Artificial miRNAs Targeting Mutant Huntingtin Show Preferential Silencing In Vitro and In Vivo

Citation: Molecular Therapy—Nucleic Acids (2015) 4, e234;  doi:10.1038/mtna.2015.7 © 2015 The American Society of Gene & Cell Therapy  All rights reserved 2162-2531/15 www.nature.com/mtna

Artificial miRNAs Targeting Mutant Huntingtin Show Preferential Silencing In Vitro and In Vivo Alex Mas Monteys1, Matthew J Wilson2, Ryan L Boudreau2, Ryan M Spengler2 and Beverly L Davidson1,3

Huntington’s disease (HD) is a dominantly inherited neurodegenerative disease caused by CAG repeat expansion in exon 1 of huntingtin (HTT). Studies in mouse models of HD with a regulated mutant transgene show that continuous mutant allele expression is required for behavioral and pathological signs; when mutant HTT expression declined, neuronal degeneration improved. To date, it is unknown whether neural cells in the adult human brain can tolerate reduction in both normal and mutant alleles. Thus, it may be important to develop allele-specific silencing approaches. Several siRNA sequences targeting the CAG expanded motif or prevalent single-nucleotide polymorphisms (SNPs) in linkage disequilibrium with the mutant allele have been designed and their selectivity demonstrated in vitro. However, it is unknown whether these allele-specific siRNAs will retain their specificity when expressed from artificial RNAi platforms. Here, we designed CAG- and SNP- targeting artificial miRNAs and demonstrate that some, but not all, retained their selectivity in vitro using an allele-specific reporter system and in vivo in a transgenic mouse model developed to express normal and mutant human HTT alleles. Molecular Therapy—Nucleic Acids (2015) 4, e234; doi:10.1038/mtna.2015.7; published online 7 April 2015 Subject Category: siRNAs, shRNAs, and miRNAs and Therapeutic Proof-of-Concept Introduction Huntington’s disease (HD) is one of the nine autosomal dominant disorders caused by polyglutamine expansion in the coding region of the gene. The disease-causing mutation is located in the first exon of the Huntingtin gene (HTT). Normal huntingtin alleles contain between 16–25 CAG repeats in exon 1, whereas the mutant HTT (mHTT) allele has more than 35 repeats.1–3 Although most HD patients are in the range of 40–50 CAGs repeats, longer expansion repeat may occur and are generally associated with a juvenile onset of the disease.4 To date, HD remains a fatal disease. Among the most promising approaches for treating HD are those based on gene silencing, either through gene editing approaches, installation of antisense oligonucleotides (ASOs), or application of inhibitory RNAs.5–7 In earlier work in multiple mice models, it was shown that partial repression of both the normal and mutant alleles was tolerated and resulted in phenotypic improvements.6,8,9 Similarly, reduction of normal HTT in monkeys was nontoxic and did not induce behavior changes, neuropathology, or inflammation.10,11 These studies support the notion that partial reduction of both huntingtin alleles may be safe. Nevertheless, it is unknown whether neural cells in the adult human brain will tolerate long-term silencing of both normal and mutant huntingtin alleles. Therefore, efforts to either regulate silencing, or inhibit the mutant allele should be investigated, as decades-long therapy will be required for treatment. Toward this end, several approaches have been considered. Peptide nucleic acids (PNAs) designed against mRNA structural differences between alleles showed robust specificity when transfected into patient cells.12 However,

their in vivo utility remains unknown. New gene-editing approaches targeting expanded repeats are being pursued to reduce CAG repeat length or silencing the mutant huntingtin locus. Alternatively, ASO and inhibitory RNAs have been developed to target the CAG-expanded disease mutation or SNPs in the disease allele.13–19 The group of Carroll et al. 17 showed that intronic SNPs could be preferentially targeted by ASOs in vitro and in vivo. In addition to intronic SNPs, SNPs in the coding region and the 3’UTR in linkage disequilibrium with the disease allele exist,20,21 and their utility for mutant allele targeting has been tested, again using ASOs.15–17 PNAs and ASOs will require life-long delivery strategies, although it is encouraging that the duration of the effect from a single bolus of ASOs to the intrathecal space is likely to be months rather than days, limiting the number of infusions patients would require per year. However, the penetration of ASOs is not sufficient to effectively silence mHTT in the basal ganglia, a major site of disease. Inhibitory RNAs processed from virally encoded artificial miRNAs provide a strategy for sustained expression and for targeting the basal ganglia.7,8 Important considerations for sustained expression are to limit expression levels of the artificial miRNA to avoid saturation of the miRNA processing machinery,22 to limit off-target silencing,23,24 and to use vectors known to be safe in primate brain.10 An added safety feature, not yet tested, would be to design the artificial miRNA to preferentially silence the mutant allele. Here, we developed artificial miRNAs to target the repeat expansion, based on earlier work by Corey et al., as well as miRNAs targeting 3’UTR-resident SNPs that are in linkage disequilibrium with HD.13,20,21 We show that both the CAG- and S ­ NP-targeting miRNAs show preferential silencing in vitro, but that this specificity may not necessarily be recapitulated in vivo. These

The Children’s Hospital of Philadelphia, Philadelphia, Pennsylvania, USA; 2The Department of Internal Medicine, University of Iowa, Iowa City, Iowa, USA; The ­Department of Pathology and Laboratory Medicine, University of Pennsylvania, Philadelphia, Pennsylvania, USA Correspondence: Beverly L Davidson, PhD, The ­Children’s Hospital of Philadelphia, Philadelphia, 5060 Colket Translational Research Building, Pennsylvania 19104, USA. E-mail: [email protected] Keywords: allele-specific silencing; Huntington's Disease; RNA interference Received 18 December 2014; accepted 26 January 2015; published online 7 April 2015. doi:10.1038/mtna.2015.7

1 3

Silencing Mutant HTT Monteys et al.

2

Importantly, the 3’UTRs were engineered to have nucleotide changes coincident with those SNPs located before the first polyA signal that are most prevalent in HTT, and identified as being in linkage disequilibrium through earlier work.20,21 Our design provides a method for simultaneous evaluation of silencing specificity of both alleles. The 3’UTR SNPs that are included in this work are shown in the cartoon of the ­full-length human HTT allele (Figure 1a) as well as the SNP name, position, sequence, and frequency (Figure 1b). Plasmids expressing CMV-HTT and CMV-mHTT were cotransfected into HEK293 cells and protein lysates evaluated for normal (Flag) or mutant (V5) HTT expression. Specificity of allele detection and uniformity of expression of the two alleles was confirmed (Figure 1c).

studies are important as we advance gene-silencing strategies forward from cell models to the clinic and indicate the need to develop suitable in vivo models for further screening. Results Allele-specific siRNA sequences designed to target the CAG expanded repeat, or prevalent SNPs in linkage disequilibrium for the mutant allele have shown its efficacy when administrated both in vitro and in vivo using HD models.13,14,19 However, it is still unknown if those siRNAs retain allele specificity when contained into an artificial miRNAs expression system for sustained in vivo delivery. Therefore, we developed a series of artificial miRNAs that when processed by the RNAi machinery would yield CAG- or SNP-targeting allele specific siRNAs sequences. As a first step, we developed an in vitro allele-specific silencing reporter system (Figure 1a). We assembled the normal (with 16 CAG repeats) and mutant (with 81 CAG repeats) full-length HTT cDNAs that were differentially tagged (FLAG versus V5, respectively) into a CMV expression cassette.

a

Targeting the expanded CAG repeat with artificial miRNAs The design of an RNAi sequence targeting the disease expanded CAG repeat mutation offers the possibility to treat the entire population of patients with HD by using a single ­molecule. Although siRNA sequences fully complementary for

rs362268 rs362306 FLAG-Tag rs362307

(CAG)16

CMVp

Human huntingtin cDNA

normal 3′UTR pA

(CAG)81

V5-Tag

CMVp

pA pA

CMV-norHtt-3′UTR 18QFLHTT

pA pA

CMV-mutHtt-3′UTR 83QFLHTT

rs362268 rs362306 rs362307

Human huntingtin cDNA

mutant 3′UTR pA

b

Allele Name

Type

Sequence

Position

Het NCBI

Het Observ

Normal

Mutant

rs362307

Single

C/T

chr4:3211643

0.164

0.36

C

T

rs362306

Single

G/A

chr4:3211898

0.353

0.298

A

G

rs362268

Single

C/G

chr4:3211946

0.365

0.296

G

C

c 18QFLHTT

83QFLHTT

18QFLHTT +83QFLHTT V5

Flag

β cat

Figure 1  System to assess allele-specific silencing of normal and mutant huntingtin (HTT) alleles. (a) Diagram of the full-length HTT constructs to differentiate normal (pCMV-norHTT-3’UTR-18QFLHTT), and mutant proteins (pCMV-mutHTT-3’UTR 83QFLHTT). Normal and mutant alleles were expressed under the control of the CMV promoter. Two different epitopes tags, FLAG (normal) or V5 tag (mutant), were added at the 3’ region of the cDNA to differentiate between the HTT cDNAs. The 3’UTR sequences containing prevalent single-nucleotide polymorphisms (SNPs) and endogenous poly A signals were cloned downstream of the full-length HTT cDNA. Positions of the different SNPs are indicated. This design allowed assessment of allele specificity after cotransfection. (b) Table indicating name of the SNP, type, sequence, position, and frequency. Nucleotide type present on each allele is also indicated; C>T for rs362307, A,>G for rs362306, and G>C for rs362268 on the normal and mutant allele, respectively. (c) Representative western blot showing specificity of detection of normal and mutant alleles. HEK 293 cells were transfected with pCMV-norHtt-3’UTR-18QFLHTT, pCMV-mutHTT-3’UTR 83QFLHTT, or cotransfected simultaneously with both constructs (wt18Q/mt83Q). V5- and FLAG-epitopes were detected using specific antibodies. β-cat, β-catenin. Molecular Therapy—Nucleic Acids

Silencing Mutant HTT Monteys et al.

3

the CAG repeat are not selective, preferential silencing for the mutant allele can be obtained when nucleotide mismatches are introduced at specific positions within the guide strand of the siRNA sequence.13 Using these ­allele-specific CAG targeting siRNAs as a template, we generated miCAG3, with mismatches at positions 9–11, and miCAG9 and miCAG10, with a single mismatch mutation at position 9 or 10, respectively (Figure 2a). As controls, we designed miCAG, a CAG targeting miRNA with full complementarity to the expanded repeat, and

a

C CA U C A A A G A C U U G G C G C G U G 01 G U 02 A U 03 C G 04 G C 05 A U 06 C G 07 G C 08 A U 09 C G 10 G C 11 A U 12 C G 13 G C 14 A U 15 C G 16 G C 17 A U 18 C G 19 G C 20 A U 21 G 22 A G C C G miCAG G C A C N N NN NN

miCtl, a low off target miRNA sequence that does not target the huntingtin mRNA. A combination of the miRNAs and fulllength HTT expression plasmids (CMV-HTT and CMV-mHTT) were transfected into cells and silencing specificity evaluated by western blot. Allele selectivity was based on the percent silencing for each allele with respect to baseline expression (triple transfected miCtl, full-length HTT expression plasmids). As expected, no allele selectivity was observed in cells treated with miCAG expression plasmids; silencing for both alleles was

C CA U C A A G A A C U U G G C G C G U G 01 G U 02 A U 03 C G 04 G C 05 A U 06 C G 07 G C 08 U A 09 * U 10 * U A 11 * A A U 12 C G 13 G C 14 A U 15 C G 16 G C 17 A U 18 C G 19 G C 20 A U 21 G 22 A G C C G miCAG3 G C C A N N NN NN

b

C CA U C A A G A A C U U G G C G C G U G 01 G U 02 A U 03 C G 04 G C 05 A U 06 C G 07 G C 08 U A 09 * C G 10 G C 11 A U 12 C G 13 G C 14 A U 15 C G 16 G C 17 A U 18 C G 19 G C 20 A U 21 A G 22 G C C G miCAG9 G C C A N N NN NN

c

C CA U C A A G A A C U U G G C G C G U G 01 G U 02 A U 03 C G 04 G C 05 A U 06 C G 07 G C 08 A U 09 U A 10 * G C 11 A U 12 C G 13 G C 14 A U 15 C G 16 G C 17 A U 18 C G 19 G C 20 A U 21 A G 22 G C C G miCAG10 G C C A N N NN NN

1.4 Flag normal HTT V5 mutant HTT

1.2 Flag normal HTT Protein level

1.0

β catenin V5 mutant HTT

miCAG

miCAG3

miCAG9

0

e

β catenin

miCAG9 (µg)

0.5

0.4

0

0

0.1

0.5

Ctl

CAG

CAG3

*

CAG9

*

CAG10

Flag normal HTT V5 mutant HTT

1.2 1.0 Protein level

V5 mutant HTT

* * *

1.4

Flag normal HTT β catenin

*

*

0.2

miCAG10

d

miCtl (µg)

0.6 0.4

β catenin miCtl

0.8

0.8

*

*

0.6 0.4

*

0.2 0 miCAG9 (µg)

0

0.1

0.5

0

0.1

0.5

www.moleculartherapy.org/mtna

Silencing Mutant HTT Monteys et al.

4

~90% (Figure 2b,c). miCAG10 was designed based on the P10 siRNA sequence containing a single mismatch at nucleotide position 10 with a reported selectivity of >25 for the mutant allele.13 However, silencing selectivity was lost when expressed in the context of our artificial miRNA expression system (both alleles silenced to 90%) (Figure 2b,c). In contrast, the siRNA sequences PM3 and P9 retained preferential silencing toward the mutant allele when expressed in the context of our artificial miRNA system (miCAG3: 41% HTT versus 56% mHTT; miCAG9: 58% HTT versus 76% m-Htt). Although, miCAG9 and miCAG3 retained its specificity for the mutant HTT allele, its selectivity was reduced with respect to the original siRNA sequences P9 and PM3 even when expressed at lower levels (Figure 2d,e). This could possibly occur due to higher and sustained miCAG9 and miCAG3 expression levels, or to the production of a nucleotide shift in siRNA sequences derived after Drosha and Dicer processing.25 Artificial miRNAs targeting HTT-resident SNPs show preferential silencing of the mutant allele in vitro To test our SNP-targeting sequences, we took advantage of the fact that the endogenous HTT alleles in HEK293 cells contain the same nucleotide at rs362268 and rs362306 than our engineered mutant allele, whereas rs362307 was contained in our constructed HTT alleles (Figure 1a). Thus, artificial miRNAs targeting rs362268 and rs362306 were screened against endogenous huntingtin, and for rs362307 by cotransfection with the FLHTT mutant allele construct. We took advantage of earlier structural studies26 and in vitro assays describing the effect of nucleotide mismatch placement between a guide sequence and its target on dicer cleavage14 in designing our artificial miRNAs. These include, counting from the 5’ end of the guide, sequences bases 2–8 (the seed region27,28; bases 10–11 (the cleavage site) and bases 16–17 (Figure 3a). In our screen, we found that the SNP-targeting artificial miRNAs with better silencing efficacy contained polymorphisms aligned at bases 5 and 6 for rs362268 (mi268.5, mi268.6), base 12 for rs362306 (mi306.12), and nucleotides 10 and 11 for rs362307 (mi307.10, mi307.11; Figure 3b–e). For rs362307, mi307.10 was our best miRNA sequence silencing mutant huntingtin about 70%, and was in agreement with the results obtained by Schwarz et al. 14 using rs362307 SNP-targeting siRNAs. Next, we tested mi268.5, mi306.12, and mi307.10 selectivity for the mutant or the normal allele using our in vitro

­llele-specific silencing system. Plasmids containing the a full-length HTT-expressing constructs depicted in Figure 1a along with the indicated plasmids expressing the artificial miRNAs were cotransfected into HEK293 cells, and the expression levels of mutant and wild-type HTT were determined. As shown in Figure 4b, each miRNA showed approximately a 2:1 preferential silencing against the mutant allele when transfected at lower doses. However, at high doses, these differences were reduced. Our results suggest that the SNP-targeting miRNAs are not sufficient to discriminate the normal versus the mutant HTT allele. For the SNPs targeted in our study, the mismatch between the miRNA sequence and the normal huntingtin allele are the following: a purine:purine mismatch (G:G) for rs362268, a pyrimidine:purine mismatch (C:A) for rs362306, and a purine:pyrimidine mismatch (A:C) for rs362307 (Figure 4a). Previous studies have shown that pyrimidine:purine and purine:pyrimidine mismatches have intermediate levels of discrimination, whereas maximum discrimination is observed with purine:purine mismatches. However, the position of the mismatch in the miRNA sequence, the nucleotide context surrounding the mismatch, the degree of complementarity on the remaining sequence, and the expression levels of the SNP-targeting miRNAs might reduce the power of discrimination. We cannot modify the mismatch type targeted by our miRNAs, but we can decrease the nucleotide pairing complementarity between the miRNA and the normal HTT mRNA to increase miRNA selectivity against the mutant allele. Therefore, we introduced a second point mutation into the miRNA sequence to decrease binding stability for the normal HTT allele. Similar to our initial design, the additional mismatches were introduced in the seed region (nt 2–8), the cleavage site (nt 10–11), or at position 16–17 (Figure 3a). In addition, for all SNP-targeting miRNAs, we designed a low off target miRNA variant by modifying the seed region to accommodate a CG dinucleotide (mi307SSeed, mi268.5SSeed, and mi306.12SSeed). The presence of CG dinucleotide is rare in mammalian 3’UTRs, and in addition to decrease pairing stability for the normal allele, it will minimize the potential of silencing unintended mRNAs. To test the second-generation SNP-targeting miRNA sequences, the full-length wild-type HTT 3’UTR with 307(C), 306(A) and 268 (G) or mutant HTT 3’UTR with 307(T), 306(G) and 268(C) was cloned downstream of Renilla luciferase (Figure 5a). The plasmids coexpressed Firefly luciferase. In this manner, differential silencing could be assessed by the

Figure 2  Allele-specific silencing of CAG-targeting miRNA sequences. (a) Cartoon depicting the miRNA sequences generated for targeting the expanded CAG repeat. miCAG has full complementarity to the expanded repeat. MiCAG3 contains three nucleotides mutated in the central region of the miRNA between nucleotides 9 and 11, whereas miCAG9 and miCAG10 contained a single-point mutation at nucleotide position 9 and 10, respectively. (b) Representative western blot of HEK293 cells cotransfected with wild-type and mutant HTT expression plasmids and miCAG, miCAG3, miCAG9, miCAG10, or miCtl as a control. Cells were harvested 36 hours after transfection and wild-type and mutant htt silencing determined by western blot. Normal huntingtin protein levels were determined with specific antibody against Flag epitope tag, whereas mutant Htt protein levels were determined with V5 antibody. β-catenin was determined as a relative control. (c) Quantitative analysis of normal and mutant huntingtin protein levels. Data are mean ± SEM relative to cells transfected with each miRNA constructs relative to miCtl (n = 6). P < 0.05; constructs were tested for statistical difference to miCtl by two-way analysis of variance. (d) Representative western blot of HEK293 cells cotransfected with wild-type and mutant htt expression plasmids and different doses of miCAG9 and miCtl. Cells were harvested 36 hours after transfection and wild-type and mutant Htt silencing determined by western blot. Normal huntingtin protein levels were determined with specific antibody against Flag epitope tag, whereas mutant HTT levels were determined with V5 antibody. β-catenin was determined as a relative control. (e) Quantitative analysis of normal and mutant huntingtin protein levels assessing miCAG9 silencing efficacy at different expression levels. Data are mean ± SEM relative to a cells transfected with each miRNA constructs relative to a miCtl (n = 12). P < 0.05; constructs were tested for statistical difference to miCtl by two-way analysis of variance. Molecular Therapy—Nucleic Acids

Silencing Mutant HTT Monteys et al.

5

a

miRNA-Shuttle sequence N N

N N

Sense strand miRNA sequence N UAAA A A G G G C G A G C A G C A G C A G U A G C A G C A AC C U C C G C G A A G C A G C A G C A G UA G C AG C A AC C UU A A A N G AC Antisense strand miRNA sequence

RISC loaded miRNA sequence Antisense strand miRNA sequence A A G C A G C A G C A G U A G C A G C A A C 22 21 20 19 18 17 16 15 14 13 12 11 10 09 08 07 06 05 04 03 02 01 P16-P17 1.2 1.0 Relative HTT mRNA

Seed sequence

1.2

*

1.0

*

*

*

0.8

Relative HTT mRNA

b

Cleavage

*

0.6 0.4 0.2

*

0.8

*

*

*

0.6

*

0.4 0.2

0 Ctl

268.5

268.6 268.10 268.11 268.16 268.17

0 Ctl

306.5

miHD268 sequences

c

miCtl

miHD268.5

306.6 306.11 306.12 306.16 306.17 miHD306 sequences

d

miHD268.6

miCtl

miHD306.12

miHD306.16 HTT

HTT

β Cat

β Cat

e

miHD307 sequences miCtl

307.5

307.6

307.10

307.11

307.16

306.17 Mutant HTT β Cat

Figure 3  Screening single-nucleotide polymorphism (SNP)-targeting miRNAs. (a) Cartoon depicting the regions where SNPs were placed relative to the miRNA sequences. Nucleotides 2–8 (Seed sequence), nucleotides 10–12 (cleavage site), and nucleotides 16–17 are highlighted. (b) Q-PCR analysis determining silencing efficacy of the different SNP targeting miRNA sequences against rs362268 and rs362306 polymorphisms. Data are mean ± SEM relative to cells transfected with each miRNA constructs relative to a miCtl (n = 4). P < 0.05; constructs were tested for statistical difference to miCtl by one-way analysis of variance. (c–e) Representative western blots of HEK293 cells transfected with mi268.5, mi268.6, mi306.12, mi306.16, and mi307 variants to determine silencing of mutant HTT protein levels. Cells were harvested 48 hours after transfection and protein levels were determined with a specific antibody against the C-terminal HTT region. β-catenin protein levels were used as a control.

luciferase ratio. For 307.10, an additional mismatch at position 5 improved its selectivity from 10% to 35%(A>C) or to 40% (A>U) (Figure 5b). For 306.12, a mismatch at position 16 improved selectivity from 25 to 45% (C>G) (Figure 5c). For 268.5, no significant improvements were noted by the addition of a second mismatch (Figure 5d), nor did modify the seed sequence (Figure 5b–d). We extended these studies beyond the luciferase reporters, where only one of the alleles is tested at a time, to the in vitro

setup that allows coexpression of both alleles and assessment of silencing selectivity. For 307.10 and 306.12, the results were similar as before (Figure 6a,b). However for 268.5, we noted a dramatic improvement with a mismatch at position 16, in contrast to the luciferase based assay (Figure 6c). Testing mutant allele-targeting artificial miRNAs in vivo To test the utility of our SNP-targeting artificial miRNAs, we generated transgenic mice expressing the alleles depicted www.moleculartherapy.org/mtna

Silencing Mutant HTT Monteys et al.

6

miHD268.5

3′AGGGAGGACGUCCGACCGACAA 5′

miHD268.5

3′AGGGAGGACGUCCGACCGACAA 5′

Normal Htt

5′UCCCUCCUCGAGGCUGGGUGUU3′

Mutant Htt

5′UCCCUCCUCGAGGCUGGCUGUU 3′

miHD306.12 Normal Htt

3′AACGGUCCAACGUCGACGAGAA 5′

miHD306.12

3′AACGGUCCAACGUCGACGAGAA 5′

5′UUGCCAGGUUACAGCUGCUCUU3′

Mutant Htt

5′UUGCCAGGUUGCAGCUGCUCUU3′

miHD307.10

3′AAACCUUCAGACACGGGAACAU 5′

miHD307.10

3′AAACCUUCAGACACGGGAACAU 5′

Normal Htt

5′UUUGGAAGUCUGCGCCCUUGUA 3′

Mutant Htt

5′UUUGGAAGUCUGUGCCCUUGUA 3′

β catenin V5 mutant Htt β catenin miCtl (µg) miHD268.5 (µg)

0.5

0.4

0

0

0.1

0.5 Flag normal Htt β catenin V5 mutant Htt β catenin

miCtl (µg) miHD306.12 (µg)

0.5

0.4

0

0

0.1

0.5 Flag normal Htt β catenin V5 mutant Htt β catenin

miCtl (µg) miHD307.10 (µg)

0.5

0.4

0

0

0.1

0.5

1.4 1.2 1.0 0.8 0.6 0.4 0.2 0 miHD268.5 (µg)

Flag normal Htt V5 mutant Htt

Protein level

Flag normal Htt

1.4 1.2 1.0 0.8 0.6 0.4 0.2 0 miHD306.12 (µg)

* *

0

1.4 1.2 1.0 0.8 0.6 0.4 0.2 0 miHD307.10 (µg)

*

0.1 0.5

0

*

0.1 0.5

Flag normal Htt V5 mutant Htt

Protein level

b

*

* *

0

0.1 0.5

0

*

0.1 0.5

Flag normal Htt V5 mutant Htt

Protein level

a

*

* *

0

0.1 0.5

0

0.1 0.5

Figure 4  Allele-specific silencing of single-nucleotide polymorphism (SNP)-targeting miRNA sequences. (a) mi268.5, mi306.12, and mi307.10 pairing to both normal and mutant huntingtin alleles. SNP mismatches between the miRNA and the normal huntingtin (HTT) allele are highlighted. (b) Left side, representative western blots for SNP-targeting miRNA sequences targeting normal and mutant huntingtin alleles at varying doses. Right side, quantitative analysis of silencing efficacy of each miRNA sequences with respect to the normal and the mutant allele. Data are mean ± SEM relative to a cells transfected with each miRNA constructs relative to miCtl (n = 6). P < 0.05; constructs were tested for statistical difference to miCtl by two-way analysis of variance test.

in Figure 7a. These alleles were expressed at similar levels, and were each ~20% of mouse Htt levels (Supplementary Figure S1). The alleles used to generate the transgenic mice are similar to the full-length cDNA used for our in vitro work except that the expansion in the CAG allele is a mixed repeat (CAG-CAA; provides protection from unwanted expansion and contraction in breeders)29 with 49 CAG-CAA versus the 81 CAG stretch used earlier. Note that due to the mixed CAG-CAA repeat in our transgenic mice, we cannot assess the selectivity of the CAG-targeting miRNA sequences, but we can determine the allele specificity of our SNP-targeting miRNA sequences design. We generated AAV2/1 viruses expressing miCtl, mi306.12v16G, and mi268.5 (Figure 7b). Double transgenic mice expressing both normal and mutant HTT were injected at 8 weeks and allele-silencing selectivity determined 3 weeks postinjection, a time point by which our Molecular Therapy—Nucleic Acids

artificial miRNAs are robustly expressed (data not shown). We did not see preferential silencing with the mi268.5 construct (Figure 7c). However, mi306.12v16G did show significantly more targeting against the mutant allele, as determined by Q-PCR and western blot (Figure 7c,d). Discussion Extensive evidence supports the therapeutic potential of lowering mutant huntingtin protein levels for HD, and ­nonallele-specific approaches are currently being pursued for clinical development.10,11 However, the need for prolonged treatment lasting over many decades and the lack of information about the long-term effects of reducing normal huntingtin levels in human justifies the investigation into allele-specific approaches that target only the mutant allele. Currently,

Silencing Mutant HTT Monteys et al.

7

a

PS2-HTTwtUTR

SV40p

268(G) 306 (A) 307 (C)

Renilla cDNA

normal 3’UTR

HSV-Tk prom

pA

Renilla cDNA

1.2

0.8

**

0.6

*

*

*

0.4 0.2

0.0 miRNA: Ctl 307.10 5C

5U

SV40pA 50 45 40 35 30 25 20 15 10 5 0 miRNA: Ctl

Normal HTT Mutant HTT

1.0

SSeed

307.10

307.10 variants

Lucif. activity (RLU)

1.2 1.0

*

0.4

50 45 40 35 30 25 20 15 10 5 0 miRNA:

*

*

*

0.6

*

*

0.2

0.0 miRNA:

Ctl

306.12 16G

16U SSeed

Ctl

306.12 16G

306.12 variants Normal HTT Mutant HTT

Lucif. activity (RLU)

1.0

*

*

0.6

*

*

*

*

0.4 0.2

0.0 miRNA:

Ctl

268.5

10G

10U

16C

16U SSeed

306.12 variants

1.2

0.8

SSeed

16U

SSeed

268.5 variants

50 45 40 35 30 25 20 15 10 5 0 miRNA: Ctl

Selectivity (% Silen Diff)

d

5U

307.10 variants

Normal HTT Mutant HTT

*

0.8

5C

Selectivity (% Silen Diff)

c

Firefly cDNA

pA pA

Selectivity (% Silen Diff)

Lucif. activity (RLU)

HSV-Tk prom

mutant 3’UTR pA

b

SV40pA

268(C) 306 (G) 307 (T)

PS2-HTTmtUTR SV40p

Firefly cDNA

pA pA

268.5

10G

10U

16C

16U

SSeed

268.5 variants

Figure 5  Assessing allele selectivity of second-generation single-nucleotide polymorphism (SNP)-targeting miRNA sequences using the dual luciferase system. (a) Cartoon depicting the psicheck constructs containing different SNPs on the 3’UTR sequences of normal and mutant alleles. (b–d) Left side, silencing efficacy was assessed measuring luciferase activity from reporter constructs containing either the normal or the mutant huntingtin (HTT) 3’UTR. Data are shown as mean ± SEM relative to cells transfected with miCtl and demonstrate different silencing efficacy of the SNP-targeting miRNA sequences with respect to the normal and the mutant allele. P < 0.05; constructs were tested for statistical difference to miCtl by one-way analysis of variance. Right side, silencing selectivity was determined by subtracting percentage of silencing of the normal and the mutant allele.

allele-specific silencing is achieved via targeting ASOs or inhibitory RNAs (siRNA, ssRNA) to the CAG repeat, or to a SNP that exists in linkage disequilibrium with the disease mutation. The efficacy of allele-specific ASOs has been demonstrated in mice, and targeting intronic sequences greatly expands the availability of target sites. However, ASOs are

limited by the necessity to optimize the dose and dosing regimen based on the method of delivery for therapy. Repetitive dosing may also raise the risk for infection. Inhibitory RNAs represent a valuable alternative to ASOs. Allele-specific siRNA sequences have been designed and their selectivity has been validated using different cellular and www.moleculartherapy.org/mtna

Silencing Mutant HTT Monteys et al.

8

a Flag normal HTT β catenin V5 Mutant HTT β catenin

b Flag normal HTT β catenin V5 Mutant HTT β catenin

c Flag normal HTT β catenin V5 Mutant HTT β catenin

Figure 6  Assessing allele selectivity of second-generation single-nucleotide polymorphism (SNP)-targeting miRNA sequences using an in vitro allele-specific reporter system. (a–c) Left side, representative western blot of different SNP-miRNA variants containing a secondary mismatch on the miRNA sequence. Right side, quantitative analysis of silencing efficacy of each miRNA sequences with respect to the normal and the mutant allele. Data are mean ± SEM relative to a cells transfected with each miRNA construct relative to a miCtl (n = 4). P < 0.05; constructs were tested for statistical difference to miCtl by two-way analysis of variance test.

in vivo HD models. However, they suffer from similar safety considerations to ASOs. Alternatively, siRNA sequences can be constitutively delivered through miRNA expression systems expressed from a viral vector, which, with respect to ASOs, facilitates delivery into the brain while minimizing the requirement for repetitive administration. To address the utility of allele-specific silencing approaches, using previously developed and novel sequences, we cloned sequences into our artificial miRNA expression system, and assessed their selectivity in vitro and in vivo. In addition, we showed that introducing additional mutations into the miRNA sequence can improve their selectivity for the mutant allele by reducing miRNA:mRNA pairing stability with the normal Molecular Therapy—Nucleic Acids

allele. Interestingly, only some sequences retained their selectivity in this platform. We note that the amount of miRNA delivered is crucial, since selectivity is reduced when miRNAs are highly expressed. This could explain mi306.12v16G selectivity in vivo with respect to mi268.5. In our study, we analyzed allele specificity 3 weeks after adeno-associated virus (AAV) injection, a time point when significant miRNA expression levels are observed. In future work, long-term studies would determine if cumulative effects from the miRNA expression are problematic. To avoid this, and maintain proper dosing, the development of a tightly regulated promoter for miRNA expression may be necessary for their clinical application.

Silencing Mutant HTT Monteys et al.

9

a

268 (G)

FLAG-Tag307(C)306 (A)267(T)

(CAG)16 HDp

normal 3’UTR

Human Huntingtin cDNA pA (CAG/CAA)49

HDp

V5-Tag307(T)

HTTwt/Flag Construct pA pA

268 (C) 306 (G) 267(C)

Human Huntingtin cDNA

mutant 3’UTR pA

b

HTTmut/V5 Construct pA pA

c miCtl

CMVp

TTTT

eGFP

pA

ITR

Relative expression

U6p

ITR U6p

mi306.12v16G

CMVp

TTTT

eGFP

pA

ITR

ITR U6p

mi268.5

CMVp

TTTT

eGFP

mi306.12v16G

1.2

ITR

pA

*

0.8

0.4

0.0 HTT:

Normal

Mutant

1.2 Relative expression

ITR

mi268.5

0.8

0.4

0.0 HTT:

Normal

Mutant

d HTTwt/Flag β Cat

HTTmut/V5 β Cat miRNA:

Ctl

306

mice 1

Ctl

306

mice 2

Ctl

306

mice 3

Ctl

306

mice 4

Figure 7  Assessing allele-specific silencing in vivo in huntingtin (HTT) double transgenic mice. (a) Cartoon depicting full-length huntingtin transgenes for the normal and the mutant HTT alleles. Full-length huntingtin cDNA was expressed under the control of the human HTT promoter. The normal allele contained 16 CAG repeats, whereas the mutant allele had 49 CAA-CAG mixed repeats. Normal and mutant huntingtin alleles were differently tagged with Flag or V5 epitope for detection of normal or mutant HTT alleles respectively. The 3’UTR sequences with different SNPs was cloned downstream of the HTT cDNA. The SNP base nucleotide is indicated for each allele. (b) Cartoon depicting bi-cistronic AAV2/1 miRNA vectors which also express an eGFP reporter cassette. (c) RT-Q-PCR analysis of normal and mutant HTT levels in double transgenic mice expressing mi268.5 or mi306.12v16G . Total RNA was collected 3 weeks after injection and transcript levels were determined by RT-QPCR. All samples were normalized to β-actin and results are the mean ± SEM relative to cells injected with a miRNA control (mi306.12v16G, n = 5; mi268.5, n = 4, P < 0.05, unpaired t-test). (d) Normal and mutant HTT protein levels were determined by western blot on mice injected with AAV2/1 mi306.12v16G. Results show preferential silencing of mi306.12v16G over the mutant huntingtin allele.

In summary, we conclude that artificial miRNAs provide a tool for preferential silencing in vivo, but that clinical application will require additional development. Efforts should be extended for controlled expression or modification to the sequences liberated such that there is better selectivity for the mutant allele in vivo. Materials and methods Vector design and AAV production. A normal full-length huntingtin cDNA with 16 CAG repeats was originally obtained from Henry Paulson (Ann Arbor, MI). A CAG repeat expansion was introduced by standard molecular biology strategies to generate a mutant allele containing 81 CAG repeats. To differentiate the normal and mutant alleles, the 3’ region of the full-length Htt cDNA was modified by addition of a V5 (mutant) or Flag epitope (wild type) to the COOH-terminus.

Full-length huntingtin constructs were cloned downstream of the CMV promoter and 3’UTR sequences containing relevant SNPs and endogenous HTT poly A sequences were cloned downstream of the Flag or V5 epitope tags. Allele-specific CAG- or SNP-targeting artificial miRNAs were generated by polymerase extension of overlapping DNA oligonucleotides (IDT, Coralville). Polymerase-extended products were purified using Qiaquick PCR purification kit, digested with XhoI-SpeI and cloned into a XhoI-XbaI site on a Pol-III expression cassette containing the mouse U6 promoter, a multiple cloning site, and the Pol-III-terminator (6T’s).30 HTT 3’UTR luciferase reporter vectors were constructed in psiCheck2 vector (Promega). 3’UTR sequences containing indicated SNPs for normal and mutant huntingtin were amplified by polymerase chain reaction (PCR), sequenced, and cloned into an XhoI-NotI sites downstream of the stop codon of the Renilla luciferase cDNA sequence. www.moleculartherapy.org/mtna

Silencing Mutant HTT Monteys et al.

10

For in vivo studies, miRNAs expression cassettes were moved into an AAV shuttle plasmid upstream of an enhanced green fluorescence protein (eGFP) expression cassette. The miRNA expression cassette and stuffer sequence were flanked at each end by AAV serotype 2 145-bp inverted terminal repeat sequences. Cell lines and transfections. HEK293 were obtained from ATCC and cultured under conditions provided by manufacturer. All plasmid DNA transfections were done with Lipofectamine 2000 (Invitrogen) using guidelines provided by manufacturer. In vitro luciferase assays. HEK293 cells at 70% confluence in a 24-well plate were cotransfected with m ­ iRNA-expressing plasmids and HTT-3’UTR luciferase reporter plasmids. At 24 hours, cells were rinsed with ice-cold ­ phosphate-buffered saline and Renilla and Firefly luciferase activities were assessed using the Dual-Luciferase Reporter Assay System (Promega) according to the manufacture’s instructions, using 20 µl of cell lysate. Luminescent readouts were obtained with a Monolight 3010 luminometer (Pharmigen). Relative light units were calculated as the quotient of Renilla/Firefly relative light units and results expressed relative to a control miRNA. Western blots. Plasmid transfected HEK293 cells and tissue punches from striata were homogenized in 100 µl of Passive Lysis Buffer. Proteins were transferred onto 0.45-µm polyvinylidene difluoride (PVDF) membranes. Membranes were blocked in ­phosphate-buffered saline-Tween 20 (0.05%) with 5% milk for 1 hour and incubated with primary antibodies against Flag (Rabbit anti Flag tag antibody; Sigma; F7425; dilution 1:4,000) or V5 (Mouse anti-V5-HRP conjugated, Invitrogen; 46–0705, dilution 1:5,000) epitop tags. As a control of loading protein levels of β-catenin were also determined (rabbit anti-β-catenin, ab2982, Abcam). Secondary antibodies horseradish perioxidase (HRP)-conjugated anti-rabbit or anti-mouse (111035-144 and 115-035-146, Jackson ImmunoResearch, West Grove, PA) diluted 1:50,000 or 1:10,000, respectively, in blocking solution followed by enhanced chemiluminiscense (ECL)plus substrate (RPN2132, Amersham Bioscience, Piscataway, NJ) and exposed to a film. Densitometry was done using the Epichem II Darkroom (95-0310-01, UVP, Upland, CA) with Lab Works 4.0 image analysis software. Q-RT-PCR. mRNA expression levels of normal and mutant huntingtin were determined by SyBr Green QPCR using primers specific for htt and the epitope tag. Total RNA was isolated using Trizol Reagent (Invitrogen), and 1 µg was DNaseI treated (DNA free, Ambion), and subjected to RT-PCR with oligo d(T). The RT-product was diluted 1/4 before analysis of mRNA expression levels by Q-PCR reaction. Normal and mutant huntingtin expression levels were determined with respect to mouse β-actin expression levels. For human Huntingtin expression levels, we used Taqman probes for human Htt and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) obtained from Applied Biosystems. Transgenic mouse models. The HTT double transgenic mouse line was generated by injecting the HTTwt/Flag Molecular Therapy—Nucleic Acids

or HTTmut/V5 expression cassette into 1-cell pronuclear stage mouse embryo from B6SJL (C57BL/6J X SJL/J; Jackson Laboratory) strain in the University of Iowa Transgenic Animal Facility. Transgenic animals were maintained in the mixed background of C57BL/6J and 129/SvJ. Genotype was determined by PCR using the following primers HTTwt/ Flag (Fwd 5′-CCCCAGGAAGCCCATATCA-3′, Rev 5′-GGCG CTCAAAGTCCCTTGT-3′) HTTmut/V5 (Fwd 5′-ACCCTCT CCTCGGTCTCGATTC-3′, Rev ­5′-AAGGGCACAGACTTCCA AAGG-3′). Progenies from five founders expressed the HTTwt/Flag and HTTmut/V5 transgenes. In one line from each transgenic mice, transgene expression levels were similar and ~20% of endogenous mouse Htt levels in the brain (Supplementary Figure S1). These lines were used for breeding and generate double transgenic mice coexpressing both transgenes. Mouse studies. All animal protocols were approved by the University of Iowa Animal Care and Use Committee. Mice were housed in a temperature-controlled environment on a 12-hour light/dark cycle. Food and water were provided ad libitum. At 8 weeks of age, mice were injected with selected AAV2/1 allelespecific virus. For AAV injections, mice were anesthetized with a ketamine and xylazine mix, and 5 µl of AAV injected bilaterally into striata at 0.2 µl/minute (coordinates: +0.86 mm rostral to Bregma, ± 1.8 mm lateral to medial, −2.5 mm ventral from brain surface). Mice used for gene expression and protein levels analyses were anesthetized with a ketamine and xylazine mix and perfused with 18 ml of 0.9% cold saline mixed with 2 ml RNAlater (Ambion) solution. Three weeks postinjection mice were sacrificed and the brain was removed, blocked, and cut into 1-mm-thick coronal slices. Tissue punches from striata were taken using a tissue corer (1.4-mm in diameter; Zivic Instruments, Pittsburgh, PA). All tissue punches were flash frozen in liquid nitrogen and stored at −80 °C until use. Statistical analysis. All statistical analyses were performed using Graph-Pad Prism v5.0 software. Data were analyzed using an unpaired t-test, and one-way analysis of variance or a two-way analysis of variance followed by a Bonferroni’s post hoc as indicated. In all cases, P < 0.05 was considered significant. Supplementary material Figure S1. Relative expression of the HTT transgenes compared to the endogenous mouse Htt as measured by ­RT-qPCR. Acknowledgments. This research was supported by funds from the National Institutes of Health (NS084475) and the Hereditary Disease Foundation. 1. Duyao, M, Ambrose, C, Myers, R, Novelletto, A, Persichetti, F, Frontali, M et al. (1993). Trinucleotide repeat length instability and age of onset in Huntington’s disease. Nat Genet 4: 387–392. 2. Kremer, B, Goldberg, P, Andrew, SE, Theilmann, J, Telenius, H, Zeisler, J et al. (1994). A worldwide study of the Huntington’s disease mutation. The sensitivity and specificity of measuring CAG repeats. N Engl J Med 330: 1401–1406. 3. Orr, HT and Zoghbi, HY (2007). Trinucleotide repeat disorders. Annu Rev Neurosci 30: 575–621.

Silencing Mutant HTT Monteys et al.

11 4. Lee, JM, Ramos, EM, Lee, JH, Gillis, T, Mysore, JS, Hayden, MR et al.; ­PREDICTHD study of the Huntington Study Group (HSG); REGISTRY study of the European Huntington’s Disease Network; HD-MAPS Study Group; COHORT study of the HSG. (2012). CAG repeat expansion in Huntington disease determines age at onset in a fully dominant fashion. Neurology 78: 690–695. 5. Garriga-Canut, M, Agustín-Pavón, C, Herrmann, F, Sánchez, A, Dierssen, M, Fillat, C et al. (2012). Synthetic zinc finger repressors reduce mutant huntingtin expression in the brain of R6/2 mice. Proc Natl Acad Sci USA 109: E3136–E3145. 6. Kordasiewicz, HB, Stanek, LM, Wancewicz, EV, Mazur, C, McAlonis, MM, Pytel, KA et al. (2012). Sustained therapeutic reversal of Huntington’s disease by transient repression of huntingtin synthesis. Neuron 74: 1031–1044. 7. Harper, SQ, Staber, PD, He, X, Eliason, SL, Martins, IH, Mao, Q et al. (2005). RNA interference improves motor and neuropathological abnormalities in a Huntington’s disease mouse model. Proc Natl Acad Sci USA 102: 5820–5825. 8. Drouet, V, Perrin, V, Hassig, R, Dufour, N, Auregan, G, Alves, S et al. (2009). Sustained effects of nonallele-specific Huntingtin silencing. Ann Neurol 65: 276–285. 9. Boudreau, RL, McBride, JL, Martins, I, Shen, S, Xing, Y, Carter, BJ et al. (2009). N ­ onallelespecific silencing of mutant and wild-type huntingtin demonstrates therapeutic efficacy in Huntington’s disease mice. Mol Ther 17: 1053–1063. 10. McBride, JL, Pitzer, MR, Boudreau, RL, Dufour, B, Hobbs, T, Ojeda, SR et al. (2011). Preclinical safety of RNAi-mediated HTT suppression in the rhesus macaque as a potential therapy for Huntington’s disease. Mol Ther 19: 2152–2162. 11. Grondin, R, Kaytor, MD, Ai, Y, Nelson, PT, Thakker, DR, Heisel, J et al. (2012). Six-month partial suppression of Huntingtin is well tolerated in the adult rhesus striatum. Brain 135(Pt 4): 1197–1209. 12. Hu, J, Matsui, M, Gagnon, KT, Schwartz, JC, Gabillet, S, Arar, K et al. (2009). A ­ llelespecific silencing of mutant huntingtin and ataxin-3 genes by targeting expanded CAG repeats in mRNAs. Nat Biotechnol 27: 478–484. 13. Hu, J, Liu, J and Corey, DR (2010). Allele-selective inhibition of huntingtin expression by switching to an miRNA-like RNAi mechanism. Chem Biol 17: 1183–1188. 14. Schwarz, DS, Ding, H, Kennington, L, Moore, JT, Schelter, J, Burchard, J et al. (2006). Designing siRNA that distinguish between genes that differ by a single nucleotide. PLoS Genet 2: e140. 15. Skotte, NH, Southwell, AL, Østergaard, ME, Carroll, JB, Warby, SC, Doty, CN et al. (2014). Allele-specific suppression of mutant huntingtin using antisense oligonucleotides: providing a therapeutic option for all Huntington disease patients. PLoS One 9: e107434. 16. Southwell, AL, Skotte, NH, Kordasiewicz, HB, Østergaard, ME, Watt, AT, Carroll, JB et al. (2014). In vivo evaluation of candidate allele-specific mutant huntingtin gene silencing antisense oligonucleotides. Mol Ther 22: 2093–2106. 17. Carroll, JB, Warby, SC, Southwell, AL, Doty, CN, Greenlee, S, Skotte, N et al. (2011). Potent and selective antisense oligonucleotides targeting single-nucleotide polymorphisms in the Huntington disease gene / allele-specific silencing of mutant huntingtin. Mol Ther 19: 2178–2185. 18. Fiszer, A, Mykowska, A and Krzyzosiak, WJ (2011). Inhibition of mutant huntingtin expression by RNA duplex targeting expanded CAG repeats. Nucleic Acids Res 39: 5578–5585.

19. Yu, D, Pendergraff, H, Liu, J, Kordasiewicz, HB, Cleveland, DW, Swayze, EE et al. (2012). Single-stranded RNAs use RNAi to potently and allele-selectively inhibit mutant huntingtin expression. Cell 150: 895–908. 20. Pfister, EL, Kennington, L, Straubhaar, J, Wagh, S, Liu, W, DiFiglia, M et al. (2009). Five siRNAs targeting three SNPs may provide therapy for three-quarters of Huntington’s disease patients. Curr Biol 19: 774–778. 21. Liu, W, Kennington, LA, Rosas, HD, Hersch, S, Cha, JH, Zamore, PD et al. (2008). Linking SNPs to CAG repeat length in Huntington’s disease patients. Nat Methods 5: 951–953. 22. McBride, JL, Boudreau, RL, Harper, SQ, Staber, PD, Monteys, AM, Martins, I et al. (2008). Artificial miRNAs mitigate shRNA-mediated toxicity in the brain: implications for the therapeutic development of RNAi. Proc Natl Acad Sci USA 105: 5868–5873. 23. Boudreau, RL, Spengler, RM and Davidson, BL (2011). Rational design of therapeutic siRNAs: minimizing off-targeting potential to improve the safety of RNAi therapy for Huntington’s disease. Mol Ther 19: 2169–2177. 24. Monteys, AM, Spengler, RM, Dufour, BD, Wilson, MS, Oakley, CK, Sowada, MJ et al. (2014). Single nucleotide seed modification restores in vivo tolerability of a toxic artificial miRNA sequence in the mouse brain. Nucleic Acids Res 42: 13315–13327. 25. Boudreau, RL, Monteys, AM and Davidson, BL (2008). Minimizing variables among hairpin-based RNAi vectors reveals the potency of shRNAs. RNA 14: 1834–1844. 26. Nakanishi, K, Weinberg, DE, Bartel, DP and Patel, DJ (2012). Structure of yeast Argonaute with guide RNA. Nature 486: 368–374. 27. Doench, JG and Sharp, PA (2004). Specificity of microRNA target selection in translational repression. Genes Dev 18: 504–511. 28. Lewis, BP, Burge, CB and Bartel, DP (2005). Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 120: 15–20. 29. Gray, M, Shirasaki, DI, Cepeda, C, André, VM, Wilburn, B, Lu, XH et al. (2008). Full-length human mutant huntingtin with a stable polyglutamine repeat can elicit progressive and selective neuropathogenesis in BACHD mice. J Neurosci 28: 6182–6195. 30. Boudreau, RL and Davidson, BL (2012). Generation of hairpin-based RNAi vectors for biological and therapeutic application. Methods Enzymol 507: 275–296.

This work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by-nc-nd/4.0/ Supplementary Information accompanies this paper on the Molecular Therapy–Nucleic Acids website (http://www.nature.com/mtna)

www.moleculartherapy.org/mtna