Assessment of genetic diversity, genetic relationship and bottleneck using microsatellites in some native Turkish goat breeds

Small Ruminant Research 105 (2012) 53–60

Contents lists available at SciVerse ScienceDirect

Small Ruminant Research journal homepage: www.elsevier.com/locate/smallrumres

Assessment of genetic diversity, genetic relationship and bottleneck using microsatellites in some native Turkish goat breeds夽 Özgecan Korkmaz A˘gao˘glu a,∗ , Okan Ertu˘grul b a b

Department of Animal Science, Faculty of Veterinary Medicine, Mehmet Akif Ersoy University, Burdur, Turkey Department of Genetics, Faculty of Veterinary Medicine, Ankara University, Ankara, Turkey

a r t i c l e

i n f o

Article history: Received 5 April 2011 Received in revised form 6 December 2011 Accepted 9 December 2011 Available online 11 January 2012 Keywords: Native Turkish goat breeds Microsatellites Genetic diversity Population structure Bottleneck

a b s t r a c t Genetic diversity, genetic relationship and bottleneck were evaluated in 5 native Turkish goat breeds (Angora, Kilis, Honamli, Hair and Norduz goat breeds) using 20 microsatellite markers. In order to investigate the genetic characterization of these goat breeds, this study was carried out with 20 different microsatellite markers in 4 different multi-locus polymerase chain reaction (PCR) systems. Twenty microsatellite loci analyses revealed that the average number of alleles per locus (15.65 allele/locus) and levels of heterozygosity (0.5192–0.9400) were fairly high. The calculated overall FIS value for all populations was 0.03656 ± 0.033 and it was not significant. All the populations were in the Hardy–Weinberg equilibrium. According to FST values, a medium level of genetic diversity was found between the Angora goat breed and other breeds. Among the other breeds, genetic diversity was low and this diversity was statistically significant. All loci were polymorphic in all populations. Results of various analyses, such as allelic variation analysis, heterozygosity analysis, F statistics, STRUCTURE test and factorial correspondence analysis, indicated that the Angora goat breed is different than the other goat breeds. Furthermore, analysis showed that the other native goat breeds could not be distinguished from each other; these breeds were grouped together. Non-significant heterozygote excess on the basis of the TPM model, as revealed from the Wilcoxon signed-rank tests, along with a normal ‘L’-shaped distribution of mode-shift test, indicated no bottleneck in Angora, Kilis, Honamli, Hair and Norduz goat populations. The results obtained from the analysis of 20 microsatellite loci indicated that goat breeds other than the Angora goat breed cannot be genetically distinguished from each other. © 2011 Elsevier B.V. All rights reserved.

1. Introduction Goats (Capra hircus) are an important domestic animal because they were one of the first animal species to be domesticated (Luikart et al., 2001; Fernandez et al., 2006) and because of their ability to rapidly adapt to different environmental conditions. These characteristics also make

夽 This paper is a summary of the PhD thesis by Özgecan Korkmaz A˘gao˘glu. ∗ Corresponding author. Tel.: +90 248 2132074; fax: +90 248 2132001. E-mail addresses: [email protected] (Ö. Korkmaz A˘gao˘glu), [email protected] (O. Ertu˘grul). 0921-4488/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.smallrumres.2011.12.005

the species important from an economic standpoint. Goat breeding is one of the most important agricultural activity and source of livelihood in rural areas in Turkey (Ertu˘grul et al., 1995). There is no systematic program of selection applied in native Turkish goat breeds. Goat breeding is an important and widespread economic activity in southeastern Anatolia, the mountainous area of Mediterranean and the rural areas of Central Anatolia in Turkey. The reason is that these regions are areas in Turkey that are developing economically. Native goat breeds in Turkey include the Angora, Kilis, Honamli, Hair and Norduz goat breeds (Akc¸apınar, 1994). The Hair goat is the most widespread goat breed in Turkey (81%) and they have been raised all over Anatolia (Yalc¸ın, 1990). Angora (2.42%), Kilis (2%),

54

Ö. Korkmaz A˘gao˘glu, O. Ertu˘grul / Small Ruminant Research 105 (2012) 53–60

Honamli and Norduz goat breeds have small populations in Turkey. The Hair goat is raised over a large geographical area that includes the Mediterranean region, the Aegean region and Southeastern Anatolia in Turkey. This breed is also raised in Iran, Afghanistan and Arabia. Females have elegantly backward-curved horns and males have large, strong curved horns. The wither height of females is about 67 cm, while males are about 70 cm (Akc¸apınar, 1994; TAGEM, 2009). The Hair goat usually has a black coat and horns. It is called the “black goat” in Turkey. Its hair is coarse, long and without undulation (TAGEM, 2009). The Angora goat is raised in Ankara, central Anatolia and some provinces of eastern Anatolia. The Angora goat originates in Ankara. Angora goats were raised in Turkey as early as 2400 B.C. (Akıncı, 1924). Several sources report Central Asia as the area of origin for this goat breed (Ryder, 2001; Hayes, 2009). Both male and female goats in this breed have horns. The female goat usually has short curved horns, while the male goat has large, strong, curved horns. The wither height of females is about 55 cm, while males are about 66 cm (Akc¸apınar, 1994; TAGEM, 2009). The most important yield of this breed is “mohair”, the name for fleece taken from Angora goats. Mohair is lustrous, silverwhite in color, and consists of long, strong, uniform fibers (Batu, 1940; Van der Westhuysen et al., 1981; Shelton, 1981). The Kilis goat is raised in the provinces of Kilis and Gaziantep in the southern Anatolian region of Turkey. Most male and female goats have horns, but sometimes they have no horns. The wither height of females about 67 cm, while males are about 70 cm (Akc¸apınar, 1994; TAGEM, 2009). The Kilis goat is the most important goat breed for milk yield in Turkey. Kilis is the name of a province in Turkey where this goat is raised most frequently. This breed has very long, pendulous ears. Their hair is straight, long and coarse (TAGEM, 2009). Kilis goats were formed by crossing the native Hair goat breed raised in Turkey with Syrian Damascus (Yalc¸ın, 1986). The Honamli goat breed is raised in the provinces of Burdur, Isparta and Antalya in the Mediterranean region of Turkey. Females have elegant backward-curved horns and males have curved horns with an axis of varying degrees. The wither height of females is about 67 cm, while males are about 70 cm (Akc¸apınar, 1994; TAGEM, 2009). The Honamli goat breed is valuable in Turkey for its cultural value. This breed is raised by traditional nomadic Turks called the “Yörüks”. This goat breed is raised in the “Teke Region”, which includes Antalya, Burdur, Isparta and the Taurus Mountains. In this goat breed, the lower jaw is longer than the upper jaw. They have an impressive convex nose. Both male and female goats have horns. The Norduz goat breed comes from the Gurpinar district of Van province in eastern Anatolia. Females usually have no horns. Males have long erect horns. The wither height of females is about 67 cm, while males are about 70 cm (Akc¸apınar, 1994; TAGEM, 2009). It is believed that this breed was brought to the Norduz area from northern Iraq 250–300 years ago. Males have horns, while females are hornless (Das¸kıran et al., 2004). In addition, Norduz goats bred in the eastern Anatolia region emerged as a result of hybridization between the Morghoz goat breed and native Turkish goat breeds. The Kilis, Honamli, Hair and Norduz goat breeds have some

phenotypic similarities, but the Angora goat breed is different. Molecular genetics characterization with adequate number of microsatellite loci has not yet been done for these breeds. Hence, it is essential to genetically characterize and describe the genetic diversity of these native breeds. Of the available markers, microsatellites are the markers of choice for assessing genetic characterization because of their characteristics and ease of application. Microsatellite loci should meet certain criteria, such as being on different chromosome regions (Dixit et al., 2008), having high polymorphic properties (Dixit et al., 2008), having high levels of heterozygosity (Qi et al., 2009), having four or more alleles (Barker, 1994), and being recommended by ISAG and FAO (Dixit et al., 2008; Qi et al., 2009). These features have been taken into consideration in this study as well. Many studies (Dalvit et al., 2008; Chaudhari et al., 2009) have been conducted to investigate the genetic diversity of farm animals, namely cattle and sheep, but studies on the genetic diversity of goat breeds are only recently being done in greater numbers. Some Turkish goat breeds have been used in different studies (Luikart et al., 1999; Canon et al., 2006), but those studies either had a low number of samples or they had less than 20 microsatellite loci. Furthermore, new studies on genetic diversity that included these goat breeds have become more interesting to the scientific world because the earlier studies did not evaluate any breeds specific to Turkey, such as the Norduz goat, and because Anatolia is geographically close to major domestication centers. Turkey has rich genetic diversity because it is located between the continents of Europe, Asia and Africa and functions as a bridge between them. Goat stock in Turkey numbered around 6,293,233 head (TUIK, 2011), which is almost 20% of small ruminants in Turkey. However, the number of goats has decreased dramatically since the 1990s (TUIK, 2011). The first step for the conservation and exploitation of domestic animal biodiversity is comprehensive knowledge of the existing genetic variability and how this variability is divided among breeds (Iamartino et al., 2005). For this reason, it is important and urgent to determine the genetic diversity of native Turkish goat breeds. The purpose of this study was to use 20 microsatellite markers to determine genetic diversity, genetic relationships and bottleneck in 5 native goat breeds raised in Turkey (Angora, Kilis, Honamli, Hair and Norduz goat breeds). The goal of this trial was to contribute to population genetics studies in Turkey using microsatellite markers and to make sure the method can be executed in the laboratory. The goal was also to achieve preliminary molecular identification using 20 microsatellite markers on the primary DNA gene bank, which was created by TURKHAYGEN-I project staff and which contains most of the native Turkish animal genetic resources. 2. Material and methods 2.1. Samples A total of 251 blood samples were collected from 5 different goat breeds in natural habitats. The sample size for each breed was: 50 Angora goats (24 different flocks and 18 different villages), 51 Kilis goats (37

Ö. Korkmaz A˘gao˘glu, O. Ertu˘grul / Small Ruminant Research 105 (2012) 53–60

55

Fig. 1. Map of Turkey showing locations for animal sampling: yellow indicates the Angora goat breed, blue indicates the Kilis goat breed, green indicates the Honamli goat breed, white indicates the Hair goat breed, and pink indicates the Norduz goat breed. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.) different flocks and 24 different villages), 49 Honamli goats (14 different flocks and 6 different villages), 52 Hair goats (32 different flocks and 7 different villages) and 49 Norduz goats (17 different flocks and 5 different villages). To represent the genetic diversity in a reliable manner, samples from the breeds were collected from different zones. The goats were not blood related (according to animal pedigrees and breeders informations). Breed properties were taken into consideration and geographical locations were also properly recorded. Blood samples collected from the goat breeds were placed into an EDTA tube for DNA isolation. Genomic DNA was extracted from 10 ml blood samples using the standard phenol chloroform method (Sambrook et al., 1989) (Fig. 1). 2.2. Molecular techniques To generate data, a set of 20 microsatellite markers (Table 1) were selected based on the guidelines of ISAG and FAO’s Domestic Animal Diversity Information System-Measurement of Domestic Animal Diversity (DADIS-MoDAD) program. The PCR mix was subjected to an initial denaturation at 95 ◦ C for 5 min, followed by 35 cycles of 30 s at 94 ◦ C, 45 s at 58 ◦ C (for Set I and Set II), 57.9 ◦ C (for Set III) or 60 ◦ C (for Set IV) and 1.5 min at 72 ◦ C with a final extension of 20 min at 72 ◦ C using the Mastercycler thermal cycler (Eppendorf). Set I, Set II and Set III had 5 loci whereas Set IV had 4 loci. However, Set IV was loaded on a fragment analysis system with loci BM1818 (multiplex + coloading) (Korkmaz A˘gao˘glu et al., 2010, 2011). The PCR of BM1818 was subjected to an initial denaturation at 94 ◦ C for 4 min, followed by 30 cycles of 30 s at 94 ◦ C, 30 s at 58 ◦ C and 30 s at 72 ◦ C with a final extension of 15 min at 72 ◦ C. Two microliters of multiplex PCR products were mixed with 0.5 ␮l of CEQ-Size Standard (Beckman Coulter) and 37.5 ␮l of SLS (sample loading solution) (Beckman Coulter) and subjected to capillary electrophoresis. Fragments were resolved on a Beckman Coulter CEQ-8000 Genetic Analyser (Frag Test 3: 2 min denaturation at 90 ◦ C, injection at 2.0 kV for 30 s, capillary temperature of 50 ◦ C and 6 kV separation for 35 min) and the collected data were analyzed using a CEQ fragment analysis program.

equilibrium (HWE), genetic distances (Nei et al., 1983), phylogenetic tree (Nei et al., 1983), factorial correspondence analysis (Lebart et al., 1984), the STRUCTURE test (Pritchard et al., 2000), and the Bottleneck test (Cornuet and Luikart, 1996). nA, the frequencies of alleles, Ho and He, Wright’s F-statistics, genetic distances and the Hardy–Weinberg equilibrium were calculated using a program called Genetix (v4.05) (Belkhir et al., 2004), while PIC was calculated using PowerStats V12 (Brenner and Morris, 1990). Factorial correspondence analysis (Lebart et al., 1984) was performed to test the possible admixtures that occurred between the populations using the “AFC sur populations” module of the GENETIX v4.05 software (Belkhir et al., 2004). An NJ tree was constructed with Population 1.2 (Langella, 1999) software. Bootstrap resampling (n = 1000) was performed to test dendrogram robustness. A genetic structure of the population was performed using a program called STRUCTURE (Pritchard et al., 2000). STRUCTURE (Pritchard et al., 2000) was also used to ascertain possible genetic structures in the analyzed dataset. The program uses the Markov Chain Monte Carlo method to estimate the natural logarithm of the probability that a given genotype X is part of a given population K (ln Pr(X|K)). The analysis was carried out with 20 runs per K to identify the most likely number of clusters present in the dataset. All runs used a burn-in period of 100,000 iterations and a data collection period of 100,000 iterations under an admixture model with allele frequencies correlated. Lastly, the bottleneck hypothesis was investigated using Bottleneck v1.2.02 (Cornuet and Luikart, 1996). TPM and the Wilcoxon signed-rank test were used to determine the bottleneck. The Wilcoxon test provides relatively high power and it can be used with as few as four polymorphic loci and any number of individuals (15–40 individuals and 10–15 polymorphic loci is recommend to achieve high power). Mutations for microsatellite loci generally do not appear to be consistent with either the IAM or the SMM. As a result, Di Rienzo et al. (1994) suggested TPM. It has been reported that the TPM model is more suitable for microsatellite data (Luikart et al., 1998) and that the Wilcoxon signed-rank test achieves high statistical power even for fewer loci (a minimum of 4) and for 15–20 individuals (Fatima, 2006).

2.3. Statistical analysis

3. Result and discussion The following were calculated for each of the 20 microsatellite loci analyzed: the number of alleles (nA) and frequencies of alleles, observed (Ho) and expected heterozygosity (unbiased – He, Hnb) (Nei, 1978), Wright’s F-statistics (Weir and Cockerham, 1984), polymorphic information content (PIC) (Botstein et al., 1980), Hardy–Weinbergp

All microsatellite markers used in this study were successfully amplified in four multiplex sets designed with consideration for annealing temperature, product size and

56

Ö. Korkmaz A˘gao˘glu, O. Ertu˘grul / Small Ruminant Research 105 (2012) 53–60

Table 1 Primer sequences and variability parameters in native Turkish goat breeds. Loci

Primer (5 → 3 )

Allele size (bp)

NAa

Hnb

Ho

PICb

BM1818

AGC TGG GAA TAT AAC CAA AGG AGT GCT TTC AAG GTC CAT GC GGACTTGCCAGAACTCTGCAAT CACTGTGGTTTGTATTAGTCAGG CTG CCA ATG CAG AGA CAC AAG A GTC TGT CTC CTG TCT TGT CAT C GCT TGC TAC ATG GAA AGT GC CTA AAA TGC AGA GCC CTA CC CTGCAGTTCTGCATATGTGG CTTAGACAACAGGGGTTTGG CAA TCT GCA TGA AGT ATA AAT AT CTT CAG GCA TAC CCT ACA CC GAGTAGAGCTACAAGATAAACTTC TAACTACAGGGTGTTAGATGAACT AAAGGCCAGAGTATGCAATTAGGAG CCACTCCTCCTGAGAATATAACATG CACGGAGTCACAAAGAGTCAGACC GCAGGACTCTACGGGGCCTTTGC TACTAAAGAAACATGAAGCTCCCA GGAAACATTTATTCTTATTCCTCAGTG GCTGAACAATGTGATATGTTCAGG GGGACAATACTGTCTTAGATGCTGC GGAAAACCCCCATATATACCTATAC AAATGTGTTTAAGATTCCATACATGTG GAGTTAGTACAAGGATGACAAGAGGCAC GACTCTAGAGGATCGCAAAGAACCAG CCC TAG GAG CTT TCA ATA AAG AAT CGG CGC TGC TGT CAA CTG GGT CAG GG TGC AAG AAG TTT TTC CAG AGC ACC CTG GTT TCA CAA AAG G GGACTCTACCAACTGAGCTACAAG TGAAATGAAGCTAAAGCAATGC TGCGGTCTGGTTCTGATTTCAC GTTTCTTCCTGCATGAGAAAGTCGATGCTTAG CTTTACTTCTGACATGGTATTTCC TGCCACTCAATTTAGCAAGC TGAACGGGTAAAGATGTG TGTTTTTAATGGCTGAGTAG GCTTTCAGAAATAGTTTGCATTCA ATCTTCACATGATATTACAGCAGA –

226–270

14

0.8526

0.8327

0.83

217–249

16

0.8617

0.8487

0.84

266–302

19

0.9046

0.8400

0.89

265–283

10

0.7589

0.7697

0.72

150–180

16

0.8513

0.7810

0.83

127–145

9

0.6351

0.6145

0.57

193–217

14

0.8754

0.8691

0.86

116–168

21

0.8445

0.8166

0.82

132–158

12

0.8318

0.8218

0.80

114–150

16

0.8373

0.8244

0.81

104–132

15

0.8540

0.8520

0.83

88–124

13

0.7598

0.6822

0.72

136–170

13

0.8358

0.8396

0.81

124–178

24

0.7750

0.7449

0.75

118–160

19

0.7883

0.7331

0.75

158–182

13

0.8538

0.8284

0.83

210–242

16

0.7815

0.7290

0.75

158–230

14

0.7280

0.7057

0.69

76–118

19

0.8505

0.8238

0.83

102–168

20

0.7979

0.7338

0.77

15,65

0.8139

0.7846

0.78

CSRD247 HSC ILSTS11 ILSTS30 INRA005 INRA23 MAF65 MAF70 OARAE54 OARCP34 OARFCB20 OARFCB48 OARFCB304 SRCRSP1 SRCRSP5 SRCRSP8 SRCRSP15 SRCRSP23 TGLA53 Ort. a b

–

Number of alleles. Polymorphic information content.

Beckman Coulter for a specific dye label (Korkmaz A˘gao˘glu et al., 2010, 2011) in all breeds, and with high polymorphism. Similar multiplex systems for goat breeds were demonstrated by Luikart et al. (1999) using 22 microsatellites (6 different multiplex sets) for parentage testing in Mongolian Cashmere, Angora, Saanen and MurcianaGrenadina breeds. Fatima et al. (2008) used two multiplex systems with 18 microsatellites (Set I: 7 microsatellites, Set II: 11 microsatellites) to assess genetic variability and possible bottlenecks, and to estimate genetic distances between Gohilwadi, Zalawadi and Surti goat breeds. In this study, a total of 313 alleles were observed. Table 1 shows the observed number of alleles as well as observed and expected heterozygosities for all the populations. Private alleles were also found in all breeds but their frequencies were much lower. The average number of alleles per locus was 15.65, ranging from 9 (INRA005) to 24 (OARFCB304). In native Turkish goat breeds, the number of observed alleles varied from 10.45 (Honamli goat breed) to 11.8 (Angora goat breed). The values were higher than observed in goat

breeds from the Czech Republic (Jandurová et al., 2004) and in Egyptian and Italian goat breeds (Agha et al., 2008). It is also higher than the values reported for other Indian, Chinese and Swiss goat breeds (Fatima et al., 2008; Qi et al., 2009; Glowatzki-Mullis et al., 2008). In this study, the high number of alleles is indicative of polymorphism and the chosen loci were sufficient for assessing genetic diversity. In previous years, both archaeological and genetic studies on goat breeds have reported that Anatolia has been a center for domestication (Bruford et al., 2003). In addition, agricultural people may have taken goats with them during migration from Asia to Europe and other regions of Anatolia regions. Among native Turkish goat breeds, the Angora goat breed had the highest average number of alleles, whereas the Honamli goat breed had the lowest average number of alleles. The Angora goat breed originated from domesticated areas in the Central Asia, according to information in the literature (Ryder, 2001; Hayes, 2009). In addition, that goat breed was raised solely in central Anatolia. The Honamli goat breed was bred in south Anatolia. One of

Ö. Korkmaz A˘gao˘glu, O. Ertu˘grul / Small Ruminant Research 105 (2012) 53–60

57

Table 2 Estimated pairwise FST as a measure of genetic differentiation (above diagonal) and Nei’s (Nei et al., 1983) standard genetic distance (below diagonal) in native Turkish goat breeds. Angora goat Angora goat Kilis goat Honamli goat Hair goat Norduz goat ***

– 0.1520 0.1589 0.1481 0.1570

Kilis goat ***

0.05734 – 0.0813 0.0643 0.0712

Honamli goat ***

0.05788 0.01382*** – 0.0587 0.0803

Hair goat ***

0.05790 0.01025*** 0.00492*** – 0.0592

Norduz goat 0.06196*** 0.01059*** 0.01470*** 0.00587*** –

(P < 0.001).

the reasons is that the Honamli goat breed is a local breed. Another reason is the hybridization and breeding programs that were implemented. The average observed heterozygosity between the populations was 0.78. The average heterozygosity observed was 0.776, 0.780, 0.792, 0.779 and 0.794 for Angora, Kilis, Honamli, Hair and Norduz goat breeds, respectively. The observed mean genetic heterozygosity (0.78) in this study was higher than that reported for the Kutchi breed of goat (0.59) (Dixit et al., 2008), the Gohilwari breed of Indian goat (0.505) (Kumar et al., 2009) and the Gujarat (India) goat breed (0.61) (Fatima et al., 2008). The statistical evaluation of informativeness of a marker is defined by PIC values, which varied between 0.57 (INRA005) and 0.89 (HSC) with a mean PIC of 0.78 across the populations. The mean PIC values were 0.79, 0.78, 0.79, 0.78 and 0.78 for Angora, Kilis, Honamli, Kilis and Norduz populations, respectively. Genetic markers exhibiting PIC values higher than 0.5 are considered to be informative in genetic population analysis (Botstein et al., 1980). For this reason, genetic diversity studies may prefer these loci. The Wright’s F-statistics for each breed and the genetic distance between populations were as shown in Table 2. FIS was calculated from the data values and the values were between 0.01621 and 0.04951. The calculated overall FIS value for all populations was 0.03656 ± 0.033 and it was not significant. All the populations were in the Hardy–Weinberg equilibrium. Additionally, the calculated FST value was 0.03005, which was statistically significant (P < 0.001). According to FST values, a medium level of genetic diversity was found between the Angora goat breed and other breeds. Among the other breeds, genetic diversity was low and this level of diversity was statistically significant. The genetic distance ranged from 0.0587 to 0.1589. The lowest genetic distance (0.0587) was between the Honamli goat breed and the Hair goat breed. The Honamli and Hair goat breeds are bred in regions that are close to each other geographically. The Angora goat breed had the highest genetic distance from other goat breeds. According to Nei’s DA genetic distance values, the highest level of genetic distance was found between the Angora goat breed and other breeds. An NJ topology tree based on Nei DA (Nei et al., 1983) describing genetic distance for the 5 goat populations in this study has been presented in a non-graphic format. This result is compatible with the other test results. Population structure and degree of admixture were assessed with STRUCTURE. The analysis was carried out with 20 different runs from K = 1 to K = 12 to identify the most likely number of clusters present in the dataset. All runs used a burn-in period of 100,000 iterations and a data

collection period of 100,000 iterations. In K = 5, across-runs average ln Pr(G|K) was maximized and also mean variance of the ln Pr(G|K) estimates was the lowest. For STRUCTURE analysis, the most appropriate number of clusters for modeling the data was five. The Angora goat breed was grouped in its own cluster with an estimated membership >0.800. However, the other goat breeds did not completely form their own cluster (<0.500). The program STRUCTURE was then run again. The most likely K was 5, which is consistent with the overall analysis (Fig. 2). The axes in the FCA test also indicated that the Angora goat breed is grouped separately from the other breeds. The native Turkish goat breeds (except for Angora) are not completely separated from each other. The result of this analysis is similar to those obtained from other analyses (Fig. 3). The two phase mutation model under Wilcoxon’s signed rank test and shift mode test were used to investigate any recent bottleneck (heterozygosity excess) in native Turkish goat populations. In a population at mutation-drift equilibrium, there is approximately an equal probability that a locus shows genetic diversity excess or deficit. Wilcoxon’s signed rank test was used for evaluating bottleneck because of its relatively high statistical power (Luikart and Cornuet, 1998). Furthermore, it is generally more useful than other tests because it is the most powerful and robust when used with a small number (<20) of polymorphic loci (Piry et al., 1999), because it can be used with as few as four polymorphic loci and any number of individuals (15–40 individuals and 10–20 polymorphic loci is recommended to achieve high power). In this study, 20 loci and almost 50 individuals from each of five breeds were used. The excess heterozygosity obtained (Table 3) was not significant (P < 0.5) in the five populations using a two phase mutation model (Fig. 4).

Fig. 2. Bar representation of the STRUCTURE analysis of native Turkish goat breeds. The analysis was carried out with 20 different runs from K = 1 to K = 12 to identify the most likely number of clusters present in the dataset. The most likely K was 5.

58

Ö. Korkmaz A˘gao˘glu, O. Ertu˘grul / Small Ruminant Research 105 (2012) 53–60

Fig. 3. Graphic representation of the factorial correspondence analysis of five populations from Turkey.

Glowatzki-Mullis et al. (2008) reported genetic bottleneck in the Valais Blackneck goat breed. Bottleneck has not been reported in Zalawadi and Gohilwadi goat populations, whereas mild bottleneck has been reported recently for the Surti breed by Fatima et al. (2008). Kumar et al. (2009) reported that the Gohilwari breed of goat has not undergone bottleneck according to three different tests and the mode shift test. Dixit et al. (2008) reported that the Kutchi breed of goat has significant deficiency of heterozygosity according to the different tests of bottleneck hypothesis

under TPM and SMM models. The bottleneck test showed that there was significant deficiency of heterozygosity but the suspected genetic bottleneck was found to be absent as the mode-shift curve is a typical “L” shape as described by Gour et al. (2006). It is very important to conserve the genetic resources of seriously bottlenecked populations because such populations may be subject to increased inbreeding depression, loss of genetic variation and fixation of deleterious alleles (Fatima et al., 2008). It is vital that native Turkish goat breeds have high genetic diversity. It

Fig. 4. Graphical representation of proportions of alleles and their distribution in native Turkish goat breeds. These results were consistent with the normal L-shaped distribution of allele frequency in five populations.

Ö. Korkmaz A˘gao˘glu, O. Ertu˘grul / Small Ruminant Research 105 (2012) 53–60 Table 3 Bottleneck analysis for Angora, Kilis, Honamli, Hair and Norduz populations using the Wilcoxon test with a two phase model. Population

MODELa

Wilcoxon test

AFDGb

Angora goat

TPM

Normal

Kilis goat

TPM

Honamli goat

TPM

Hair goat

TPM

Norduz goat

TPM

P 1: 0.66289 P 2: 0.70118 P 1: 0.43474 P 2: 0.86949 P 1: 0.05699 P 2: 0.11399 P 1: 0.31076 P 2: 0.62151 P 1: 0.05270 P 2: 0.10540

Normal Normal Normal Normal

P1, probability (one tail for H excess); P2 (two tail for H excess or deficiency); TPM, two phase model. a Parameters for TPM: variance = 30.00, proportion of SMM = 70.00%, estimation based on 1000 replications. b L-shaped distribution of allele frequency.

is also critical that we respond to the changing demands of world climate change and meet the needs of people involved in animal production, so that we can ensure that domestic goat breeds continue to adapt well to their environment and so we can conserve genetic resources. Unfortunately, the number of native goat breeds is continually decreasing due to numerous factors, including certain procedures performed by breeders in Turkey to increase efficiency (uncontrolled mating etc.), certain breeding programs that have been implemented, population growth, the diminished importance of certain yield factors (such as the yield of Angora goat mohair), and the fact that the value of goats has dropped because they are said to be harmful to forest vegetation. Native Turkish goat breeds have not undergone bottleneck according to the Wilcoxon sink-rank test in TPM and the mode shift test. However, numbers of native Turkish goats (especially the Angora, Honamli and Norduz goat breeds) have decreased significantly in recent years. In this regard, registered breeds should be kept pure, and breeders should be informed about this issue. The data from this study showed that a considerable amount of information regarding genetic diversity and relationships in native Turkish goat breeds can be determined using microsatellite markers recommended by ISAG/FAO. Furthermore, the genetic material stored in the DNA bank made it possible to ascertain molecular characterization through the use of microsatellite markers. Moreover, this data provided important information for conservation programs and could be utilized to define breeding strategies. Acknowledgements This research was supported by the TUBITAK-KAMAG No. 106G005 (117) TURKHAYGEN-I (In Vitro Conservation and Preliminary Molecular Identification of Some Turkish Domestic Animal Genetic Resources-I) project. The authors would like to thank the staff of the TURKHAYGEN-I Project. In addition, the authors are thankful to Associate Professor Galip Kaya, who kindly checked the English grammar of the manuscript.

59

References Agha, S.H., Pilla, F., Galal, S., Shaat, I., D’andrea, M., Reale, S., Abdelsalam, A.Z.A., Li, M.H., 2008. Genetic diversity in Egyptian and Italian goat breeds measured with microsatellite polymorphism. J. Anim. Breed. Genet. 125, 194–200. Akc¸apınar, H., 1994. Kec¸i Yetis¸tiricili˘gi Ders Notu. A.Ü. Veteriner Fakültesi Zootekni Anabilim Dalı. Akıncı, I.A., 1924. Ankara Kec¸isinin Islahi (Improvement of the Angora Goat), I˙ stanbul. Batu, S., 1940. Ankara Kec¸isinin Tarihi ve Mens¸ei Hakkinda bir Tetkik (A study on the history and origin of the Angora goat). Yük. Zir. Enst. C¸alıs¸maları, Ankara. Barker, J.S.F., 1994. A global protocol for determining genetic distance among domestic livestock breeds. In: Proceedings of the 5th World Congress on Genetics Applied to Livestock Production, vol. 21, pp. 501–508. Belkhir, K., Borsa, P., Chikhi, L., Goudet, J., Bonhomme, F., 2004. GENETIX 4.05 WindowsTM Software for Sample Genetics. Genome, Populations, Interactions. University Laboratoire of Montpellier, France, Universite Montpellier II//www.univmontp2.fr/∼genetix/genetix/genetix.htm//December 2004. Botstein, D., White, R.L., Skolnick, M., Davis, R.W., 1980. Construction of a genetic linkage map in man using restriction fregment length polymorphism. Am. J. Hum. Genet. 32, 324–331. Brenner, C., Morris, J., 1990. Paternity index calculations in single locus hypervariable DNA probes: validation and other studies. In: Proceedings for the International Symposium on Human Identification 1989, Promega Corporation, Madison, WI, pp. 21–53. Bruford, M.W., Bradley, D.G., Luikart, G., 2003. DNA markers reveal the complexity of livestock domestication. Nat. Genet. 4, 2–12. Canon, J., Garcia, D., Garcia-Atance, M.A., Obexer-Ruff, G., Lenstra, J.A., Ajmone-Marsan, P., Dunner, S., 2006. Geographical partitioning of goat diversity in Europe and the Middle East. Anim. Genet. 37 (4), 327–334. Chaudhari, M.V., Parmar, S.N.S., Joshi, C.G., Bhong, C.D., Fatima, S., Thakur, M.S., Thakur, S.S., 2009. Molecular characterization of Kenkatha and Gaolao (Bos indicus) cattle breeds using microsatellite markers. Anim. Biodivers. Conserv. 32 (2), 71–76. Cornuet, J.M., Luikart, G., 1996. Description and power analysis of two tests for detecting recent population bottlenecks from allele frequency data. Genetics 144, 2001–2014. Dalvit, C., Sacca, E., Cassandro, M., Gervaso, M., Pastore, E., Piasentier, E., 2008. Genetic diversity and variability in Alpine sheep breeds. Small Ruminant Res. 80, 45–51. Das¸kıran, I˙ ., Cedden, F., Bingöl, M., 2004. Norduz goat of East Anatolia. J. Anim. Vet. Adv. 3 (12), 881–883. Di Rienzo, A., Peterson, A.C., Garza, J.C., Valdes, A.M., Slatkin, M., 1994. Mutational processes of simple sequence repeat loci in human populations. Proc. Natl. Acad. Sci. 91, 3166–3170. Dixit, S.P., Verma, N.K., Ahlawat, S.P.S., Aggarwal, R.A.K., Kumar, S., Chander, R., Singh, K.P., 2008. Molecular genetic characterization of Kutchi breed of goat. Curr. Sci. 95 (7), 946–952. Ertu˘grul, M., Akman, N., Elic¸in, A., Arık, Z., 1995. Küc¸ükbas¸ hayvansal ürünler tüketim projeksiyonları ve üretim hedefleri. In: TMMOB Ziraat Mühendisleri Odası, Türkiye Ziraat Mühendisli˘gi IV, Teknik Kongresi, Ankara, pp. 753–770. Fatima, S., Bhong, C.D., Rank, D.N., Joshi, C.G., 2008. Genetic variability and bottleneck studies in Zalawadi, Gohilwadi and Surti goat breeds of Gujarat (India) using microsatellites. Small Ruminant Res. 77, 58–64. Fatima, S., 2006. Study of genetic variability among Gohilwadi, Surti and Zalawadi Goats using microsatellite analysis. Master of Veterinary Science in Animal Genetics and Breeding. Department of Animal Genetics and Breeding, College of Veterinary Science & Animal Husbandry Anand Agriculture University, Anand. (Master’s Thesis). Fernandez, H., Hughes, S., Vigne, J.D., Helmer, D., Hodgins, G., Miquel, C., Hanni, C., Luikart, G., Taberlet, P., 2006. Divergent mtDNA lineages of goats in an Early Neolithic site, far from the initial domestication areas. PNAS 103, 15375–15379. Glowatzki-Mullis, M.L., Muntwyler, J., Baumle, E., Gaillard, C., 2008. Genetic diversity measures of Swiss goat breeds as decision-making support for conservation policy. Small Ruminant Res. 74, 202–211. Gour, D.S., Malik, G., Ahlawat, S.P.S., Pandey, A.K., Sharma, R., Gupta, N., Gupta, S.C., Bisen, P.S., Kumar, D., 2006. Analysis of genetic structure of Jamunapari goats by microsatellite markers. Small Ruminant Res. 66, 140–149. Hayes, J.L., 2009. The angora goat; its origin, culture and products. In: Mudge, E.R. (Ed.), Report Upon Wool and Manufactures of Wool. BiblioLife, pp. 81–106.

60

Ö. Korkmaz A˘gao˘glu, O. Ertu˘grul / Small Ruminant Research 105 (2012) 53–60

Iamartino, D., Bruzzone, A., Lanza, A., Blasi, M., Pilla, F., 2005. Genetic diversity of Southern Italian goat populations assessed by microsatellite markers. Small Ruminant Res. 57, 249–255. Jandurová, O.M., Kott, T., Kottová, B., Czerneková, V., 2004. Seven microsatellite markers useful for determining genetic variability in White and Brown Short-Haired goat breeds. Small Ruminant Res. 52, 271–274. Korkmaz A˘gao˘glu, Ö., C¸ınar Kul, B., Akyüz, B., Özkan, E., Ertu˘grul, O., Erol, H., 2010. Kec¸i Türünde Mikrosatellit Polimorfizminin Belirlenmesinde Farklı C¸oklu-PZR (Multipleks PCR) Sistemleri. Vet. Hekim. Der. Derg. 81 (2), 21–27. Korkmaz A˘gao˘glu, Ö., C¸ınar Kul, B., Akyüz, B., Özkan, E., Ertu˘grul, O., 2011. Different four PCR-multiplex systems via twenty microsatellite loci in goat. Curr. Opin. Biotechnol. 22 (Suppl. 1), S51. Kumar, S., Dixit, S.P., Verma, N.K., Singh, D.K., Pande, A., Kumar, S., Chander, R., Singh, L.B., 2009. Genetic diversity analysis of the Gohilwari breed of Indian goat (Capra hircus) using microsatellite markers. Am. J. Anim. Vet. Sci. 4 (3), 49–57. Langella, O., 1999. Populations 1.2. 30. A Population Genetic Software. Lebart, L., Morineau, A., Warwick, K., 1984. Multivariant Descriptive Statistical Analysis. John Wiley and Sons, New York, USA. Luikart, G., Allendorf, F.W., Cornuet, J.M., William, B.S., 1998. Distortion of allele frequency distributions provides a test for recent population bottlenecks. J. Hered. 89, 238–247. Luikart, G., Biju-Duval, M.P., Ertugrul, O., Zagdsuren, Y., Maudet, C., Taberlet, P., 1999. Power of 22 microsatellite markers in fluorescent multiplexes for parentage analysis in goats (Capra hircus). Anim. Genet. 30 (6), 431–438. Luikart, G., Cornuet, J.M., 1998. Empirical evaluation of a test for identifying recently bottlenecked populations from allele frequency data. Conserv. Biol. 12 (1), 228–237. Luikart, G., Gielly, L., Excoffier, L., Vigne, J.D., Bouvet, J., Taberlet, P., 2001. Multiple maternal origins and weak phylogeographic structure in domestic goats. Proc. Natl. Acad. Sci. U.S.A. 98, 5927–5932.

Nei, M., 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89, 583–590. Nei, M., Tajima, F., Tateno, Y., 1983. Accuracy of estimated phylogenetic trees from molecular data. J. Mol. Evol. 19, 153–170. Piry, S., Luikart, G., Cornuet, J.M., 1999. Bottleneck: a computer program for detecting recent reductions in the effective size using allele frequency data. J. Hered. 90, 502–503. Pritchard, J.K., Stephens, M., Donnelly, P., 2000. Inference of population structure using multilocus genotype data. Genetics 155, 945–959. Qi, Y., Luo, J., Han, X.F., Zhu, Y.Z., Chen, C., Liu, J.X., Sheng, H.J., 2009. Genetic diversity and relationships of 10 Chinese goat breeds in the Middle and Western China. Small Ruminant Res. 82, 88–93. Ryder, M.L., 2001. Textile fibres from goats. In: Reeve, E.C.R. (Ed.), Encyclopedia of Genetics. Htzroy Dearborn Publishers, USA, pp. 379–381. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular cloning: A laboratory manual, vol. 3., 2nd ed Cold Spring Harbor Laboratory, Cold-Spring Harbor, New York. Shelton, M., 1981. Fiber production. In: Gall, C. (Ed.), Goat Production. Academic Press, London, pp. 379–409. TAGEM, 2009. Türkiye Evcil Hayvan Genetik Kaynakları Tanıtım Katalo˘gu. Ankara. TUIK, 2011. Tarım I˙ statistikleri. http://www.tuik.gov.tr (accessed 20.10.2011.). Van der Westhuysen, J.M., Wentzel, D., Grobler, M.C., 1981. Angora Goats and Mohair in South Africa. Nasionale Koerante Beperk, Port Elizabeth. Weir, B.S., Cockerham, C.C., 1984. Estimating F-statistics for the analysis of population structure. Evolution 38 (6), 1358–1370. Yalc¸ın, B.C., 1986. Sheep and Goats in Turkey. Food and Agriculture Organization of the United Nations, Rome, Italy. Yalc¸ın, B.C., 1990. Koyun Kec¸i Hastalıkları ve Yetis¸tiricili˘gi Kitabı. TÜM VET Hayvancılık Hizmetleri Yayınları 2 (456), Teknografik Matbaası, I˙ stanbul.