Assessment of epithelial sodium channel variants in nonwhite cystic fibrosis patients with non-diagnostic CFTR genotypes

JCF-01190; No of Pages 8

Journal of Cystic Fibrosis xx (2015) xxx – xxx www.elsevier.com/locate/jcf

Original Article

Assessment of epithelial sodium channel variants in nonwhite cystic fibrosis patients with non-diagnostic CFTR genotypes Marie-Luise Brennan a , Lynn M. Pique a , Iris Schrijver a,b,⁎ a b

Department of Pathology, Stanford University Medical Center, Stanford, CA 94305, USA Department of Pediatrics, Stanford University Medical Center, Stanford, CA 94305, USA Received 10 October 2014; revised 31 March 2015; accepted 1 April 2015

Abstract Purpose: Several lines of evidence suggest a role for the epithelial sodium channel (ENaC) in cystic fibrosis (CF). The purpose of our study was to assess the contribution of genetic variants in the ENaC subunits (α, β, γ) in nonwhite CF patients in whom CFTR molecular testing has been non-diagnostic. Methods: Samples were obtained from patients who were nonwhite and whose molecular CFTR testing did not identify two mutations. Sequencing of the SCNN1A, B, and G genes was performed and variants assessed for pathogenicity and association with CF using databases, protein and splice site mutation analysis software, and literature review. Results: We identified four nonsynonymous amino acid variants in SCNN1A, three in SCNN1B and one in SCNN1G. There was no convincing evidence of pathogenicity. Whereas all have been reported in the dbSNP database, only p.Ala334Thr, p.Val573Ile, and p.Thr663Ala in SCNN1A, p.Gly442Val in SCNN1B and p.Gly183Ser in SCNN1G were previously reported in ENaC genetic studies of CF or CF-like patients. Synonymous substitutions were also observed but novel synonymous variants were not detected. Conclusion: There is no conclusive association of ENaC genetic variants with CF in nonwhite CF patients. © 2015 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved. Keywords: Cystic fibrosis; CF; Epithelial sodium channel; ENaC; SCNN1; Molecular diagnosis; CFTR; Nonwhite

1. Introduction Cystic fibrosis (CF) is caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which encodes a chloride channel expressed predominantly in exocrine tissues [1]. The presence of two CFTR mutations typically results in chronic sinopulmonary disease and congenital absence of the vas deferens. There is considerable clinical heterogeneity and pancreatic, hepatic, and gastrointestinal manifestations also frequently occur [1]. ⁎ Corresponding author at: Department of Pathology, L235, Stanford University Medical Center, 300 Pasteur Drive, Stanford, CA 94305, USA. Tel.: +1 650 724 2403; fax: +1 650 724 1567. E-mail address: [email protected] (I. Schrijver).

The pathogenic mechanisms within lung tissue remain debated [2–11]. Two major hypotheses differ on altered salt concentration versus decreased serous secretions as the initial inciting incident affecting airway surface liquid, and leading to thickened mucus, decreased natural antibiotic function, and predisposition to infection [2–6]. A third hypothesis focuses on negative regulation of the epithelial sodium channel (ENaC) by CFTR in the lung [7–11]. In the context of CF, there is decreased chloride/bicarbonate (Cl−/HCO3−) secretion due to loss of CFTR function and hyperabsorption of sodium (Na+) and water (H2O) due to increased ENaC activity with resultant dehydration of airway surface liquid and mucus thickening. These proposed pathologic mechanisms are neither exclusive nor necessarily exhaustive. In reality, more than one mechanism may contribute to the development of clinical manifestations.

http://dx.doi.org/10.1016/j.jcf.2015.04.001 1569-1993/© 2015 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved. Please cite this article as: Brennan M-L, et al, Assessment of epithelial sodium channel variants in nonwhite cystic fibrosis patients with non-diagnostic CFTR genotypes, J Cyst Fibros (2015), http://dx.doi.org/10.1016/j.jcf.2015.04.001

2

M.-L. Brennan et al. / Journal of Cystic Fibrosis xx (2015) xxx–xxx

ENaC plays a role in salt and water resorption in epithelia in the lungs and in many additional organs, and is instrumental in the transition from newborn fluid to air-filled lung functioning [8–12]. It is heteromeric, consisting of alpha, beta and gamma subunits [13] encoded by the SCNN1A, B and G genes, respectively. There is also a variably expressed delta subunit present in some tissues, including lung epithelium [14,15]. Under-expression of ENaC due to mutations in the SCNN1 genes leads to type 1 pseudohypoaldosteronism, a form of renal salt wasting, and overexpression to Liddle syndrome, a salt-sensitive hypertension [16]. A genetic association between ENaC and hypertension in African Americans has been reported [17]. The association of ENaC with lung pathology in humans is complex. In Liddle syndrome (ENaC overexpression), lung ENaC remains functionally inhibited by CFTR and pathology restricted to the kidney [18]. In pseudohypoaldosteronism (ENaC loss of function) there is increased fluid volume in lungs, and patients have poorly understood respiratory issues particularly at a young age (congestion, rhinorrhea, tachypnea, wheezing) [19]. These effects are compensated by increased mucociliary transport rates and respiratory issues tend to improve with age [19]. This supports ENaC involvement in lung processes but does not directly address ENaC overexpression in human lung disease. Mouse models with ENaC channel overexpression [20] or with ENaC protein levels increased by conditional knockout of ubiquitin ligase NEDD4L in lung epithelia [21] show a phenotype reminiscent of CF. To evaluate a potential role for ENaC in CF, several genetic studies in mostly white CF populations have been performed (Table 1).

Stanke et al. examined 37 pairs of twins and their families and found transmission disequilibrium and intrapair discordance in support of roles for SCNN1G and SCNN1B, respectively [22]. Additionally, some patients with CF or CF-like disease but sequence changes in only one CFTR allele were found to have missense mutations in ENaC subunits [23–29]. To assess the functional effects of such missense changes, Xenopus laevis oocytes were injected with constructs containing specific mutations (p.Trp493Arg in α-ENaC (SCNN1A) and p.Val348Met, p.Glu539Lys, p.Pro267Leu, and p.Gly294Ser in β-ENaC (SCNN1B)) and exhibited altered sodium currents [23,28]. Further characterization indicated gain of function mechanisms in α-ENaC (SCNN1A) p.Trp493Arg through a reduction in the inhibitory effect of extracellular Na+, and in β-ENaC (SCNN1B) p.Val348Met via the increased probability of ENaC channels remaining open [30,31]. Clinical genetic testing for CF can be performed by different approaches including mutation panel testing with panels that were primarily designed for carrier screening purposes, and DNA sequencing with or without deletion/duplication analysis. In composite, genetic testing does not identify a molecular cause in about 1–5% of typical CF patients, and a higher percentage in those with less classic presentations [32]. The elusive molecular etiology can be due to unidentified mutations in the CFTR gene itself, such as when sequence changes occur in noncoding regions that would not be included in diagnostic testing but that nevertheless harbor pathogenic changes, or it can result from mutations in other genes. For the “typical” CF patient, diagnosis can often be made based on newborn

Table 1 Summary of genetic association studies examining a potential role for ENaC in CF and CF-like conditions. Ethnicity

# of subjects a SCNN1 subunit Genotype/clinical characteristics b Sequence variant c

Caucasian (France) [26]

56

Caucasian (Europe) [28]

29; 47

B G A

B G Unknown (USA) [23]

20

African 5; 55 (Rwanda) [27]

Caucasian (Spain) [29]

10

Caucasian/African (France) [24] 20; 35 Caucasian (Italy) [35]

a b c

24; 15

A B A B G A B G B G A B G

Two CFTR mutations; Classic CF p.Thr313Met, p.Gly589Ser p.Leu481Gln, p.Val546Ile One/no CFTR mutation; typical c.− 760ANG, c.− 717GNC, c.− 68CNT, p.Pro33Pro and atypical CF cases p.Phe61Leu, p.Val114Ile, p.Leu180Leu, p.Arg181Trp, p.Ala334Thr, p.Trp493Arg, p.Thr663Ala p.Ser82Cys, p.Pro93Pro, c.777-5TNC, p.Phe293Phe, p.Ile515Ile, p.Gly589Ser, p.Asp629Asp p.Tyr129Tyr, p.Ile158Ile, p.Gly183Gly, p.Glu197Lys, c.1176+14ANG, c.1373+29TNC, c.1432−7GNA, p.Leu649Leu No CFTR mutations p.Arg181Trp Non-classic CF p.Glu539Lys, c.1543-2ANG One/no CFTR mutation; CF-like c.− 28TNC, p.Val573Ile p.Val348Met, p.Gly442Val, p.Thr577Thr, c.1346+28CNT p.Ser212Ser, c.1176+30GNC One/no CFTR mutation; CF p.Val14Gly, p.Leu203Leu, p.Arg204Trp, p.Ala304Pro, and CF-like p.Ala357Thr, p.Cys641Phe, c.875+35GNA p.Phe293Phe, p.Arg563Gln, p.Pro574Pro p.Gly183Gly One/no CFTR mutation p.Ser82Cys, p.Asn288Ser,p.Pro369Thr Bronchiectasis p.Gly183Ser, p.Glu197Lys One/no CFTR mutation; c.− 760ANG, p.Ala334Thr, p.Thr663Ala CFTR-related disorders p.Pro93Pro, p.Phe293Phe p.Tyr129Tyr, p.Ile158Ile, p.Gly183Gly, p.Leu649Leu, c.1176+14ANG, c.1373+29TNC, c.1432− 7GN A

Listed as number of subjects per genotype (if known). Clinical characteristics listed are per original study description. Bolded variants were observed in the current study.

Please cite this article as: Brennan M-L, et al, Assessment of epithelial sodium channel variants in nonwhite cystic fibrosis patients with non-diagnostic CFTR genotypes, J Cyst Fibros (2015), http://dx.doi.org/10.1016/j.jcf.2015.04.001

M.-L. Brennan et al. / Journal of Cystic Fibrosis xx (2015) xxx–xxx

screening and/or clinical grounds. In the less typical CF patient (i.e., no classic signs at birth, negative family history, single system involvement, equivocal newborn screen, nonwhite), however, making a clinical diagnosis may be more difficult at an early age and lack of appropriate genetic screening could impact time to diagnosis [33] as well as clinical status and outcomes [34]. The search for genetic contributors to CF other than CFTR mutations has been ongoing for more than ten years. To investigate further the potential role of ENaC in CF patients with non-diagnostic CFTR molecular testing, we identified and analyzed variants of the SCNN1A, B and G genes in a nonwhite population that has been underrepresented in prior studies. 2. Patients and methods 2.1. Patients This project was approved by the Stanford Internal Review Board (IRB 13897). Residual, de-identified specimens from a cross-sectional study were used. Living, nonwhite CF patients enrolled in the CF Foundation Patient Registry (2001–2013) via 156 United States based CF centers were eligible for participation. For the purpose of this study, nonwhite was defined as: African American, Native American, Asian, Middle Eastern or self-classified “other” nonwhite, non-Hispanic backgrounds. Patients may have more than one race/ethnicity, one of which may be white. Diagnosis of CF was based on current diagnostic criteria. The designation of atypical CF was based on clinical judgment of likely CF disease despite non-diagnostic test results and continued need for follow up at a CF center. For the purposes of this study, we refer to the patients in composite as CF patients, unless otherwise noted. We refer to patients in studies referenced herein by the designation and clinical description given by the publishing authors. Clinical inclusion criteria for our study thus were: 1) Diagnosis of CF or atypical CF and being clinically followed at a CF center, 2) Self-identified (or parent identified if too young to self-identify) as nonwhite and non-Hispanic, and 3) Presence of one or zero CFTR variants following diagnostic CFTR sequencing and multiplex ligation-dependent probe amplification (MLPA) deletion/duplication analysis. CF diagnostic sequencing encompassed all CFTR exons and splice sites; potentially pathogenic sequence changes were confirmed bidirectionally. This selection approach yielded 33 study subjects. Patients were excluded if they did not meet inclusion criteria. 2.2. Genetic variant identification by sequencing DNA amplification of the SCNN1A, B, and G coding exons was performed on previously isolated DNA. Primer pairs to amplify the ENaC subunits were as described [28] with the exception of newly designed primers to amplify SCNN1G exons 9 and 10 (Forward 5′CCTTCAACTCACATCCTCAAC3′, Reverse 5′CTCCACAAGGTAATTCTTTTCC3′) and exon 11 (Forward 5′TTGGGCTGCCTACACTCATG3′, Reverse 5′TA CACATACAGAAGCAAGTGAG3′). PCR conditions were: 1 ×

3

Amplitaq Gold™ buffer (Life Technologies, Carlsbad, CA), 1.5 mM MgCl2, 0.125 mM dNTPs, 0.4 μM of each primer, 5 U Amplitaq Gold™ (Life Technologies, Carlsbad, CA), and 100 ng of DNA for most reactions. PCR reaction conditions for exon 3 of SCNN1A contained 1 M betaine. Exons 12 and 13 of SCNN1G required 3 mM MgCl2. MJ Research (BioRad, Hercules, CA) thermocycler program parameters were: 95 °C for 5 min, followed by 35 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min, concluding with 72 °C for 5 min. A higher annealing temperature (62 °C) was used for exon 3 of SCNN1A, exons 2, 9, 10 and 13 of SCNN1B, and exon 2 of SCNN1G. The presence, size and quality of amplified products were assessed by agarose gel electrophoresis, followed by purification by Elim Biopharmaceuticals (Hayward, CA). Samples were sequenced on an ABI 3730xI sequencing instrument (Life Technologies, Carlsbad, CA). Sequencing results were visually inspected for quality, and then assessed for genetic variants using Mutation Surveyor DNA Variant Analysis Software (SoftGenetics, State College, PA) and the following GenBank reference sequences: NC_000012.11 for SCNN1A, NG_011908.1 for SCNN1B, and NG_011909.1 for SCNN1G. Detected genetic variants were confirmed by sequencing in both forward and reverse directions.

2.3. Pathogenicity assessment by database query and computational analysis cDNA nucleotide and amino acid positions of identified genetic variants are listed in Table 4. dbSNP (http://www.ncbi. nlm.nih.gov/SNP/) and SNP Nexus (http://snp-nexus.org/) were queried for all variants. SNP reference (rs) numbers and the corresponding reported allele frequencies were noted. For exon variants, PolyPhen-2 (Polymorphism Phenotyping v2, http://genetics.bwh.harvard.edu/pph2/), SIFT (Sorting Intolerant From Tolerant, http://sift.jcvi.org/), and Provean (Protein Variation Effect Analyzer, http://provean.jcvi.org/genome_ submit.php) were used to predict functional consequences of predicted amino acid changes in the protein sequence. Amino acid cellular domain location was assigned from the UniProt database (http://www.uniprot.org). We analyzed intronic variants within twenty base pairs of an exon/intron splice site. Potential effects on splicing were assessed by NNSplice, a neural network splice site prediction tool via Berkeley Drosophila Genome Project (http://www.fruitfly.org/seq_tools/splice.html). Automated Splice Site and Exon Definition Analysis (ASSEDA; http://splice.uwo.ca) was also used to assess effect of sequence changes on mRNA splicing. Phenotype and disease association were queried on Pubmed (http://www.ncbi.nlm.nih.gov/pubmed/), Genetic Association of Complex Diseases and Disorders (http://geneticassociationdb.nih.gov/), and on the Catalogue of Published Genome Wide Association Studies (http://www. genome.gov/gwastudies/). Our variant classification was based upon review of allele frequency, literature review of any prior functional studies in the gene region, and computational prediction of whether a mutation affects transcription, translation or processing.

Please cite this article as: Brennan M-L, et al, Assessment of epithelial sodium channel variants in nonwhite cystic fibrosis patients with non-diagnostic CFTR genotypes, J Cyst Fibros (2015), http://dx.doi.org/10.1016/j.jcf.2015.04.001

4

M.-L. Brennan et al. / Journal of Cystic Fibrosis xx (2015) xxx–xxx

Table 2 Results of CFTR molecular analysis in cystic fibrosis patients. Carrier status

Number of patients

CFTR variant

None Heterozygous Heterozygous Heterozygous Heterozygous Heterozygous Heterozygous Heterozygous Heterozygous Heterozygous Heterozygous Heterozygous

19 1 4 1 1 1 1 1 1 1 1 1

None Complex rearrangement p.Phe508del p.Arg117His c.− 288GNC c.− 461ANG c.1393−42GNA c.1327_1330dup c.2554dupT c.2620−15CNG c.2988+1GNA c.4243−5CNT

Legacy name

ΔF508 R117H N/A − 329ANG 1525−42GNA 1461ins4 N/A 2752−15CNG 3120+1GNA 4375−5CNT

CF patient DNA samples were screened at the CFTR genetic locus using sequencing with bidirectional confirmation and reflex to MLPA deletion/ duplication analysis. N/A = not applicable.

Table 3 Demographics and clinical characteristics of cystic fibrosis patients with non-diagnostic CFTR results. Patient characteristic

Number of total (%)

Sex — male and female Age at diagnosis (average years old and range) Race Black White and Black American Indian or Alaskan and White Other (non-Hispanic) Clinical diagnosis suggested by (can be N1) Respiratory abnormalities Nasal polyps/sinus disease Failure to thrive/malnutrition Steatorrhea/abnormal stools/malabsorption Meconium ileus Newborn screening Multiple symptoms at presentation Sweat chloride value (average mmol/L and range)

19/33 (58%); 14/33 (42%) 10.1 (0.2–47) 24/33 (73%) 4/33 (12%) 2/33 (b 1%) 3/33 (b 1%) 21/33 3/33 7/33 7/33 2/33 2/33 13/33 79 (41–160)

3. Results 3.1. Patients and clinical characteristics We examined the potential contribution of CFTR-associated ENaC in nonwhite, non-Hispanic CF patients whose CFTR sequencing and deletion/duplication analysis was non-diagnostic. A total of 33 patient samples were available for sequencing analysis of the SCNN1 genes, including 19 with no mutations in CFTR by sequence analysis and deletion/duplication analysis. All others had one sequence change in the CFTR gene (Table 2). Demographics and clinical characteristics of the patients are indicated in Table 3. All individuals were being followed at CF centers with 28 patients meeting criteria for CF and five being clinically treated for atypical CF. In the majority of the cases, the clinical diagnosis was suggested initially by respiratory abnormalities. Failure to thrive and/or malnutrition, and steatorrhea/ abnormal stools/malabsorption were the next most common findings. In 39%, multiple symptoms were noted at presentation. All individuals, except the five atypical CF patients, had sweat chloride values greater than 60 mmol/L. All atypical CF cases had abnormal sweat chloride levels in the 41–59 mmol/L range, which is considered indeterminate for the diagnosis of CF. 3.2. Genetic variants in ENaC subunits The variants identified in the SCNN1A, B, and G genes by PCR amplification and sequencing are listed in Table 4. For SCNN1A, we found variants with nonsynonymous amino acid changes in exon 6 (p.Ala334Thr) and in exon 13 (p.Val573Ile, p.Cys618Phe, p.Thr663Ala). We observed one variant with a synonymous amino acid change in exon 5 (p.Asp326Asp). We did not observe any changes in exons 1–4 or 7–12 of this gene. For SCNN1B, we found variants resulting in nonsynonymous amino acid changes in exon 8 (p.Arg388Cys), exon 9 (p.Gly442Val), and exon 13 (p.Thr594Met). We observed variants with synonymous amino acid changes in exon 2 (p.Pro93Pro, p.Ala94Ala), exon 5 (p.Phe293Phe) and exon 10 (p.Ser467Ser). No variants were noted in exons 3, 4, 6, 7, 11

and 12 of the SCNN1B gene. For SCNN1G, we identified one variant with a nonsynonymous amino acid change in exon 3 (p.Gly183Ser). We observed variants with synonymous amino acid changes in exon 3 (p.Tyr129Tyr, p.Ile158Ile, p.Gly183Gly); exon 4 (p.Ser212Ser) and exon 13 (p.Leu649Leu). No variants were located in exons 2 and 5–12 of the SCNN1G gene. 3.3. Database and computational analysis of nonsynonymous exon variants We queried the dbSNP database, a public archive for single nucleotide polymorphisms and small-scale variations, to see whether the variants observed among our patients (Table 4) had been previously documented. We did not observe novel variants. A variant that is present at N 1% allele frequency in the general population meets the definition of “polymorphism” and we used this metric as an initial, preliminary threshold regarding potential pathogenicity when evaluating dbSNP frequencies. This assumption does not exclude functional consequences of the variant. We also considered the number of alleles examined and ethnicity, if known, in evaluating published allele frequencies for comparisons. Three of four variants with nonsynonymous amino acid changes in SCNN1A (p.Ala334Thr; p.Cys618Phe; p.Thr663Ala) have been observed in dbSNP previously with allele frequencies greater than 1%, as well as in our current study. Control population allele frequencies for the p.Val573Ile variant include reports in dbSNP (0.05%, based on 20 alleles, unknown ethnicity) and an African control population (7.8%, based on 400 alleles) [27]. We observed a 1.5% allele frequency in our study, consistent with low frequency in African CF-like patients (0.9%, based on 110 alleles) [27]. For SCNN1B variant allele frequencies, nonsynonymous variant p.Thr549Met (0.3%, based on 12 alleles, unknown ethnicity) and synonymous variants p.Ala94Ala (0.5%, based on 22 alleles, unknown ethnicity) and p.Ser467Ser (0.2%, based on 8 alleles, unknown ethnicity) were seen at frequencies b 1% in dbSNP but at higher allele frequencies (1.5% for each, based on 66 alleles) in our study. Variant frequency observed is listed in Table 4 but

Please cite this article as: Brennan M-L, et al, Assessment of epithelial sodium channel variants in nonwhite cystic fibrosis patients with non-diagnostic CFTR genotypes, J Cyst Fibros (2015), http://dx.doi.org/10.1016/j.jcf.2015.04.001

M.-L. Brennan et al. / Journal of Cystic Fibrosis xx (2015) xxx–xxx

5

Table 4 Genetic variants identified in SCNN1 genes. Sequence variant

Exon

# of patients per genotype

RS ID

MAF/minor allele a; observed variant %

Residue location/predicted effect b

SCNN1A c.684+10GNA c.978CNT, p.Asn326Asn c.1000GNA, p.Ala334Thr c.1717GNA, p.Val573Ile c.1853GNT, p.Cys618Phe c.1987ANG, p.Thr663Ala

3–4 5 6 13 13 13

1 het 1 het 5 hom, 12 het 1 het 6 het 27 hom, 7 het

– 61731141 11542844 59142484 3741913 2228576

–; 1.5 A = 0.013/29; 1.5 T = 0.208/453; 33.3 T = 0.005/10; 1.5 A = 0.037/81; 9.1 T = 0.281/612; 92.4

N/A; no effect Extracellular; N/A Extracellular; no effect Helical; no effect Cystoplasmic; no consensus c Cystoplasmic; no effect

SCNN1B c.279TNC, p.Pro93Pro c.282CNT, p.Ala94Ala c.879CNT, p.Phe293Phe c.1162CNT, p.Arg388Cys c.1325GNT, p.Gly442Val c.1401CNT, p.Ser467Ser c.1781CNT, p.Thr594Met

2 2 5 8 9 10 13

24 hom, 9 het 1 het 2 hom, 9 het 2 het 1 hom, 3 het 1 het 1 het

238547 139950628 250563 61729788 1799980 74012901 1799979

T = 0.259/564; 86.4 T = 0.005/11; 1.5 T = 0.083/181; 19.7 A = 0.011/23; 3.0 T = 0.038/82; 7.6 T = 0.002/4; 1.5 T = 0.003/6; 1.5

Extracellular; N/A Extracellular; N/A Extracellular; N/A Extracellular; no consensus c Extracellular; no effect Extracellular; N/A Cystoplasmic; no consensus c

SCNN1G c.387TNC, p.Tyr129Tyr c.474TNC, p.Ile158Ile c.547GNA, p.Gly183Ser c.549CNT, p.Gly183Gly c.636CNT, p.Ser212Ser c.1176+14ANG c.1432−7GNA c.1947CNG, p.Leu649Leu

3 3 3 3 4 7–8 10–11 13

11 het 11 het 2 het 3 het 1 het 14 hom, 14 het 2 hom, 7 het 2 hom, 8 het

5734 5735 5736 5737 5739 5740 13306653 5723

C = 0.249/543; 16.7 C = 0.250/544; 16.7 A = 0.012/26; 3.0 T = 0.056/121; 4.5 T = 0.014/30; 1.5 A = 0.191/416; 63.6 A = 0.184/400; 16.7 G = 0.184/400; 18.2

Extracellular; N/A Extracellular; N/A Extracellular; no effect Extracellular; N/A Extracellular; N/A N/A; No effect N/A; no effect Cytoplasmic; N/A

Abbreviations: Hom — homozygous genotype; Het — heterozygous genotype; RS ID — reference sequence ID number; MAF — global minor allele frequency; N/A — not applicable. a MAF/Minor Allele is reported for the rs id number listed. The nucleotide listed is the minor allele. (Note: the variant observed in this study is not always the second most common variant.) Frequency of the minor allele is listed per number of times the allele is observed in the alleles tested. The current default global population sample comprises 1000 Genome phase I genotype data from 1094 worldwide individuals, released in May of 2011. The observed variant percentage is the allele frequency expressed as percentage, observed in this study. It is included for comparison purposes with the control population data. b Residue location (cystoplasmic; helical; or extracellular) is indicated. Composite effect predicted by SIFT, PolyPhen-2 and Provean computer algorithms are summarized. If all were in agreement that a variant would be predicted to have no effect, this is listed. If there is a discrepancy, it is listed as “no consensus”. c Protein prediction analysis results were not consistent between programs. For p.Cys618Phe and p.Thr594Met, Polyphen-2 predicted a “probably damaging” effect that was not predicted by SIFT or Provean analysis. For p.Arg388Cys, Provean predicted a “might be damaging” effect that was not predicted by Polyphen-2 or SIFT analysis.

statistical calculations could not validly be made due to the small number of samples and/or significantly different sampling sizes. For SCNN1G, no variants were present in dbSNP at less than 1% allele frequency. To examine potential pathogenic effects on the protein due to nonsynonymous amino acid changes, we utilized three protein variant analysis software programs (SIFT, PolyPhen-2, Provean). For SCNN1A, all variants except p.Cys618Phe received benign, neutral and tolerated scores, respectively, from the three programs and are thus predicted unlikely to be pathogenic. For p.Cys618Phe, the protein variant analysis programs were not in agreement regarding predicted pathogenic effects (Table 4). For SCNN1B, all three programs predicted that p.Gly442Val was likely non-pathogenic. For p.Arg388Cys and p.Thr594Met, there was no agreement among the protein variant prediction analysis programs (Table 4). For the SCNN1G variant p.Gly183Ser, SIFT, PolyPhen-2 and Provean all predicted that the substitution was likely to be non-pathogenic. We also used ASSEDA analysis and variant position within the gene to examine possible effects on mRNA splicing. While there were some potential effects on acceptor and donor sites, these sites were less likely to be used than the natural sites and the natural

acceptor and donor sites were predicted to remain the major splice form.

3.4. Literature review of prior studies and pathogenicity determination Table 1 summarizes the prior genetic variant studies on ENaC in CF or CF-like conditions. Interestingly, several variants that we observed (p.Val573Ile in SCNN1A, p.Gly442Val in SCNN1B, and p.Ser212Ser in SCNN1G) were also seen in a study of Rwandan patients with respiratory issues and one or no CFTR mutations [27]. These variants were not observed in other, predominantly white, CF cohorts. Conversely, the SCNN1G p.Gly183Ser variant observed in our study was present in both a patient of African descent in a French study [24] and in a white CFTR-related disorders study [35]. The only variant with evidence suggestive of pathogenicity supported by clinical evidence was SCNN1G p.Gly183Ser. This variant was observed in a bronchiectasis patient of African descent who exhibited normal sweat chloride testing but abnormal nasal potential difference [24]. These findings are suggestive of altered sodium

Please cite this article as: Brennan M-L, et al, Assessment of epithelial sodium channel variants in nonwhite cystic fibrosis patients with non-diagnostic CFTR genotypes, J Cyst Fibros (2015), http://dx.doi.org/10.1016/j.jcf.2015.04.001

6

M.-L. Brennan et al. / Journal of Cystic Fibrosis xx (2015) xxx–xxx

transport, but have not been verified in additional cases, making this a variant of unknown clinical significance. 3.5. Genetic variants in introns of ENaC-encoding genes For SCNN1A, B and G, various intronic variants were identified. Our review and analyses were limited to those within 20 base pairs of the exon/intron splice site: one variant was seen in SCNN1A (c.684+10GNA) and two variants in SCNN1G (c.1176+14ANG, c.1432−7GNA). We utilized NNSplice to look for potential effects of these variants on abolishing or creating alternative splice sites and found that the existing splice sites remained highly predicted with site prediction scores greater than 0.9 (of possible 1.0) and with no new sites predicted. We also used ASSEDA to look for potential effects on mRNA splicing. The natural acceptor or donor sites were not predicted to be altered. Weaker potential sites were noted for c.1176+14ANG and c.1432−7GNA, but these were not predicted to activate and thus affect the natural sites. We concluded that, based on database, computational, positional and literature review, there is no obvious evidence of pathogenicity for these intronic changes. 4. Discussion Although CFTR mutations are the only known cause of classic CF, there remain clinically diagnosed CF patients without two CFTR mutations identified, despite extensive testing. This is true not only for the white population but also and especially for much less commonly studied nonwhite populations in which CF has lower prevalence. A “missing molecular etiology” is estimated to occur in 1–5% of typical CF cases [32]. The patient with non-diagnostic molecular testing is a challenge for clinical practitioners in terms of diagnosis, early intervention, genetic counseling, and disease prognosis. Patients with unknown molecular etiologies are of considerable interest and ultimately may provide novel insights regarding diagnostic approaches with added value and regarding therapies for what is a phenotypic spectrum with significant morbidity and mortality in both classic and atypical CF disease. For those with fewer classically observed symptoms, improved testing may help with early diagnosis and, similar to classic CF, such early diagnosis and subsequent intervention may improve outcomes. In an early study, there was a 5–10% reduction in the mortality of children with CF by 10 years of age who had no newborn manifestation of meconium ileus, but were identified via CF newborn screening [36]. Observational studies also indicated that children identified through CF newborn screening had better lung function, growth parameters, and neurocognitive development than clinically ascertained children. Our study population of 33 nonwhite CF/atypical CF patients “missing a molecular etiology” after diagnostic CFTR sequencing and MLPA testing had an average age at diagnosis of 10.1 years with a median of 7.3 years for clinically diagnosed CF patients and 10.5 and 9 years of age, respectively, for the atypical CF patients. For patients enrolled in the Cystic Fibrosis Foundation Patient Registry overall, these numbers were lower: 3.5 and 0.4 years of

age, respectively [37]. The increased age at diagnosis in our subjects may be due, in part, to the fact that most patients were born prior to nationwide newborn screening, and to their clinical presentation. For example, few in this study had manifested meconium ileus and most had only single organ involvement with respiratory symptoms at presentation, making the clinical diagnosis more challenging. Apart from the aim of making a molecular diagnosis, and making it is early as possible, a more complete understanding of the molecular basis of CF phenotypes would also benefit our understanding of pathophysiologic aspects contributing to the disease process itself. Genetic variants differ in incidence and frequency between ethnic groups. Examination of variants in nonwhite populations (both healthy and clinically affected) in order to determine the incidence and composition of genetic variants in different ethnic groups is critical for diagnostic and interpretive purposes. In the United States, CF is estimated to occur in 1:3000 Caucasians, 1:9200 Hispanics, 1:10,900 Native Americans, 1:15,000 African Americans, and 1:30,000 Asian Americans [38]. Our patient cohort was predominantly African American (n = 24/33). The frequency of SCNN1 alleles identified in our study was examined in dbSNP (which includes 1000 genomes data), other CF cohort studies, and among our participants. The 1000 genomes database contains variant frequencies for an ethnically diverse sampling of persons (n = 523/2577 of East Asian Ancestry; n = 494/2577 of South Asian Ancestry; n = 691/2577 of African Ancestry; n = 514/2577 of European Ancestry; n = 355/2577 of Total Americas Ancestry; http://www.1000genomes.org/about). The genetic variants in our study were observed in the nonwhite patients in other CF studies [24,27] and in one white CFTRrelated disorders cohort study [35]. Naturally, variant frequencies differ between studies and are affected by sample size and ethnic composition. Given these constraints, conclusions from statistical comparisons effectively cannot be made. It has been suggested that complex alleles of CFTR or polygenic factors, such as composite CFTR/SCNN1 genotypes could account for CF or atypical CF in patients without two CFTR mutations [24,25,28,29]. Of the 14 patients with one CFTR mutation in our study, all but one had a SCNN1 variant as well. No definitive conclusions can be drawn from this without statistical analysis on larger numbers. However, the variants present in conjunction with a CFTR mutation were common polymorphisms (p.Ala334Thr and p.Thr663Ala in SCNN1A), present in 33% and 92% of our patient cohort respectively, and reported in the general population at 20.8% and 28.1%, respectively. These data are thus not supportive of an obvious complex allele pathophysiology. Other CFTR/ SCNN1 mutation combinations included one patient with CFTR p.Arg117His and p.Cys618Phe in SCNN1A and one patient with CFTR p.Phe508del and p.Gly183Ser in SCNN1G. Although relatively rare in the general population (3.7% and 1.2%, respectively), these SCNN1 polymorphisms were seen in additional patients without CFTR mutations in our study (n = 5 and 1, respectively). Both of the SCNN1 variants are variants of unknown clinical significance. Thus, our data are not supportive of these variants acting in polygenic fashion although modifier effects cannot be excluded. In addition, in silico analysis is

Please cite this article as: Brennan M-L, et al, Assessment of epithelial sodium channel variants in nonwhite cystic fibrosis patients with non-diagnostic CFTR genotypes, J Cyst Fibros (2015), http://dx.doi.org/10.1016/j.jcf.2015.04.001

M.-L. Brennan et al. / Journal of Cystic Fibrosis xx (2015) xxx–xxx

necessarily limited, compared to functional studies. However, due to the complex nature of such studies, even in the CFTR gene itself functional studies have only been conducted for a minority of mutations. Although a phenotypic effect of the described SCNN1 variants seems unlikely, contributing functional effects in vivo cannot be entirely ruled out. Accurate variant interpretation requires convincing experimental and medical findings. Regarding clinical evidence, we note that the bronchiectasis patient with the p.Gly183Ser variant in SCNN1G manifested evidence of sodium transport alteration in nasal tissue but not on sweat chloride testing [24]. This variant is listed as a pathogenic allele in Online Mendelian Inheritance in Man, based on these findings. It has been argued that this tissue-type sodium transport pattern is present in Liddle syndrome patients, and thus consistent with ENaC alteration being pathogenic in the bronchiectasis patient [24]. The two patients with this mutation in our study met clinical criteria for CF and had elevated sweat chloride values of 62 and 105 mmol/L, respectively. However, protein software prediction did not predict a pathogenic effect. Thus, this variant remains of unknown significance meriting further assessment once additional studies become available. From a mechanistic standpoint, the direct interaction of CFTR and ENaC and effects on sodium are of interest. Several lines of evidence support ENaC involvement in CF, and suggest it to have potential to become a novel drug target for this condition [7–12,39], but whether ENaC is a cause, modulator or neither remains to be elucidated. The secreted protein short palate lung and nasal epithelial clone 1 (SPLUNC1) inhibits ENaC-dependent sodium absorption. This inhibition is pH dependent and lost in the acidic CF airway environment due to pH-sensitive SPLUNC1 protein motifs [40], which suggests that ENaC hyperactivity is a consequence rather than the cause of the disease process. The molecular interactions of CFTR at the cellular level are receiving increased scrutiny, and the complexity of the “CFTR interactome”, i.e., proteins influenced by and influencing CFTR, is becoming increasingly appreciated. Similarly, other protein–protein interactions, shear stress effects, cellular trafficking and intracellular second messenger effects on ENaC are receiving attention [11]. Whereas our study does not support causative ENaC involvement in CF and CF-like disease through the presence of pathogenic sequence changes, the question of ENaC modulation of the phenotype remains relevant for both white and nonwhite populations and merits continued investigation.

Conflict of interest notification M.L.B., L.P., and I.S. have no conflict of interest related to this work to declare.

Acknowledgments We thank the Cystic Fibrosis Foundation for providing clinical information.

7

References [1] Welsh MJ RB, Accurso F, Cutting GR. Cystic fibrosis. In: Valle DBA, Vogelstein B, Kinzler KW, Antonarakis SE, Bellabio A, Gibson K, Mitchell G, editors. OMMBID — The Online Metabolic and Molecular Bases of Inherited Diseases. New York, NY: McGraw-Hill; 2013. [2] Smith JJ, Travis SM, Greenberg EP, Welsh MJ. Cystic fibrosis airway epithelia fail to kill bacteria because of abnormal airway surface liquid. Cell 1996;85(2):229–36. [3] Finkbeiner WE, Shen BQ, Widdicombe JH. Chloride secretion and function of serous and mucous cells of human airway glands. Am J Physiol 1994;267(2 Pt 1):L206–10. [4] Ballard ST, Trout L, Bebok Z, Sorscher EJ, Crews A. CFTR involvement in chloride, bicarbonate, and liquid secretion by airway mucosal glands. Am J Physiol 1999;277(4 Pt 1):L694–9. [5] Wang X, Zhang Y, Amberson A, Engelhardt JF. New models of tracheal airway define the glandular contribution to airway surface fluid and electrolyte composition. Am J Respir Cell Mol Biol 2001;24(2): 195–202. [6] Joo NS, Irokawa T, Robbins RC, Wine JJ. Hypsecretion, not hyperabsorption, is the basic defect in cystic fibrosis airway glands. J Biol Chem 2006; 281(11):7392–8. [7] Matsui H, Grubb BR, Tarran R, Randell SH, Gatzy JT, Davis CW, et al. Evidence for pericilliary liquid layer depletion, not abnormal ion composition, in the pathogenesis of cystic fibrosis airways disease. Cell 1998;95(7):1005–15. [8] Mall MA. Role of the amiloride-sensitive epithelial Na+ channel in the pathogenesis and as a therapeutic target for cystic fibrosis lung disease. Exp Physiol 2009;94(2):171–4. [9] Collawn JF, Lazrak A, Bebok Z, Matalon S. The CFTR and ENaC debate: how important is ENaC in CF lung disease. Am J Physiol Lung Cell Mol Physiol 2012;302(11):L1141–6. [10] Althaus M. ENaC inhibitors and airway re-hydration in cystic fibrosis: state of the art. Curr Mol Pharmacol 2013;6(1):3–12. [11] Hobbs CA, Da Tan C, Tarran R. Does epithelial sodium channel hyperactivity contribute to cystic fibrosis lung disease? J Physiol 2013; 591(Pt 18):4377–87. [12] Hummler E, Barker P, Talbot C, Wang Q, Verdumo C, Grubb B, et al. A mouse model for the renal salt-wasting syndrome pseudohypoaldosteronism. Proc Natl Acad Sci U S A 1997;94(21):11710–5. [13] Canessa CM, Schild L, Buell G, Thorens B, Gautschi I, Horisberger J-D, et al. Amiloride-sensitive epithelial Na+ channel is made of three homologous subunits. Nature 1994;367(6462):463–7. [14] Ji HL, Su XF, Kedar S, Li J, Barbry P, Smith PR, et al. Delta-subunit confers novel biophysical features to the alpha beta gamma-human epithelial sodium channel (ENaC) via a physical interaction. J Biophys Chem 2006;281(12):8233–41. [15] Bangel-Rulard N, Sobczak K, Christmann T, Kentrup D, Langhorst H, Kusche-Vihrog K, et al. Characterization of the epithelial sodium channel delta-subunit in human nasal epithelium. Am J Respir Cell Mol Biol 2010; 42(4):498–505. [16] Gharavi ALR. The inherited basis of blood pressure variation and hypertension. In: Valle DBA, Vogelstein B, Kinzler KW, Antonarakis SE, Bellabio A, Gibson K, Mitchell G, editors. OMMBID — The Online Metabolic and Molecular Bases of Inherited Diseases. New York, NY: McGraw-Hill; 2013. [17] Su YR, Menon AG. Epithelial sodium channels and hypertension. Drug Metab Dispos 2001;4(Pt 2):553–6. [18] Hopf A, Schreiber R, Mall M, Greger R, Kunzelmann K. Cystic fibrosis transmembrane conductance regulator inhibits epithelial Na+ channels carrying Liddle's syndrome mutations. J Biol Chem 1999;274:13894–9. [19] Kerem E, Bistritzer T, Hanukoglu A, Hofmann T, Zhou Z, Bennett W, et al. Pulmonary epithelial sodium channel dysfunction and excess airway liquid in pseudohypoaldosteronism. N Engl J Med 1999;341: 156–62. [20] Mall M, Grubb BR, Harkema JR, O'Neal WK, Boucher RC. Increased airway epithelial Na+ absorption produces cystic fibrosis-like lung disease in mice. Nat Med 2004;10(5):487–93.

Please cite this article as: Brennan M-L, et al, Assessment of epithelial sodium channel variants in nonwhite cystic fibrosis patients with non-diagnostic CFTR genotypes, J Cyst Fibros (2015), http://dx.doi.org/10.1016/j.jcf.2015.04.001

8

M.-L. Brennan et al. / Journal of Cystic Fibrosis xx (2015) xxx–xxx

[21] Kimura T, Kawabe H, Jiang C, Zhang W, Xiang Y-Y, Lu C, et al. Deletion of the ubiquitin ligase Nedd4L in lung epithelia causes cystic fibrosis-like disease. Proc Natl Acad Sci U S A 2011;108(8):3216–21. [22] Stanke F, Becker T, Cuppens H, Kumar V, Cassiman J-J, Jansen S, et al. The TNFalpha receptor TNFRSF1A and genes encoding the amiloridesensitive sodium channel ENaC as modulators in cystic fibrosis. Hum Genet 2006;119(3):331–43. [23] Sheridan MB, Fong P, Groman JD, Conrad C, Flume P, Diaz R, et al. Mutations in the beta-subunit of the epithelial Na+ channel in patients with a cystic fibrosis-like syndrome. Hum Mol Genet 2005;14(22):3493–8. [24] Fajac I, Viel M, Sublemontier S, Hubert D, Bienvenu T. Could a defective epithelial sodium channel lead to bronchiectasis. Respir Res 2008;9:46. [25] Fajac I, Viel M, Gaitch N, Hubert D, Bienvenu T. Combination of ENaC and CFTR mutations may predispose to cystic fibrosis-like disease. Eur Respir J 2009;34(3):772–3. [26] Viel M, Leroy C, Hubert D, Fajac I, Bienvenu T. ENaCbeta and gamma genes as modifier genes in cystic fibrosis. J Cyst Fibros 2008;7(1):23–9. [27] Mutesa L, Azad AK, Verhaeghe C, Segers K, Vanbellinghen JF, Ngendahayo L, et al. Genetic analysis of Rwandan patients with cystic fibrosis-like symptoms: identification of novel cystic fibrosis transmembrane conductance regulator and epithelial sodium channel gene variants. Chest 2009;135(5):1233–42. [28] Azad AK, Rauh R, Vermeulen F, Jaspers M, Korbmacher J, Boissier B, et al. Mutations in the amiloride-sensitive epithelial sodium channel in patients with cystic fibrosis-like disease. Hum Mutat 2009;30(7): 1093–103. [29] Ramos MM, Trujillano DD, Olivar RR, Sotillo F, Ossowski S, Manzanares J, et al. Extensive sequence analysis of CFTR, SCNN1A, SCNN1B, SCNN1G and SERPINA1 suggests an oligogenic basis for cystic fibrosis-like phenotypes. Clin Genet 2014;86(1):91–5. [30] Rauh R, Diakov A, Tzschoppe A, Korbmacher J, Azad AK, Cuppens H, et al. A mutation of the epithelial sodium channel associated with atypical

[31]

[32]

[33]

[34] [35]

[36]

[37] [38]

[39]

[40]

cystic fibrosis increases channel open probability and reduces Na+ self inhibition. J Physiol 2010;588(Pt 8):1211–25. Rauh R, Soell D, Haerteis S, Diakov A, Nesterov V, Krueger B, et al. A mutation in the β-subunit of ENaC identified in a patient with cystic fibrosis-like symptoms has a gain-of-function effect. Am J Physiol Lung Cell Mol Physiol 2013;304(1):L43–55. Dequeker E, Sturhmann M, Morris MA, Casals T, Castellani C, Claustres M, et al. Best practice guidelines for molecular genetic diagnosis of cystic fibrosis and CFTR-related disorders — updated European recommendations. Eur J Hum Genet 2009;17:51–65. Spencer DA, Venkataraman M, Higgins S, Stevenson K, Weller PH. Cystic fibrosis in children from ethnic minorities in the West Midlands. Respir Med 1994;88(9):671–5. Campbell III PW, White TB. Newborn screening for cystic fibrosis: an opportunity to improve care and outcomes. J Pediatr 2005;147(3 Suppl.):S2–5. Amato F, Bellia C, Cardillo G, Castaldo G, Ciaccio M, Elce A, et al. Extensive molecular analysis of patients bearing CFTR-related disorders. J Mol Diagn 2012;14(1):81–9. Grosse SD, Rosenfeld M, Devine OJ, Lai HJ, Farrell PM. Potential impact of newborn screening for cystic fibrosis on child survival: a systematic review and analysis. J Pediatr 2006;149(3):362–6. Cystic Fibrosis Foundation Patient Registry. Annual data report to the center directors; 2011(Bethesda, Maryland). Hamosh A, FitzSimmons SC, Macek Jr M, Knowles MR, Rosenstein BJ, Cutting GR. Comparison of the clinical manifestations of cystic fibrosis in black and white patients. J Pediatr 1998;132(2):255–9. Almaca J, Faria D, Sousa M, Uliyakina I, Conrad C, Sirianant L, et al. High-content siRNA screen reveals global ENaC regulators and potential cystic fibrosis therapy targets. Cell 2013;154(6):1390–400. Garland AL, Walton WG, Coakley RD, Tan CD, Gilmore RC, Hobbs CA, et al. Molecular basis for pH-dependent mucosal dehydration in cystic fibrosis airways. Proc Natl Acad Sci U S A 2013;110(40):15973–8.

Please cite this article as: Brennan M-L, et al, Assessment of epithelial sodium channel variants in nonwhite cystic fibrosis patients with non-diagnostic CFTR genotypes, J Cyst Fibros (2015), http://dx.doi.org/10.1016/j.jcf.2015.04.001