- Email: [email protected]
Assessing the genetic diversity of the vir genes in Indian Plasmodium vivax population
Acta Tropica 124 (2012) 133–139
Contents lists available at SciVerse ScienceDirect
Acta Tropica journal homepage: www.elsevier.com/locate/actatropica
Assessing the genetic diversity of the vir genes in Indian Plasmodium vivax population P. Gupta, A. Das, O.P. Singh, S.K. Ghosh, V. Singh ∗ National Institute of Malaria Research, Sector-8 Dwarka, New Delhi 110077, India
a r t i c l e
i n f o
Article history: Received 22 November 2011 Received in revised form 5 July 2012 Accepted 12 July 2012 Available online 20 July 2012 Keywords: Malaria Plasmodium vivax Vir genes Genetic diversity India
a b s t r a c t Variant surface antigens (VSAs) present on the surface of parasitized erythrocytes facilitate many Plasmodium spp. to escape the host immune system during infection. Multigene families coding for VSAs exist in several Plasmodium spp. and are located on telomeric and subtelomeric regions of the chromosomes. P. vivax genome also contains a multigene superfamily vir (variant interspersed repeats), present in the subtelomeric region with a possible role in immune evasion like the var gene in P. falciparum. Blood samples from 148 symptomatic malaria cases were collected from five different regions of India, viz. Mangalore, Rourkela, Goa, Delhi and Jabalpur. P. vivax isolates (74 single infections) were sequenced for four vir genes (viz. vir 27, vir 4, vir 12 and vir 21) and analyzed for the genetic variability existing in different populations of India. The results indicate that vir genes in different P. vivax populations in India are highly divergent both within and between the isolates. High levels of single nucleotide polymorphisms (SNPs) were observed attributing to the existing polymorphism for all the four vir genes studied across the population. Detailed knowledge of the genetic variation among the vir genes will help in understanding the evolutionary aspects of vir genes and may also provide basis for understanding the disease chronicity. © 2012 Elsevier B.V. All rights reserved.
1. Introduction The Plasmodium species are capable of infecting a large variety of animals including mammals, birds and reptiles. Among the species which infect humans, P. falciparum is the most deadly and P. vivax causes majority of malaria morbidity outside Africa. Most chromosomes of Plasmodium contain multigene families coding for VSAs on their telomeric and subtelomeric regions. Three families of VSAs in P. falciparum have been recognized: the var, rif and stevor genes which encode P. falciparum erythrocyte membrane protein (PfEMP), repetitive interspersed family (RIFIN) and subtelomeric variable open reading frame (STEVOR) respectively; providing enormous ability to the survival of parasite in various environments and facilitating the invasion of the host and vector immune systems (Hoffman et al., 2002; Niang et al., 2009; Templeton, 2009). The cytoadherence phenomenon in P. falciparum by the parasitized erythrocytes is linked to expression of clonally variant antigens on their surface encoded by the var genes (Smith et al., 2001). The largest multigene family identified so far is the Plasmodium interspersed repeats (pir) family which is shared by rif/stevor in P. falciparum, vir in P. vivax, simian and rodent malaria species i.e. kir in P. knowlesi and the cir/bir/yir family in P. chabaudi, P. berghei and P. yoelli respectively (Janssen et al., 2004; Cunningham
∗ Corresponding author. Tel.: +91 11 25307140; fax: +91 11 25307177. E-mail address: vineetas [email protected] (V. Singh). 0001-706X/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.actatropica.2012.07.002
et al., 2009). All these multigene families vary in number and gene organization depending on the parasite species (Deitsch and Hviid, 2004). The relationship of the VSAs with the pathogenesis of malaria has been long considered as important targets for vaccine development and alternative control strategies (Jemmely et al., 2010; Smith et al., 2001). P. vivax, the most widely distributed human-malaria species, contains vir superfamily corresponding to approximately 10% of the coding sequences (del Portillo et al., 2001; Merino et al., 2006). The complete annotation of the P. vivax laboratory strains from El Salvador (Sal I) genome revealed a total of 346 vir genes making it the largest subtelomeric family (Fernandez-Becerra et al., 2009; del Portillo et al., 2004). Clustering the Vir proteins in the Salvador I genome along with sequence similarities yielded twelve subfamilies (A–L) indicating that there is a vast repertoire of vir genes abundantly expressed in isolates obtained from human patients (Fernandez-Becerra et al., 2005; Carlton et al., 2008; Merino et al., 2006). The vir genes vary greatly, consisting of 1–5 exons in which the second exon is highly variable and range from 156 to 2316 bp in length (Carlton et al., 2008; Fernandez-Becerra et al., 2009). The major role of vir genes in natural infections remains unknown till date though their involvement in establishing chronic infections has been proposed (del Portillo et al., 2001). With the help of phylogenetic analysis like Minimum Evolution tree methods, population genetic structure of the var and stevor genes were deduced, thus by using similar tools the genetic structure of the vir genes can also be inferred (Blythe et al., 2009; Barry et al., 2007). A more extensive
134
P. Gupta et al. / Acta Tropica 124 (2012) 133–139
study about the vir gene repertoire is required in order to estimate the diversity and size of the vir genes. The main objective of this study was to determine the diversity of the vir genes in P. vivax from the various epidemiological regions. Measure of antigenic diversity would help to find a relationship with malaria transmission and provide an insight in its pathogenesis. About 80% of the P. vivax malaria cases in Southeast Asia are contributed primarily from India. The tenacity of P. vivax in India is attributed to several factors like the existence of different P. vivax strains, presence of several mosquito vectors, tropical climate and poor economy (Singh et al., 2009). The areas where P. vivax malaria is most prevalent are Orissa, West Bengal and Jharkhand in the east, Chhattisgarh and Madhya Pradesh in central India, Gujarat and Rajasthan in the west, and Karnataka in the south with perennial transmission in southern and central India (Joshi et al., 2008; http://www.nvbdcp.gov.in/, http://www.malariasite.com/). This is a population level study of the Indian P. vivax vir subtelomeric multigene superfamily. 2. Materials and methods 2.1. Study area The study was approved by the Institute’s ethical committee and detailed patient history with the informed consent was taken from the patients before the collection of samples. A total of 148 blood samples were collected from patients by the finger prick method from five different regions of India viz. Delhi (northern India) (DEL-15 isolates), Goa (western India) (GOA-15 isolates), Rourkela (eastern India) (RKL-13 isolates), Mangalore (southern India) (MNG-42 isolates) and Jabalpur (central India) (JBL-4 isolates) (Fig. 1). The samples were collected through the years 2007–2010. 2.2. Malaria diagnosis Rapid Diagnostic Tests (RDT) (Bioline SD Rapid Test) was used for preliminary detection and diagnosis of the Plasmodium species. Thick and thin peripheral blood smears were prepared for microscopic diagnosis. After microscopic examination and RDT, the bloodspots were made on Whatman (Number 3) filter paper strips from the positive samples and stored at 4 ◦ C. 2.3. Genomic DNA extraction Genomic DNA extraction of P. vivax samples was done from filter paper blood spots using QIAamp DNA Blood Mini Kit (Qiagen Inc.) according to the manufacturer’s instructions. 2.4. Detection of mixed infections The samples were analyzed by genus specific primers namely rPLU5 (5 CCTGTTGTTGCCTTAAACTTC 3 ) and rPLU6 (5 TTAAAATTGTTGCAGTTAAAACG 3 ) specific for the smaller subunit of rRNA (18S rRNA) in the primary PCR (Johnston et al., 2006). The second step comprises of 2 primer sets, rVIV1 (5 CGCTTCTAGCTTAATCCACATAACTGATAC 3 ) and rVIV2 (5 ACTTCCAAGCCGAAGCAAAGAAAGTCCTTA 3 ) specific for P. vivax which amplifies a target sequence of 120 bps and the other set rFAL1 (5 TTAAACTGGTTTGGGAAAACCAAATATATT 3 ) and rFAL2 (5 ACACAATGAACTCAATCATGACTACCCGTC 3 ) specific for P. falciparum which amplifies 205 bp of DNA (Johnston et al., 2006). The primary PCR amplification cycles included an initial step of 95 ◦ C for 5 min followed by 30 cycles of 94 ◦ C for 1 min, 60 ◦ C for 2 min, 72 ◦ C for 2 min and a final extension of 72 ◦ C for 5 min. The nested PCR amplification cycles included an initial step of 95 ◦ C for 5 min followed
by 30 cycles of 94 ◦ C for 1 min, 55 ◦ C for 2 min, 72 ◦ C for 2 min and a final extension of 72 ◦ C for 5 min. After the mixed infection analysis, the isolates were further genotyped by merozoite surface protein 3␣ (MSP3␣) molecular marker to confirm the presence of single clone infections in P. vivax positive samples (Bruce et al., 1999). 2.5. Gene selection and primer designing Work was carried out on four vir genes namely vir 27, vir 4, vir 12 and vir 21. The vir genes to be analyzed were chosen on the basis of their size, the subfamilies and their in silico analysis. The genes belonged to subfamily I, C, E and B. Subfamily B and C are more highly polymorphic with variant and conserved blocks distributed along the sequences, whereas the subfamily E is more conserved in comparison. The in silico analysis of these genes revealed their functional role in coding variable surface proteins. Vir 27 belonged to subfamily I, vir 4 from subfamily C, vir 12 from subfamily E and vir 21 from subfamily B. Since all these genes were above 1 kb in size, two sets of primers were designed by Primer 3 software version 0.4.0 (http://frodo.wi.mit.edu/) (Table 1). The conformational analysis of the designed primers was done by Oligocalc software (Oligonucleotide properties calculator). Vir 27, 4 and 12 have three exons and two introns whereas vir 21 has two exons and a single intron. The primary PCR primers for vir 27 were v27 1 and v27 4 spanning a length of 1375 bp. Two sets of semi-nested primers for vir 27 were used for amplifying a region of 827 bp by v27 1 and v27 2 and 705 bp by v27 3 and v27 4. For vir 4, the primary PCR primers were v4 1 and v4 4 which amplified 1455 bp sequence. Two sets of semi-nested primers v4 1 and v4 2 and v4 3 and v4 4 were used for amplifying a region of 751 bp and 828 bp respectively. The primary PCR primers for vir 12 were v12 1 and v12 3 for gene length of 2038 bp. One set of semi-nested primers v12-2 and v12-3 amplified a region of 1323 bp. For vir 21, the primary PCR primers used were v21 1 and v21 4 spanning a length of 1074 bp. Two sets of semi-nested primers were used for amplifying a region of 628 bp by v21 1 and v21 2 and 505 bp by v21 3 and v21 4. 2.6. Amplification and sequencing of vir genes Single P. vivax infections were amplified using vir specific primers. In the primary PCR step the primers span the whole gene and two semi-nested PCR reactions amplified the two fragments for all the four vir genes. The primary PCR amplification cycles for vir 27, vir 4 and vir 12 included an initial step of 95 ◦ C for 5 min followed by 35 cycles of 95 ◦ C for 30 s, 50 ◦ C for 30 s, 72 ◦ C for 1 min and a final extension of 72 ◦ C for 5 min. The semi-nested PCR had 30 cycles with cycling conditions as in the primary PCR. The primary PCR amplification cycles for vir 21 consisted of an initial step of 95 ◦ C for 4 min followed by 35 cycles of 95 ◦ C for 30 s, 52 ◦ C for 30 s, 72 ◦ C for 30 s and a final extension of 72 ◦ C for 7 min. The semi-nested PCR had 30 cycles and an annealing temperature of 48 ◦ C with same cycling conditions as in the primary PCR. The samples were run in 1.5% agarose gel with 100 bp and 1 kb marker. The PCR samples were purified using QIAquick PCR purification kit (Qiagen Inc.) according to the manufacturer’s instructions. These samples were sequenced by the BigDye terminator (V3.1, Applied Biosystems) cycle sequencing ready reaction kit. 2.7. Phylogenetic analysis The Sal 1 (GenBank ID: AAKM01000041.2 for vir 27, GenBank ID: AAKM01000104.1 for vir 4, GenBank ID: AAKM01000016.1 for vir 12, GenBank ID: AAKM01000003.1 for vir 21) was used as reference strain for comparing the vir gene sequences. After successful sequencing; the sequences obtained were edited, indels were removed and sequences were aligned
P. Gupta et al. / Acta Tropica 124 (2012) 133–139
135
Fig. 1. Map showing the geographic distribution of samples from five different sites along with the number of P. falciparum and P. vivax samples collected and the climate pertaining to each region.
Table 1 List of PCR primers, amplicon sizes and accession number of the reference sequences used in the study. PCR primers v27 v27 v27 v27 v4 v4 v4 v4
1 4 2 3
1 4 2 3
v12 1 v12 3 v12 2 v21 v21 v21 v21
1 4 2 3
Primer sequence 5 –3
Subfamily
Gene length (bp)
Accession number
vir 27 gene: PVX 102630 TGGCATTACACTTAGCGGTAT TGGTGTATCTGTGTGAAGATTTG CATTTTGAGCACGTTCTCCTT TCAAGTTGTAAGGTGATCAATGAAA vir 4 gene: PVX 021680 CGAAATATACTTGTCTTAACTGGTTG CAGAATGGCATCTGTTTATGC GACCAATATTTTGGGCAGGTT AGGTAGAATTGCGGCTCAGA vir 12 gene: PVX 097525 AAATATTCAAACAATGGCAATACA ACTTCCCGTGCAGGTATTTC TGACATAGGTAACGCATAATATAGCA vir 21 gene: PVX 115480 ACAACTCATTGGTATTTACATTTATGA TGCGAAAAATAAGACGCAAA TTCAAAGCATAAAATTCGCACT TCCCAAAATAAAGGCAAGGTT
I
1255 bp
AAKM01000041.2
C
1314 bp
AAKM01000104.1
E
2548 bp
AAKM01000016.1
B
974 bp
AAKM01000003.1
136
P. Gupta et al. / Acta Tropica 124 (2012) 133–139
#Reference TKAEAPREGGTVGGVVDAKAKPGAAESEGAESGIPKPAAAKPAP-----AKPVA-------------------------TSPAPSERAPAKPVAAKPAATKPATTKPAKEESEGEDPAGAKPVA-----AKPAPGEAVPAKPVAAKPVATESAAPERAPEAPEP #D1
TKAEAPREGGTVGGVVDAKAKPGAAESEGAESGIPKPAAAKPAP-----AKPVA-------------------------TSPAPSERAPAKPVAAKPAATKPATTKPAKEECEGEDPAGAKPVA-----AKPAPGEAVPAKPVAAKPVATESAAPERAQEAH?-
#D5
TKAEAPREGGTVGGVVDAKAKPGAAESEGAESGIPKPAAAKPAP-----AKPVA-------------------------TSPAPSERAPAKPVAAKPAATKPATTKPAKEESEGEDPAGAKPVA-----AKPAPGEAVPAKPVAAKPVATESAAPERAPEA?—
#G5
TKAEAPREGGTVGGVVDAKAKPGAAESEGAESGIPKPAAAKPAP-----AKPVA-------------------------TSPAPSERAPAKPVAAKPAATKPATTKPAKEESEGEDPAGAKPVAAKPVAAKPAPGEAVPAKPVAAKFVATESAAPERAPEAY?-
#M37
TKAEAPREGGTVGGVVDAKAKPGA-----AESGIPKPAAAKPAP-----AKPVAAKPVA--------------------TSPAPSERAPAKPVAAKPAATKPATTKPAKEESEGEDPARAKPVA-----AKPAPGEAVPAKPVAAKPVATKSAPPEPAQEV?—
#M39
TKAEAPREGGTVGGVVDAKAKPGA-----AESGIPKPAAAKPAP-----AKPVAAKPVA--------------------TSPAPSERAPAKPVAAKPAATKPATTKPAKEESEGEDPARAKPVA-----AKPAPGEAVPAKPVAAKPVATKSAPPEPAQEV?—
#G4
TKAEAPREGGTVGGVVDAKAKPGA-----AESGIPKPAAAKPAP-----AKPVAAKPVAAKPVAAKPVAAKPVAAKPVATSPAPSERAPAKPVA----------------------------------------------------------------------
#M38
KEPEVPRDGGTGGVELDAKAKPGTAVSEGAGSGVLKP--------------------VAAKPAD---------------TNPAPSERAPAKPVAAKPAATKPA-----KEESEGEDPAQAKPVP---------------AKPVAAKPLATKSAPPERAPEAP?-
#M40
TKAEAPREGGTGGVELDAKAKPGTAVSEGAGSGVLKPAAAKPAPVKPAPAKPVAAKPVAAKPAD---------------TNPAPSERAPAKPVAAKPAATKPA-----KEESEGEDPAQAKPVP---------------AKPVAAKPLATKSAPPERAPEALQ?
#D3
KEPEVPRDGGTGGVELDAKAKPGTAVSEGAGSGVLKP--------------------VAAKPAD---------------TNPAPSERAPAKPVAAKPAATKPA-----KEESEGEDPAQAKPVP---------------AKPVAAKPLATKSAPPERAPEALT?
#G1
TKAEAPREGGTVGGVVDAKAKPGTAVSEGAGSGVLKPAAAKPAPVKPAPAKPVAAKPVAAKPAD---------------TNPAPSERAPAKPVAAKPAATKPA-----KEESEGEDPAQAKPVP---------------AKPVAAKPLATKSAPPERAPEA?—
#R3
TKAEAPREGGTVGGVVDAKAKPGTAVSEGAGSGVLKPAAAKPAPVKPAPAKPVAAKPVAAKPAD---------------TNPAPSERAPAKPVAAKPAATKPA-----KEESEGEDPAQAKPVP---------------AKPVAAKPLATKSAPPERAPEA?—
#D2
KKPEAPREGGTGGVEVDAKAKPGAAGSEGAESGVPKPAAAKPAPVKPAPAKPVAAKPVA--------------------TSPAQSECAPAKPVAAKPAATKPA-----KEESEGEDPAGAKPVA-----AKPAPGEAVPAKPVAAKPVATKSAPPEPAQEVLT?
#D4
KKPEAPREGGTGGVEVDAKAKPGAAGSEGAESGVPKPAAAKPAPVKPAPAKPVAAKPVA--------------------TSPAPSERAPAKPVAAKPAATKPATTKPAKEESEGEDPAGAKPVA-----AKPAPGEAVPAKPVAAKPVATESAAPERAPEAL?-
#R2
KKPEAPREGGTGGVEVDAKAKPGAAGSEGAESGVPKPAAAKPAPVKPAPAKPVAAKPVA--------------------TSPAPSERAPAKPVAAKPAATKPATTKPAKEESEGEDPAGAKPVA-----AKPAPGEAVPAKPVAAKPVATESAAPERAPE?---
#R5
KKPEAPREGGTGGVEVDAKAKPGAAGSEGAESGVPKPAAAKPAPVKPAPAKPVAAKPVA--------------------TSPAPSERAPAKPVA---------------------------------------------AKPVA-----TESAAPERAPG?---
Fig.
2. Part
of
amino
acid
sequences
of
vir and
12
for
the
15
isolates
and
the
reference.
The
sequences
depict
the
repeat
amino
acids
.
using Clustal W (Chenna et al., 2003). SNPs were inferred and validated using MEGA 4.0 software (Tamura et al., 2007; http://www.megasoftware.net/). Phylogenetic trees showing genetic distances were constructed by MEGA 4.0 using minimum evolution methods. Tajima’s D test was done for vir genes due to the large extent of polymorphism observed in the isolates. Tajima’s D test is a statistical test which calculates a standardized measure of the total number of segregating sites in a sequence and the average number of mutations between pairs in the sample (Tajima, 1989). 3. Results 3.1. Diagnosis of samples From the total 148 samples, 89 samples were found positive for P. vivax infection by microscopic diagnosis. RDT diagnosis was positive for 75 samples of P. vivax. Microscopy revealed various stages of P. vivax rings, trophozoites and schizonts. 3.2. Molecular analysis of the vir gene The positive samples after microscopic diagnosis were analyzed for mixed infections of Plasmodium spp. by PCR assay. Fifteen samples from Mangalore were positive for mixed infections of P. falciparum and P. vivax and showed a band at both; 205 and 120 bp respectively. P. vivax single clone infections were found in 74 samples on analysis by msp3␣ molecular marker. From 74 P. vivax positive samples successful amplification for vir genes was observed in 45 isolates for vir 27, 6 isolates for vir 4 gene, 19 isolates for vir 12 and 22 isolates for vir 21 collected from different regions of the country. We carried out the comparison of each sequence with the available sequences in the Genbank at NCBI and PlasmoDB. On aligning the sequences various non-synonymous and synonymous SNPs were observed in the P. vivax isolates. The polymorphisms are further described in the vir genes section below. Vir 12 showed amino acid non tandem repeats concentrated toward the end of the sequence. AKPGA/AP/VA, ESEG, ERAP and TKPA were the observed repeats. Only one isolate from Delhi showed identical amino acid sequence on comparison with the reference sequence of Sal I (Fig. 2). Though vir 4 showed TGAATA and AAGGAA nucleotide repeat sequences but no amino acid repeat sequences were found. Phylogenetic trees of the vir genes showed no significant geographical specific branching (Figs. 4–7). After aligning the gene
sequences in various isolates the intron sequences were analyzed manually which showed high similarity in the intron regions of the vir genes within isolates except vir 21 which showed variability in three isolates from Goa and Rourkela even in the intron region. None of the phylogenetic trees for the vir genes showed any congruency on comparison indicating the existing hypervariability among the genes in the population. Tajima’s D test was done for all the four vir genes which showed 22 segregating sites for vir 27, three segregating sites for vir 4, 85 sites for vir 12 and 155 sites for vir 21. 3.2.1. Vir 27 The total length of vir 27 is 1255 bp. For vir 27 on sequence analysis 22 polymorphic sites were found among which 17 were non-synonymous and five were synonymous. Two samples from Mangalore showed six and four non-synonymous mutations respectively. Three samples from Rourkela showed three nonsynonymous mutations each. A total of 11 isolates (three, two and six from Mangalore, Delhi and Rourkela respectively) showed non-synonymous mutation at C34Y while 10 isolates (two, one and seven from Mangalore, Delhi and Rourkela) showed nonsynonymous mutation at D258Y (Fig. 3). The minimum evolution phylogenetic tree for 34 samples analyzed for vir 27 clearly divides the isolates into two distinct clades. Thirty samples comprise the first clade including the reference sequence and only four samples make up the second clade. Each clade is divided further into subgroups. The distribution is very random and shows no particular pattern with the regions from where the samples were collected (Fig. 4). 3.2.2. Vir 4 The total length of vir 4 is 1314 bp. The three polymorphic sites found in the gene were non-synonymous. The nucleotide changed at A645C leading to amino acid sequence change Q173P in five isolates. In three isolates change occurred at T742A and amino acid changed at N205K whereas in one isolate change was observed at G871A and the amino acid changed at M248I. From the minimum evolution phylogenetic tree of vir 4 we can conclude that the isolates are divided into two clear clades. The first clade comprises of three isolates whereas the second clade consists of the reference sequence and the remaining isolates (Fig. 5). 3.2.3. Vir 12 The total length of vir 12 is 2548 bp. The alignment of the sequences shows that the gene is highly variable among the 19
P. Gupta et al. / Acta Tropica 124 (2012) 133–139
Position
0 0 6 #Reference Y #M36 . #M37 . #M38 C #M39 . #M40 . #M3 . #M6 . #M10 . #M16 . #M21 . #M14 #M22 #M41 . #D1 . #D2 . #D3 . #D4 . #D5 . #G1 . #G2 . #G3 . #G4 . #G5 . #G7 . #G8 C #G9 . #G10 . #R1 . #R2 . #R3 . #R4 . #R5 . #R6 . #R7 . #R8 . #R9 . #R10 .
0 3 4 C . Y . Y . . . . . .
0 3 5 S . . . . . . . . . .
1 4 6 R . . . . . . . . G .
. Y Y Y . . . . . . . . . . . . . Y . . Y . Y Y Y Y
. . . . . . . . . . . . . . . . . . . . . . . . . F
. . . . . . . . . . . . . . . . . . . . . . . . . .
1 6 3 K . . . E E . . .
1 9 2 C . . . . . . . . S . . . . . . . . . . . . . . . . . . . E . . . . . . . . . . . . . . . . . . . . . . . E . . . . . E . . .
2 0 8 R . . . . . . . . . . .
2 3 9 R . . . C . . . . . . .
2 5 8 D . . . Y . . . Y . . .
2 6 5 T . . . . . . . . . . .
2 7 3 S . . . . . . . . . . .
2 8 9 S . . . . . . . . . . .
3 0 0 A . . . . . . . . P . .
3 0 9 R . . . . . . . . K . .
3 2 2 D . . . . . . . . V . .
3 2 5 N . . . . . . .
. H . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . .
. . . . Y . . . . . . . . . Y Y . Y . . Y Y Y Y
. . ? . . . . . . . . . . . . . . . . . . . . .
. . ? . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . L . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . H . . . . . .
137
Y . .
. . . . .
Fig. 3. Amino acid sequence showing the non-synonymous mutations in vir 27. ‘?’ denotes ambiguous polymorphism.
isolates that have been analyzed. Eighty five segregating sites have been observed with many non-synonymous mutations among them according to the Tajima’s test of neutrality. Many repeat regions were observed within the sequence and similarly for its amino acid sequence. The minimum evolution bootstrap test of phylogeny for the 19 samples for vir 12 shows the clear presence of two clades. The first clade consists of 12 samples including the reference and the second clade contains eight samples. Again, no particular pattern was observed for the distribution of samples in the population (Fig. 6).
3.2.4. Vir 21 The total length of vir 21 is 974 bp. Sequence analysis of vir 21 showed 155 polymorphic sites depicting the highly diverse nature of this gene when compared to the reference sequence. The bootstrap test of phylogeny for the 18 samples analyzed for vir 21 shows the clear presence of two clades. The first clade consists of 15 samples including the reference sequence and the second clade has three samples. The distribution shows no particular pattern (Fig. 7).
Fig. 4. Phylogenetic tree vir 27. The evolutionary history was inferred using the minimum evolution method. The optimal tree with branch length = 0.01679741 is shown in the figure. The percentage of the replicate trees in which the associated taxa clustered together in the bootstrap test (500 replicates) are shown next to the branches. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The ME tree was searched using the Neighbor-joining algorithm.
4. Discussion The vir family is the largest multigene family of human malaria and is included in the superfamily pir (Plasmodium interspersed repeats) along with rif/stevor in P. falciparum, kir in P. knowlesi and
Fig. 5. Phylogenetic tree vir 4. The evolutionary history was inferred using the minimum evolution method. Sum of branch length = 0.00304754 is shown.
138
P. Gupta et al. / Acta Tropica 124 (2012) 133–139
Fig. 6. Phylogenetic tree vir 12. The evolutionary history was inferred using the Minimum Evolution method. The optimal tree with the sum of branch length = 0.16003899 is shown. Phylogenetic analyses were conducted in MEGA 4.0.
Fig. 7. Phylogenetic tree vir 21. The evolutionary history was inferred using the minimum evolution method. The optimal tree with the sum branch length = 0.26627393 is shown.
cir/yir/bir family in P. chaubadi, P. yoelii and P. berghei (Janssen et al., 2004). In this study, the vir genes sequence repertoire and diversity were analyzed to determine the variability of these genes within Indian field isolates. Here we report the high level of SNPs existing in the vir genes in Indian isolates. In our study we initially diagnosed the malaria cases by microscopy which has long been considered the standard method for diagnosis (Bronzan et al., 2008). PCR assay for Plasmodium species identification was carried out for the 89 P. vivax samples identified by microscopy in which 74 were P. vivax infections and 15 samples from Mangalore (Karnataka) were mixed infections of P. falciparum and P. vivax signifying the sensitivity of the PCR assay over microscopy (Gupta et al., 2010). Presence of mixed infections could be because southern India is endemic to both P. falciparum and P. vivax (Hastings et al., 2005; http://www.malariasite.com/). The analysis of vir gene sequences showed high polymorphism existing for all the four vir genes studied within and between the isolates. The vir genes chosen for this study ranged from 974 to 2540 bp and belonged to different subfamilies. The basis of the vir genes was their in silico analysis which predicted their functional role in coding variable surface proteins. Among the vir genes analyzed in the present study, vir 21 was the most polymorphic substantiating earlier reports of subfamily B showing more variance on comparison (Fernandez-Becerra et al., 2009). Sequence analysis of vir 12 showed a much higher number of polymorphisms within the isolates when compared to the reference sequence. A high number of repeat regions observed in vir 12 maybe due to recombination resulting in vir 12 more variable than other vir genes. The repeat sequences help the parasite to evade immune responses as seen in var genes, rif genes and stevor genes in P. falciparum (Kyes et al., 2007; Blythe et al., 2009). Six isolates were successfully sequence analyzed for vir 4 and no distinct repeat sequences were found as seen in vir 12. Sequence analysis for vir 27 revealed amino acid sequences with several non-synonymous mutations indicating this gene to be less polymorphic on comparison with vir 12 and vir 21 in which the polymorphism observed was immense. It has been reported that subfamilies of vir genes have homology with multigene families like surfin and Pfmc-2tm genes (Fernandez-Becerra et al., 2009) encoding antigens used by P. falciparum to evade the host immune response (Mphande et al., 2008). The amino acid changes seen due to SNPs in the study might lead to the diversity in malarial antigens associated with immune evasion (de Souza-Neiras et al., 2007). The existing high diversity of vir genes is indicative of the fact that they may have a role to play in host immune evasion though more research is needed to explore this aspect of the diversity seen in the vir genes. By substantiating the results obtained from the genome sequence of P. vivax and phylogenetic analysis, a basic idea about the population genetic structure was inferred. The phylogenetic trees of all four vir genes divided the isolates into two clear clades that can potentially be divided into further subgroups. However no obvious cluster was observed and the distribution of isolates within the subgroups was random. There was no apparent trend for sequences of the same geographic region to be more closely related. The research data collected for the vir multigene family has not been able to decipher the actual biological function of the vir genes till date. It is proposed that Vir proteins have a possible role in immune evasion mechanism which facilitates the disease chronicity (Merino et al., 2006). Cytoadherence attributing to the disease severity in P. falciparum is mediated by the var genes multigene family (Su et al., 1995). Though such phenomena is not seen in P. vivax the mechanism of the spleen evasion by the parasite remains unsolved and it is speculated that Vir proteins might be responsible for this trait of parasite (Fernandez-Becerra et al., 2009). There are reports of severe pathology in P. vivax like respiratory distress
P. Gupta et al. / Acta Tropica 124 (2012) 133–139
and coma which is further questioning the portrayal of P. vivax as ‘benign’ and emergence of chloroquine resistance in P. vivax has also been reported (Carlton et al., 2008; Picot and Bienvenu, 2009; Kochar et al., 2005). It would be interesting to see how this highly diverse multigene family could be correlated to the increasing severity of P. vivax malaria and work could be carried out on the expression profile of the vir genes in the near future. Due to lack of adequate genetic data about P. vivax more comprehensive studies are needed to demonstrate polymorphic and population genetic studies of P. vivax not only in India but also in other countries. Our studies essentially confirmed the existence of tremendous polymorphism among the vir genes in natural infections. It clearly demonstrates that vir genes in natural infections from five different geographical regions are randomly distributed. Since this study serves merely in substantiating the highly variant nature of these genes, more extensive research is needed to understand the expression of vir genes/proteins in natural infections for their speculated role in pathogenesis. 4.1. Nucleotide sequence accession numbers The nucleotide sequences of the vir genes have been deposited in the GenBank database under accession numbers JQ733915–JQ733988. 5. Conclusion The P. vivax vir genes vary greatly and were found to be very diverse in Indian isolates. Vir 12 showed more diversity than the other vir genes as large number of polymorphisms and repeat regions were observed in the gene sequences. The high sequence variability observed in the four vir genes is non-consistent and the phylogenetic trees for them also gives no indication of a distinct pattern in subgroups suggesting further that distribution of the vir genes in the population is non-region specific. Further studies are required to know more about the population genetic structure of the vir genes. Acknowledgements We would like to thank the Department of Biotechnology (DBT) for providing us the grant required for carrying out all the research work. References Barry, A.E., Leliwa-Sytek, A., Tavul, L., Imrie, H., Migot-Nabias, F., Brown, S.M., McVean, G.A., Day, K.P., 2007. Population genomics of the immune evasion (var) genes of Plasmodium falciparum. PLoS Pathogens 3, e34. Blythe, J.E., Niang, M., Marsh, K., Holder, A.A., Langhorne, J., Preiser, P.R., 2009. Characterization of the repertoire diversity of the Plasmodium falciparum stevor multigene family in laboratory and field isolates. Malaria Journal 26, 140. Bronzan, R.N., McMorrow, M.L., Kachur, S.P., 2008. Diagnosis of malaria: challenges for clinicians in endemic and non-endemic regions. Molecular Diagnosis & Therapy 12, 299–306. Bruce, M.C., Galinski, M.R., Barnwell, J.W., Snounou, G., Day, K.P., 1999. Polymorphism at the merozoite surface protein-3alpha locus of Plasmodium vivax: global and local diversity. American Journal of Tropical Medicine and Hygiene 61, 518–525. Carlton, J.M., Adams, J.H., Silva, J.C., Bidwell, S.L., Lorenzi, H., Caler, E., Crabtree, J., Angiuoli, S.V., Merino, E.F., Amedeo, P., Cheng, Q., Coulson, R.M., Crabb, B.S., del Portillo, H.A., Essien, K., Feldblyum, T.V., Fernandez-Becerra, C., Gilson, P.R., Gueye, A.H., Guo, X., Kang’a, S., Kooij, T.W., Korsinczky, M., Meyer, E.V., Nene, V., Paulsen, I., White, O., Ralph, S.A., Ren, Q., Sargeant, T.J., Salzberg, S.L., Stoeckert, C.J., Sullivan, S.A., Yamamoto, M.M., Hoffman, S.L., Wortman, J.R., Gardner, M.J., Galinski, M.R., Barnwell, J.W., Fraser-Liggett, C.M., 2008. Comparative genomics of the neglected human malaria parasite Plasmodium vivax. Nature 9, 757–763. Chenna, R., Sugawara, H., Koike, T., Lopez, R., Gibson, T.J., Higgins, D.G., Thompson, J.D., 2003. Multiple sequence alignment with the clustal series of programmes. Nucleic Acids Research 31, 3497–3500.
139
Cunningham, D., Fonager, J., Jarra, W., Carret, C., Preiser, P., Langhorne, J., 2009. Rapid changes in transcription profiles of the Plasmodium yoelii yir multigene family in clonal populations: lack of epigenetic memory? PLoS ONE 4, e4285. de Souza-Neiras, W.C., de Melo, L.M., Machado, R.L., 2007. The genetic diversity of Plasmodium vivax – a review. Memórias do Instituto Oswaldo Cruz 102, 245–254. Deitsch, K.W., Hviid, L., 2004. Variant surface antigens, virulence genes and the pathogenesis of malaria. Trends in Parasitology 20, 562–566. del Portillo, H.A., Fernandez-Becerra, C., Bowman, S., Oliver, K., Preuss, M., Sanchez, C.P., Schneider, N.K., Villalobos, J.M., Rajandream, M.A., Harris, D., Pereira da Silva, L.H., Barrell, B., Lanzer, M., 2001. A superfamily of variant genes encoded in the subtelomeric region of Plasmodium vivax. Nature 12, 839–842. del Portillo, H.A., Lanzer, M., Rodriguez-Malaga, S., Zavala, F., Fernandez-Becerra, C., 2004. Variant genes and the spleen in Plasmodium vivax malaria. International Journal for Parasitology 34, 1547–1554. Fernandez-Becerra, C., Pein, O., de Oliveira, T.R., Yamamoto, M.M., Cassola, A.C., Rocha, C., Soares, I.S., de Braganc¸a Pereira, C.A., del Portillo, H.A., 2005. Variant proteins of Plasmodium vivax are not clonally expressed in natural infections. Molecular Microbiology 58, 648–658. Fernandez-Becerra, C., Yamamoto, M.M., Vêncio, R.Z., Lacerda, M., Rosanas-Urgell, A., del Portillo, H.A., 2009. Plasmodium vivax and the importance of the subtelomeric multigene vir superfamily. Trends in Parasitology 25, 44–51. Gupta, B., Gupta, P., Sharma, A., Singh, V., Dash, A.P., Das, A., 2010. High proportion of mixed-species Plasmodium infections in India revealed by PCR diagnostic assay. Tropical Medicine and International Health 15, 819–824. Hastings, M.D., Maguire, J.D., Bangs, M.J., Zimmerman, P.A., Reeder, J.C., Baird, J.K., Sibley, C.H., 2005. Novel Plasmodium vivax dhfr alleles from the Indonesian Archipelago and Papua New Guinea: association with pyrimethamine resistance determined by a Saccharomyces cerevisiae expression system. Antimicrobial Agents and Chemotherapy 49, 733–740. Hoffman, S.L., Subramanian, G.M., Collins, F.H., Venter, J.C., 2002. Plasmodium, human and anopheles genomics and malaria. Nature 415, 702–709. Janssen, C.S., Phillips, R.S., Turner, C.M., Barrett, M.P., 2004. Plasmodium interspersed repeats: the major multigene superfamily of malaria parasites. Nucleic Acids Research 26, 5712–5720. Jemmely, N.Y., Niang, M., Preiser, P.R., 2010. Small variant surface antigens and Plasmodium evasion of immunity. Future Microbiology 5, 663–682. Johnston, S.P., Pieniazek, N.K., Xayavong, M.V., Slemenda, S.B., Wilkins, P.P., da Silva, A.J., 2006. PCR as a confirmatory technique for laboratory diagnosis of malaria. Journal of Clinical Microbiology 44, 1087–1089. Joshi, H., Prajapati, S.K., Verma, A., Kang’a, S., Carlton, J.M., 2008. Plasmodium vivax in India. Trends in Parasitology 24, 228–235. Kochar, D.K., Saxena, V., Singh, N., Kochar, S.K., Kumar, S.V., Das, A., 2005. Plasmodium vivax malaria. Emerging infectious diseases 11, 132–134. Kyes, S.A., Kraemer, S.M., Smith, J.D., 2007. Antigenic variation in Plasmodium falciparum: gene organization and regulation of the var multigene family. Eukaryotic Cell 6, 1511–1520. Malaria site (India) (http://www.malariasite.com/). MEGA: Molecular Evolutionary Genetics Analysis (http://www.megasoftware.net/). Merino, E.F., Fernandez-Becerra, C., Durham, A.M., Ferreira, J.E., Tumilasci, V.F., d’Arc-Neves, J., da Silva-Nunes, M., Ferreira, M.U., Wickramarachchi, T., Udagama-Randeniya, P., Handunnetti, S.M., del Portillo, H.A., 2006. Multicharacter population study of the vir subtelomeric multigene superfamily of Plasmodium vivax, a major human malaria parasite. Molecular and Biochemical Parasitology 149, 10–16. Mphande, F.A., Ribacke, U., Kaneko, O., Kironde, F., Winter, G., Wahlgren, M., 2008. SURFIN4.1, a schizont-merozoite associated protein in the SURFIN family of Plasmodium falciparum. Malaria Journal 1, 116. National Vector Borne Disease Control Programme National, (http://www.nvbdcp.gov.in). Niang, M., Yan Yam, X., Preiser, P.R., 2009. The Plasmodium falciparum STEVOR multigene family mediates antigenic variation of the infected erythrocyte. PLoS Pathogens 5, e1000307. Picot, S., Bienvenu, A.L., 2009. Plasmodium vivax infection: not so benign. Medical Science (Paris) 25, 622–626. Primer 3 software version 0.4.0 (http://frodo.wi.mit.edu/). Singh, V., Mishra, N., Awasthi, G., Dash, A.P., Das, A., 2009. Why is it important to study malaria epidemiology in India? Trends in Parasitology 25, 452–457. Smith, J.D., Gamain, B., Baruch, D.I., Kyes, S., 2001. Decoding the language of var genes and Plasmodium falciparum sequestration. Trends in Parasitology 17, 538–545. Su, X.Z., Heatwole, V.M., Wertheimer, S.P., Guinet, F., Herrfeldt, J.A., Peterson, D.S., Ravetch, J.A., Wellems, T.E., 1995. The large diverse gene family var encodes proteins involved in cytoadherence and antigenic variation of Plasmodium falciparum-infected erythrocytes. Cell 14, 89–100. Tajima, F., 1989. Statistical methods for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123, 585–595. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24, 1596–1599. Templeton, T.J., 2009. The varieties of gene amplification, diversification and hypervariability in the human malaria parasite, Plasmodium falciparum. Molecular and Biochemical Parasitology 166, 109–116.
Contents lists available at SciVerse ScienceDirect
Acta Tropica journal homepage: www.elsevier.com/locate/actatropica
Assessing the genetic diversity of the vir genes in Indian Plasmodium vivax population P. Gupta, A. Das, O.P. Singh, S.K. Ghosh, V. Singh ∗ National Institute of Malaria Research, Sector-8 Dwarka, New Delhi 110077, India
a r t i c l e
i n f o
Article history: Received 22 November 2011 Received in revised form 5 July 2012 Accepted 12 July 2012 Available online 20 July 2012 Keywords: Malaria Plasmodium vivax Vir genes Genetic diversity India
a b s t r a c t Variant surface antigens (VSAs) present on the surface of parasitized erythrocytes facilitate many Plasmodium spp. to escape the host immune system during infection. Multigene families coding for VSAs exist in several Plasmodium spp. and are located on telomeric and subtelomeric regions of the chromosomes. P. vivax genome also contains a multigene superfamily vir (variant interspersed repeats), present in the subtelomeric region with a possible role in immune evasion like the var gene in P. falciparum. Blood samples from 148 symptomatic malaria cases were collected from five different regions of India, viz. Mangalore, Rourkela, Goa, Delhi and Jabalpur. P. vivax isolates (74 single infections) were sequenced for four vir genes (viz. vir 27, vir 4, vir 12 and vir 21) and analyzed for the genetic variability existing in different populations of India. The results indicate that vir genes in different P. vivax populations in India are highly divergent both within and between the isolates. High levels of single nucleotide polymorphisms (SNPs) were observed attributing to the existing polymorphism for all the four vir genes studied across the population. Detailed knowledge of the genetic variation among the vir genes will help in understanding the evolutionary aspects of vir genes and may also provide basis for understanding the disease chronicity. © 2012 Elsevier B.V. All rights reserved.
1. Introduction The Plasmodium species are capable of infecting a large variety of animals including mammals, birds and reptiles. Among the species which infect humans, P. falciparum is the most deadly and P. vivax causes majority of malaria morbidity outside Africa. Most chromosomes of Plasmodium contain multigene families coding for VSAs on their telomeric and subtelomeric regions. Three families of VSAs in P. falciparum have been recognized: the var, rif and stevor genes which encode P. falciparum erythrocyte membrane protein (PfEMP), repetitive interspersed family (RIFIN) and subtelomeric variable open reading frame (STEVOR) respectively; providing enormous ability to the survival of parasite in various environments and facilitating the invasion of the host and vector immune systems (Hoffman et al., 2002; Niang et al., 2009; Templeton, 2009). The cytoadherence phenomenon in P. falciparum by the parasitized erythrocytes is linked to expression of clonally variant antigens on their surface encoded by the var genes (Smith et al., 2001). The largest multigene family identified so far is the Plasmodium interspersed repeats (pir) family which is shared by rif/stevor in P. falciparum, vir in P. vivax, simian and rodent malaria species i.e. kir in P. knowlesi and the cir/bir/yir family in P. chabaudi, P. berghei and P. yoelli respectively (Janssen et al., 2004; Cunningham
∗ Corresponding author. Tel.: +91 11 25307140; fax: +91 11 25307177. E-mail address: vineetas [email protected] (V. Singh). 0001-706X/$ – see front matter © 2012 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.actatropica.2012.07.002
et al., 2009). All these multigene families vary in number and gene organization depending on the parasite species (Deitsch and Hviid, 2004). The relationship of the VSAs with the pathogenesis of malaria has been long considered as important targets for vaccine development and alternative control strategies (Jemmely et al., 2010; Smith et al., 2001). P. vivax, the most widely distributed human-malaria species, contains vir superfamily corresponding to approximately 10% of the coding sequences (del Portillo et al., 2001; Merino et al., 2006). The complete annotation of the P. vivax laboratory strains from El Salvador (Sal I) genome revealed a total of 346 vir genes making it the largest subtelomeric family (Fernandez-Becerra et al., 2009; del Portillo et al., 2004). Clustering the Vir proteins in the Salvador I genome along with sequence similarities yielded twelve subfamilies (A–L) indicating that there is a vast repertoire of vir genes abundantly expressed in isolates obtained from human patients (Fernandez-Becerra et al., 2005; Carlton et al., 2008; Merino et al., 2006). The vir genes vary greatly, consisting of 1–5 exons in which the second exon is highly variable and range from 156 to 2316 bp in length (Carlton et al., 2008; Fernandez-Becerra et al., 2009). The major role of vir genes in natural infections remains unknown till date though their involvement in establishing chronic infections has been proposed (del Portillo et al., 2001). With the help of phylogenetic analysis like Minimum Evolution tree methods, population genetic structure of the var and stevor genes were deduced, thus by using similar tools the genetic structure of the vir genes can also be inferred (Blythe et al., 2009; Barry et al., 2007). A more extensive
134
P. Gupta et al. / Acta Tropica 124 (2012) 133–139
study about the vir gene repertoire is required in order to estimate the diversity and size of the vir genes. The main objective of this study was to determine the diversity of the vir genes in P. vivax from the various epidemiological regions. Measure of antigenic diversity would help to find a relationship with malaria transmission and provide an insight in its pathogenesis. About 80% of the P. vivax malaria cases in Southeast Asia are contributed primarily from India. The tenacity of P. vivax in India is attributed to several factors like the existence of different P. vivax strains, presence of several mosquito vectors, tropical climate and poor economy (Singh et al., 2009). The areas where P. vivax malaria is most prevalent are Orissa, West Bengal and Jharkhand in the east, Chhattisgarh and Madhya Pradesh in central India, Gujarat and Rajasthan in the west, and Karnataka in the south with perennial transmission in southern and central India (Joshi et al., 2008; http://www.nvbdcp.gov.in/, http://www.malariasite.com/). This is a population level study of the Indian P. vivax vir subtelomeric multigene superfamily. 2. Materials and methods 2.1. Study area The study was approved by the Institute’s ethical committee and detailed patient history with the informed consent was taken from the patients before the collection of samples. A total of 148 blood samples were collected from patients by the finger prick method from five different regions of India viz. Delhi (northern India) (DEL-15 isolates), Goa (western India) (GOA-15 isolates), Rourkela (eastern India) (RKL-13 isolates), Mangalore (southern India) (MNG-42 isolates) and Jabalpur (central India) (JBL-4 isolates) (Fig. 1). The samples were collected through the years 2007–2010. 2.2. Malaria diagnosis Rapid Diagnostic Tests (RDT) (Bioline SD Rapid Test) was used for preliminary detection and diagnosis of the Plasmodium species. Thick and thin peripheral blood smears were prepared for microscopic diagnosis. After microscopic examination and RDT, the bloodspots were made on Whatman (Number 3) filter paper strips from the positive samples and stored at 4 ◦ C. 2.3. Genomic DNA extraction Genomic DNA extraction of P. vivax samples was done from filter paper blood spots using QIAamp DNA Blood Mini Kit (Qiagen Inc.) according to the manufacturer’s instructions. 2.4. Detection of mixed infections The samples were analyzed by genus specific primers namely rPLU5 (5 CCTGTTGTTGCCTTAAACTTC 3 ) and rPLU6 (5 TTAAAATTGTTGCAGTTAAAACG 3 ) specific for the smaller subunit of rRNA (18S rRNA) in the primary PCR (Johnston et al., 2006). The second step comprises of 2 primer sets, rVIV1 (5 CGCTTCTAGCTTAATCCACATAACTGATAC 3 ) and rVIV2 (5 ACTTCCAAGCCGAAGCAAAGAAAGTCCTTA 3 ) specific for P. vivax which amplifies a target sequence of 120 bps and the other set rFAL1 (5 TTAAACTGGTTTGGGAAAACCAAATATATT 3 ) and rFAL2 (5 ACACAATGAACTCAATCATGACTACCCGTC 3 ) specific for P. falciparum which amplifies 205 bp of DNA (Johnston et al., 2006). The primary PCR amplification cycles included an initial step of 95 ◦ C for 5 min followed by 30 cycles of 94 ◦ C for 1 min, 60 ◦ C for 2 min, 72 ◦ C for 2 min and a final extension of 72 ◦ C for 5 min. The nested PCR amplification cycles included an initial step of 95 ◦ C for 5 min followed
by 30 cycles of 94 ◦ C for 1 min, 55 ◦ C for 2 min, 72 ◦ C for 2 min and a final extension of 72 ◦ C for 5 min. After the mixed infection analysis, the isolates were further genotyped by merozoite surface protein 3␣ (MSP3␣) molecular marker to confirm the presence of single clone infections in P. vivax positive samples (Bruce et al., 1999). 2.5. Gene selection and primer designing Work was carried out on four vir genes namely vir 27, vir 4, vir 12 and vir 21. The vir genes to be analyzed were chosen on the basis of their size, the subfamilies and their in silico analysis. The genes belonged to subfamily I, C, E and B. Subfamily B and C are more highly polymorphic with variant and conserved blocks distributed along the sequences, whereas the subfamily E is more conserved in comparison. The in silico analysis of these genes revealed their functional role in coding variable surface proteins. Vir 27 belonged to subfamily I, vir 4 from subfamily C, vir 12 from subfamily E and vir 21 from subfamily B. Since all these genes were above 1 kb in size, two sets of primers were designed by Primer 3 software version 0.4.0 (http://frodo.wi.mit.edu/) (Table 1). The conformational analysis of the designed primers was done by Oligocalc software (Oligonucleotide properties calculator). Vir 27, 4 and 12 have three exons and two introns whereas vir 21 has two exons and a single intron. The primary PCR primers for vir 27 were v27 1 and v27 4 spanning a length of 1375 bp. Two sets of semi-nested primers for vir 27 were used for amplifying a region of 827 bp by v27 1 and v27 2 and 705 bp by v27 3 and v27 4. For vir 4, the primary PCR primers were v4 1 and v4 4 which amplified 1455 bp sequence. Two sets of semi-nested primers v4 1 and v4 2 and v4 3 and v4 4 were used for amplifying a region of 751 bp and 828 bp respectively. The primary PCR primers for vir 12 were v12 1 and v12 3 for gene length of 2038 bp. One set of semi-nested primers v12-2 and v12-3 amplified a region of 1323 bp. For vir 21, the primary PCR primers used were v21 1 and v21 4 spanning a length of 1074 bp. Two sets of semi-nested primers were used for amplifying a region of 628 bp by v21 1 and v21 2 and 505 bp by v21 3 and v21 4. 2.6. Amplification and sequencing of vir genes Single P. vivax infections were amplified using vir specific primers. In the primary PCR step the primers span the whole gene and two semi-nested PCR reactions amplified the two fragments for all the four vir genes. The primary PCR amplification cycles for vir 27, vir 4 and vir 12 included an initial step of 95 ◦ C for 5 min followed by 35 cycles of 95 ◦ C for 30 s, 50 ◦ C for 30 s, 72 ◦ C for 1 min and a final extension of 72 ◦ C for 5 min. The semi-nested PCR had 30 cycles with cycling conditions as in the primary PCR. The primary PCR amplification cycles for vir 21 consisted of an initial step of 95 ◦ C for 4 min followed by 35 cycles of 95 ◦ C for 30 s, 52 ◦ C for 30 s, 72 ◦ C for 30 s and a final extension of 72 ◦ C for 7 min. The semi-nested PCR had 30 cycles and an annealing temperature of 48 ◦ C with same cycling conditions as in the primary PCR. The samples were run in 1.5% agarose gel with 100 bp and 1 kb marker. The PCR samples were purified using QIAquick PCR purification kit (Qiagen Inc.) according to the manufacturer’s instructions. These samples were sequenced by the BigDye terminator (V3.1, Applied Biosystems) cycle sequencing ready reaction kit. 2.7. Phylogenetic analysis The Sal 1 (GenBank ID: AAKM01000041.2 for vir 27, GenBank ID: AAKM01000104.1 for vir 4, GenBank ID: AAKM01000016.1 for vir 12, GenBank ID: AAKM01000003.1 for vir 21) was used as reference strain for comparing the vir gene sequences. After successful sequencing; the sequences obtained were edited, indels were removed and sequences were aligned
P. Gupta et al. / Acta Tropica 124 (2012) 133–139
135
Fig. 1. Map showing the geographic distribution of samples from five different sites along with the number of P. falciparum and P. vivax samples collected and the climate pertaining to each region.
Table 1 List of PCR primers, amplicon sizes and accession number of the reference sequences used in the study. PCR primers v27 v27 v27 v27 v4 v4 v4 v4
1 4 2 3
1 4 2 3
v12 1 v12 3 v12 2 v21 v21 v21 v21
1 4 2 3
Primer sequence 5 –3
Subfamily
Gene length (bp)
Accession number
vir 27 gene: PVX 102630 TGGCATTACACTTAGCGGTAT TGGTGTATCTGTGTGAAGATTTG CATTTTGAGCACGTTCTCCTT TCAAGTTGTAAGGTGATCAATGAAA vir 4 gene: PVX 021680 CGAAATATACTTGTCTTAACTGGTTG CAGAATGGCATCTGTTTATGC GACCAATATTTTGGGCAGGTT AGGTAGAATTGCGGCTCAGA vir 12 gene: PVX 097525 AAATATTCAAACAATGGCAATACA ACTTCCCGTGCAGGTATTTC TGACATAGGTAACGCATAATATAGCA vir 21 gene: PVX 115480 ACAACTCATTGGTATTTACATTTATGA TGCGAAAAATAAGACGCAAA TTCAAAGCATAAAATTCGCACT TCCCAAAATAAAGGCAAGGTT
I
1255 bp
AAKM01000041.2
C
1314 bp
AAKM01000104.1
E
2548 bp
AAKM01000016.1
B
974 bp
AAKM01000003.1
136
P. Gupta et al. / Acta Tropica 124 (2012) 133–139
#Reference TKAEAPREGGTVGGVVDAKAKPGAAESEGAESGIPKPAAAKPAP-----AKPVA-------------------------TSPAPSERAPAKPVAAKPAATKPATTKPAKEESEGEDPAGAKPVA-----AKPAPGEAVPAKPVAAKPVATESAAPERAPEAPEP #D1
TKAEAPREGGTVGGVVDAKAKPGAAESEGAESGIPKPAAAKPAP-----AKPVA-------------------------TSPAPSERAPAKPVAAKPAATKPATTKPAKEECEGEDPAGAKPVA-----AKPAPGEAVPAKPVAAKPVATESAAPERAQEAH?-
#D5
TKAEAPREGGTVGGVVDAKAKPGAAESEGAESGIPKPAAAKPAP-----AKPVA-------------------------TSPAPSERAPAKPVAAKPAATKPATTKPAKEESEGEDPAGAKPVA-----AKPAPGEAVPAKPVAAKPVATESAAPERAPEA?—
#G5
TKAEAPREGGTVGGVVDAKAKPGAAESEGAESGIPKPAAAKPAP-----AKPVA-------------------------TSPAPSERAPAKPVAAKPAATKPATTKPAKEESEGEDPAGAKPVAAKPVAAKPAPGEAVPAKPVAAKFVATESAAPERAPEAY?-
#M37
TKAEAPREGGTVGGVVDAKAKPGA-----AESGIPKPAAAKPAP-----AKPVAAKPVA--------------------TSPAPSERAPAKPVAAKPAATKPATTKPAKEESEGEDPARAKPVA-----AKPAPGEAVPAKPVAAKPVATKSAPPEPAQEV?—
#M39
TKAEAPREGGTVGGVVDAKAKPGA-----AESGIPKPAAAKPAP-----AKPVAAKPVA--------------------TSPAPSERAPAKPVAAKPAATKPATTKPAKEESEGEDPARAKPVA-----AKPAPGEAVPAKPVAAKPVATKSAPPEPAQEV?—
#G4
TKAEAPREGGTVGGVVDAKAKPGA-----AESGIPKPAAAKPAP-----AKPVAAKPVAAKPVAAKPVAAKPVAAKPVATSPAPSERAPAKPVA----------------------------------------------------------------------
#M38
KEPEVPRDGGTGGVELDAKAKPGTAVSEGAGSGVLKP--------------------VAAKPAD---------------TNPAPSERAPAKPVAAKPAATKPA-----KEESEGEDPAQAKPVP---------------AKPVAAKPLATKSAPPERAPEAP?-
#M40
TKAEAPREGGTGGVELDAKAKPGTAVSEGAGSGVLKPAAAKPAPVKPAPAKPVAAKPVAAKPAD---------------TNPAPSERAPAKPVAAKPAATKPA-----KEESEGEDPAQAKPVP---------------AKPVAAKPLATKSAPPERAPEALQ?
#D3
KEPEVPRDGGTGGVELDAKAKPGTAVSEGAGSGVLKP--------------------VAAKPAD---------------TNPAPSERAPAKPVAAKPAATKPA-----KEESEGEDPAQAKPVP---------------AKPVAAKPLATKSAPPERAPEALT?
#G1
TKAEAPREGGTVGGVVDAKAKPGTAVSEGAGSGVLKPAAAKPAPVKPAPAKPVAAKPVAAKPAD---------------TNPAPSERAPAKPVAAKPAATKPA-----KEESEGEDPAQAKPVP---------------AKPVAAKPLATKSAPPERAPEA?—
#R3
TKAEAPREGGTVGGVVDAKAKPGTAVSEGAGSGVLKPAAAKPAPVKPAPAKPVAAKPVAAKPAD---------------TNPAPSERAPAKPVAAKPAATKPA-----KEESEGEDPAQAKPVP---------------AKPVAAKPLATKSAPPERAPEA?—
#D2
KKPEAPREGGTGGVEVDAKAKPGAAGSEGAESGVPKPAAAKPAPVKPAPAKPVAAKPVA--------------------TSPAQSECAPAKPVAAKPAATKPA-----KEESEGEDPAGAKPVA-----AKPAPGEAVPAKPVAAKPVATKSAPPEPAQEVLT?
#D4
KKPEAPREGGTGGVEVDAKAKPGAAGSEGAESGVPKPAAAKPAPVKPAPAKPVAAKPVA--------------------TSPAPSERAPAKPVAAKPAATKPATTKPAKEESEGEDPAGAKPVA-----AKPAPGEAVPAKPVAAKPVATESAAPERAPEAL?-
#R2
KKPEAPREGGTGGVEVDAKAKPGAAGSEGAESGVPKPAAAKPAPVKPAPAKPVAAKPVA--------------------TSPAPSERAPAKPVAAKPAATKPATTKPAKEESEGEDPAGAKPVA-----AKPAPGEAVPAKPVAAKPVATESAAPERAPE?---
#R5
KKPEAPREGGTGGVEVDAKAKPGAAGSEGAESGVPKPAAAKPAPVKPAPAKPVAAKPVA--------------------TSPAPSERAPAKPVA---------------------------------------------AKPVA-----TESAAPERAPG?---
Fig.
2. Part
of
amino
acid
sequences
of
vir and
12
for
the
15
isolates
and
the
reference.
The
sequences
depict
the
repeat
amino
acids
.
using Clustal W (Chenna et al., 2003). SNPs were inferred and validated using MEGA 4.0 software (Tamura et al., 2007; http://www.megasoftware.net/). Phylogenetic trees showing genetic distances were constructed by MEGA 4.0 using minimum evolution methods. Tajima’s D test was done for vir genes due to the large extent of polymorphism observed in the isolates. Tajima’s D test is a statistical test which calculates a standardized measure of the total number of segregating sites in a sequence and the average number of mutations between pairs in the sample (Tajima, 1989). 3. Results 3.1. Diagnosis of samples From the total 148 samples, 89 samples were found positive for P. vivax infection by microscopic diagnosis. RDT diagnosis was positive for 75 samples of P. vivax. Microscopy revealed various stages of P. vivax rings, trophozoites and schizonts. 3.2. Molecular analysis of the vir gene The positive samples after microscopic diagnosis were analyzed for mixed infections of Plasmodium spp. by PCR assay. Fifteen samples from Mangalore were positive for mixed infections of P. falciparum and P. vivax and showed a band at both; 205 and 120 bp respectively. P. vivax single clone infections were found in 74 samples on analysis by msp3␣ molecular marker. From 74 P. vivax positive samples successful amplification for vir genes was observed in 45 isolates for vir 27, 6 isolates for vir 4 gene, 19 isolates for vir 12 and 22 isolates for vir 21 collected from different regions of the country. We carried out the comparison of each sequence with the available sequences in the Genbank at NCBI and PlasmoDB. On aligning the sequences various non-synonymous and synonymous SNPs were observed in the P. vivax isolates. The polymorphisms are further described in the vir genes section below. Vir 12 showed amino acid non tandem repeats concentrated toward the end of the sequence. AKPGA/AP/VA, ESEG, ERAP and TKPA were the observed repeats. Only one isolate from Delhi showed identical amino acid sequence on comparison with the reference sequence of Sal I (Fig. 2). Though vir 4 showed TGAATA and AAGGAA nucleotide repeat sequences but no amino acid repeat sequences were found. Phylogenetic trees of the vir genes showed no significant geographical specific branching (Figs. 4–7). After aligning the gene
sequences in various isolates the intron sequences were analyzed manually which showed high similarity in the intron regions of the vir genes within isolates except vir 21 which showed variability in three isolates from Goa and Rourkela even in the intron region. None of the phylogenetic trees for the vir genes showed any congruency on comparison indicating the existing hypervariability among the genes in the population. Tajima’s D test was done for all the four vir genes which showed 22 segregating sites for vir 27, three segregating sites for vir 4, 85 sites for vir 12 and 155 sites for vir 21. 3.2.1. Vir 27 The total length of vir 27 is 1255 bp. For vir 27 on sequence analysis 22 polymorphic sites were found among which 17 were non-synonymous and five were synonymous. Two samples from Mangalore showed six and four non-synonymous mutations respectively. Three samples from Rourkela showed three nonsynonymous mutations each. A total of 11 isolates (three, two and six from Mangalore, Delhi and Rourkela respectively) showed non-synonymous mutation at C34Y while 10 isolates (two, one and seven from Mangalore, Delhi and Rourkela) showed nonsynonymous mutation at D258Y (Fig. 3). The minimum evolution phylogenetic tree for 34 samples analyzed for vir 27 clearly divides the isolates into two distinct clades. Thirty samples comprise the first clade including the reference sequence and only four samples make up the second clade. Each clade is divided further into subgroups. The distribution is very random and shows no particular pattern with the regions from where the samples were collected (Fig. 4). 3.2.2. Vir 4 The total length of vir 4 is 1314 bp. The three polymorphic sites found in the gene were non-synonymous. The nucleotide changed at A645C leading to amino acid sequence change Q173P in five isolates. In three isolates change occurred at T742A and amino acid changed at N205K whereas in one isolate change was observed at G871A and the amino acid changed at M248I. From the minimum evolution phylogenetic tree of vir 4 we can conclude that the isolates are divided into two clear clades. The first clade comprises of three isolates whereas the second clade consists of the reference sequence and the remaining isolates (Fig. 5). 3.2.3. Vir 12 The total length of vir 12 is 2548 bp. The alignment of the sequences shows that the gene is highly variable among the 19
P. Gupta et al. / Acta Tropica 124 (2012) 133–139
Position
0 0 6 #Reference Y #M36 . #M37 . #M38 C #M39 . #M40 . #M3 . #M6 . #M10 . #M16 . #M21 . #M14 #M22 #M41 . #D1 . #D2 . #D3 . #D4 . #D5 . #G1 . #G2 . #G3 . #G4 . #G5 . #G7 . #G8 C #G9 . #G10 . #R1 . #R2 . #R3 . #R4 . #R5 . #R6 . #R7 . #R8 . #R9 . #R10 .
0 3 4 C . Y . Y . . . . . .
0 3 5 S . . . . . . . . . .
1 4 6 R . . . . . . . . G .
. Y Y Y . . . . . . . . . . . . . Y . . Y . Y Y Y Y
. . . . . . . . . . . . . . . . . . . . . . . . . F
. . . . . . . . . . . . . . . . . . . . . . . . . .
1 6 3 K . . . E E . . .
1 9 2 C . . . . . . . . S . . . . . . . . . . . . . . . . . . . E . . . . . . . . . . . . . . . . . . . . . . . E . . . . . E . . .
2 0 8 R . . . . . . . . . . .
2 3 9 R . . . C . . . . . . .
2 5 8 D . . . Y . . . Y . . .
2 6 5 T . . . . . . . . . . .
2 7 3 S . . . . . . . . . . .
2 8 9 S . . . . . . . . . . .
3 0 0 A . . . . . . . . P . .
3 0 9 R . . . . . . . . K . .
3 2 2 D . . . . . . . . V . .
3 2 5 N . . . . . . .
. H . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . .
. . . . Y . . . . . . . . . Y Y . Y . . Y Y Y Y
. . ? . . . . . . . . . . . . . . . . . . . . .
. . ? . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . L . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . H . . . . . .
137
Y . .
. . . . .
Fig. 3. Amino acid sequence showing the non-synonymous mutations in vir 27. ‘?’ denotes ambiguous polymorphism.
isolates that have been analyzed. Eighty five segregating sites have been observed with many non-synonymous mutations among them according to the Tajima’s test of neutrality. Many repeat regions were observed within the sequence and similarly for its amino acid sequence. The minimum evolution bootstrap test of phylogeny for the 19 samples for vir 12 shows the clear presence of two clades. The first clade consists of 12 samples including the reference and the second clade contains eight samples. Again, no particular pattern was observed for the distribution of samples in the population (Fig. 6).
3.2.4. Vir 21 The total length of vir 21 is 974 bp. Sequence analysis of vir 21 showed 155 polymorphic sites depicting the highly diverse nature of this gene when compared to the reference sequence. The bootstrap test of phylogeny for the 18 samples analyzed for vir 21 shows the clear presence of two clades. The first clade consists of 15 samples including the reference sequence and the second clade has three samples. The distribution shows no particular pattern (Fig. 7).
Fig. 4. Phylogenetic tree vir 27. The evolutionary history was inferred using the minimum evolution method. The optimal tree with branch length = 0.01679741 is shown in the figure. The percentage of the replicate trees in which the associated taxa clustered together in the bootstrap test (500 replicates) are shown next to the branches. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The ME tree was searched using the Neighbor-joining algorithm.
4. Discussion The vir family is the largest multigene family of human malaria and is included in the superfamily pir (Plasmodium interspersed repeats) along with rif/stevor in P. falciparum, kir in P. knowlesi and
Fig. 5. Phylogenetic tree vir 4. The evolutionary history was inferred using the minimum evolution method. Sum of branch length = 0.00304754 is shown.
138
P. Gupta et al. / Acta Tropica 124 (2012) 133–139
Fig. 6. Phylogenetic tree vir 12. The evolutionary history was inferred using the Minimum Evolution method. The optimal tree with the sum of branch length = 0.16003899 is shown. Phylogenetic analyses were conducted in MEGA 4.0.
Fig. 7. Phylogenetic tree vir 21. The evolutionary history was inferred using the minimum evolution method. The optimal tree with the sum branch length = 0.26627393 is shown.
cir/yir/bir family in P. chaubadi, P. yoelii and P. berghei (Janssen et al., 2004). In this study, the vir genes sequence repertoire and diversity were analyzed to determine the variability of these genes within Indian field isolates. Here we report the high level of SNPs existing in the vir genes in Indian isolates. In our study we initially diagnosed the malaria cases by microscopy which has long been considered the standard method for diagnosis (Bronzan et al., 2008). PCR assay for Plasmodium species identification was carried out for the 89 P. vivax samples identified by microscopy in which 74 were P. vivax infections and 15 samples from Mangalore (Karnataka) were mixed infections of P. falciparum and P. vivax signifying the sensitivity of the PCR assay over microscopy (Gupta et al., 2010). Presence of mixed infections could be because southern India is endemic to both P. falciparum and P. vivax (Hastings et al., 2005; http://www.malariasite.com/). The analysis of vir gene sequences showed high polymorphism existing for all the four vir genes studied within and between the isolates. The vir genes chosen for this study ranged from 974 to 2540 bp and belonged to different subfamilies. The basis of the vir genes was their in silico analysis which predicted their functional role in coding variable surface proteins. Among the vir genes analyzed in the present study, vir 21 was the most polymorphic substantiating earlier reports of subfamily B showing more variance on comparison (Fernandez-Becerra et al., 2009). Sequence analysis of vir 12 showed a much higher number of polymorphisms within the isolates when compared to the reference sequence. A high number of repeat regions observed in vir 12 maybe due to recombination resulting in vir 12 more variable than other vir genes. The repeat sequences help the parasite to evade immune responses as seen in var genes, rif genes and stevor genes in P. falciparum (Kyes et al., 2007; Blythe et al., 2009). Six isolates were successfully sequence analyzed for vir 4 and no distinct repeat sequences were found as seen in vir 12. Sequence analysis for vir 27 revealed amino acid sequences with several non-synonymous mutations indicating this gene to be less polymorphic on comparison with vir 12 and vir 21 in which the polymorphism observed was immense. It has been reported that subfamilies of vir genes have homology with multigene families like surfin and Pfmc-2tm genes (Fernandez-Becerra et al., 2009) encoding antigens used by P. falciparum to evade the host immune response (Mphande et al., 2008). The amino acid changes seen due to SNPs in the study might lead to the diversity in malarial antigens associated with immune evasion (de Souza-Neiras et al., 2007). The existing high diversity of vir genes is indicative of the fact that they may have a role to play in host immune evasion though more research is needed to explore this aspect of the diversity seen in the vir genes. By substantiating the results obtained from the genome sequence of P. vivax and phylogenetic analysis, a basic idea about the population genetic structure was inferred. The phylogenetic trees of all four vir genes divided the isolates into two clear clades that can potentially be divided into further subgroups. However no obvious cluster was observed and the distribution of isolates within the subgroups was random. There was no apparent trend for sequences of the same geographic region to be more closely related. The research data collected for the vir multigene family has not been able to decipher the actual biological function of the vir genes till date. It is proposed that Vir proteins have a possible role in immune evasion mechanism which facilitates the disease chronicity (Merino et al., 2006). Cytoadherence attributing to the disease severity in P. falciparum is mediated by the var genes multigene family (Su et al., 1995). Though such phenomena is not seen in P. vivax the mechanism of the spleen evasion by the parasite remains unsolved and it is speculated that Vir proteins might be responsible for this trait of parasite (Fernandez-Becerra et al., 2009). There are reports of severe pathology in P. vivax like respiratory distress
P. Gupta et al. / Acta Tropica 124 (2012) 133–139
and coma which is further questioning the portrayal of P. vivax as ‘benign’ and emergence of chloroquine resistance in P. vivax has also been reported (Carlton et al., 2008; Picot and Bienvenu, 2009; Kochar et al., 2005). It would be interesting to see how this highly diverse multigene family could be correlated to the increasing severity of P. vivax malaria and work could be carried out on the expression profile of the vir genes in the near future. Due to lack of adequate genetic data about P. vivax more comprehensive studies are needed to demonstrate polymorphic and population genetic studies of P. vivax not only in India but also in other countries. Our studies essentially confirmed the existence of tremendous polymorphism among the vir genes in natural infections. It clearly demonstrates that vir genes in natural infections from five different geographical regions are randomly distributed. Since this study serves merely in substantiating the highly variant nature of these genes, more extensive research is needed to understand the expression of vir genes/proteins in natural infections for their speculated role in pathogenesis. 4.1. Nucleotide sequence accession numbers The nucleotide sequences of the vir genes have been deposited in the GenBank database under accession numbers JQ733915–JQ733988. 5. Conclusion The P. vivax vir genes vary greatly and were found to be very diverse in Indian isolates. Vir 12 showed more diversity than the other vir genes as large number of polymorphisms and repeat regions were observed in the gene sequences. The high sequence variability observed in the four vir genes is non-consistent and the phylogenetic trees for them also gives no indication of a distinct pattern in subgroups suggesting further that distribution of the vir genes in the population is non-region specific. Further studies are required to know more about the population genetic structure of the vir genes. Acknowledgements We would like to thank the Department of Biotechnology (DBT) for providing us the grant required for carrying out all the research work. References Barry, A.E., Leliwa-Sytek, A., Tavul, L., Imrie, H., Migot-Nabias, F., Brown, S.M., McVean, G.A., Day, K.P., 2007. Population genomics of the immune evasion (var) genes of Plasmodium falciparum. PLoS Pathogens 3, e34. Blythe, J.E., Niang, M., Marsh, K., Holder, A.A., Langhorne, J., Preiser, P.R., 2009. Characterization of the repertoire diversity of the Plasmodium falciparum stevor multigene family in laboratory and field isolates. Malaria Journal 26, 140. Bronzan, R.N., McMorrow, M.L., Kachur, S.P., 2008. Diagnosis of malaria: challenges for clinicians in endemic and non-endemic regions. Molecular Diagnosis & Therapy 12, 299–306. Bruce, M.C., Galinski, M.R., Barnwell, J.W., Snounou, G., Day, K.P., 1999. Polymorphism at the merozoite surface protein-3alpha locus of Plasmodium vivax: global and local diversity. American Journal of Tropical Medicine and Hygiene 61, 518–525. Carlton, J.M., Adams, J.H., Silva, J.C., Bidwell, S.L., Lorenzi, H., Caler, E., Crabtree, J., Angiuoli, S.V., Merino, E.F., Amedeo, P., Cheng, Q., Coulson, R.M., Crabb, B.S., del Portillo, H.A., Essien, K., Feldblyum, T.V., Fernandez-Becerra, C., Gilson, P.R., Gueye, A.H., Guo, X., Kang’a, S., Kooij, T.W., Korsinczky, M., Meyer, E.V., Nene, V., Paulsen, I., White, O., Ralph, S.A., Ren, Q., Sargeant, T.J., Salzberg, S.L., Stoeckert, C.J., Sullivan, S.A., Yamamoto, M.M., Hoffman, S.L., Wortman, J.R., Gardner, M.J., Galinski, M.R., Barnwell, J.W., Fraser-Liggett, C.M., 2008. Comparative genomics of the neglected human malaria parasite Plasmodium vivax. Nature 9, 757–763. Chenna, R., Sugawara, H., Koike, T., Lopez, R., Gibson, T.J., Higgins, D.G., Thompson, J.D., 2003. Multiple sequence alignment with the clustal series of programmes. Nucleic Acids Research 31, 3497–3500.
139
Cunningham, D., Fonager, J., Jarra, W., Carret, C., Preiser, P., Langhorne, J., 2009. Rapid changes in transcription profiles of the Plasmodium yoelii yir multigene family in clonal populations: lack of epigenetic memory? PLoS ONE 4, e4285. de Souza-Neiras, W.C., de Melo, L.M., Machado, R.L., 2007. The genetic diversity of Plasmodium vivax – a review. Memórias do Instituto Oswaldo Cruz 102, 245–254. Deitsch, K.W., Hviid, L., 2004. Variant surface antigens, virulence genes and the pathogenesis of malaria. Trends in Parasitology 20, 562–566. del Portillo, H.A., Fernandez-Becerra, C., Bowman, S., Oliver, K., Preuss, M., Sanchez, C.P., Schneider, N.K., Villalobos, J.M., Rajandream, M.A., Harris, D., Pereira da Silva, L.H., Barrell, B., Lanzer, M., 2001. A superfamily of variant genes encoded in the subtelomeric region of Plasmodium vivax. Nature 12, 839–842. del Portillo, H.A., Lanzer, M., Rodriguez-Malaga, S., Zavala, F., Fernandez-Becerra, C., 2004. Variant genes and the spleen in Plasmodium vivax malaria. International Journal for Parasitology 34, 1547–1554. Fernandez-Becerra, C., Pein, O., de Oliveira, T.R., Yamamoto, M.M., Cassola, A.C., Rocha, C., Soares, I.S., de Braganc¸a Pereira, C.A., del Portillo, H.A., 2005. Variant proteins of Plasmodium vivax are not clonally expressed in natural infections. Molecular Microbiology 58, 648–658. Fernandez-Becerra, C., Yamamoto, M.M., Vêncio, R.Z., Lacerda, M., Rosanas-Urgell, A., del Portillo, H.A., 2009. Plasmodium vivax and the importance of the subtelomeric multigene vir superfamily. Trends in Parasitology 25, 44–51. Gupta, B., Gupta, P., Sharma, A., Singh, V., Dash, A.P., Das, A., 2010. High proportion of mixed-species Plasmodium infections in India revealed by PCR diagnostic assay. Tropical Medicine and International Health 15, 819–824. Hastings, M.D., Maguire, J.D., Bangs, M.J., Zimmerman, P.A., Reeder, J.C., Baird, J.K., Sibley, C.H., 2005. Novel Plasmodium vivax dhfr alleles from the Indonesian Archipelago and Papua New Guinea: association with pyrimethamine resistance determined by a Saccharomyces cerevisiae expression system. Antimicrobial Agents and Chemotherapy 49, 733–740. Hoffman, S.L., Subramanian, G.M., Collins, F.H., Venter, J.C., 2002. Plasmodium, human and anopheles genomics and malaria. Nature 415, 702–709. Janssen, C.S., Phillips, R.S., Turner, C.M., Barrett, M.P., 2004. Plasmodium interspersed repeats: the major multigene superfamily of malaria parasites. Nucleic Acids Research 26, 5712–5720. Jemmely, N.Y., Niang, M., Preiser, P.R., 2010. Small variant surface antigens and Plasmodium evasion of immunity. Future Microbiology 5, 663–682. Johnston, S.P., Pieniazek, N.K., Xayavong, M.V., Slemenda, S.B., Wilkins, P.P., da Silva, A.J., 2006. PCR as a confirmatory technique for laboratory diagnosis of malaria. Journal of Clinical Microbiology 44, 1087–1089. Joshi, H., Prajapati, S.K., Verma, A., Kang’a, S., Carlton, J.M., 2008. Plasmodium vivax in India. Trends in Parasitology 24, 228–235. Kochar, D.K., Saxena, V., Singh, N., Kochar, S.K., Kumar, S.V., Das, A., 2005. Plasmodium vivax malaria. Emerging infectious diseases 11, 132–134. Kyes, S.A., Kraemer, S.M., Smith, J.D., 2007. Antigenic variation in Plasmodium falciparum: gene organization and regulation of the var multigene family. Eukaryotic Cell 6, 1511–1520. Malaria site (India) (http://www.malariasite.com/). MEGA: Molecular Evolutionary Genetics Analysis (http://www.megasoftware.net/). Merino, E.F., Fernandez-Becerra, C., Durham, A.M., Ferreira, J.E., Tumilasci, V.F., d’Arc-Neves, J., da Silva-Nunes, M., Ferreira, M.U., Wickramarachchi, T., Udagama-Randeniya, P., Handunnetti, S.M., del Portillo, H.A., 2006. Multicharacter population study of the vir subtelomeric multigene superfamily of Plasmodium vivax, a major human malaria parasite. Molecular and Biochemical Parasitology 149, 10–16. Mphande, F.A., Ribacke, U., Kaneko, O., Kironde, F., Winter, G., Wahlgren, M., 2008. SURFIN4.1, a schizont-merozoite associated protein in the SURFIN family of Plasmodium falciparum. Malaria Journal 1, 116. National Vector Borne Disease Control Programme National, (http://www.nvbdcp.gov.in). Niang, M., Yan Yam, X., Preiser, P.R., 2009. The Plasmodium falciparum STEVOR multigene family mediates antigenic variation of the infected erythrocyte. PLoS Pathogens 5, e1000307. Picot, S., Bienvenu, A.L., 2009. Plasmodium vivax infection: not so benign. Medical Science (Paris) 25, 622–626. Primer 3 software version 0.4.0 (http://frodo.wi.mit.edu/). Singh, V., Mishra, N., Awasthi, G., Dash, A.P., Das, A., 2009. Why is it important to study malaria epidemiology in India? Trends in Parasitology 25, 452–457. Smith, J.D., Gamain, B., Baruch, D.I., Kyes, S., 2001. Decoding the language of var genes and Plasmodium falciparum sequestration. Trends in Parasitology 17, 538–545. Su, X.Z., Heatwole, V.M., Wertheimer, S.P., Guinet, F., Herrfeldt, J.A., Peterson, D.S., Ravetch, J.A., Wellems, T.E., 1995. The large diverse gene family var encodes proteins involved in cytoadherence and antigenic variation of Plasmodium falciparum-infected erythrocytes. Cell 14, 89–100. Tajima, F., 1989. Statistical methods for testing the neutral mutation hypothesis by DNA polymorphism. Genetics 123, 585–595. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24, 1596–1599. Templeton, T.J., 2009. The varieties of gene amplification, diversification and hypervariability in the human malaria parasite, Plasmodium falciparum. Molecular and Biochemical Parasitology 166, 109–116.