than 10 mg ml
1 level, A. annua plant can survive and artemisinin synthesis will be decrease. Similarly plant growth and artemisinin will also be affected in Cr(VI) rich area. In saline areas artemisinin content may be enhanced but plant growth will be affected negatively.

Acknowledgments The authors are grateful to Director of G. B. Pant Institute of Himalayan Environment Development (An autonomous institute of the Ministry of Environment and Forestry, MoEF, Govt. of India) Almora for availing the necessary resources towards this study. Thanks is due to Dr. Shekhar Mallick (Scientist, NBRI) for critical suggestion and editing. Thanks are also due to Drs. RS Rawal, Anita Pandey, SK Nandi, and central facility of the institute for providing initial plant material from arboretum, HPLC, spectrophotometer and other instruments. Thanks are also due to MoEF for providing financial support for this study. References Artus, N.N., 2006. Arsenic and cadmium phytoextraction potential of crambe compared with Indian mustard. Journal of Plant Nutrition 29, 667–679. Beauchamp, C.O., Fridovich, I., 1971. Superoxide dismutase: improved assays and an assay applicable to acrylamide gels. Annual Review of Biochemistry 44, 276–287. Borrmann, S.N., Szlezak, J.F., Faucher, P.B., Matsiegui, R., Neubauer, R.K., Biner, B.L., Kremsner, P.G., 2001. Artesunate and praziquantel for the treatment of Schistosoma haematobium infections: a double blind, randomized, placebocontrolled study. Journal of Infectious Diseases 184, 1363–1366. Bradford, M.M., 1976. A rapid and sensitive method for the quantization of microgram quantities of protein utilizing the principle of protein dye binding. Analytical Biochemistry 72, 248–254. Cakmak, I., Horst, J., 1991. Effect of aluminium of lipid peroxidation, superoxide dismutase, catalase and peroxidase activities in root tips of soybean (Glycine max). Physiologia Plantarum 83, 463–468. Carbonell-Barrachina, A.A., Burlo, F., Lopez, E., Mataix, J., 1998. Tomato plant nutrition as affected by arsenic concentration. Journal of Plant Nutrition 21, 235–244. Carbonell-Barrachina, A.A., Burlo Carbonell, F., Mataix-Beneyto, J., 1997. Effect of sodium arsenite and sodium chloride on bean plant nutrition (macronutrients). Journal of Plant Nutrition 20, 1617–1633.

S. Paul, K. Shakya / Ecotoxicology and Environmental Safety 98 (2013) 59–65

Chandlee, J.M., Scandalios, J.G., 1984. Analysis of variants affecting the catalase development program in maize scutellum. Theoretical and Applied Genetic 69, 71–77. Chen, D.H., Ye, H.C., Li, G.F., 2000. Expression of a chimeric farnesyl diphosphate synthase gene in Artemisia annua L. transgenic plants via Agrobacterium tumefaciens-mediated transformation. Plant Science 155, 179–185. de la Rosa, G., Peralta-Videa, J.R., Montes, M., Gardea-Torresdey, J.L., 2005. A study of the differential uptake and transportation of trivalent and hexavalent chromium by tumbleweed (Salsola kali). Archives of Environmental Contamination and Toxicology 48, 225–232. Efferth, T., Dunstan, H., Sauerbrey, A., Miyachi, H., Chitambar, C.R., 2001. The antimalarial artesunate is also active against cancer. International Journal of Oncology 18, 767–773. Gulz, P.A., Gupta, S.K., Schulin, R., 2005. Arsenic accumulation of common plants from contaminated soils. Plant and Soil 272, 337–347. Gunes, A., Pilbeam, D.J., Inal, A., 2009. Effect of arsenic–phosphorus interaction on arsenic-induced oxidative stress in chickpea plants. Plant and Soil 314, 211–220. Han, F.X., Maruthi, Sridhar, B.B., Monts, D.L., Su, Y., 2004. Phytoavailability and toxicity of trivalent and hexavalent chromium to Brassica juncea. New Phytologist 162, 489–499. Hartley-Whitaker, J., Ainswort, G., Meharg, A.A., 2001. Copper and arsenate induced oxidative stress in Holcus lanatus L. clones with differential sensitivity. Plant, Cell and Environment 24, 713–722. Kim, Y.J., Kim, J.H., Lee, C.E., Mok, Y.G., Choi, J.S., Shin, H.S., Hwang, S., 2006. Expression of yeast transcriptional activator MSN1 promotes accumulation of chromium and sulfur by enhancing sulfate transporter level in plants. FEBS Letter 580, 206–210. Lichtenthaler, H.K., Buschmann, C., 2001. Chlorophylls and carotenoids: measurement and characterization by UV–vis spectroscopy, Current Protocols in Food Analytical Chemistry. John Wiley and Sons, New York, pp. F4.3.1–F4.3.8. Liu, J.M., Ni, M.Y., Fan, J.F., Tu, Y.Y., Wu, Z.H., Wu, Y.L., Chou, W.S., 1979. Structure and reaction of arteannuin. Acta Chimica Sinica 37, 120–143. Mallick, S., Sinam, G., Sinha, S., 2011. Study on arsenate tolerant and sensitive cultivars of Zea mays L.: differential detoxification mechanism and effect on nutrients status. Ecotoxicology and Environmental Safety 74, 1316–13220. Manara, A., 2012. Plant Responses to Heavy Metal Toxicity A. Furini (ed.), Plants and Heavy Metals, Springer Briefs in Biometals, 10.1007/978-94-007-4441-7_2. Mannan, A., Liu, C., Arsenault, P.R., Towler, M.J., Vail, D.R., Lorence, A., Weathers, P.J., 2010. DMSO triggers the generation of ROS leading to an increase in artemisinin and dihydroartemisinic acid in Artemisia annua shoot cultures. Plant Cell Reports 29 (2), 143–152. Meharg, A.A., Macnair, M.R., 1992. An altered phosphate uptake system in arsenatetolerant Holcus lanatus L. New Phyto 116, 29–35. Massoud, F.I., 1977. Basic principles for prognosis and monitoring of salinity and sodicity. In: Proceedings of the International Conference on Managing Saline Water for Irrigation. Texas Tech. University, Lubbock, Texas. 16–20 August 1976. pp. 432–454. Mercke, P., Bengtsson, M., Bouwmeester, H.J., Posthumus, M.A., Brodelius, P.E., 2000. Molecular cloning, expression, and characterization of amorpha-4,11diene synthase, a key enzyme of artemisinin biosynthesis in Artemisia annua L. Archives of Biochemistry and Biophysics 381, 173–180. Møller, I.M., Jensen, P.E., Hansson, A., 2007. Oxidative modifications to cellular components in plants. Annual Review of Plant Biology 58, 459–481.

65

Nasim, S.A., Dhir, B., 2010. Heavy metals alter the potency of medicinal plants. Reviews of Environmental Contamination and Toxicology 203, 139–149, http: //dx.doi.org/10.1007/978-1-4419-1352-4_5. Ni, M., Dehesh, K., Tepperman, J.M., Quail, P.H., 1996. GT-2: in vivo transcriptional activation activity and definition of novel twin DNA binding domains with reciprocal target sequence selectivity. Plant Cell 8, 1041–1059. Paul, S., Khanuja, S.P.S., Shasany, A.K., Gupta, M.M., Darokar, M.P., Saikia, D., Gupta, A.K., 2010. Enhancement of artemisinin content through four cycles of recurrent selection with relation to heritability, correlation and molecular marker in Artemisia annua L. Planta Medica 76, 1468–1472. Qian, Z., Ling, Ke Gong., Jianbing, Z., Fuyuan, L., Yueyue, J., Shaobo, W., Guofeng, G., Kexuan, T. A, W., 2007. Simple and efficient procedure to enhance artemisinin content in Artemisia annua L by seeding to salinity stress. African Journal of Biotechnology 6 (12), 1410–1413. Rai, R., Pandey, S., Rai, S.P., 2011. Arsenic-induced changes in morphological, physiological, and biochemical attributes and artemisinin biosynthesis in Artemisia annua, an antimalarial plant. Ecotoxicology 20 (8), 1900–1913. Ramakrishna, A., Ravishankar, G.A., 2011. Influence of abiotic stress signals on secondary metabolites in plants. Plant Signaling and Behavior 6 (11), 1720–1731. Romero, M.R., Efferth, T., Serrano, M.A., Macias, R.I., Briz, O., Marin, J.J., 2005. Effect of artemisinin/artesunate as inhibitors of hepatitis B virus production in an “in vitro” replicative system. Antiviral Research 68 (2), 75–83. Ro, D.K., Arimura, G., Lau, S.Y., Piers, E., Bohlmann, J., 2005. Loblolly pine abietadienol/abietadienal oxidase PtAO (CYP720B1) is a multifunctional, multisubstrate cytochrome P450 mono oxygenase. PNAS, USA 102, 8060–8065. Shanker, A.K., Cervantes, C., Loza-Tavera, H., Vudainayagam, S., 2005. Chromium toxicity in plants. Environment International 31, 739–753. Saikia, S.K., Mishra, A.K., Tiwari, S., Pandey, R., 2012. Hexavalent chromium induced histological alterations in Bacopa monnieri (L.) and assessment of genetic variance. Journal of Cytology and Histology 3, 2–8. Singh, H.P., Batish, D.R., Kholi, R.K., Arora, K., 2007. Arsenic-induced root growth inhibition in mung bean (Phaseolus aureus Roxb.) is due to oxidative stress resulting from enhanced lipid peroxidation. Journal of Plant Growth Regulation 53, 65–73. Singh, N., Lai, P., 2001. Selective toxicity of dihydroartemisinin and holo transferr in toward human breast cancer cells. Life Science 70, 49–56. Singh, N., Ma, L.Q., Srivastava, M., Rathinasabapathi, B., 2006. Meta- bolic adaptations to arsenic induced oxidative stress in Pteris vittata L. and Pteris ensiformis L. Plant Science 170, 274–282. Sinha, S., Sinam, G., Mishra, R.K., Mallick, S., 2010. Metal accumulation, growth, antioxidants and oil yield of Brassica juncea L. exposed to different metals. Ecotoxicology and Environmental Safety 73, 1352–1361. Teoh, K.H., Polichuk, D.R., Reed, D.W., Nowak, G., Covello, P.S., 2006. Artemisia annua L. (Asteraceae) trichome-specific cDNAs reveal CYP71AV1, a cytochrome P450 with a key role in the biosynthesis of the antimalarial sesquiterpene lactone artemisinin. FEBS Letters 580, 1411–1416. Vernay, P., Gauthier-Moussard, C., Jean, L., Bordas, F., Faure, O., Ledoigt, G., Hitmi, A., 2008. Effect of chromium species on phytochemical and physiological parameters in Datura innoxia. Chemosphere 72 (5), 763–771. Wang, J.W., Tan, R.X., 2002. Artemisinin production in Artemisia annua hair root cultures with improved growth by altering the nitrogen source in the medium. Biotechnology Letters 24, 1153–1156. Zhao, F.J., Ma, J.F., Meharg, A.A., McGrath, S.P., 2009. Arsenic uptake and metabolism in plants. New Phytologist 181, 777–794.