PI3K complex in MLTC-1 cells

Journal of Hazardous Materials 391 (2020) 122227

Contents lists available at ScienceDirect

Journal of Hazardous Materials journal homepage: www.elsevier.com/locate/jhazmat

Arsenic induces dysfunctional autophagy via dual regulation of mTOR pathway and Beclin1-Vps34/PI3K complex in MLTC-1 cells

T

Chen Lianga,1, Zhiyuan Fenga,1, Ram Kumar Mantharia, Chong Wangb, Yongli Hana, Weixiang Fua, Jundong Wanga, Jianhai Zhanga,* a b

College of Animal Science and Veterinary Medicine, Shanxi Agricultural University, Taigu, Shanxi, 030801, People's Republic of China Medical Experiment Center, Shaanxi University of Chinese Medicine, Xianyang, Shaanxi, 712046, People's Republic of China

GRAPHICAL ABSTRACT

ARTICLE INFO

ABSTRACT

Editor: R. Teresa

Arsenic poisoning and induced potential lesion is a global concern. However, the exact mechanisms underlying its toxicity especially in male reproductive system still remain unclear. Hence, this study aimed to explore the roles of mTOR and Beclin1-Vps34/PI3K complex during As-induced-toxicity using Rapamycin (mTOR inhibitor), Beclin1 siRNA and 3-methyladenine (3-MA, Vps34/PI3K inhibitor) in testicular stromal cells. For this, mouse testis Leydig Tumor Cell lines (MLTC-1) were challenged with As2O3 (0, 3, 6 and 9 μM) exposure for 24 hs. LysoTracker Red and Monodansylcadaverine (MDC) staining results depicted a significant accumulation of autophagosomes in MLTC-1 cells exposed to arsenic. Meanwhile, arsenic treatment up-regulated autophagic markers including LC3, Atg7, Beclin1 and Vps34 expressions, mTOR downstream autophagy related genes and the Beclin1-Vps34/PI3K complex associated members. Furthermore, silencing of Beclin1, and inhibition of Vps34/ PI3K and mTOR altered the arsenic-induced autophagosomes formation. However, p62, the substrate protein of autophagy, was also up-regulated by arsenic administration independent on Beclin1-Vps34/PI3K complex. Altogether, our results revealed that arsenic exposure induced autophagosomes formation via regulation of the Beclin1-Vps34/PI3K complex and mTOR pathway; the blockage of autophagosomes degradation maybe due to

Keywords: Arsenic Autophagy MTOR pathway Beclin1-Vps34/PI3K complex Male reproductive toxicity

Corresponding author at: Shanxi Key Laboratory of Ecological Animal Science and Environmental Medicine, College of Animal Science and Veterinary Medicine, Shanxi Agricultural University, Taigu, 030801, Shanxi, People's Republic of China. E-mail addresses: [email protected], [email protected] (J. Zhang). 1 The authors contributed equally to this work. ⁎

https://doi.org/10.1016/j.jhazmat.2020.122227 Received 10 December 2019; Received in revised form 1 February 2020; Accepted 2 February 2020 Available online 03 February 2020 0304-3894/ © 2020 Elsevier B.V. All rights reserved.

Journal of Hazardous Materials 391 (2020) 122227

C. Liang, et al.

impaired function of lysosomes. Thus, this study provides a novel mechanistic approach with respect to Asinduced male reproductive toxicity.

1. Introduction

related genes and proteins in mouse testis Leydig Tumor cells lines (MLTC-1). Besides, the mTOR inhibitor rapamycin, siRNA Beclin1, and Vps34/PI3K inhibitor 3-MA were used to explore the regulation function of mTOR pathway and Beclin1-Vps34/PI3K complex and provide a novel mechanism by which arsenic induced male reproductive toxicity.

Arsenic (As) is a common environmental contaminant that widely distributed all around the world. Millions of people are exposed to As via drinking water, contaminated soil, air, fish and other sea organisms rich in methylated As species. Occupational exposure was observed especially in the USA, Bangladesh, Pakistan, India, China and other Asian countries (Zheng and Flanagan, 2017). Hence, for the past decades, most of the researchers paid more attention on As and its globalized effects. Arsenic was known to be associated with various cancer types like lung cancer (Fan et al., 2016), bladder cancer (Baris et al., 2016), and prostate cancer (Roh et al., 2017). Recent studies reported that As impaired many organ systems, particularly the male reproductive system (Huang et al., 2016; da Silva et al., 2017). Concretely, a significant decrease in testicular weight and seminiferous tubules diameter was reported post As exposure (Chang et al., 2007; Guvvala et al., 2016; de Araujo Ramos et al., 2017). Analogously, As reduced the number, motility and viability of sperm (Chiou et al., 2008; Huang et al., 2016), injured spermatogonia and spermatocyte (Mukhopadhyay et al., 2013), finally leading to sperm malformation (da Silva et al., 2017). Furthermore, As also induced genetic and epigenetic alterations in Leydig cells (Singh and Jr, 2007); like decreased cell numbers in damaging atrophy and increased nuclear diameter with a dose-dependent manner (Ahmad, 2008; Sanghamitra et al., 2008). Besides, As exposure reduced the release of gonadotropins, the synthesis of testosterone and steroids pathways, further affected spermatogenesis (Chiou et al., 2008; Alamdar et al., 2017). However, the mechanisms underlying its toxicity on male reproductive system have not yet to be clarified. Autophagy plays a key role in several physiological and pathological conditions in organisms, excessive and repressed autophagy levels have adverse effect on the male reproductive system (Zhang et al., 2017; Feng et al., 2019; Liang et al., 2020). As an intracellular metabolic pathway, autophagy is controlled by a series of AuTophaGy-related (ATG) genes, such as Atg5, Atg7 and Atg8 (Kim and Lee, 2014; Minina et al., 2014; Ward et al., 2016). Among these genes, LC3 (Atg8) composes the frame of autophagosomes, meanwhile, Atg5, Atg12, Atg7 and p62 assist LC3 binding to autophagosomes. Beyond that, Beclin 1 encodes a coiled protein that binds to the Class III phosphatidylinositol-3kinase Vps34 (Vps34/PI3K) that generates phosphatidylinositol-3phosphate, which is required for autophagosome formation (Itakura et al., 2008). There are three distinct Beclin1-Vps34 complexes that have been identified in mammalian cells that share the core components of Beclin 1, Vps34 and Vps15. In addition, complex I involved in autophagy contains Atg14 L (Itakura et al., 2008), complex II involved in autophagosome and endosome maturation contains UVRAG (Itakura and Mizushima, 2009), and complex III involved in suppressing autophagosome and endosome maturation contains UVRAG and Rubicon (Matsunaga et al., 2009). Besides, mammalian targets of rapamycin (mTOR) act as a negative regulator for autophagy in mammals, which works together with two downstream proteins, ULK1 and Atg13 (Bhaskar and Hay, 2007; Jung et al., 2010). Autophagy via PI3K-AktmTOR signalling pathway in the developing mouse brain-specific regions induced by arsenic (Manthari et al., 2018a, 2018b), and fluorideinduced autophagosome formation and underlying mechanisms by male reproductive toxicity have been reported in our recent studies (Zhang et al., 2017; Feng et al., 2019; Liang et al., 2020). Hence, in this current study, to explore the role of autophagy in Asinduced male reproductive toxicity, we made an attempt to observe the As-induced accumulation of autophagosomes, alterations in autophagy

2. Materials and methods 2.1. Cell culture Mouse testis Leydig Tumor Cells lines MLTC-1 (ATCC®CRL-2065™) were obtained from the Institute of Zoology, Chinese Academy of Sciences, Beijing, China. Frozen cells were rapidly thawed in water bath at 37 °C, and cultured in RPMI Medium Modified (HyClone, USA) containing 10 % fetal bovine serum (FBS, ExCell Bio, China) and 1 % Penicillin-Streptomycin (TransGen Biotech, China). Then the cells were incubated at 37 °C with 5 % CO2 in air. When Leydig cells reached a confluence of 80–90 %, they were detached from flasks using 0.25 % trypsin (trypsinization) and passaged into six-well plates for arsenic trioxide (As2O3) exposure. 2.2. Cell viability assay Cell viability was determined by using the MTT cell proliferation kit (BBI Life Sciences, Shanghai, China). Cells were seeded at a density of 5 × 104 cells per well into a 96-well plate, and incubated in humidified incubator. The cells were treated with 0, 1, 10, 20, 40, 60, 80,100 μM As2O3 for 24 hs. MTT reagent at final concentration of 0.5 mg/mL was added into each well. After incubation for 4 h, the culture media in 96well plate were replaced with formazan solubilization solution, and shaken gently to make the formazan dissolved. Finally, the absorbance of each well was measured at 490 nm by Thermo Scientific Varioskan Flash (Thermo Fisher Scientific, USA). Five repeats were taken for each treatment. Results were expressed as percentages of the controls, which were assigned with 100 % viability. The half-maximal inhibitory concentration (IC50) and 95 % confidence intervals were calculated. 2.3. Observation for autolysosome According to the results of MTT assay, 0, 3, 6, and 9 μM As2O3 were selected as treatment concentrations of MLTC-1 cells. Lyso-Tracker Red (Beytime Biotechnology, China) and Monodansylcadaverine (MDC, Sigma-Aldrich, USA) were applied to stain autolysosome in MLTC-1, respectively (Sui et al., 2015; Zhang et al., 2017). Briefly, culture medium was aspirated and 50 nM Lyso-Tracker Red was added and incubated for 1 h at 37 °C followed by incubation with DAPI for 10 min. And then the cells were washed 3 times with phosphate buffered saline (PBS), finally observed by Cytation 5 imaging reader (BioTek, USA). For MDC staining, culture medium was aspirated followed by washing the cells in PBS 3 times (5 min each). And then cells were fixed by 4 % paraformaldehyde for 15 min and washed 3 times in PBS (3 min each). Finally, the cells were incubated with 50 μM MDC dye for 45 min at 37 °C. Later, the cells were washed with PBS for 3 times (5 min each) and then examined under a fluorescence microscope (DMI3000, Leica, Germany). The positive cells were analyzed by counting and fluorescence intensity methods. 2.4. Real-time PCR (qPCR) Total RNA was isolated from MLTC-1 cells using RNAiso (Takara, 2

Journal of Hazardous Materials 391 (2020) 122227

C. Liang, et al.

China) following the manufacturer’s instructions. The quality of total RNA was analyzed with 0.8 % agarose gel electrophoresis and NanoDrop 2000 (Thermo Fisher Scientific, USA). Total RNA was reverse-transcribed to cDNA using Primer Script™ RT Master Mix kit (Takara, China). β-actin was used as an internal reference control. The specific primers were designed by Primer 3.0 Plus software (Table 1) and synthesized by Invitrogen Company (Thermo Fisher Scientific, USA). Real-time PCR (qPCR) was performed using Mix SYBR ® Premix Ex Taq™II (2X) (Takara, China) and the Quant Studio 7 Flex QRT-PCR system (Life Technologies, USA). The relative expression results of target genes were analyzed by the 2− ΔΔCT method (Zhao et al., 2019).

by blocking for 15 min in Triton X-100 (Solarbio, China), and washing 3 times in PBS (5 min each). Then, nonspecific antibody binding was blocked by incubating with PBS containing 10 % fetal bovine serum for 30 min. Subsequently, the slides were incubated with primary antibody (mouse anti-Vps34, Santa Cruz Biotechnology, USA, 1:200) overnight at 4 °C, followed by incubation with fluorescent-labelled secondary antibody (Alexa Fluor 488 Proteintech Group, China) for 1 h at 37 °C and then washed with PBS 3 times. Ultimately, Cytation 5 imaging reader (BioTek, USA) was applied to detect the fluorescence (Excitation wavelength 488 nm, emission wavelength 519 nm). 30 images were taken from each group for analysis.

2.5. Western blotting

2.7. mTOR inhibition

Total protein of cells was extracted with ice-cold RIPA lysis buffer (PMSF added), and the concentration was determined by Bicinchoninic Acid (BCA) kit (KeyGEN Biotechnology, China). 20 μg protein samples were loaded and resolved by electrophoresis on 12 % SDS-PAGE gel and then transferred onto nitrocellulose (NC) membrane (Biosharp, China) at 35 V. Later, the membrane was blocked with 5 % (w/v) powdered skimmed milk and resuspended in TBST (TBS with 0.05 % Tween-20) at room temperature for 2 h. Subsequently, incubated with primary antibodies: rabbit anti-Beclin1 (1:1000), rabbit anti-LC3 (1:1000), rabbit anti-p62 (1:1000), mouse anti-β-actin (1:2000, Proteintech Group, China), and rabbit anti-Atg7 (1:1000, Wanleibio, China), overnight at 4 °C. Then, the membranes were washed 3 times with TBST for 5 min each, followed by secondary antibody (1:5000) incubation at room temperature for 2 h. Finally, blots were developed by using Enhanced Chemiluminescence (ECL, Absin Bioscience, China), scanned and analyzed by Fluor Chem Q Imaging System (Cell & Bioscience, USA).

Rapamycin, a specific mTOR inhibitor, was employed as a model to detect whether As affects the autophagy in MLTC-1 cells. Rapamycin (Solarbio, China) was added to the culture medium of MLTC-1 cells at a final concentration of 20 nM in the mTOR inhibition groups and incubated for 1 h. The cells inhibited by rapamycin were divided into two groups, which were treated with 0 and 9 μM As2O3, respectively. Meanwhile, the normal MLTC-1 cells exposed with 9 μM As2O3 or not were looked as the comparison and the blank control. After 24 hs exposure period, the total protein content of MLTC-1 cells from all four groups was extracted for analyzing the expression levels of autophagy maker proteins. 2.8. RNA interference targeting Beclin1 Three pairs of specific small interfering RNA (siRNA) and one nontargeting (as negative control) siRNA sequences were designed based on the mRNA sequences of Beclin1 in mouse obtained from NCBI (NM_019584.3), and were constructed by GenePharma (Shanghai, China). The siRNA sequences were shown in Table 2. Transfection reagent siRNA-Mate™ (GenePharma, China) and siRNA pools were preincubated at room temperature for 10 min in serum-free media to facilitate formation of siRNA-siRNA-Mate complexes. 10, 30, 50, 80 and 100 nM siRNA concentrations were screened to test the transfected system. Fluorescence FAM-siRNA was used to monitor transfected

2.6. Immunofluorescence MLTC-1 cells were seeded onto glass cover slips and allowed to adhere for overnight incubation. Then, the cells were washed 3 times with PBS (3 min each) and fixed by 4 % paraformaldehyde (Boster Biological Technology, China) for 15 min at room temperature. After that, the cells were washed with PBS for 3 times (5 min each), followed Table 1 Primer sequences and product size of target genes for QRT-PCR. Genes

GenBank access No.

Primer sequence (5′-3′)

Product size (bp)

β-actin

NM_007393.5

233

LC3

NM_026160.4

Beclin1

NM_019584.3

Atg7

NM_001253717.1

P62

NM_001290769.1

mTOR

NM_020009.2

ULK1

NM_009469.3

Atg13

NM_145528.3

Vps34

NM_181414.5

Vps15

NM_001081309.1

Atg14

NM_172599.4

UVRAG

NM_178635.3

Rubicon

NM_001200038.1

Forward: AGACTTCGAGCAGGAGATGG Reverse: GCACTGTGTTGGCATAGAGG Forward: GATAATCAGACGGCGCTTGC Reverse: ACTTCGGAGATGGGAGTGGA Forward: CTCTGAAACTGGACACGAGC Reverse: CCTGAGTTAGCCTCTTCCTCC Forward: TGTGGCTAGGACACTGATGG Reverse: TCACGGGATTGGAGTAGGAG Forward: ACAGCCAGAGGAACAGATGG Reverse: GGAGGGTGCTTCGAATACTG Forward: TGTGAACGGAACATACGACC Reverse: TTGCTTGCCCATCAGAGTCAG Forward: AGTTCTGGAGATTGCAGCCC Reverse: ACCACACTTTCCTGGAGCTG Forward: TGGCGGAAGATTTGGACTCC Reverse: GGGTTTCCACAAAGGCATCG Forward: AGAGTGCTCTTATGCCTGCC Reverse: TCTTGACGCAAGTCGTCTCC Forward: CATGCTGTTCCGGCAGTATGT Reverse: GACTCCAGATTTGTGCGCTTG Forward: CTGGCCTTGTCACCATATCC Reverse: GCAGGCAAAGTACCAACCAC Forward: CGTGGAGGAGTCTTGACTTTG Reverse: CCCAAGTACTTCAGCCCATC Forward: TGTGGAAGGTTTGGTGTCAG Reverse: TGGATGAGCCCATGATACAG

3

99 124 83 240 117 81 84 94 136 120 148 108

Journal of Hazardous Materials 391 (2020) 122227

C. Liang, et al.

efficiency using fluorescence microscopy. The best siRNA and transfected system were screened for further As2O3 treatment and evaluation of Beclin1, LC3, Atg7, and p62 expressions (Figure S2). And then, MLTC-1 cells were seeded in 6-well plate and stably transfected at 80 % confluence with siRNA-1 at a final concentration of 50 nM using siRNAmate™. After 24 hs, cell samples were harvested to detect the expression of Beclin 1, LC3, Atg7, and p62 at both mRNA and protein levels.

Table 2 Beclin1 siRNA sequences. siRNA siRNA-1 siRNA-2 siRNA-3 non-targeting siRNA (Negative control)

Sequence (5′-3′) Sense strand Antisense strand Sense strand Antisense strand Sense strand Antisense strand Sense strand Antisense strand

GAUGGUGUCUCUCGAAGAUTT AUCUUCGAGAGACACCAUCTT GCUCCAUGCUUUGGCCAAUTT GCUCCAUGCUUUGGCCAAUTT

2.9. Vps34/PI3K inhibition

GGUACCGACUUGUUCCCUATT UAGGGAACAAGUCGGUACCTT

Vps34/PI3K selective inhibitor 3-methyladenine (3-MA) was purchased from Selleck (Shanghai, China). 3-MA was dissolved in PBS at a concentration of 250 mM in 60 °C water bath and maintained as stock solution. After several pre-experiments, the final concentration of 5 mM 3-MA and one hour-preincubation presented the best inhibition effectiveness in MLTC-1 cells. And then, the healthy MLTC-1 cells were

UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT

Fig. 1. Accumulation of autophagosomes in MLTC-1 cells treated with 0, 3, 6, and 9 μM As2O3 for 24 h. (A–L) Acidic lysosomes labelled with Lyso-Tracker Red (Red color), shows an increased accumulation of autophagosomes with an increase in the concentration of As2O3. (M–P) Random images from the cells after MDC staining in control and three experimental groups. Fluorescent regions (green color) indicate MDC positive-cells.(Q–R)Quantitative analysis results of Lyso-Tracker labelled acid lysosomes and MDC-labeled autophagic vacuoles, respectively. The values are presented as mean ± SD. *** p﹤0.001, * p﹤0.05 indicate significant differences compared to the control. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article). 4

Journal of Hazardous Materials 391 (2020) 122227

C. Liang, et al.

divided into four groups: one is the control group without any treatments; the second group treated with 9 μM As2O3 which is the arsenic treatment group; the third group is the 3-MA treatment group alone, and the fourth group treated with combination of 9 μM As2O3 As2O3 and 3-MA. After 24 h, the cells were harvested for protein extraction. The autophagy related proteins LC3, Atg7, and p62 were detected by western blotting.

were elevated significantly compared to the control group (Fig. 1). This demonstrated that arsenic exposure caused accumulation of autophagosomes in MLTC-1 cells. 3.2. Effects of As2O3 on autophagy markers expressions To further confirm the accumulation of autophagosomes induced by arsenic, the transcript and translation levels of autophagic markers like LC3, Beclin1, Atg7, and p62 in MLTC-1 cells were examined by qPCR and western blotting respectively (Fig. 2). Compared with the control group, mRNA expression levels of LC3 (P < 0.001), Beclin 1 (P < 0.05) and Atg7 (P < 0.05) were significantly up-regulated in MLTC-1 cells exposed to 9 μM As2O3, and a significant increase in p62 mRNA expression occurred in 6 μM As2O3 group (P < 0.05). From the protein levels, the ratio of LC3-II/LC3-I, which is looked as the gold standard to monitor autophagosome formation, was markedly increased in 9 μM As2O3 group compared to the control group (P < 0.05). Similarly, the protein expression levels of Beclin1, Atg7, and p62 were also significantly up-regulated in MLTC-1 cells exposed to 9 μM As2O3 (P < 0.05, P < 0.01, P < 0.01, respectively). Combined with the previous qualitative results, we clearly revealed that the occurrence of autophagosomes was increased and arsenic exposure induced dysfunctional autophagy in testicular stromal cells.

2.10. Statistical analyses In cell viability assays, the data are normalized to control cells and expressed as the percentage of live cells relative to total cells. The data were analyzed using one-way analysis of variance (ANOVA) and unpaired t-test (P < 0.05), using the Graph Pad Prism 7 software (San Diego, CA, USA). Data are reported as mean ± SEM. 3. Results 3.1. Appearance of autophagolysosome in MLTC-1 cells According to MTT results (Figure S1), IC50 of As2O3 treated with MLTC-1 cells for 24 h was 94.28 μM with 95 % confidence interval of 84.79–104.8 μM. Hence, 3, 6 and 9 μM As2O3 were selected as exposure doses to treat MLTC-1 cells. Lyso-tracker is a-fluorescent dye for labeling and tracking acidic organelles in live cells thus can track and reflect the acid lyosomes (Sui et al., 2015), and Monodansylcadaverine (MDC) is autophagic vacuole dye (Zhang et al., 2017). Therefore we used them to observe qualitatively the appearance of autophagolysosome after arsenic exposure. From images, the relative fluorescence intensity of Lyso-Tracker Red and MDC staining were significantly increased in 3, 6 and 9 μM As2O3 exposed cells. Further analysis showed that the levels of acidic lysosomes in 9 μM As2O3 group and the fluorescence intensity of MDC positive-cells in 6- and 9 μM As2O3 group

3.3. Effects of As2O3 on mTOR pathway during autophagy Rapamycin, an inhibitor of mTOR was used to evaluate the role of mTOR pathway in the regulation of arsenic-induced autophagy in MLTC-1 cells. Marker proteins LC3, Atg7 and p62 expressions were evaluated by western blot. The results showed that the ratio of LC3-II/ LC3-I and Atg7 expression were significantly increased by treatment with 9 μM As2O3 alone compared to the control (P < 0.05), correspondingly, under the condition of rapamycin pre-treatment, there

Fig. 2. Changes in the expressions of autophagy key markers in mRNA and protein levels induced by As2O3. (A–D) MRNA expression levels of LC3, Beclin1, Atg7, p62 as detected by qPCR. All data were expressed as relative values against their respective control group. The values are presented as mean ± SEM (n = 5). (E–H) Protein expressions levels of LC-3 II/I, Beclin1, Atg7, p62 as evaluated by Western blot analysis. β-actin was used as an internal control. The values are presented as mean ± SEM (n = 5). *** p﹤0.001, ** p﹤0.01, * p﹤0.05 indicate significant differences compared to the control. 5

Journal of Hazardous Materials 391 (2020) 122227

C. Liang, et al.

were no significant differences in the protein levels of LC3-II/LC3-I and Atg7 either arsenic treatment or not (Fig. 3). Meanwhile, the expression level of p62 was significantly up-regulated by As2O3 treatment and down-regulated with rapamycin treatment (P < 0.001). Prior to As exposure, rapamycin treatment decreased p62 expression compared to non-rapamycin pre-treatment (P < 0.01; Fig. 3D). These results indicate that mTOR pathway maybe involve during As-induced autophagosome formation in MLTC-1 cells. In addition, Atg7 expression level was high in Rapa pre-treatment group alone comparing with the controls. The protein levels of LC3-II/LC3-I and Atg7 in rapamycin plus arsenic treatment group were not changed comparing with arsenic treatment alone. These differences illustrate that other regulation mechanisms, not only mTOR pathway, maybe play a role in arsenic-induced autophagosome formation in MLTC-1 cells.

siBeclin-1. These data imply that not merely Beclin1 involves in As2O3–induced autophagy in MLTC-1 cells. 3.5. Vps34/PI3K involved in As2O3 induced autophagosomes formation Vps34 is a key regulator of autophagy which interacts with Beclin1, so Vps34 expression levels in MLTC-1 cells exposure to different dose of arsenic were determined by qPCR and immunofluorescence. The results showed that both mRNA and protein levels of Vps34 increased significantly by 9 μM As2O3 treatments for 24 hs (Fig.5). Furthermore, 3MA, a selective inhibitor of Vps34/PI3K, was employed to evaluate whether Vps34/PI3K involve in arsenic-induce autophagosomes formation in MLTC-1 cells. From data, the values of LC3-II/LC3-I, Atg7 and p62 expressions were upregulated significantly in the arsenic treatment groups compared to the controls. However, Atg7 and p62 expressions in As2O3 plus to 3-MA treatment groups have not changed compared to 3MA treatment alone, except for slight divergence in LC3-II/LC3-I value. Moreover, 3-MA treatment alone or together with arsenic changed significantly the expressions levels of LC3-II/LC3-I and p62 compared to the control or without 3-MA treatment groups whatever arsenic was treated or not, yet Atg7 expression level was not altered by 3-MA treatment. These results suggest that the mechanism of arsenic-induced autophagy in MLTC-1 cells is more complex and Vps34/PI3K pathway maybe play a vital role in this process.

3.4. Effects of As2O3 on Beclin1-dependent autophagy To clarify if arsenic-induced autophagy is Beclin-1-dependent, Beclin1 RNAi model was employed in this study. According to the results of inhibition concentration and efficiency test (Figure S2), 50 nM Beclin1 siRNA (siRNA-1) can carry out the best inhibition percent to Beclin1 in MLTC-1 cells. The down-regulated Beclin1 expression in protein level is obvious in siRNA transfected group compare with the control and non-targeting siRNA (negative control) groups respectively. Moreover, the protein expression levels of Beclin1, LC3-II/LC3-I, Atg7, and p62 were increased significantly by 9 μM As2O3 treatment again compare with the control group (0 μM As2O3), however, under the conditions of Beclin1 siRNA knockdown, no significant differences of these four proteins expressions were observed between arsenic plus Beclin1 siRNA co-treatment and Beclin1 siRNA treatment alone (Fig. 4). Furthermore, the decreased Beclin1 and increased p62 levels were shown in arsenic plus Beclin1 siRNA co-treatment croups compared with the arsenic treatment alone, while LC3-II/LC3-I and Atg7 were not significantly changed between the two groups. Besides, Beclin1 siRNA pre-treatment decreased the ratio of LC3-II/LC3-I and upregulated significantly p62 expression compare to the controls, while Atg7 expression level in MLTC-1 cells was not changed by pre-treating with

3.6. Expressions of genes related to mTOR pathway and Beclin1-Vps34/ PI3K complex components The mRNA expression levels of mTOR pathway regulated genes like mTOR, ULK1, Atg13 were detected by qPCR. In comparison to the control group, mRNA expression levels of ULK1 (P < 0.05, Fig. 6B) was significantly increased in cells exposed to 9 μM As2O3. However, no significant changes were observed in mTOR and Atg13 mRNA expression levels (Fig. 6A and 6C). Four genes Vps15, Atg14, UVRAG, and Rubicon constituting Beclin1-Vps34 complex were also investigated in this study. Exposure to 9 μM As2O3 led to a significant increase in Atg14 (P < 0.05, Fig. 6E) and UVRAG (P < 0.01, Fig. 6F) mRNA expression Fig. 3. Role of mTOR pathway in As2O3-induces autophagy in MLTC-1 cells. (A) The typical western blot bands of LC3, Atg7, p62 expressions in MLTC-1 cells treated with 9 μM As2O3 for 24 h and/or 20 nM Rapamycin for 1 h. (B–D) The quantitative analysis results of LC3-II/I, Atg7, p62 expressions respectively in MLTC-1 cells. Data are shown as mean ± SEM (n = 5). *** p﹤0.001, ** p﹤0.01, * p﹤0.05 indicate significant differences compared to the control, ns indicates no significant difference.

6

Journal of Hazardous Materials 391 (2020) 122227

C. Liang, et al.

Fig. 4. Role of Beclin1 pathway in As2O3 induces autophagy in MLTC-1 cells.. (A–D) Protein expression levels of Beclin1, LC3, Atg7, and p62 in MLTC-1 cells in the control, transfected with non-targeting (negative control, NC) siRNA, Beclin1 siRNA, and 9 μM As2O3 treatment groups. β-actin was used as an internal control. Each bar represents means ± SEM (n = 5). **p ﹤0.01, *p ﹤0.05 indicates significant differences compared to the respective paired group.

levels with no significant changes in Vps15 (Fig. 6D) and Rubicon (Fig. 6G) mRNA expression levels. The results showed that As had a profound effect on the genes associated with Beclin1-Vps34 complex.

autophagosomes, which engulf the cargo and transport it to the vacuole/lysosome for breakdown and recycling (Parzych and Klionsky, 2014; White et al., 2015). In this study, we observed qualitatively a significant accumulation of autophagosomes in MLTC-1 cells exposure to As through the methods of Lyso-Tracker Red (Biederbick et al., 1995) and Monodansylcadaverine (MDC) staining (Wu et al., 2015). Furthermore, the mRNA and protein expression levels of autophagic markers LC3, Beclin1, Atg7 and P62 were significantly increased by As. In particular, the LC3-II/LC3-I value which is well considered as a gold standard to monitor the occurrence of autophagosome formation was markedly elevated in MLTC-1 cells by 9 μM As2O3 treatment for 24 h. These consequences revealed that arsenic exposure induced dysfunctional autophagy in testicular stromal cells. The results are similar to other types of cells’s response to arsenic. For example, Li et al. (2014) reported a significant increase in the expression levels of Beclin1, LC3 in Burkitt’s lymphoma Raji cells exposed to As2O3. Manthari et al. (2018) from our laboratory showed that maternal exposure As2O3 caused a significant increase of Beclin1, LC3, and Atg12 expression levels in the brain regions of mice. Lots of literatures have shown that mTOR is one of major signal pathways related to the regulation of autophagy (Kumar et al., 2014; Wang et al., 2016a,b; Mi et al., 2016). Our pervious study has proved that phosphorylation of mTOR is involved in fluoride-induced autophagosome formation and contribute to the elucidation of the underlying mechanisms of fluoride-induced male reproductive toxicity (Zhang et al., 2017). Another work from our group found that arsenic induces autophagy in developmental mouse cerebral cortex and hippocampus by inhibiting PI3K/Akt/mTOR signalling pathway (Manthari et al., 2018a). In the present study, we found that the changed expressions of autophagy marker proteins LC3, Atg7 and p62 caused by arsenic had resumed when the MLTC-1 cells treated with rapamycin (a special inhibitor of mTOR pathway) during arsenic exposure. The results

4. Discussion Now-a-days, assessment of autophagy during metal-induced reproductive toxicity is a significant issue owing to an increased ecotoxicological data looking at the impact of environmental pollutants on male reproductive system. Arsenic (As), as a widespread environmental pollutant, occupies the 1st rank of the ATSDR’s Substance Priority List in 2017 and has adverse affects on male reproductive function (Ahmad, 2008; Guvvala et al., 2016; Souza et al., 2016; da Silva et al., 2017; de Araujo et al., 2017; Han et al., 2020). Meanwhile, there are more than 150 articles about arsenic and autophagy that have been published, including several papers about arsenic-induced autophagy in cells or tissues of reproductive system (Smith et al., 2010; Wang et al., 2017, 2018). However, mostly published studies focused on variety of cancer cells (Qian et al., 2007; Yang et al., 2008; Bolt et al., 2010; Liu et al., 2012; Li et al., 2014; Chiu et al., 2015) and somatic cells or tissues including brain (Manthari et al., 2018a, 2018b), skeletal muscles (Wang et al., 2018) and liver (Wang et al., 2020). The mechanism involved in As mediate-autophagy in male reproductive system is lack. The present study firstly reveals that arsenic induces dysfunctional autophagy via dual regulation of mTOR pathway and Beclin1-Vps34/PI3K complex in MLTC-1 cells, and provides a novel interpretation to how As induces male reproductive toxicity. Autophagy plays a key role in maintaining intracellular homeostasis by degrading intracellular macromolecules and damaged organelles, and both excessive and repressed autophagy levels are pernicious in cells (Costa et al., 2016; Ward et al., 2016). Autophagy is characterized by the formation of double-membrane bound vesicles called 7

Journal of Hazardous Materials 391 (2020) 122227

C. Liang, et al.

Fig. 5. As2O3 induces autophagosomes formation via regulation of Vps34/PI3K. (A) Effect of arsenic on Vps34 mRNA expression levels as detected by qPCR and the results are presented as mean ± SEM (n = 5). * p﹤0.05 shows significant differences compared to the control group. (B) Immunofluorescent staining (IF) images of Vps34 protein expression in MLTC-1 treated with 0, 3, 6, and 9 μM As2O3 for 24 h. The green color indicates the Vps34 protein and DAPI stains the cell nuclei. (C) The quantitative analysis of fluorescence intensity to IF results by IMC software. ** p﹤0.01 indicate significant differences compared to the control. (D–F) Western blot analysis results of LC3 II/I, Atg7, and p62 expression in absence or presence of 3-MA and As2O3. 3-methyladenine (3-MA) was used as the specific inhibitor of Vps34/ PI3K and pre-treated for 1 h before exposure to 9 μM As2O3. β-actin was used as a loading control. Data are presented as means ± SEM (n = 5). *** p﹤0.001, ** p﹤ 0.01, * p﹤0.05 indicate significant differences compared to the control, ns indicates no significant difference. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article).

observed in this study are consistent with other cells models from available literatures (Chung and Chang, 2003; Alexander et al., 2010; Wang et al., 2017; Li et al., 2018). Accordingly, it can be demonstrated that mTOR pathway might be mediate As-induced autophagosomes formation in MLTC-1 cells.

On the other hands, the Beclin1-Vps34 complex is also involved in the molecular mechanisms that regulate the autophagy as an important autophagic initiation regulator. Beclin1 (yeast Atg6) is the first identified autophagy related gene and generally binds to Vps34 (vacuolar sorting protein 34) during autophagy initiation in mammals (Zhong 8

Journal of Hazardous Materials 391 (2020) 122227

C. Liang, et al.

Fig. 6. Alterations in mRNA expressions of genes related to mTOR pathway and Beclin1-Vps34/PI3K complex induced by As2O3 in MLTC-1 cells. (A–C) The mRNA expressions of mTOR and its downstream genes (ULK1, Atg13) in MLTC-1 cells exposed to As2O3. β-actin was used as housekeeper gene. The values are presented as mean ± SEM (n = 5). *** p﹤0.001, ** p﹤0.01, * p﹤0.05 indicate significant differences compared to the control. (D–G) The mRNA expression changes in Vps15, Atg14, UVRAG, Rubicon regulated by Beclin1-Vps34 complex in MLTC-1 cells exposed to As2O3. The values are presented as mean ± SEM (n = 4). ** p ﹤0.01, *p ﹤ 0.05 show significant differences compared to the control group.

et al., 2014; Sun et al., 2015). The autophagy induced by arsenic via Beclin-1 pathway have been reported in leukemia cell lines and ovarian carcinoma cells (Qian et al., 2007; Smith et al., 2010). Therefore, we struggled to explore the potential function of Beclin1 or/and Vps34/ PI3K in As-induced autophagy in MLTC-1 cells by using Beclin1 siRNA and 3-methyladenine (3-MA) respectively in the present study. The results further demonstrated that arsenic increased significantly the protein expression levels of Beclin1, LC3-II/LC3-I, Atg7, and p62, while Beclin1 siRNA knockdown weaken the changed difference caused by arsenic treatment in MLTC-1 cells. Similarly, arsenic exposure enhanced markedly the expression levels of Vps34 expressions and autophagy related proteins, while Vps34/PI3K inhibition by 3-MA treatment down-regulated LC3-II/LC3-I ratio and eliminated partially the effects of As-induced autophagy. All these suggest that both Beclin1 and Vps34/PI3K involves in arsenic-induces autophagosomes formation in MLTC-1 cells. It should be noted that p62, as a marker to study autophagic flux, has not been decreased when autophagy is induced by As compared with the majority of studies. Instead, p62 expression was significantly up-regulated in MLTC-1 cells treated with either arsenic alone, or combination with Beclin1 siRNA or Vps34 inhibitor. This phenomenon indicated that As blocked autophagy flux, which meant autophagosomes were formed but have not be degraded. Interestingly, the process is dependent on mTOR signal pathway and has not been affected by Beclin1-Vps34 complex. Even the unchanged Rubicon expression levels

by As also implied that autophagosomes were accumulated and degradation blocked in this study. P62, binds directly to LC3, is itself degraded by autophagy and may serve to link ubiquitinated proteins to the autophagic machinery to enable their degradation in the lysosome (Johansen and Lamark, 2011). Previous studies have shown that defects in autophagy function can lead to genetic instability and p62 protein aggregation (Riley et al., 2011; Lau et al., 2013; Simon et al., 2017). A significant increase in p62 levels as a result of Nrf2 alteration in skin cancer caused by As has been reported (Shah et al., 2017). There are also studies suggested that arsenic disrupted lysosomal membrane integrity and blocked autophagic flux through inhibiting autophagosome and lysosome fusion (Bolt et al., 2010; Wang et al., 2016a,b; Dodson et al., 2018). Therefore, the dysregulation of autophagy and the blockage of autophagosomes degradation might be due to impaired function of lysosomes induced by arsenic in MLTC-1 cells. In addition, autophagic negative regulator mTOR, positive regulators ULK1 and Atg13 participate in autophagy process through mTOR signalling pathway (Bhaskar and Hay, 2007; Jung et al., 2010; Wan et al., 2017), Autophagy can also be enhanced by the mutual increase between ULK1 complex and Beclin1-Vps34/PI3K complex which are composed of Becin1, Vps34, Vps15, Atg14, UVRAG, and Rubicon (Wirth et al., 2013). In this study, up-regulated mRNA expressions caused by arsenic appeared in ULK1, as well as in Becin1, Vps34, Atg14 and UVRAG except for Vps15 and Rubicon. Coincidentally, ULK1 phosphorylates Atg14 to promote autophagy occurrence (Park et al., 9

Journal of Hazardous Materials 391 (2020) 122227

C. Liang, et al.

Fig. 7. Suggested regulative mechanistic pathway underlying As-induced autophagy in MLTC-1 cells. Arsenic exposure induces autophagosomes formation and alterations of autophagy makers LC3, Atg7, Beclin1 and p62 at the gene and protein expression levels in testicular stromal cells (MLTC). Beclin1-Vps34/PI3K complex and mTOR pathway play the pivotal role in this dysfunctional autophagy regulation.

2016). Combination with these results implicated that arsenic exposure caused autophagy dysfunction via dual regulation of mTOR pathway and beclin1-Vps34/PI3K complex in MLTC-1 Cells (Fig. 7). As for the unchanged the mRNA expressions of mTOR, Atg13, Atg15, and Rubicon in this study or other genes involve in arsenic-induced autophagy, there is still unclear. Even so, the protein expression changes of LC3-II/LC3-I, Atg7 and p62 expressions, as the general makers of autophagy, are not always consistent in response to Rapamycin treatment and Beclin1 siRNA, as well as 3-MA treatment. That variability further implies that the regulative mechanism by which arsenic-induced autophagy in MLTC-1 cells is more complex and further research is indispensable with regards to the concerns.

Writing - review & editing, Visualization, Project administration, Funding acquisition. Zhiyuan Feng: Conceptualization, Methodology, Writing - original draft, Investigation. Ram Kumar Manthari: Writing review & editing, Visualization. Chong Wang: Writing - review & editing, Writing - original draft. Yongli Han: Methodology. Weixiang Fu: Data curation. Jundong Wang: Project administration. Jianhai Zhang: Conceptualization, Writing - review & editing, Validation, Supervision, Project administration, Funding acquisition. Declaration of Competing Interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

5. Conclusions

Acknowledgements

Taken together, the present study revealed that arsenic exposure induced autophagosomes formation and alterations of autophagy makers at the gene and protein expression levels in testicular stromal cells. Beclin1-Vps34/PI3K complex and mTOR pathway play the pivotal role in this dysfunctional autophagy regulation. Meanwhile, arsenic also blocked the autophagosomes degradation depended on mTOR pathway and caused p62 and autophagosomes accumulation by potentially damaging the function of lysosomes. This study provides not only a new sight to elucidate the underlying mechanism by which As-induced male reproductive toxicity, but also helpful to evaluate health risk of various hazardous materials.

This work was supported by the National Natural Science Foundation of China (Grant No. 31741120), Natural Science Foundation of Shanxi Province (Grant No. 201901D111233), Top Youth Talent Plan of Shanxi Province, and Key Science Research and Development Project of Shanxi Province (No. 201903D211008). Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.jhazmat.2020.122227.

Compliance with ethical standards

References

All regulations of the Institutional Animal Care and Use Committee of Shanxi Agricultural University were strictly followed during the experiment to protect the welfare of the animals.

Agency for toxic substances and disease registry (ATSDR), 2017. Priority List of Hazardous Substances. https://www.atsdr.cdc.gov/spl/#2017spl. Ahmad, I., 2008. Arsenic induced microscopic changes in rat testis. Prof. Med. J. 287–291. http://www.theprofesional.com/index.php/tpmj/issue/view/96. Alamdar, A., Xi, G., Huang, Q., Tian, M., Eqani, S., Shen, H., 2017. Arsenic activates the expression of 3beta-HSD in mouse Leydig cells through repression of histone H3K9 methylation. Toxicol. Appl. Pharmacol. 326, 7–14. https://doi.org/10.1016/j.taap. 2017.04.012. PMID: 28414027.

CRediT authorship contribution statement Chen Liang: Conceptualization, Resources, Formal analysis, 10

Journal of Hazardous Materials 391 (2020) 122227

C. Liang, et al. Alexander, A., Cai, S.L., Kim, J., Nanez, A., Sahin, M., MacLean, K.H., et al., 2010. ATM signals to TSC2 in the cytoplasm to regulate mTORC1 in response to ROS. Proc Natl Acad Sci U S A 109 (21), 4153–4158. https://doi.org/10.1073/pnas.0913860107. PMID: 20160076. Baris, D., Waddell, R., Beane Freeman, L.E., Schwenn, M., Colt, J.S., Ayotte, J.D., et al., 2016. Elevated bladder cancer in northern New England: the role of drinking water and arsenic. J. Natl. Cancer Inst. 108 (9). https://doi.org/10.1093/jnci/djw099. pii: djw099. PMID: 27140955. Bhaskar, P.T., Hay, N., 2007. The two TORCs and akt. Dev. Cell 12 (4), 487–502. https:// doi.org/10.1016/j.devcel.2007.03.020. PMID: 17419990. Biederbick, A., Kern, H.F., Elsässer, H.P., 1995. Monodansylcadaverine (MDC) is a specific in vivo marker for autophagic vacuoles. Eur. J. Cell Biol. 66 (1), 3–14 PMID: 7750517. Bolt, A.M., Douglas, R.M., Klimecki, W.T., 2010. Arsenite exposure in human lymphoblastoid cell lines induces autophagy and coordinated induction of lysosomal genes. Toxicol. Lett. 199 (2), 153–159. https://doi.org/10.1016/j.toxlet.2010.08.017. PMID: 20816728. Chang, S.I., Jin, B., Youn, P., Park, C., Park, J.D., Ryu, D.Y., 2007. Arsenic-induced toxicity and the protective role of ascorbic acid in mouse testis. Toxicol. Appl. Pharmacol. 218 (2), 196–203. https://doi.org/10.1016/j.taap.2006.11.009. PMID: 17188728. Chiou, T.J., Chu, S.T., Tzeng, W.F., Huang, Y.C., Liao, C.J., 2008. Arsenic Trioxide impairs spermatogenesis via reducing gene expression levels in testosterone synthesis pathway. Chem. Res. Toxicol. 21 (8), 1562–1569. https://doi.org/10.1021/ tx700366x. PMID: 18630931. Chiu, H.W., Tseng, Y.C., Hsu, Y.H., Lin, Y.F., Foo, N.P., Guo, H.R., et al., 2015. Arsenic trioxide induces programmed cell death through stimulation of ER stress and inhibition of the ubiquitin-proteasome system in human sarcoma cells. Cancer Lett. 356 (2 Pt B), 762–772. https://doi.org/10.1016/j.canlet.2014.10.025. PMID: 25449439. Chung, Y.C., Chang, Y.F., 2003. Serum interleukin-6 levels reflect the disease status of colorectal cancer. J. Surg. Oncol. 83 (4), 222–226. https://doi.org/10.1002/jso. 10269. PMID: 12884234. Costa, L., Amaral, C., Teixeira, N., Correia-da-Silva, G., Fonseca, B.M., 2016. Cannabinoid-induced autophagy: protective or death role? Prostaglandins Other Lipid Mediat. 122, 54–63. https://doi.org/10.1016/j.prostaglandins.2015.12.006. PMID: 26732541. da Silva, R.F., Borges, C.D.S., de Almeida Lamas, C., Cagnon, V.H.A., de Grava Kempinas, W., 2017. Arsenic trioxide exposure impairs testicular morphology in adult male mice and consequent fetus viability. J Toxicol Environ Health A 80 (19-21), 1166–1179. https://doi.org/10.1080/15287394. PMID: 289567192017.1376405. de Araujo Ramos, A.T., Diamante, M.A.S., de Almeida Lamas, C., Dolder, H., de Souza Predes, F., 2017. Morphological and morphometrical changes on adult Wistar rat testis caused by chronic sodium arsenite exposure. Environ. Sci. Pollut. Res. Int. 24 (36), 27905–27912. https://doi.org/10.1007/s11356-017-0200-2. PMID: 28988284. Dodson, M., Liu, P., Jiang, T., Ambrose, A., Luo, G., Montserrat, R., et al., 2018. Increased O-GlcNAcylation of SNAP29 drives arsenic-induced autophagic dysfunction. Mol. Cell. Biol. 38 (11), e00595–17. https://doi.org/10.1128/MCB.00595-17. PMID: 29507186. Fan, Y., Jiang, Y., Hu, P., Chang, R., Yao, S., Wang, B., et al., 2016. Modification of association between prior lung disease and lung cancer by inhaled arsenic: a prospective occupational-based cohort study in Yunnan. China. J Expo Sci Environ Epidemiol 26 (5), 464–470. https://doi.org/10.1038/jes.2016.22. PMID: 27072426. Feng, Z., Liang, C., Manthari, R.K., Wang, C., Zhang, J., 2019. Effects of fluoride on autophagy in mouse Sertoli cells. Biol. Trace Elem. Res. 187 (2), 499–505. Guvvala, P.R., Sellappan, S., Parameswaraiah, R.J., 2016. Impact of arsenic(V) on testicular oxidative stress and sperm functional attributes in Swiss albino mice. Environ. Sci. Pollut. Res. Int. 23 (18), 18200–18210. https://doi.org/10.1007/s11356-0166870-3. PMID: 27265425. Han, Y., Liang, C., Manthari, R.K., Yu, Y., Gao, Y., Liu, Y., et al., 2020. Arsenic influences spermatogenesis by disorganizing the elongation of spermatids in adult male mice. Chemosphere 238, 124650. https://doi.org/10.1016/j.chemosphere.2019.124650. PMID: 31472347. Huang, Q., Luo, L., Alamdar, A., Zhang, J., Liu, L., Tian, M., et al., 2016. Integrated proteomics and metabolomics analysis of rat testis: mechanism of arsenic-induced male reproductive toxicity. Sci. Rep. 6, 32518. https://doi.org/10.1038/srep32518. PMID: 27585557. Itakura, E., Mizushima, N., 2009. Atg14 and UVRAG: mutually exclusive subunits of mammalian Beclin 1-PI3K complexes. Autophagy 5 (4), 534–536. https://doi.org/10. 4161/auto.5.4.8062. PMID: 19223761. Itakura, E., Kishi, C., Inoue, K., Mizushima, N., 2008. Beclin 1 forms two distinct phosphatidylinositol 3-kinase complexes with mammalian Atg14 and UVRAG. Mol. Biol. Cell 19 (12), 5360–5372. https://doi.org/10.1091/mbc.e08-01-0080. PMID: 18843052. Johansen, T., Lamark, T., 2011. Selective autophagy mediated by autophagic adapter proteins. Autophagy 7 (3), 279–296. https://doi.org/10.4161/auto.7.3.14487. PMID: 21189453. Jung, C.H., Ro, S.H., Cao, J., Otto, N.M., Kim, D.H., 2010. mTOR regulation of autophagy. FEBS Lett. 584 (7), 1287–1295. https://doi.org/10.1016/j.febslet.2010.01.017. Kim, K.H., Lee, M.S., 2014. Autophagy-a key player in cellular and body metabolism. Nat. Rev. Endocrinol. 10 (6), 322–337. https://doi.org/10.1038/nrendo.2014.35. PMID: 24663220. Kumar, D., Shankar, S., Srivastava, R.K., 2014. Rottlerin induces autophagy and apoptosis in prostate cancer stem cells via PI3K/Akt/mTOR signaling pathway. Cancer Lett. 343 (2), 179–189. https://doi.org/10.1016/j.canlet.2013.10.003. PMID:2412581. Lau, A., Zheng, Y., Tao, S., Wang, H., Whitman, S.A., White, E., et al., 2013. Arsenic inhibits autophagic flux, activating the Nrf2-Keap1 pathway in a p62-dependent

manner. Mol. Cell. Biol. 33 (12), 2436–2446. https://doi.org/10.1128/MCB.0174812. PMID: 23589329. Li, C.L., Wei, H.L., Chen, J., Wang, B., Xie, B., Fan, L.L., et al., 2014. Arsenic trioxide induces autophagy and antitumor effects in Burkitt’s lymphoma Raji cells. Oncol. Rep. 32 (4), 1557–1563. https://doi.org/10.3892/or.2014.3369. PMID: 25110043. Li, T., Ma, R., Zhang, Y., Mo, H., Yang, X., Hu, S., et al., 2018. Arsenic trioxide promoting ETosis in acute promyelocytic leukemia through mTOR-regulated autophagy. Cell Death Dis. 9 (2), 75. https://doi.org/10.1038/s41419-017-0018-3. PMID: 29362482. Liang, C., Gao, Y., He, Y., Han, Y., Manthari, R.K., Tikka, C., et al., 2020. Fluoride induced mitochondrial impairment and PINK1-mediated mitophagy in Leydig cells of mice: in vivo and in vitro studies. Environ Pollut 256, 113438. https://doi.org/10.1016/j. envpol.2019.113438. Liu, N., Tai, S., Ding, B., Thor, R.K., Bhuta, S., Sun, Y., et al., 2012. Arsenic trioxide synergizes with everolimus (Rad001) to induce cytotoxicity of ovarian cancer cells through increased autophagy and apoptosis. Endocr. Relat. Cancer 19 (5), 711–723. https://doi.org/10.1530/ERC-12-0150. PMID: 22919067. Manthari, R.K., Tikka, C., Ommati, M.M., Niu, R., Sun, Z., Wang, J., et al., 2018a. Arsenic induces autophagy in developmental mouse cerebral cortex and hippocampus by inhibiting PI3K/Akt/mTOR signaling pathway: involvement of blood-brain barrier’s tight junction proteins. Arch. Toxicol. 92 (11), 3255–3275. https://doi.org/10.1007/ s00204-018-2304-y. PMID: 30225639. Manthari, R.K., Tikka, C., Ommati, M.M., Niu, R., Sun, Z., Wang, J., et al., 2018b. Arsenicinduced autophagy in the developing mouse cerebellum: involvement of the bloodbrain barrier’s tight-junction proteins and the PI3K-Akt-mTOR signaling pathway. J. Agric. Food Chem. 66 (32), 8602–8614. https://doi.org/10.1021/acs.jafc.8b02654. PMID: 30032600. Matsunaga, K., Saitoh, T., Tabata, K., Omori, H., Satoh, T., Kurotori, N., et al., 2009. Two Beclin 1-binding proteins, Atg14L and Rubicon, reciprocally regulate autophagy at different stages. Nat. Cell Biol. 11 (4), 385–396. https://doi.org/10.1038/ncb1846. PMID: 19270696. Mi, Y., Xiao, C., Du, Q., Wu, W., Qi, G., Liu, X., 2016. Momordin Ic couples apoptosis with autophagy in human hepatoblastoma cancer cells by reactive oxygen species (ROS)mediated PI3K/Akt and MAPK signaling pathways. Free Radic. Biol. Med. 90, 230–242 PMID: 26593748, https://doi.org/10.1016/ j.freeradbiomed.2015.11.022. Minina, E.A., Bozhkov, P.V., Hofius, D., 2014. Autophagy as initiator or executioner of cell death. Trends Plant Sci. 19 (11), 692–697. https://doi.org/10.1016/j.tplants. 2014.07.007. PMID: 25156061. Mukhopadhyay, P.K., Dey, A., Mukherjee, S., Pradhan, N.K., 2013. The effect of coadministration of alpha-tocopherol and ascorbic acid on arsenic trioxide-induced testicular toxicity in adult rats. J. Basic Clin. Physiol. Pharmacol. 24 (4), 245–253. https://doi.org/10.1515/jbcpp-2012-0039. PMID: 23950573. Park, J.M., Jung, C.H., Seo, M., Otto, N.M., Grunwald, D., Kim, K.H., et al., 2016. The ULK1 complex mediates MTORC1 signaling to the autophagy initiation machinery via binding and phosphorylating ATG14. Autophagy 12 (3), 547–564. https://doi. org/10.1080/15548627.2016.1140293. PMID: 27046250. Parzych, K.R., Klionsky, D.J., 2014. An overview of autophagy: morphology, mechanism, and regulation. Antioxid. Redox Signal. 20 (3), 460–473. https://doi.org/10.1093/ ars. PMID: 237252952013.5371. Qian, W., Liu, J., Jin, J., Ni, W., Xu, W., 2007. Arsenic trioxide induces not only apoptosis but also autophagic cell death in leukemia cell lines via up-regulation of Beclin-1. Leuk. Res. 31 (3), 329–339. https://doi.org/10.1016/j.leukres.2006.06.021. PMID: 16882451. Riley, B., Kaiser, S., Kopito, R., 2011. Autophagy inhibition engages Nrf2-p62 ub-associated signaling. Autophagy 7 (3), 338–340. https://doi.org/10.4161/auto.7.3. 14780. PMID: 21252622. Roh, T., Lynch, C.F., Weyer, P., Wang, K., Kelly, K.M., Ludewig, G., 2017. Low-level arsenic exposure from drinking water is associated with prostate cancer in Iowa. Environ. Res. 159, 338–343. https://doi.org/10.1016/j.envres.2017.08.026. PMID: 28841521. Sanghamitra, S., Hazra, J., Upadhyay, S.N., Singh, R.K., Amal, R.C., 2008. Arsenic induced toxicity on testicular tissue of mice. Indian J. Physiol. Pharmacol. 52 (1), 84 PMID: 18831356. Shah, P., Trinh, E., Qiang, L., Xie, L., Hu, W.Y., Prins, G.S., et al., 2017. Arsenic induces p62 expression to form a positive feedback loop with Nrf2 in human epidermal keratinocytes: implications for preventing arsenic-induced skin cancer. Molecules 22 (2), E194 PMID: 28125038, https://doi.org/10.3390 molecules22020194. Simon, H., Friis, R., Tait, S., Ryan, K., 2017. Retrograde signaling from autophagy modulates stress responses. Sci. Signal. 10 (468). https://doi.org/10.1126/scisignal. aag2791. pii: eaag2791, PMID: 28246201. Singh, K.P., Jr, D.M.J., 2007. Genetic and epigenetic changes induced by chronic low dose exposure to arsenic of mouse testicular Leydig cells. Int. J. Oncol. 30 (1), 253–260 PMID: 17143536. Smith, D.M., Patel, S., Raffoul, F., Haller, E., Mills, G.B., Nanjundan, M., 2010. Arsenic trioxide induces a beclin-1-independent autophagic pathway via modulation of SnoN/SkiL expression in ovarian carcinoma cells. Cell Death Differ. 17 (12), 1867–1881 PMID: 20508647, https://doi.org/10.1038/ cdd.2010.53. Souza, A.C., Marchesi, S.C., Ferraz, R.P., Lima, G.D., de Oliveira, J.A., Machado-Neves, M., 2016. Effects of sodium arsenate and arsenite on male reproductive functions in Wistar rats. J Toxicol Environ Health A 79 (6), 274–286. https://doi.org/10.1080/ 15287394.2016.1150926. PMID: 27029432. Sui, L., Zhang, R.H., Zhang, P., Yun, K.L., Zhang, H.C., Liu, L., et al., 2015. Lead toxicity induces autophagy to protect against cell death through mTORC1 pathway in cardiofibroblasts. BioSci Reps 35 (2), e00186. https://doi.org/10.1042/BSR20140164. PMID: 25686247. Sun, T., Li, X., Zhang, P., Chen, W.D., Zhang, H.L., Li, D.D., et al., 2015. Acetylation of Beclin 1 inhibits autophagosome maturation and promotes tumour growth. Nat.

11

Journal of Hazardous Materials 391 (2020) 122227

C. Liang, et al. Commun. 6, 7215. https://doi.org/10.1038/ncomms8215. PMID: 26008601. Wan, W., You, Z., Xu, Y., Zhou, L., Guan, Z., Peng, C., et al., 2017. mTORC1 phosphorylates ccetyltransferase p300 to regulate autophagy and lipogenesis. Mol. Cell 68 (2), 323–335. https://doi.org/10.1016/j.molcel.2017.09.020. e326, PMID: 29033323. Wang, B., Abraham, N., Gao, G., Yang, Q., 2016a. Dysregulation of autophagy and mitochondrial function in Parkinson’s disease. Transl. Neurodegener. 5 (19) PMID: 27822367, https://doi.org/10.118 6/s40035-016-0065-1. Wang, R., Zhang, Q., Peng, X., Zhou, C., Zhong, Y., Chen, X., et al., 2016b. Stellettin B induces G1 arrest, apoptosis and autophagy in human nonsmall cell lung cancer A549 cells via blocking PI3K/Akt/mTOR pathway. Sci. Rep. 6, 27071. https://doi.org/10. 1038/srep. PMID: 27243769. Wang, G., Zhang, T., Sun, W., Wang, H., Yin, F., Wang, Z., et al., 2017. Arsenic sulfide induces apoptosis and autophagy through the activation of ROS/JNK and suppression of Akt/mTOR signaling pathways in osteosarcoma. Free Radic. Biol. Med. 106, 24–37 PMID: 28188923, https://doi.org/10.1016/ j.freeradbiomed.2017.02.015. Wang, Y., Zhao, H., Shao, Y., Liu, J., Li, J., Luo, L., Xing, M., 2018. Copper (II) and/or arsenite-induced oxidative stress cascades apoptosis and autophagy in the skeletal muscles of chicken. Chemosphere 206, 597–605. https://doi.org/10.1016/j. chemosphere.2018.05.013. PMID: 29778937. Wang, Y., Zhao, H., Guo, M., Fei, D., Zhang, L., Xing, M., 2020. Targeting the miR-122/ PKM2 autophagy axis relieves arsenic stress. J. Hazard. Mater. 383, 121217. https:// doi.org/10.1016/j.jhazmat.2019.121217. PMID: 31546213. Ward, C., Martinez-Lopez, N., Otten, E.G., Carroll, B., Maetzel, D., Singh, R., et al., 2016. Autophagy, lipophagy and lysosomal lipid storage disorders. Biochim. Biophys. Acta 1861 (4), 269–284. https://doi.org/10.1016/j.bbalip.2016.01.006. PMID: 26778751. White, E., Mehnert, J.M., Chan, C.S., 2015. Autophagy, metabolism, and cancer. Clin. Cancer Res. 21 (22), 5037–5046. https://doi.org/10.1158/1078-0432.CCR-15-0490.

PMID: 26567363. Wirth, M., Joachim, J., Tooze, S.A., 2013. Autophagosome formation–the role of ULK1 and Beclin1-PI3KC3 complexes in setting the stage. Semin. Cancer Biol. 23 (5), 301–309. https://doi.org/10.1016/j.semcancer.2013.05.007. PMID: 23727157. Wu, F., Xu, H.D., Guan, J.J., Hou, Y.S., Gu, J.H., Zhen, X.C., et al., 2015. Rotenone impairs autophagic flux and lysosomal functions in Parkinson’s disease. Neuroscience 284, 900–911 PMID: 25446361, https:// doi.org/10.1016/j.neuroscience.2014.11.004. Yang, Y.P., Liang, Z.Q., Gao, B., Jia, Y.L., Qin, Z.H., 2008. Dynamic effects of autophagy on arsenic trioxide-induced death of human leukemia cell line HL60 cells. Acta Pharmacol. Sin. 29 (1), 123–134. https://doi.org/10.1111/j.1745-7254.2008.00732. x. PMID: 18158874. Zhang, J., Zhu, Y., Shi, Y., Han, Y., Liang, C., Feng, Z., et al., 2017. Fluoride induced autophagy via the regulation of mTOR phosphorylation in mice Leydig cells. J. Agric. Food Chem. 65 (40), 8966–8976. https://doi.org/10.1021/acs.jafc.7b03822. PMID: 28927274. Zhao, H., Wang, Y., Liu, J., Guo, M., Fei, D., Yu, H., Xing, M., 2019. The cardiotoxicity of the common carp (Cyprinus carpio) exposed to environmentally relevant concentrations of arsenic and subsequently relieved by zinc supplementation. Environ. Pollut. 253, 741–748. https://doi.org/10.1016/j.envpol.2019.07.065. PMID: 31344536. Zheng, Y., Flanagan, S.V., 2017. The case for universal screening of private well water quality in the US and testing requirements to achieve it: evidence from arsenic. Environ. Health Perspect. 125, 085002. https://doi.org/10.1289/EHP629. Zhong, Y., Morris, D.H., Jin, L., Patel, M.S., Karunakaran, S.K., Fu, Y.-J., et al., 2014. Nrbf2 Protein suppresses autophagy by modulating Atg14L protein-containing Beclin 1-Vps34 complex architecture and reducing intracellular phosphatidylinositol-3 phosphate levels. J. Biol. Chem. 289 (38), 26021–26037. https://doi.org/10.1074/ jbc.M114.561134. PMID: 25086043.

12