Asian sand dust enhances murine lung inflammation caused by Klebsiella pneumoniae

Toxicology and Applied Pharmacology 258 (2012) 237–247

Contents lists available at SciVerse ScienceDirect

Toxicology and Applied Pharmacology journal homepage: www.elsevier.com/locate/ytaap

Asian sand dust enhances murine lung inflammation caused by Klebsiella pneumoniae Miao He a, 1, Takamichi Ichinose b, Seiichi Yoshida b, Shoji Yamamoto c, 2, Ken-ichiro Inoue c, 3, Hirohisa Takano c, 4, Rie Yanagisawa c, 5, Masataka Nishikawa d, Ikuko Mori d, Guifan Sun a, Takayuki Shibamoto e,⁎ a

Department of Environmental and Occupational Health, College of Public Health, China Medical University, 11001, Shenyang, China Department of Health Sciences, Oita University of Nursing and Health Sciences, 870-1201, Oita, Japan Pathophysiology Research Team, National Institute for Environmental Studies, 305-8506, Tsukuba, Ibaraki, Japan d Environmental Chemistry Division, National Institute for Environmental Studies, 305-8506, Tsukuba, Ibaraki, Japan e Department of Environmental Toxicology, University of California, Davis, CA 95616, USA b c

a r t i c l e

i n f o

Article history: Received 6 September 2011 Revised 31 October 2011 Accepted 7 November 2011 Available online 19 November 2011 Keywords: Asian sand dust Klebsiella pneumoniae Lung inflammation Toll-like receptor NALP3 inflammasome

a b s t r a c t Inhaling concomitants from Asian sand dust (ASD) may result in exacerbation of pneumonia by the pathogen. The exacerbating effect of ASD on pneumonia induced by Klebsiella pneumoniae (KP) was investigated in ICR mice. The organic substances adsorbed onto ASD collected from the atmosphere of Iki-island in Japan were excluded by heat treatment at 360 °C for 30 min. ICR mice were instilled intratracheally with ASD at doses of 0.05 mg or 0.2 mg/mouse four times at 2-week intervals (total dose of 0.2 mg or 0.8 mg/mouse) and were administrated with ASD in the presence or absence of KP at the last intratracheal instillation. Pathologically, ASD caused exacerbation of pneumonia by KP as shown by increased inflammatory cells within the bronchiolar and the alveolar compartments. ASD enhanced the neutrophil number dose dependently as well as the expression of cytokines (IL-1β, IL-6, IL-12, IFN-γ, TNF-α) and chemokines (KC, MCP-1, MIP-1α) related to KP in BALF. In an in vitro study using RAW264.7 cells, combined treatment of ASD and KP increased gene expression of IL-1β, IL-6, IFN-β, KC, MCP-1, and MIP-1α. The same treatment tended to increase the protein level of IL-1β, TNF-α and MCP-1 in a culture medium compared to each treatment alone. The combined treatment tended to increase the gene expression of Toll-like receptor 2 (TLR2), and NALP3, ASC and caspase1 compared with KP alone. These results suggest that the exacerbation of pneumonia by ASD + KP was due to the enhanced production of pro-inflammatory mediators via activation of TLR2 and NALP3 inflammasome pathways in alveolar macrophages. © 2011 Elsevier Inc. All rights reserved.

Introduction It is well known that sand storms arise in almost all areas in the world, especially Arizona, Brisbane, the Sahara and the Asian region. Asian sand dust (ASD) storms arise from the Gobi Desert, the Taklimakan Desert, and loess areas of interior China during the spring season. ASD aerosol spreads through downwind areas, such as East

⁎ Corresponding author at: Department of Environmental Toxicology, University of California, Davis, CA 95616, USA. Fax: + 1 530 752 3394. E-mail address: [email protected] (T. Shibamoto). 1 Present address: Oita University of Nursing and Health Sciences, 2944-9 Megusuno Oita City, Oita Prefecture, 870-1201, Japan. 2 Professor Yamamoto has passed away for gastric cancer in December, 2010. 3 Present address: Department of Public Health and Molecular Toxicology, School of Pharmacy, Kitasato University, 108-8641, Tokyo, Japan. 4 Present address: Environmental Health Division, Department of Environmental Engineering, Graduate School of Engineering, Kyoto University, Kyoto daigaku-Katsura, Nishikyo-ku, Kyoto 615-8530, Japan. 5 Present address: National Institute for Minamata Disease, Department of Basic Medical Sciences, 4058-18 Hama, Minamata City, Kumamoto, 867-0008, Japan. 0041-008X/$ – see front matter © 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.taap.2011.11.003

China, the Korean Peninsula, and Japan, as well as across the Pacific Ocean to the United States (Duce et al., 1980; Husar et al., 2001; Kim et al., 2001). ASD reportedly is transported one full circuit around the globe (Uno et al., 2009). ASD contains various chemical species, such as sulfate (SO42 −) and nitrate (NO3−) derived from air pollutants (SO2, NO2) as well as microbial agents, including bacteria, fungi, fungal spores, and viruses (Chen et al., 2010; Kobayashi et al., 2010; Maki et al., 2010). Recently the microbial communities transported with ASD have attracted much attention as bioaerosols (biological particles) affecting ecosystem and human health in downwind areas. The airborne sand dust and the microorganisms mentioned above may cause adverse effects on respiratory health and increase mortality and morbidity. Epidemiologic studies have demonstrated that dust storm events caused an increase of hospitalization for pneumonia in China (Meng and Lu, 2007) and an increase in daily mortality in Seoul, Korea (Kwon et al., 2002). In Taiwan, there have been reports that ASD events coincided with an increase of mortality, emergency treatment for cardiovascular disease and hospitalization for pneumonia (Bell et al., 2008; Chan et al., 2008; Chen et al., 2004). In Japan, the deterioration of Japanese cedar pollinosis and seasonal allergic

238

M. He et al. / Toxicology and Applied Pharmacology 258 (2012) 237–247

rhinitis (Sato, 2009), and exacerbation of adult asthma (Watanabe et al., 2011) and child asthma (Kanatani et al., 2010) occurred during a dust storm event also have been reported. Therefore, experimental studies to confirm the epidemiological results, suggesting that ASD causes an increase in the incidence of pneumonia induced by microbial agents during a dust storm event, are in order. Inhalation of highly pathogenic bacteria or influenza viruses, which might be transported by ASD, presents a significant threat to human health. Our previous studies have shown that intratracheal instillation of ASD caused bronchitis and alveolitis, and clearly increased neutrophils along with its relevant chemokines and Th1 relevant cytokines in bronchoalveolar lavage fluid (BALF), whereas ASD heated at 360 °C to exclude toxic materials (microbiological materials, sulfate, nitrate, etc.) caused considerably fewer effects (He et al., 2010a). We suggest that the microbial components attached to ASD play an important role in the lung inflammation caused by ASD. However, whether the Asian sand particle itself causes the deterioration into pneumonia induced by pathogenic bacteria is unknown. Klebsiella pneumoniae (KP) is a gram-negative bacterium with a world-wide distribution and the most common cause of human pneumonia infections (Podschun and Ullmann, 1998). In the present study, the exacerbating effect of ASD on pneumonia induced by KP was investigated in ICR mice. The investigation included examination of pathologic change in the mice lungs, cytological alteration in bronchoalveolar lavage fluids (BALF), and changes in inflammatory cytokines and chemokines in BALF. Alveolar macrophages are key cells for protective pulmonary defense against inflammation (Broug-Holub et al., 1997). Toll-like receptors (TLRs) that belong to the pattern recognition receptors (PRRs) family in antigen presenting cells like macrophages or dendritic cells have been the molecules involved in the recognition of pathogen-associated molecular patterns (PAMP) that lead to the inflammatory process (Mariathasan and Monack, 2007). NALP3 (NACHT domain, leucine-rich repeat, and pyrin domain-containing protein 3), which belongs to the Nod-like receptor (NLR) family in antigen presenting cells is an essential component of inflammasomes triggered by microbial ligands like peptidoglycan, danger-associated molecular patterns, and crystals, to form NALP3 inflammasome (Pétrilli et al., 2007). The NALP3 inflammasome activates caspase-1 (Agostini et al., 2004) for processing and secretion of the cytokines interleukin (IL)-1β (Fritz et al., 2006; Mayor et al., 2007). In the first in vitro experiment, the gene expression of TLR2, TLR4 and pro-inflammatory cytokines secreted into the culture medium was measured in RAW264.7 cells infected with KP plus anti-TLR2 and anti-TLR4 antibodies to investigate the role of TLRs in signaling a pathway for pro-inflammatory cytokines production. In the second in vitro experiment, the gene expression of TLR2, TLR4, NALP3, ASC, caspase-1 and IL-1β in RAW264.7 cells was measured in the presence of ASD and/or KP to investigate the role of TLRs and NALP3 inflammasome in the deterioration of pneumonia by ASD. The cytokine levels secreted into the culture medium by RAW264.7 cells were also measured.

Materials and methods Animals. A total of 96 male ICR mice (5 weeks old) were purchased from Charles River Japan, Inc. (Kanagawa, Japan). After 1 week, the sick mice, mice with abnormal body weight, and mice stressed from different environmental breeding were screened out. The remaining mice were subsequently fed a commercial diet CE-2 (CLEA Japan, Inc., Tokyo, Japan) and given water ad libitum. Mice were housed in plastic cages lined with soft wood chips. The cages were placed in a conventional room, which was air conditioned at 23 °C and 55–70% humidity with a light/dark (12 h/12 h) cycle. The study adhered to the U.S. National Institutes of Health guidelines for the use of experimental animals.

The animal care method was approved by the Animal Care and Use Committee at National Institute for Environmental Studies, Japan. Preparation of particles and bacteria. The present study used ASD previously collected from Iki-island (He et al., 2010a), Japan March 21st–22nd, 2002 after a massive 3-day dust storm event in East Asia. The average density of the ambient particulate matter (Total suspended particle: TSP) in March 21–22 was 672 μg–796 μg/m3/day in Nagasaki, Iki-island, Japan and 10 mg/m3/day in Beijing, China (Sun et al., 2004). The samples were heated at 360 °C for 30 min in an electric heater to exclude toxic materials (microbiological materials, sulfate, nitrate, etc.) adhering to them. K. pneumoniae ATCC 9997 (KP) was obtained from the American Type Culture Collection (ATCC) (Rockville, MD). KP was cultured in growth medium of nutrient broth overnight in a bacterial incubator at 37 °C. KP was washed twice in normal saline (Otsuka Co., Kyoto, Japan), and was prepared at a concentration of 4.3 × 10 6 cells/ml for intratracheal instillation. Study protocol. The study protocol was based on the exposure patterns of cases where Asian people are exposed to ASD together with highly pathogenic bacteria several times during the spring season. ICR mice were divided into six groups (n= 16, each group) according to the treatment with particles: control (normal saline), ASD0.2 (ASD 0.2 mg/ mouse), ASD0.8 (ASD 0.8 mg/mouse), KP alone, ASD0.2 + KP and ASD0.8 + KP. The ASD was suspended in normal saline (0.9% NaCl) for instillation (Otsuka Co., Kyoto, Japan). This suspension was sonicated for 5 min with an ultrasonic disrupter, UD-201 type with micro tip (Tomy, Tokyo, Japan), under a cooling condition. The ASD alone group was intratracheally instilled with ASD at doses of 0.05 mg or 0.2 mg through a polyethylene tube under anesthesia with 4% halothane (Takeda Chemical, Osaka, Japan) four times at 2-week intervals. Therefore, the administration doses were 0.2 mg/mouse and 0.8 mg/ mouse, respectively. The control group was instilled intratracheally with 0.1 ml of normal saline (Otsuka Co., Kyoto, Japan) four times at 2-week intervals. The KP alone group was intratracheally instilled with 0.1 ml two time-dilution solution of KP (concentration of 4.3 × 10 6 cells/ml) at the last intratracheal instillation. The ASD0.2 + KP group and the ASD0.8 + KP group were simultaneously injected with ASD and KP at the last intratracheal instillation. One day after the last intratracheal administration, the mice (age = 12 weeks) from all groups were killed by exsanguination under deep anesthesia by intraperitoneal injection of pentobarbital. Pathological evaluation. Eight of the 16 mice from each group were used for pathologic examination. The lungs were fixed by 10% neutral phosphate-buffered formalin. After separation of the lobes, 2 mm thick blocks were taken for paraffin embedding. Embedded blocks were sectioned at a thickness of 3 μm, and then were stained with hematoxylin and eosin (HE) and with periodic acid-Schiff (PAS) to evaluate the degree of lung inflammation. A pathological observation of the inflammatory cells and epithelial cells in the airway of each lung lobe on the slides was performed using a Nikon ECLIPSE light microscope (Nikon Co., Tokyo, Japan). Bronchoalveolar lavage fluid (BALF). The remaining eight mice were used for an examination of the free cell contents from bronchoalveolar lavage fluid (BALF). BALF and cell counts were conducted using a previously reported method (He et al., 2010a,b; Ichinose et al., 2006; 2008a,b). In brief, the trachea was cannulated after the collection of blood. The lungs were lavaged with two injections of 0.8 ml of sterile saline at 37 °C by syringe. The lavaged fluid was harvested by gentle aspiration. The average volume retrieved was 90% of the amount instilled (1.6 ml). The fluids from the two

M. He et al. / Toxicology and Applied Pharmacology 258 (2012) 237–247

lavages were combined, cooled to 4 °C, and centrifuged at 1500 rpm for 10 min. The total amount of lavages collected from individual mice was used in order to measure the protein levels of cytokines and chemokines in the BALF. The total cell count of a fresh fluid specimen was determined using a hemocytometer. Differential cell counts were assessed on cytologic preparations. Slides were prepared using a Cytospin (Sakura Co., Ltd., Tokyo, Japan) and stained with Diff-Quik (International Reagents Co., Kobe, Japan). A total of 300 cells were counted under oil immersion microscopy. The BALF supernatants were stored at − 80 °C until analyzed for cytokines and chemokines. Quantitation of cytokines and chemokines in BALF. The cytokine protein levels in the BALF were determined using enzyme-linked immunosorbent assays (ELISA). IL-12was measured using an ELISA kit from Endogen, Inc. (Cambridge, MA). Interferon (IFN)-β, IFN-γ, IL-1β, IL2, IL-6, tumor necrosis factor (TNF)-α, keratinocyte chemoattractant (KC), monocyte chemotactic protein (MCP)-1, and macrophage inflammatory protein (MIP)-1α were measured using an ELISA kit from R&D Systems Inc. (Minneapolis, MN). Concentrations of cytokine and chemokine were calculated using standard curves. The detection limits of the assays were 3 pg/ml for IL-1β, 3 pg/ml for IL-2, 1.8 pg/ml for IL-6, 2.5 pg/ml for IL-12, 15.5 pg/ml for IFN-β, 2 pg/ml for IFN-γ, 5.1 pg/ml for TNF-α, 2 pg/ml for KC, 3 pg/ml for MCP-1, and 1.5 pg/ml for MIP-1α. Cell culture. RAW264.7 cells, which are macrophage-like cells derived from BALB/c male mice, were obtained from the American Type Culture Collection (ATCC) (Rockville, MD). The cells were cultured at 37 °C in a humidified atmosphere of 5% CO2–95% air and maintained in Dulbecco's modified Eagle's medium with 10% heat inactivated fetal bovine serum. For gene expression analysis of TLRs and chemokines in cells infected with KP, RAW264.7 cells were plated at a concentration of 4 × 10 5 cells per 60-mm dish, mixed with 1 μg of TLR2 antibody T2.5 (anti-TLR2) (Hycult Biotech Inc, PA) and/or TLR4 antibody MTS510 (anti-TLR4) (Hycult Biotech Inc, PA) for 1 h precipitation, and then KP was added to cells to a final concentration of 4.3 × 10 4 cells/ml. Cells were incubated for 3 h and 12 h. The monoclonal antibody T2.5 reacts with mouse Toll-like receptor 2 (TLR2, CD282) to inhibit murine TLR2-mediated cell activation in murine RAW264.7 cells and primary macrophages (Meng et al., 2004). The MTS510 monoclonal antibody reacts preferentially with murine TLR4 that is associated with MD-2 to block LPS-induced cytokine production (Akashi et al., 2000). For gene expression analysis of TLRs, NALP3 inflammasome and cytokines in cells treated with ASD, RAW264.7 cells were plated at a concentration of 4 × 10 5 cells per 60-mm dish. And then ASD with or without KP was added to cells. The final concentration of ASD was 30 μg/ml and the concentration of KP solution was 4.3 × 10 4 cells/ml. Cells were then incubated for 3 h and 12 h. Gene expression analysis. Total RNA was extracted by standard procedures using 0.5 ml of Isogen (Nippon Gene, Tokyo, Japan) per dish. After DNase treatment of the total RNA, cDNA was synthesized by reverse transcription using M-MLV. Quantitative PCR was performed using an ABI Prism 7000 Sequence Detection System (Applied Biosystems, Inc., Foster City, CA) under the same conditions as in our previous studies (He et al., 2010a,b; Yoshida et al., 2006). Two wells were used for each sample. The relative expression of each sample was calculated as the mean value divided by the mean value for GAPDH. The primers and probes used in this in vitro study are shown in Table 1. Assay for cytokines in nutrient medium. The protein levels of cytokines in the nutrient medium were determined using ELISA. IL-1β, IL-6, IFN-β, TNF-α, KC, MCP-1 and MIP-1α were measured using an ELISA kit from R&D Systems Inc.

239

Table 1 Primers and probes used in the present in vitro study. Primers and probes

Gene sequence

GAPDH sense GAPDH antisense GAPDH probe TLR2 sense TLR2 antisense TLR2 probe TLR4 sense TLR4 antisense TLR4 probe IL-1β sense IL-1β antisense IL-1β probe Nalp3 sense Nalp3antisense NaIp3 probe CARD sense CARD antisense CARD probe Casp 1 sense Casp 1 antisense Casp 1 probe IFN-β sense IFN-β antisense IFN-β probe IL-6 sense IL-6 antisense IL-6 probe TNF-αsense TNF-α antisense TNF-α probe KC sense KC antiscnse KC probe MCP-1 sense MCP-1 antisense MCP-1 probe MIP-1α sense MIP-1α antisense MIP-1α probe

TGCACCACCAACTGCTTAG GGATGCAGGGATGATGTTC CAGAAGACTGTGGATGGCCCCTC GAATTGCATCAC CGGTCAGAA CTGAGCAGA ACAGCGTTTGC CGTCAAATCTCAGAGGATGCTACGAGC AGGACTCTGATCA TGGCACTGTT GAGTTTCTGATC CATGCATFGG CCAGGAAGCTTGAATCCCTGCATAGAGG TCCTGAACTCAACTGTGAAATGC AGCCCAGGTCAAAGGTTTGG AGCAGCCCTTCATCTTTTGGGGTCCG TGGAGAAAATGCCTTGGGAGAC GGTCAGAGCTGAACAACAGATTG AGGCCGGAATTCACCAACCCCAGCT AGCTGCAAACGACTAAAGAAGAG ACCCTGGCAATGAGTGCTTG CCACAAAGTGTCCTGTTCTGGCTGTACTCT TCACGCCCTGTTGGAAAGG CTCACTGAGTTGATAAATTGCTTCC CTTTGCCCTCAGGATCTTGTCAGCCATG TCCCTATGGAGATGACGGAGAA TCIGAGTTCATCCAGGACIACGTA CACTGCCTTTGCCATCCAAGAGATGC CCGGAGAGGAGACTFCACAGA GTTGTTCATACAATCAGAATTGCCATT ACCACTCCCAACAGACCTGTCTATACCACT CAAAATTCGAGTGACAAGCCTGTA CACCACTAGTTGGTTGTCTTTGAGA CACGTCGTAGCAAACCACCAAGTGGA GCTTGAAGGTGTTGCCCTCA CCAGCCTACTCATTGGGATCA ACCCAAACCGAAGTCATAGCCACACTCA TCTGGGCCTGCTGTTCACA CCAGCCTACTCATTGGGATCA TTGGCTCAGCCAGATGCAGTTAACGC ATTCCACGCCAATTCATCGT TTGGAGTCAGCGCAGATCTG CCTTTGCTCCCAGCCAGGTGTCATT

Statistical analysis. Statistical analyses on the pathologic evaluation in the airway, cytokine and chemokine proteins in BALF, and gene expression in RAW264.7 cells and protein levels of cytokines in the nutrient medium were conducted using Tukey for pairwise comparisons (KyPlot Ver.5, Kyens Lab Inc., Tokyo, Japan). Differences among groups were determined as statistically significant at a level of p b 0.05. Results Contents of chemical elements in ASD As previously reported (He et al., 2010a), the chemical elements in the ASD sample used in this study were 61.8% SiO2, 13.6% Al2O3, 5.7% Fe2O3, 5.4% CaO, 3.3% MgO, 0.01% TiO2, and 2.6% K2O. The size distribution peak of ASD was observed at 4.7 μm. Enhancement of cell numbers in BALF by ASD To estimate the effects of ASD on the lung inflammation caused by KP, the cellular profile of BALF was examined (Fig. 1). ASD0.2 and ASD0.8 caused little increase in the number of neutrophils in BALF. ASD0.8 alone (p b 0.001) and ASD0.2 + KP (p b 0.01) increased the number of macrophages in BALF compared to the control. KP alone induced a significant increase in total cell (p b 0.001), neutrophil (p b 0.001) and lymphocyte (p b 0.01) counts in BALF compared to the control. Administration of ASD0.2 or ASD0.8 combined with KP increased the number of total cells and neutrophils in BALF compared to the control, KP and ASD alone (p b 0.001). Furthermore, ASD0.8 +

240

M. He et al. / Toxicology and Applied Pharmacology 258 (2012) 237–247

350

Total Cells

*‡¶

300

Cell number (×104 total BALF)

Neutrophils 250

*‡§

*‡¶

Macrophages *‡§

Lymphocytes 200 *

150

*

100

†

*

50

*‡¶

†

0

Control

ASD0.2

ASD0.8

KP

ASD0.2+ KP

ASD0.8+ KP

Fig. 1. Cellular profile in bronchoalveolar lavage fluids (BALF). All values expressed as mean ± SE. ⁎p b 0.001 versus control, †p b 0.01 versus control, ‡p b 0.001 versus KP, §p b 0.001 versus ASD0.2, ¶p b 0.001 versus ASD0.8.

KP resulted in a further significant increase of lymphocytes in BALF compared to the control, KP and ASD alone (p b 0.001). Enhancement of pathologic changes in the airway by ASD To evaluate the effects of ASD on pneumonia caused by KP, lung pathology in the six groups of mice was investigated (Fig. 2). No pathological alterations were found in the lungs of the control group (Fig. 2A). Invasion of inflammatory cells was not observed, although scattered ASD was seen in the alveolar area in ASD0.2 (Fig. 2B) or ASD0.8 (Fig. 2C)-treated mice. KP alone caused slight

A

infiltration of neutrophils into the submucosa of the airways with slight goblet cell proliferation in the bronchial epithelium and invasion of neutrophils into the alveolar area (Fig. 2D). However, ASD0.2 + KP (Fig. 2E) and ASD0.8 + KP (Fig. 2F) caused more prominent infiltration of neutrophils into the alveolar tissue spaces and the connective tissue in the airway compared with KP alone. ASD0.8 + KP, in particular, was more effective in causing the accumulation of neutrophils in the alveolar compartments than ASD0.2 + KP. Both combined administrations caused goblet cell proliferation in the bronchial epithelium and hypertrophy of the connective tissue in the airway (Figs. 2E, F).

B

0.4 µm D

C

0.4 µm E

0.4 µm

0.4 µm F

0.4 µm

0.4 µm

Fig. 2. Effects of ASD on pathological changes in the lungs induced by KP. No pathological changes in lungs treated with saline (A). The invasion of inflammatory cells was not observed though scattered ASD was seen in the alveolar area in an ASD0.2 (B) or ASD0.8 (C)-treated mouse. Slight infiltration of neutrophils in the submucosa of the airway with slight goblet cell proliferation in the bronchial epithelium and invasion of neutrophils in the alveolar area were seen in the KP-only group (D). More prominent infiltration of neutrophils into the alveolar tissue spaces and the connective tissue in the airway was seen in the ASD0.2 + KP group (E) and the ASD0.8 + KP (F) group than in the KP-only group. Moderate to marked goblet cell proliferation in the bronchial epithelium and hypertrophy of the connective tissue in the airway were seen in the ASD0.2 + KP group (E) and the ASD0.8 + KP (F) group (E, F).

M. He et al. / Toxicology and Applied Pharmacology 258 (2012) 237–247

α, KC, and MCP-1in the ASD0.8 + KP group were greater than the sum of ASD0.8 alone and KP group alone. ASD caused no expression of IL-2 and IFN-β in the presence or absence of KP.

Animal (n)

Cytokines (pg/ml) IL-1β

IL-2

IL-6

Control ASD0.2 ASD0.8 KP

8 8 8 8

ND ND ND ND

ASD0.2 + KP

8

ASD0.8 + KP

8

ND ND ND 52.2 ± 7.01† 88.0 ± 12.1†¶I 121 ± 10.5†§II⁎⁎

ND ND ND 155 ± 9.11† 239 ± 32.0†¶I 286 ± 31.6†§II

ND ND

IL-12

IFN-β

IFN-γ

26.2 ± 4.57 67.7 ± 13.2 76.4 ± 13.5 967 ± 48.1†

ND ND ND ND

1080 ± 97.6†I

ND

1415 ± 46.9†§II¶¶

ND

ND ND ND 104 ± 25.1 149 ± 40.9 854 ± 355‡¶§§⁎⁎

⁎The control group was instilled intratracheally with 0.1 ml of normal saline (Otsuka Co., Kyoto, Japan) four times at 2-week intervals. The ASD-only group was intratracheally instilled with ASD at doses of 0.05 mg or 0.2 mg four times at 2-week intervals. The total doses administered were 0.2 mg/mouse or 0.8 mg/mouse. The KP-only group was intratracheally instilled with 0.1 ml two time-dilution solution of KP (concentration of 4.3 × 106/ml) at the last intratracheal instillation. The ASD0.2 + KP group and the ASD0.8 + KP group were simultaneously injected with ASD and KP at the last intratracheal instillation. All values were expressed as mean± SE. ND: not detected. † p b 0.001 versus Control; ‡p b 0.01 versus Control; §p b 0.001 versus KP; ¶p b 0.05 versus KP; Ip b 0.001 versus ASD0.2; IIp b 0.001 versus ASD0.8; §§p b 0.01 versus ASD0.8; ¶¶ p b 0.001 versus ASD0.2 + KP; ⁎⁎p b 0.05 versus ASD0.2 + KP.

Enhancement of cytokines and chemokines in BALF by ASD To investigate the effects of ASD on the expression of cytokines (Table 2) and chemokines (Table 3) caused by KP, the protein levels of IL-1β, IL-2, IL-6, IL-12, IFN-β, IFN-γ, TNF-α, KC, MCP-1 and MIP1α in BALF were measured. ASD0.8 alone caused a significant increase (p b 0.001) of MIP-1α compared to the control (Table 3). KP alone increased the cytokines (p b 0.001) of IL-1β, IL-6 and IL-12, and chemokines (p b 0.05) of KC, MCP-1 and MIP-1α compared to the control (Tables 2 and 3). ASD0.2 + KP caused a more prominent increase of IL-1β, IL-6 and KC compared to the control (p b 0.001), ASD0.2 alone (p b 0.001) and KP alone (IL-1β, p b 0.05; IL-6, p b 0.05; KC, p b 0.001). ASD0.8 + KP showed a remarkable elevation of all the cytokines and chemokines compared to the control (IL-1β, IL-6, IL-12, TNF-α, KC, MCP-1, MIP-1α, p b 0.001; IFN-γ, p b 0.01), ASD0.8 alone (IL-1β, IL-6, IL-12, KC, MCP-1, p b 0.001; IFN-γ, TNF-α, p b 0.01) and KP alone (IL1β, IL-6, IL-12, TNF-α, KC, p b 0.001; IFN-γ, p b 0.05; MCP-1, p b 0.01). ASD0.8 + KP showed a further increase of IL-1β (p b 0.05), IL-12 (p b 0.001), IFN-γ (p b 0.05), and MIP-1α (p b 0.01) compared to ASD0.2 + KP. In particular, increased levels of IL-1β, IL-6, IFN-γ, TNF-

In vitro analysis of expression of TLRs and pro-inflammatory mediator in RAW264.7 cells infected with KP To determine the role of TLRs in signaling a pathway for proinflammatory mediator production in RAW264.7 cells infected with KP, the gene expression of TLR2, TLR4, MIP-1α, MCP-1 and TNF-α in the cells and protein levels of their pro-inflammatory mediator in a culture medium were measured in the presence or absence of antiTLR2 and anti-TLR4 antibodies (Figs. 3 and 4). As shown in Fig. 3, KP markedly increased the mRNA expression of TLR2 compared to the control at 3 h (p b 0.001). Treatment with anti-TLR2 and antiTLR2 + anti-TLR4 tended to suppress the mRNA expression of TLR2 at 3 h (Fig. 3) and tended to suppress the mRNA expression of MIP1α at 3 h and 12 h, MCP-1 at 12 h and TNF-α at 3 h in RAW264.7 cell, as well as their protein levels secreted into the culture medium at 12 h compared with the cells treated with KP alone (Fig. 4). Treatment with anti-TLR4 tended to slightly suppress the mRNA expression of TLR2 at 3 h (Fig. 3). However, KP suppressed the expression of TLR4 mRNA in the absence or presence of these antibodies at 3 h and 12 h (p b 0.001) compared with the control (Fig. 3). Treatment of anti-TLR4 could not suppress the gene expression of MIP-1α, MCP-1 and TNF-α induced by KP at either of the time points 0.14

TLR 2 relative mRNA expression (target GAPDH)

Table 2 Expression of cytokines in bronchoalveolar lavage fluids (BALF). Group⁎

241

3h 12 h

*

0.12

*

* *

0.1 0.08 0.06 0.04 0.02 0 KP aTLR 2 aTLR 4 -

+ -

+ + -

+ +

-

+ + +

+ -

+ + -

+ + +

+ +

0.012

Group⁎

Control ASD0.2 ASD0.8 KP ASD0.2 + KP ASD0.8 + KP

Animal Chemokines (pg/ml) (n) TNF-α KC

MCP-1

MIP-1α

8 8 8 8 8

ND 3.10 ± 2.24 8.27 ± 3.53 405 ± 87.9§ 585 ± 97.1† II

ND 13.0 ± 2.05 93.2 ± 25.6† 58.7 ± 10.4§ 91.2 ± 8.45†§§

8

ND ND ND 58.5 ± 8.29 126 ± 26.2‡¶¶ 226 ± 52.3†¶††

14.8 ± 1.73 46.2 ± 4.51 90.9 ± 11.4 123 ± 15.3§ 313 ± 44.9†¶II

418 ± 35.5†¶‡‡ 866 ± 151† I‡‡ 157 ± 8.98†¶⁎⁎

⁎The control group was instilled intratracheally with 0.1 ml of normal saline (Otsuka Co., Kyoto, Japan) four times at 2-week intervals. The ASD-only group was intratracheally instilled with ASD at doses of 0.05 mg or 0.2 mg four times at 2-week intervals. The total doses administered were 0.2 mg/mouse or 0.8 mg/mouse. The KP-only group was intratracheally instilled with 0.1 ml two time-dilution solution of KP (concentration of 4.3 × 106/ml) at the last intratracheal instillation. The ASD0.2 + KP group and the ASD0.8 + KP group were simultaneously injected with ASD and KP at the last intratracheal instillation. All values were expressed as mean± SE. ND: not detected. † p b 0.001 versus Control; ‡p b 0.01 versus Control; §p b 0.05 versus Control; ¶p b 0.001 versus KP; Ip b 0.01 versus KP; IIp b 0.001 versus ASD0.2; §§p b 0.01 versus ASD0.2; ¶¶ p b 0.05 versus ASD0.2; ‡‡p b 0.001 versus ASD0.8; ††p b 0.01 versus ASD0.8; ⁎⁎p b 0.01 versus ASD0.2 + KP.

TLR 4 relative mRNA expression (target GAPDH)

3h

Table 3 Expression of chemokines in bronchoalveolar lavage fluids (BALF).

12 h

0.01 0.008

‡

0.006

†

†

0.004 *

*

*

*

+

+

+

+ +

0.002 0 KP aTLR 2 aTLR 4

-

+

-

-

+ + -

-

+

+

+

+

-

+ -

+

+ +

Fig. 3. Effects of KP on TLR2 and TLR4 mRNA expression in RAW264.7 cells in the presence or absence of anti-TLR2 and anti-TLR4 antibodies. RAW264.7 cells were plated at a concentration of 4 × 105 cells per 60-mm dish, mixed with 1 μg of TLR2 antibody T2.5 or/and TLR4 antibody MTS510 (Hycult Biotech Inc., 600 West Germantown Pike, Suite 400, Plymouth Meeting, PA 19462) for overnight precipitation, and then KP was added to cells at the concentration of 4.3 × 104/ml. Cells were incubated for 3 h and 12 h. Results are expressed as mean ± SE. ⁎p b 0.001 versus Control, †p b 0.01 versus Control, ‡p b 0.05 versus Control.

M. He et al. / Toxicology and Applied Pharmacology 258 (2012) 237–247

MCP-1 relative mRNA expression (target GAPDH)

†

3

† †

† †§

*

*

†

2 1 -

+ -

+ + -

+ +

-

+ + +

+ + -

+ +

+ + +

†

†

0.12 ‡I

0.09 *I

0.06

0 KP aTLR 2 aTLR 4

-

†

†

†

†

+ -

+ + -

+ +

+ + +

1

+ -

+ + -

+ +

+ + +

†

†I

0.6 0.4

†

0.2 0 KP aTLR 2 aTLR 4

-

+ -

*

-

+ + -

+ +

+ + +

-

+ -

†

+ + -

†

+ +

†

+ + +

+ -

+ + -

+ +

+ + +

-

3h 12 h

+ -

+ + -

+ +

+ + +

†

‡

4

‡

*

3

I

2 1

0 KP aTLR 2 aTLR 4

-

†

†

0.8

*

3 25 ×10

3h 12 h

1.2

-

†

3h 12 h

*

5

0.15

0.03

×104

3 6 ×10

3h 12 h

0.18

+ -

16 14 12 10 8 6 4 2 0 KP aTLR 2 aTLR 4

MIP-1α (pg/ml)

4

0 KP aTLR 2 aTLR 4

TNF-α relative mRNA expression (target GAPDH)

3h 12 h

5

MCP-1 (pg/ml)

6

TNF- α (pg/ml)

MIP-1α relative mRNA expression (target GAPDH)

242

+ -

+ + -

+ +

+ + +

-

+ -

+ + -

+ +

†

3h 12 h

20

†

15

†I§ †I

10 5

0 KP aTLR 2 aTLR 4

+ + +

-

†

†

+ -

+ + -

† ‡I

+ +

+ + +

-

+ -

+ + -

+ +

+ + +

Fig. 4. Effect of KP on mRNA expression and secretion of chemokines in RAW 264.7 cells in the presence or absence of anti-TLR2 and anti-TLR4 antibodies. RAW264.7 cells were plated at a concentration of 4 × 105 cells per 60-mm dish, mixed with 1 μg of TLR2 antibody T2.5 or/and TLR4 antibody MTS510 (Hycult Biotech Inc., 600 West Germantown Pike, Suite 400, Plymouth Meeting, PA 19462) for overnight precipitation, and then KP was added to cells to a final concentration of 4.3 × 104/ml. Cells were incubated for 3 h and 12 h. All values expressed as mean ± SE. †p b 0.001 versus Control, ‡p b 0.01 versus Control, ⁎p b 0.05 versus Control, Ip b 0.01 versus KP, §p b 0.01 versus KP + aTLR4.

(Fig. 4), and the suppression levels of these proteins in the culture medium were lower in the presence anti-TLR4 than in the presence anti-TLR2. In vitro analysis of expression of TLRs and pro-inflammatory mediator in RAW264.7 cells treated with ASD and KP The effects of ASD on the expression of TLRs and proinflammatory mediators induced by KP were examined in RAW264.7 cells (Figs. 5, 6 and 7). ASD alone caused no increased expression of TLR2 mRNA in RAW264.7 cells, but KP alone significantly increased the mRNA at 3 h compared with the control (p b 0.01) (Fig. 5). Combined treatment of ASD and KP further increased TLR2 mRNA at 3 h compared to KP alone, but not significant (Fig. 5). ASD alone and the combined treatment caused no increase of TLR2 mRNA at 12 h. ASD alone tended to decrease of TLR4 mRNA, but KP alone and ASD + KP significantly decreased TLR4 mRNA compared with the control and ASD alone (p b 0.001) (Fig. 5). ASD alone and ASD + KP caused no change of the mRNA at 12 h. KP alone and ASD + KP significantly increased the mRNA expression of IL-1β, IL-6, IFN-β, TNF-α, KC, MCP-1 and MIP-1α at 3 h compared to the control and ASD alone (p b 0.001) (Figs. 6 and 7). ASD + KP caused further increases in the mRNA expression compared with KP alone at 3 h, but not significant. The mRNA expression of IL1β, IL-6, MCP-1 and MIP-1α induced by KP alone and ASD + KP at 12 h was still greater compared to that of KP alone and ASD + KP at

3 h (Figs. 6 and 7). This mRNA expression was still higher in ASD + KP than in KP alone at 12 h. In results comparable to these, administration of KP alone and ASD + KP caused a remarkable elevation in the protein level of IL-6, TNF-α, MCP-1 and MIP-1α in culture medium compared to the control and ASD alone (p b 0.001) at 3 h and 12 h (Figs. 6 and 7). ASD + KP caused further increases of TNF-α and MCP-1 compared with KP alone at 12 h (Fig. 7), but MIP-1α stayed at almost the same level. KP alone and ASD + KP caused an increase of low levels of IL1-β at 3 h and 12 h. The levels were higher in ASD + KP than in KP alone at 12 h, but not significant. KP alone and ASD + KP treatment caused no increase of IFN-β and KC protein in a culture medium. In vitro analysis of gene expression of NALP3 ASC, and caspase-1 in RAW264.7 cells treated with ASD and KP To investigate the effects of ASD on sensors for leading to inflammation in the antigen presenting cells, the gene expressions of NALP3, ASC, caspase-1 in RAW264.7 cells were measured (Fig. 8). ASD alone caused no increased expression of NALP3 mRNA. KP alone and ASD + KP significantly increased NALP3 mRNA at 3 h (p b 0.001) compared with the control and tended to increase caspase-1 at 12 h. The expression levels of NALP3 mRNA at 3 h and caspase-1 mRNA at 12 h were higher in ASD + KP than in KP alone. ASD alone and ASD + KP tended to increase ASC (except ASD alone at 3 h) at 3 h and 12 h compared with the control.

M. He et al. / Toxicology and Applied Pharmacology 258 (2012) 237–247

A

243

0.08 *†

0.07

3h

TLR 2 relative mRNA expression (target GAPDH)

‡§

0.06

12 h

0.05 0.04 0.03 0.02 0.01 0 Control

B

ASD

KP

ASD+KP

Control

ASD

KP

ASD+KP

0.016

3h 0.014

TLR 4 relative mRNA expression (target GAPDH)

12 h 0.012 0.01 0.008 0.006 *†

0.004

*†

0.002 0 Control

ASD

KP

ASD+KP

Control

ASD

KP

ASD+KP

5

Fig. 5. Effects of ASD on TLR2 and TLR4 mRNA in RAW264.7 cells by KP. RAW264.7 cells were plated at a concentration of 4 × 10 cells per 60-mm dish. And then ASD with or without KP was added to cells. The final concentration of ASD was 30 μg/ml and the concentration of KP solution was 4.3 × 104/ml. Cells were then incubated for 3 h and 12 h. All values expressed as mean ± SE. ⁎p b 0.001 versus Control, †p b 0.001 versus ASD, ‡p b 0.01 versus Control, §p b 0.01 versus ASD.

Discussion ASD has been shown to adsorb many kinds of microorganisms (Chen et al., 2010; Kobayashi et al., 2010; Maki et al., 2010) some of which are highly pathogenic. The exacerbation of pneumonia incidence by Asian sand particles in murine lungs was investigated using KP. The present study has demonstrated that administration of ASD exacerbated pneumonia incidence in KP infected mice, which is evidenced by cellular profiles of BALF and pathological examinations. As to overall trends, these changes were paralleled by the expression of proinflammatory cytokines such as IL-1β, IL-6, IL-12, and IFN-γ, and chemokines including TNF-α, KC, MCP-1 and MIP-1α. Furthermore, all the enhancing effects were more remarkable in the ASD0.8 + KP group than in the ASD0.2 + KP group. In addition, in the in vitro study using RAW264.7 cells, combined administration of ASD and KP increased the mRNA expression of IL1β, IL-6, IFN-β, KC, MCP-1 and MIP-1α and increased the protein level of IL-1β, TNF-α, and MCP-1 in a culture medium compared to each being administered alone.

Effective host defense against lung bacterial infection is primarily dependent upon the rapid clearance of the organism from the respiratory tract. This clearance is known to be mediated by macrophages and neutrophils that are vigorously recruited and/or activated at the site of infection (Toews et al., 1979). In this in vivo study, the administration of ASD combined with KP enhanced inflammation, which was characterized by an increase of neutrophils and macrophages in BALF. These results provide evidence that ASD contributes to the aggravation of neutrophilic lung inflammation induced by KP. The various biological components in BALF may well reflect an event in the lungs. IL-1β and IL-18 produced by the NALP3inflammasome pathway are important pro-inflammatory cytokines that, on one hand, activate monocytes, macrophages, and neutrophils, and on the other hand, induce Th1 and Th17 adaptive cellular responses (Netea et al., 2010). TNF-α contributes to the host defense against bacterial invasion (Williams et al., 1999), activates macrophages to kill intracellular pathogens, and is directly involved in neutrophilic inflammation of the airway (Kips et al., 1992; Windsor et al., 1993). Also IL-6, IFN-γ, KC, MCP-1 and MIP-1α play an important role in an inflammation process. It has been reported that neutrophilic

244

B

1.2

3h *†

IL-1β (pg/ml)

*†

0.8

*†

0.6 0.4 0.2

8

ASD

KP ASD+KP Control

ASD

KP

12 10 8 6 4 ND

Control

ASD+KP

ND

ASD

KP ASD+KP Control

ASD

KP

ASD+KP

3h

*†

125

12 h

6 5 4 3 *†

2

*†

150

*†

3h

*†

*†

12 h

100 75 50 25

1

ND

ND

Control

ASD

ND

ND

ND

ND

0

0 Control

ASD

KP ASD+KP Control

ASD

KP

ASD+KP

E IFN-β relative mRNA expression (target GAPDH)

12 h

D

×10-4

7

F 2.5

3h

14

0

IL-6 (pg/ml)

C

16

2

0.0 Control

IL-6 relative mRNA expression (target GAPDH)

*†

12 h

1.0

×10-4

*†

2.0 *†

KP ASD+KP Control

14

3h

12 h

12

12 h

‡§

1.5 1.0 0.5

KP

ND

ND

ASD

KP

ASD+KP

10 8 6 4 2

0.0

ASD

16

3h

IFN-β (pg/ml)

IL-1β relative mRNA expression (target GAPDH)

A

M. He et al. / Toxicology and Applied Pharmacology 258 (2012) 237–247

ND

ND

ND

ASD

KP

ND

ND

ND

0 Control

ASD

KP ASD+KP Control

ASD

KP

ASD+KP

Control

ASD+KP Control

ASD+KP

Fig. 6. Effect of ASD on gene expression and protein secretion of IL-1β, IL-6, and IFN-β in RAW 264.7 cells by KP. RAW264.7 cells were plated at a concentration of 4 × 105 cells per 60-mm dish. And then ASD with or without KP was added to cells. The final concentration of ASD was 30 μg/ml and the concentration of KP solution was 4.3 × 104/ml. Cells were then incubated for 3 h and 12 h. All values expressed as mean ± SE. ND: not detected. ⁎p b 0.001 versus Control, †p b 0.001 versus ASD, ‡p b 0.01 versus Control, §p b 0.01 versus ASD, I p b 0.05 versus KP.

inflammation accompanying these cytokines (IL-1β, IL-6, IL-12, IFNγ, TNF-α) and chemokines (KC, MCP-1, MIP-1α) in the murine lung was induced by KP (Tsai et al., 1998; Yoshida et al., 2001). In the present study, ASD alone tended to increase IL-12, KC, MIP-1α in BALF. Although KP caused increases of these pro-inflammatory mediators in BALF, these production effects by combined treatment of ASD and KP were greater than the total effect of the ASD and KP groups, suggesting that the combination treatment may cause increased neutrophilic inflammation via enhancement of these pro-inflammatory mediators. In the first in vitro experiment, we investigated the roles of TLR2 and TLR4 as signaling pathways for pro-inflammatory cytokine production in RAW264.7 cells infected with KP plus anti-TLR2 and antiTLR4 antibodies. Activation of TLRs leads to induction of direct antimicrobial pathways, expression of costimulatory molecules and release of cytokines and chemokines that influence airway inflammation (Beutler, 2004; Beutler et al., 2003). Although TLR4 is the principal TLR species involved in LPS like E. coli signaling, recent studies indicate that TLR2 in murine macrophages is the primary signal transducing molecule for Porphyromonas gingivalis LPS and Leptospiral LPS (Hirschfeld et al., 2001; Tapping et al., 2007). KP strain 52145 increases the expression of TLR2 and TLR4 mRNA and their protein in human airway epithelial cells (Regueiro et al., 2009). However,

outer membrane protein A (kpOmpA) from KP I-145 signaled through TLR2 induced dendritic cells to produce IL-12 (Jeannin et al., 2000). Thus, the gene or protein expression of TLR2 and TLR4 is different depending on the kind of gram-negative bacteria, the origin of LPS, strains of KP and kind of host cell used. In the present study, KP (ATCC 9997) increased the expression of TLR2 mRNA in RAW264.7 cells, and treatment with anti-TLR2 and anti-TLR2 + anti-TLR4 tended to suppress the mRNA expression of TLR2 and suppressed the mRNA expression of MIP-1α, MCP-1 and TNF-α in RAW264.7 cell, as well as their protein levels secreted into the culture medium. However, KP suppressed the expression of TLR4 mRNA in the absence or presence of these antibodies. Treatment of anti-TLR4 could not suppress the expression of MIP-1α, MCP-1 and TNF-α mRNA and the suppression levels of these proteins in the culture medium were lower in the presence of anti-TLR4 than in the presence of anti-TLR2. Our results indicate that the production of these pro-inflammatory mediators may be caused mainly via the TLR2 signaling pathway. In the second in vitro study, the gene expression of TLR2, TLR4 and pro-inflammatory mediators in RAW264.7 cells and their protein levels in the culture medium was measured in the presence of ASD and/or KP. KP or ASD + KP increased the expression of TLR2 mRNA, but suppressed TLR4 mRNA. The expression of TLR2 mRNA was higher in the ASD + KP group than in the KP group. The gene

M. He et al. / Toxicology and Applied Pharmacology 258 (2012) 237–247

B 1.2

*†

25 ×103

*†

3h

1

12 h

0.8 0.6 0.4 0.2 0 ASD

KP ASD+KP Control

ASD

KP

12 h

10 *†

5 Control

*†

ASD

KP ASD+KP Control

ASD

KP

ASD+KP

D 5

-5

7 ×10 6 5 4 3 2 1 0 Control

*†

3h

KC (pg/ml)

KC relative mRNA expression (target GAPDH)

*†

15

ASD+KP

12 h

*†

3h

4

12 h

3 2 1

ND

ND

ND

ND

ND

ASD

KP ASD+KP Control

ND

ND

ND

0 ASD

KP ASD+KP Control

ASD

KP

ASD+KP

Control

F

E

0.6

*†§

3h

0.5

12 h

*†

0.4 0.3 0.2 *†

0.1

*†‡

ASD

KP

3 7 ×10

ASD+KP

*† 3h

6

MCP-1 (pg/ml)

MCP-1 relative mRNA expression (target GAPDH)

20

0 Control

C

*†

12 h

5 4 3 2 1 0

0 Control

ASD

KP ASD+KP Control

ASD

KP

Control

ASD+KP

G

ASD

KP

ASD+KP Control

ASD

KP

ASD+KP

H 150 ×103

*†

1.2 *†

1

*†

0.8

3h

MIP-1α (pg/ml)

MIP-1α relative mRNA expression (target GAPDH)

*†

3h

TNF-α (pg/ml)

TNF-α relative mRNA expression (target GAPDH)

A

245

*†

12 h

0.6 0.4 0.2

*†

*†

3h

125

12 h

100 75 50 *†

25

*†

0

0 Control

ASD

KP ASD+KP Control

ASD

KP

ASD+KP

Control

ASD

KP ASD+KP Control

ASD

KP

ASD+KP

Fig. 7. Effect of ASD on gene expression and protein secretion of TNF-α, KC, MCP-1, and MIP-1α in RAW 264.7 cells by KP. RAW264.7 cells were plated at a concentration of 4 × 105 cells per 60-mm dish. And then ASD with or without KP was added to cells. The final concentration of ASD was 30 μg/ml and the concentration of KP solution was 4.3 × 104/ml. Cells were then incubated for 3 h and 12 h. All values expressed as mean ± SE. ND: not detected. ⁎p b 0.001 versus Control, †p b 0.001 versus ASD, ‡p b 0.001 versus KP, §p b 0.01 versus KP.

expression of pro-inflammatory molecules such as IL-6, IFN-β, KC, MCP-1 and MIP-1α was parallel with the gene expression of TLR2. The protein levels of TNF-α and MCP-1 in the culture medium were also higher in the ASD + KP group than in the KP group at 12 h. These results indicate that activation of the TLR2 pathway by ASD + KP may lead to enhanced production of pro-inflammatory mediators. Activation of the NALP3 is associated with the widest spectrum of stimuli such as Gram-positive, Gram-negative bacteria, toxins as well as uric acid crystals (Mariathasan et al., 2006; Martinon et al., 2006; Willingham et al., 2007). In the second in vitro study, ASD + KP tended to increase the gene expression of NALP3 and IL-1β in RAW264.7 cells and IL-1β secretion into the culture medium compared with KP alone. These results indicate that activation of NALP3 inflammasomes by ASD + KP may lead to increased production of the IL-1β protein. In this in vivo study, therefore, the increased IL-1β production by

ASD + KP may lead to subsequent inflammatory response as shown by a remarkable increase of neutrophils (Fig. 1). We speculate that the exacerbation of susceptibility to pneumonia in the presence of ASD + KP could be due to the enhanced production of proinflammatory mediators via activation of TLR2 and NALP3 inflammasome pathways in alveolar macrophages. Most importantly, this in vivo study showed that altering the dose of ASD dramatically affected lung inflammation caused by KP in mice. This result indicated that the dose dependent increase of macrophages as antigen presenting cells in the lung also may be responsible for leading to increases in the incidence of pneumonia cases triggered by exposure to ASD + KP. The activation of TLRs and NALP3 inflammasomes in alveolar macrophages by the interaction of mineral particles and pathogens may be important in aggravating lung inflammation. However, our findings obtained in the present in vivo and in vitro study were not enough to explain the aggravating mechanism by ASD containing 60% of silica. In future work, comparative experiments to determine

246

NALP3 relative mRNA expression (target GAPDH)

A

M. He et al. / Toxicology and Applied Pharmacology 258 (2012) 237–247

Conflict of interest statements

0.07 *†

0.06

The authors do not have any conflict to interest to disclose.

3h

*†

12 h

0.05

Acknowledgments

0.04 0.03 0.02 0.01 0 Control ASD

ASC relative mRNA expression (target GAPDH)

B

KP ASD+KP Control ASD

KP ASD+KP

References

2.5 3h

2

12 h

1.5 1 0.5 0 Control ASD

C 7

KP ASD+KP Control ASD

KP ASD+KP

x10-4 3h

Casp-1 relative mRNA expression (target GAPDH)

We appreciate the vital contribution of students at Oita University of Nursing and Health Sciences in this research. This study was supported in part by a grant (No. 21651010) from the Ministry of Education, Culture, Sports, Science and Technology of Japan, and by Ministry of the Environment in Japan. This work was partly supported by the Global Environment Research Fund (B-0901) of the Ministry of the Environment, Japan.

6

12 h

5 4 3 2 1 0 Control ASD

KP ASD+KP Control

ASD

KP ASD+KP

Fig. 8. Effects of ASD on NALP3, ASC and caspase-1 mRNA in RAW264.7 cells by KP. RAW264.7 cells were plated at a concentration of 4 × 105 cells per 60-mm dish. And then ASD with or without KP was added to cells. The final concentration of ASD was 30 μg/ml and the concentration of the KP solution was 4.3 × 104/ml. Cells were then incubated for 3 h and 12 h. All values expressed as mean ± SE. ⁎p b 0.001 versus Control, † p b 0.001 versus ASD.

whether non-toxic particles or toxic particle like silica enhances pathogen-induced inflammatory response via TLRs or NALP3 inflammasome, is in order to confirm the aggravating mechanism. This study demonstrated the exacerbating effect of ASD on KPinduced pneumonia. The activations of TLR2 and NALP3 inflammasomes by ASD may be at least partially participating in this phenomenon. These receptors may play an important role in the secretion of pro-inflammatory mediators for protecting the host from pathogen. Even so, severe lung inflammation enhanced by ASD causes lung injury to the host. The hazardous effects of bioaerosols (biogenic particles) and mineral dust on human respiratory disease are also becoming a public concern. Atmospheric exposure to highly pathogenic bacteria and virus-carrying particulate matters could present a significant threat to human health. The experimental findings in the present study may serve as a warning about the ill effects of airborne sand dust in the world on the human respiratory system.

Agostini, L., Martinon, F., Burns, K., McDermott, M.F., Hawkins, P.N., Tschopp, J., 2004. NALP3 forms an IL-1beta-processing inflammasome with increased activity in Muckle–Wells autoinflammatory disorder. Immunity 20, 319–325. Akashi, S., Shimazu, R., Ogata, H., Nagai, Y., Takeda, K., Kimoto, M., Miyake, K., 2000. Cutting edge: cell surface expression and lipopolysaccharide signaling via the Toll-like receptor 4-MD-2 complex on mouse peritoneal macrophages. J. Immunol. 164, 3471–3475. Bell, M.L., Levy, J.K., Lin, Z., 2008. The effect of sandstorms and air pollution on causespecific hospital admissions in Taipei, Taiwan. Occup. Environ. Med. 65 (2), 104–111. Beutler, B., 2004. Inferences, questions and possibilities in Toll-like receptor signalling. Nature 430, 257–263. Beutler, B., Hoebe, K., Du, X., Ulevitch, R.J., 2003. How we detect microbes and respond to them: the Toll-like receptors and their transducers. J. Leukoc. Biol. 74, 479–485. Broug-Holub, E., Toews, G.B., van Iwaarden, J.F., Strieter, R.M., Kunkel, S.L., Paine III, R., Standiford, T.J., 1997. Alveolar macrophages are required for protective pulmonary defenses in murine Klebsiella pneumonia: elimination of alveolar macrophages increases neutrophil recruitment but decreases bacterial clearance and survival. Infect. Immun. 65 (4), 1139–1146. Chan, C.C., Chuang, K.J., Chen, W.J., Chang, W.T., Lee, C.T., Peng, C.M., 2008. Increasing cardiopulmonary emergency visits by long-range transported Asian dust storms in Taiwan. Environ. Res. 106 (3), 393–400. Chen, Y.S., Sheen, P.C., Chen, E.R., Liu, Y.K., Wu, T.N., Yang, C.Y., 2004. Effects of Asian dust storm events on daily mortality in Taipei, Taiwan. Environ. Res. 95 (2), 151–155. Chen, P.S., Tsai, F.T., Lin, C.K., Yang, C.Y., Chan, C.C., Young, C.Y., Lee, C.H., 2010. Ambient influenza and avian influenza virus during dust storm days and background days. Environ. Health Perspect. 118 (9), 1211–1216. Duce, R.A., Unni, C.K., Ray, B.J., Prospero, J.M., Merrill, J.T., 1980. Long-range atmospheric transport of soil dust from Asia to the tropical North Pacific: temporal variability. Science 209, 1522–1524. Fritz, J.H., Ferrero, R.L., Philpott, D.J., Girardin, S.E., 2006. Nod-like proteins in immunity, inflammation and disease. Nat. Immunol. 7, 1250–1257. He, M., Ichinose, T., Yoshida, S., Nishikawa, M., Mori, I., Yanagisawa, R., Takano, H., Inoue, K., Sun, G., Shibamoto, T., 2010a. Airborne Asian sand dust enhances murine lung eosinophilia. Inhal. Toxicol. 22 (12), 1012–1025. He, M., Ichinose, T., Yoshida, S., Nishikawa, M., Mori, I., Yanagisawa, R., Takano, H., Inoue, K., Sun, G., Shibamoto, T., 2010b. Urban particulate matter in Beijing, China, enhances allergen-induced murine lung eosinophilia. Inhal. Toxicol. 22, 709–718. Hirschfeld, M., Weis, J.J., Toshchakov, V., Salkowski, C.A., Cody, M.J., Ward, D.C., Qureshi, N., Michalek, S.M., Vogel, S.N., 2001. Signaling by Toll-like receptor 2 and 4 agonists results in differential gene expression in murine macrophages. Infect. Immun. 69, 1477–1482. Husar, R.B., Tratt, D.B., Schichtel, B.A., Falke, S.R., Li, F., Jaffe, D., Gasso, S., Gill, T., Laulainen, N.S., Lu, F., Reheis, M.C., Chun, Y., Westphal, D., Holben, B.N., Gueymard, C., McKendry, I., Kuring, N., Feldman, G.C., McClain, C., Frouin, R.J., Merrill, J., DuBois, D., Vigonola, F., Sugimoto, N., Malm, W.C., 2001. Asian dust events of April 1998. J. Geophys. Res. 106, 18316–18330. Ichinose, T., Sadakane, K., Takano, H., Yanagisawa, R., Nishikawa, M., Mori, I., Kawazato, H., Yasuda, A., Hiyoshi, K., Shibamoto, T., 2006. Enhancement of mite allergeninduced eosinophil infiltration in the murine airway and local cytokine/chemokine expression by Asian sand dust. J. Toxicol. Environ. Health Part A 69, 1571–1585. Ichinose, T., Yoshida, S., Sadakane, K., Takano, H., Yanagisawa, R., Inoue, K., Nishikawa, M., Mori, I., Kawazato, H., Yasuda, A., Shibamoto, T., 2008a. Effects of asian sand dust, Arizona sand dust, amorphous silica and aluminum oxide on allergic inflammation in the murine lung. Inhal. Toxicol. 20, 685–694. Ichinose, T., Yoshida, S., Hiyoshi, K., Sadakane, K., Takano, H., Nishikawa, M., Mori, I., Yanagisawa, R., Kawazato, H., Yasuda, A., Shibamoto, T., 2008b. The effects of microbial materials adhered to Asian sand dust on allergic lung inflammation. Arch. Environ. Contam. Toxicol. 55, 348–357. Jeannin, P., Renno, T., Goetsch, L., Miconnet, I., Aubry, J.P., Delneste, Y., Herbault, N., Baussant, T., Magistrelli, G., Soulas, C., Romero, P., Cerottini, J.C., Bonnefoy, J.Y., 2000. OmpA targets dendritic cells, induces their maturation and delivers antigen into the MHC class I presentation pathway. Nat. Immunol. 1 (6), 502–509.

M. He et al. / Toxicology and Applied Pharmacology 258 (2012) 237–247 Kanatani, K.T., Ito, I., Al-Delaimy, W.K., Adachi, Y., Mathews, W.C., Ramsdell, J.W., Toyama Asian Desert Dust, Asthma Study Team, 2010. Desert dust exposure is associated with increased risk of asthma hospitalization in children. Am. J. Respir. Crit. Care Med. 182 (12), 1475–1481. Kim, B.G., Han, J.S., Park, S.U., 2001. Transport SO2 and aerosol over the Yellow Sea. Atmos. Environ. 35, 727–737. Kips, J.C., Cuvelier, C.A., Pauwels, R.A., 1992. Effect of acute and chronic antigen inhalation on airway morphology and responsiveness in actively sensitized rats. Am. Rev. Respir. Dis. 145 (6), 1306–1310. Kobayashi, F., Kodanikuchi, K., Kakikawa, M., Maki, T., Yamada, M., Tobo, Y., Hong, C.S., Matsuki, A., Iwasaka, Y., 2010. Direct samplings, separated culture, and identifications of kosa bioaerosols over Noto Peninsula, Suzu City (Japanese) Earozoru Kenkyu 25 (1), 23–28. Kwon, H.J., Cho, S.H., Chun, Y., Lagarde, F., Pershagen, G., 2002. Effects of the Asian dust events on daily mortality in Seoul, Korea. Environ. Res. 90, 1–5. Maki, T., Susuki, S., Kobayashi, F., Kakikawa, M., Tobo, Y., Yamada, M., Higashi, T., Matsuki, A., Hong, C., Hasegawa, H., Iwasaka, Y., 2010. Phylogenetic analysis of atmospheric halotolerant bacterial communities at high altitude in an Asian dust (KOSA) arrival region, Suzu City. Sci. Total Environ. 408 (20), 4556–4562. Mariathasan, S., Monack, D.M., 2007. Inflammasome adaptors and sensors: intracellular regulators of infection and inflammation. Nat. Rev. Immunol. 7 (1), 31–40. Mariathasan, S., Weiss, D.S., Newton, K., McBride, J., O'Rourke, K., Roose-Girma, M., Lee, W.P., Weinrauch, Y., Monack, D.M., Dixit, V.M., 2006. Cryopyrin activates the inflammasome in response to toxins and ATP. Nature 440, 228–232. Martinon, F., Petrilli, V., Mayor, A., Tardivel, A., Tschopp, J., 2006. Goutassociated uric acid crystals activate the NALP3 inflammasome. Nature 440, 237–241. Mayor, A., Martinon, F., De Smedt, T., Pétrilli, V., Tschopp, J., 2007. A crucial function of SGT1 and HSP90 in inflammasome activity links mammalian and plant innate immune responses. Nat. Immunol. 8, 497–503. Meng, Z., Lu, B., 2007. Dust events as a risk factor for daily hospitalization for respiratory and cardiovascular diseases in Minqin, China. Atmos. Environ. 41, 7048–7058. Meng, G., Rutz, M., Schiemann, M., Metzger, J., Grabiec, A., Schwandner, R., Luppa, P.B., Ebel, F., Busch, D.H., Bauer, S., Wagner, H., Kirschning, C.K., 2004. Antagonistic antibody prevents Toll-like receptor 2-driven lethal shock-like syndromes. J. Clin. Invest. 113, 1473–1481. Netea, M.G., Simon, A., van de Veerdonk, F., Kullberg, B.J., Van der Meer, J.W., Joosten, L.A., 2010. IL-1beta processing in host defense: beyond the inflammasomes. PLoS Pathog. 6 (2), e1000661. Pétrilli, V., Dostert, C., Muruve, D.A., Tschopp, J., 2007. The inflammasome: a danger sensing complex triggering innate immunity. Curr. Opin. Immunol. 19, 615–622. Podschun, R., Ullmann, U., 1998. Klebsiella spp. as nosocomial pathogens: epidemiology, taxonomy, typing methods, and pathogenicity factors. Clin. Microbiol. Rev. 11, 589–603.

247

Regueiro, V., Moranta, D., Campos, M.A., Margareto, J., Garmendia, J., Bengoechea, J.A., 2009. Klebsiella pneumoniae increases the levels of Toll-like receptors 2 and 4 in human airway epithelial cells. Infect. Immun. 77 (2), 714–724. Sato, T., 2009. The study on the change of symptoms in allergic rhinitis during Asian sand dust phenomenon. Jibi Ryensyou (in Japanese) 102, 831–839. Sun, Y., Zuang, G., Yuan, H., Zhang, X., Guo, J., 2004. Characteristics and sources of 2002 super dust storm in Beijing. Chin. Sci. Bull. 49 (7), 698–705. Tapping, R.I., Omueti, K.O., Johnson, C.M., 2007. Genetic polymorphisms within the human Toll-like receptor 2 subfamily. Biochem. Soc. Trans. 35 (Pt 6), 1445–1448. Toews, G., Gross, G.N., Pierce, A.K., 1979. The relationship of inoculum size to lung bacterial clearance and phagocytic cell response in mice. Am. Rev. Respir. Dis. 120, 55. Tsai, W.C., Strieter, R.M., Wilkowski, J.M., Bucknell, K.A., Burdick, M.D., Lira, S.A., Standiford, T.J., 1998. Lung-specific transgenic expression of KC enhances resistance to Klebsiella pneumoniae in mice. J. Immunol. 161 (5), 2435–2440. Uno, I., Eguchi, K., Yumimoto, K., Takemura, T., Shimizu, A., Uematsu, M., Liu, Z., Wang, Z., Hara, Y., Sugimoto, N., 2009. Asian dust transported one full circuit around the globe. Nat. Geosci. 2, 557–560. Watanabe, M., Yamasaki, A., Burioka, N., Kurai, J., Yoneda, K., Yoshida, A., Igishi, T., Fukuoka, Y., Nakamoto, M., Takeuchi, H., Suyama, H., Tatsukawa, T., Chikumi, H., Matsumoto, S., Sako, T., Hasegawa, Y., Okazaki, R., Horasaki, K., Shimizu, E., 2011. Correlation between Asian dust storms and worsening asthma in western Japan. Allergol. Int. 60 (3), 267–275. Williams, D.M., Magee, D.M., Bonewald, L.F., Smith, J.G., Bleicker, C.A., Byrne, G.I., Schachter, J., 1999. A role in vivo for tumor necrosis factor alpha in host defense against Chlamydia trachomatis. Infect. Immun. 58 (6), 1572–1576. Willingham, S.B., Bergstralh, D.T., O'Connor, W., Morrison, A.C., Taxman, D.J., Duncan, J.A., Barnoy, S., Venkatesan, M.M., Flavell, R.A., Deshmukh, M., 2007. Microbial pathogen-induced necrotic cell death mediated by the inflammasome components CIAS1/cryopyrin/NLRP3 and ASC. Cell Host Microbe 2, 147–159. Windsor, A.C., Walsh, C.J., Mullen, P.G., Cook, D.J., Fisher, B.J., Blocher, C.R., LeeperWoodford, S.K., Sugerman, H.J., Fowler, A.A., 1993. Tumor necrosis factor-alpha blockade prevents neutrophil CD18 receptor upregulation and attenuates acute lung injury in porcine sepsis without inhibition of neutrophil oxygen radical generation. J. Clin. Invest. 91 (4), 1459–1468. Yoshida, K., Matsumoto, T., Tateda, K., Uchida, K., Tsujimoto, S., Iwakurai, Y., Yamaguchi, K., 2001. Protection against pulmonary infection with Klebsiella pneumoniae in mice by interferon-gamma through activation of phagocytic cells and stimulation of production of other cytokines. J. Med. Microbiol. 50 (11), 959–964. Yoshida, S., Yoshida, M., Sugawara, I., Takeda, K., 2006. Mice strain differences in effects of fetal exposure to diesel exhaust gas on male gonadal differentiation. Environ. Sci. 13, 117–123.