Assessment of gold nanoparticle effects in a marine teleost (Sparus aurata) using molecular and biochemical biomarkers

Accepted Manuscript Title: Assessment of gold nanoparticle effects in a marine teleost (Sparus aurata) using molecular and biochemical biomarkers Author: M. Teles C. Fierro-Castro P. Na-Phatthalung A. Tvarijonaviciute T. Trindade A.M.V.M. Soares L. Tort M. Oliveira PII: DOI: Reference:

S0166-445X(16)30149-7 http://dx.doi.org/doi:10.1016/j.aquatox.2016.05.015 AQTOX 4393

To appear in:

Aquatic Toxicology

Received date: Revised date: Accepted date:

24-12-2015 13-4-2016 21-5-2016

Please cite this article as: Teles, M., Fierro-Castro, C., Na-Phatthalung, P., Tvarijonaviciute, A., Trindade, T., Soares, A.M.V.M., Tort, L., Oliveira, M., Assessment of gold nanoparticle effects in a marine teleost (Sparus aurata) using molecular and biochemical biomarkers.Aquatic Toxicology http://dx.doi.org/10.1016/j.aquatox.2016.05.015 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Assessment of gold nanoparticle effects in a marine teleost (Sparus aurata) using molecular and biochemical biomarkers

M. Telesa*, C. Fierro-Castroa, P. Na-Phatthalungb, A. Tvarijonaviciutec, T. Trindadee, A.M.V.M. Soaresd, L. Torta and M. Oliveirad

a

Department of Cell Biology, Physiology and Immunology, Universitat Autònoma de

Barcelona, 08193 Barcelona, Spain b

Department of Microbiology and Excellent Research Laboratory on Natural Products,

Faculty of Science and Natural Product Research Center of Excellence, Prince of Songkla University, Hat Yai, Songkhla 90112, Thailand c

Department of Medicine and Animal Surgery, Universitat Autònoma de Barcelona,

08193 Barcelona, Spain d

Department of Biology & CESAM, University of Aveiro, 3810-193 Aveiro, Portugal

e

Department of Chemistry & CICECO, University of Aveiro, 3810-193 Aveiro, Portugal

*Corresponding author Phone: +34-635847831. E-mail address: [email protected]

1   

Graphical abstract

HIGHLIGHTS • AuNP effects were investigated at molecular and biochemical levels in Sparus aurata. • AuNP coated with PVP exerts more effects than AuNP coated with citrate. • AuNP-PVP induced changes in antioxidant, immune and apoptosis related-genes mRNA levels. • The increase in plasma TOS indicates that AuNP-PVP generates oxidative stress. • AuNP-PVP induced in S. aurata a non-monotonic response pattern. 

ABSTRACT Gold nanoparticles (AuNP) are increasingly employed in a variety of applications and are likely to be increasing in the environment, posing a potential emerging environmental threat. Information on possible hazardous effects of engineered nanoparticles is urgently required to ensure human and environmental safety and promote the safe use of novel nanotechnologies. Nevertheless, there is a lack of comprehensive knowledge on AuNP effects in marine species. The present study aimed to assess AuNP effects in a marine teleost, Sparus aurata, by combining endpoints at different biological levels (molecular and biochemical). For that purpose, fish were exposed via water for 96 h to 4, 80 and 1600 µg.L-1 of AuNP (~40 nm) coated with citrate or polyvinylpyrrolidone (PVP). Results revealed a significant impact of AuNP-PVP in the hepatic expression of antioxidant, immune and apoptosis related genes. Total oxidative status was increased in plasma after exposure to the lowest concentration of AuNP-PVP, although without altering the total antioxidant capacity. Furthermore, AuNP did not induce significant damage in the liver since the activity of neither hepatic indicator (aspartate aminotransferase and alkaline phosphatase) increased. Overall, the present study demonstrated that AuNP, even with a biocompatible coating is able to alter oxidative status and expression of relevant target 2   

genes in marine fish. Another important finding is that effects are mainly induced by the lowest and intermediate concentrations of the PVP coated AuNP revealing the importance of different coatings.

Keywords Gold nanoparticles; Fish; Transcriptional levels; Biochemical; Integrated biomarker response

3   

1. Introduction The novel characteristics specific to engineered nanoparticles (NP) have led to many exciting new applications. Given the increasing widespread production and uses of NP, their entry into water bodies is expected, making coastal environments potential impact zones due to the high population and industrial density in these areas (LaprestaFernández et al., 2012). Consequently, there is also a risk of NPs to human and environmental health (Hansen et al., 2011). Nevertheless, despite the recommendations for critical assessment of European Union and United States policies, comprehensive knowledge on environmental effects of NP is still scarce, resulting in high uncertainty in risk estimation. This gap is partly due to poor physical and chemical characterization of NPs and lack of systematic studies employing endpoints related to their mode of action (Shaw and Handy, 2011). Hence, though inclusion of NPs in the Water Framework Directive has been an issue of debate, with no clear guidelines existing regarding their release into water (Hansen et al., 2011). Among the most used NPs, gold NPs (AuNP) have been employed in high technology applications such as organic photovoltaics, electronic conductors and catalysis, sensory probes, drug delivery and recently in water remediation and aquaculture practices (Rather et al., 2011). Their widespread use has placed them as an emerging environmental threat and led to their inclusion in OECD list of representative manufactured nanomaterials (OECD, 2010). A basic prerequisite for using AuNP is their non-toxic and biocompatible nature for in vitro and in vivo environments, which is an assumption based on the properties of bulk gold that is chemically inert (Alkilany and Murphy, 2010). However, it was recently demonstrated that gold nanorods are able to pass from the water column to the marine food-web, having the capacity to bioaccumulate and induce physiological and biochemical effects (Ferry et al., 2009; Lapresta-Fernández et al., 2012). Despite this, data on AuNP ecotoxicity to aquatic organisms are scarce and most studies deal with regulatory testing in freshwater species using standardized acute toxicity assays (Lapresta-Fernández et al., 2012; Truong et al., 2013). In marine species, studies have been mainly performed with bivalves, which are able to incorporate, and bioaccumulate AuNP, displaying DNA damage, oxidative stress and increased expression of antioxidant genes (García-Negrete et al., 2013; Joubert et al., 2013; Volland et al. 2015). To the authors’ knowledge, a single study has, so far, assessed effects of waterborne exposure to AuNP (AuNP-citrate) to an estuarine fish, Pomatoschistus microps, but at a salinity of 18. P. microps, exposed for 96 h to 0.2 mg.L-1 of 5 nm Au4   

NP-citrate, incorporated gold and displayed a decreased predatory performance at 20 ºC although the same was not observed at 25 ºC (Ferreira et al., 2016). To the best of our knowledge no data are available on AuNP effects in marine fish at higher salinities. Hence, the present study will focus on one of the most commercially important fish species (fishery and aquaculture), the gilthead sea bream (Sparus aurata L.), widespread in Atlantic and Mediterranean coastal waters. It is a top predator and one of the most consumed fish in south Europe. Furthermore, S. aurata has already proved its suitability as a bioindicator in toxicity testing (Del Valls et al., 1998; Teles et al., 2005; Zena et al., 2015).  Over-generation of reactive oxygen species (ROS) and depletion of antioxidant defenses, with consequent oxidative damage to cellular macromolecules, has been hypothesized as a possible explanation for AuNP toxicity (Lapresta-Fernández et al., 2012; Tedesco et al., 2010a, b), although, in some cases, expression of oxidative stressrelated genes has not been affected by AuNP (Dedeh et al., 2015). Nonetheless, the assessment of the balance between overall oxidant and antioxidant defenses can be a valuable tool for evaluating the potential damaging effects of AuNP on fish. The assessment of this balance, by using plasma biomarkers, can be performed without the sacrifice of animals, providing an additional advantage for both ethical and economic reasons. In this regard, esterase activity (EA) can be used as a promising non-specific biomarker of exposure to environmental contaminants. Total oxidant status (TOS) reflects the total oxidant species and it is a valuable tool in the diagnosis of different pathologies (Erel, 2005). On the other hand, TAC (total antioxidant capacity) reflects the global antioxidant status of the organism and it is a marker of the combined effects of the different antioxidants. The analysis of mRNA levels of target genes, assessed with RT-qPCR (reverse transcriptase-quantitative real time PCR), has been used in studies focusing on the modes of action of contaminants, providing insights into the transcriptional networks and affected signaling (Kloas et al., 2009). Moreover, the transcriptional analysis allows the detection of early warning signs of possible damaging effects, since changes at the molecular level occur prior to manifestations at higher levels of biological organization. Nevertheless, to our knowledge, there are no studies concerning AuNP effects at the molecular level in marine fish. The present study aimed to evaluate AuNP effects on S. aurata. For that purpose, fish

were

exposed

to

AuNP

with

different 5 

 

surface

coating

(citrate

and

polyvinylpyrrolidone, PVP). The selection of these two surface coatings was based on their applications in different areas of research and different stability in high ionic strength media (Barreto et al., 2015). AuNP possessing a layer of citrate ions has been shown to have a high rate of cellular uptake compared to conjugated ones, due to the adsorption of serum proteins onto their surface (Chen et al., 2013). PVP has been widely used as a capping/reducing/nucleating agent due to its stabilizing ability, biocompatibility and solubility in various polar solvents (Behera and Ram, 2014). The stability of four housekeeping genes on S. aurata liver was analyzed in order to determine the most appropriate set of housekeeping genes for RT-qPCR data analysis. In order to obtain information on the AuNP modes of action, the transcriptional levels of target genes associated with antioxidant defenses, immune system, cell-tissue repair and apoptosis were measured in the liver. Biochemical biomarkers related to oxidative stress and liver health status were determined in plasma. Plasma reflects the overall physiological status of the animal and has been widely used to diagnose health status in situations of inappropriate feeding, chronic pathology or stress conditions that do not necessarily lead to manifestation of clinical symptoms (Pérez-Sánchez et al., 2013). Liver is the target organ for the majority of xenobiotics having an important role for their metabolism and storage, as well as for the redox metabolism (Prieto et al., 2006). In this regard, these two biological samples were considered candidates for the detection of early warning signs of possible damaging effects of AuNP. Finally, an integrated biomarker approach analysis, combining the biomarkers at the molecular and biochemical levels, was performed to identify early-warning signs of AuNP toxicity.

2. Materials and methods 2.1. Test organisms Gilthead sea bream (S. aurata) specimens of 9±0.5 g (mean ± standard deviation) mass were acquired from an aquaculture in the North of Spain. Once in the laboratory, fish were acclimated to laboratory conditions for three weeks in 250 L aquaria containing aerated and filtered (Eheim filters) artificial saltwater (ASW; Ocean Fish, Prodac) at a salinity of 35, under a photoperiod of 12 h light:12 h dark, at a temperature of 20±1 ºC. Fish were handfed daily with a commercial sea bream diet (Sorgal, Portugal) at a ratio of 1 g per 100 g of fish. Food was withheld 48 h before the beginning of the bioassay. All experimental procedures involving fish were carried out according to the 3 R principles 6   

of Animal Experimentation following Portuguese legislation (authorization N421/2013 of the legal authority “Direção Geral de Veterinária”) that agrees with the International Guiding Principles for Biomedical Research Involving Animals (EU 2010/63). All animal handling was performed with accredited researchers.

2.2. Gold nanoparticle synthesis and characterization Prior to AuNP synthesis, all glass material was washed with aqua regia and later rinsed thoroughly with ultrapure water. AuNPs of approximately 40 nm were prepared by reduction of HAuCl4 by citrate, as described by Lekeufack et al. (2010). After synthesis, all citrate-coated AuNPs (AuNP-citrate) were centrifuged (Sorvall Lynx 4000, Thermo) to remove impurities and resuspended in ultrapure water. The final concentration of AuNP-citrate present in the suspension was determined based on their absorption spectra and sizes (Liu et al., 2007; Paramelle et al., 2014). AuNP-citrate were coated with a PVP layer and quantified as described in Barreto et al. (2016). Characterization of AuNPs was performed by UV-Vis spectrophotometry (Cintra 303, GBC Scientific) and dynamic light scattering (DLS), assessing hydrodynamic size and zeta potential (Zetasizer Nano ZS, Malvern) and by transmission electron microscopy (Hitachi, H9000 NAR). Based on the results obtained by Barreto et al. (2016) with similar AuNPs, and the recognition that intensity and position of the surface plasmon resonance peaks of AuNPs are related to the size, shape and colloidal stability (Pereira et al., 2014), an assay stability test was performed by mixing AuNP suspensions (15 mg.L-1) with ASW in separate tanks, in a ratio of 1:1. surface plasmon resonance was analyzed after 0, 24 and 96h. The ASW used to maintain aquatic organisms in the laboratory has been used to perform toxicity tests with a variety of compounds. ASW was prepared by dissolving the salt in reverse osmosis water until reaching a salinity of 35.

2.3. Fish bioassay The bioassay generally followed fish acute OECD bioassays. All glass material was washed with acid (HNO3 10%) and rinsed in ultrapure water before the experiments. Test solutions (4, 80 and 1600 µg.L-1) of AuNP were prepared by dilution of the stock solutions in artificial saltwater (35 g.L−1). The tested concentrations include one, below a predicted environmental value (including water and soil of 6.13 μg.L−1; Garcia-Negrete et al., 2013) and in the same order of magnitude of the lowest concentrations tested in 7   

studies with bivalves (García-Negrete et al., 2013; Tiede et al., 2009), with 20 fold increases. Ten fish were randomly distributed throughout duplicate 80 L experimental tanks containing 50 L of test solution (5 fish per tank), at 1 g of fish per L of test solution, for 96 h. During the test, photoperiod, temperature and aeration conditions were similar to those used in the acclimation period. Food was withheld during the bioassay. After checking fish mortality and water temperature, salinity, conductivity, pH and dissolved oxygen in the aquaria, 80% of the test media was carefully changed every 24 h, to reduce the build-up of metabolic residues. At the end of the exposure period, seven fish were anesthetized with tricaine methane sulphonate (MS222), and blood quickly collected from the posterior cardinal vein with heparinized syringes. After blood sampling, fish were euthanized by spinal section and the liver was excised, frozen in liquid nitrogen and stored at -80 ºC. Plasma was isolated by centrifugation at 10000 g min for 3 min (Megafuge 8R, Thermo - Heraeus) and stored at -80 ºC until analyses.

2.4. RNA extraction and complementary DNA (cDNA) synthesis Total RNA was extracted from the liver using TRI Reagent (Sigma). The concentration and quality of the RNA were measured using a NanoDropND-1000 Spectrophotometer (Thermo Fisher Scientific, USA). An aliquot of RNA was run on a 1% agarose gel and post-stained with ethidium bromide to verify the RNA integrity. Reverse transcription (RT), to generate cDNA, was performed using 1 g of total RNA, denatured 70 °C, 10 min, Oligo dT15primer (Promega) and SuperScriptTM III Reverse Transcriptase enzyme (Invitrogen), in presence of the recombinant ribonuclease inhibitor RNaseOUTTM (Invitrogen) in a final volume of 20 μl. The resultant cDNA was stored at −20 °C until use. All procedures were performed following the manufacturer’s protocols.

2.5. Transcriptional analysis The GenBank identification, primer sequences and efficiencies are shown in Table 1. This set of genes included markers of: antioxidant status, specifically genes encoding glutathione peroxidase 1 and 4 (GPx1, GPx4), superoxide dismutase [Zn] (SOD2), glutathione reductase (GR), catalase (CAT), glutathione S-transferase 3 (GST3), peroxiredoxin 6 (PRDX6) and metallothionein (MT); cell-tissue repair, including heatshock protein 70 (HSP70) and glucose regulated protein-75 (GRP75); innate immune function, such as interleukin 1β, tumor necrosis factor-α (TNFα), cyclooxygenase 2 (COX2), interleukin 10 (IL10) and transferrin (TF); and apoptosis, namely Bcl-2 8   

associated X protein (BAX) caspase 3 (CASP3). Efficiency of the amplification was determined for each primer pair using serial 5-fold dilutions of pooled cDNA. The efficiency was calculated as E = 10

(-1/s)

where s is the slope generated from the serial

dilutions, when Log dilution is plotted against ΔCT (threshold cycle number) (Pfaffl, 2001). RT-qPCR was performed using iTaqTM Universal SYBR® Green Supermix (BioRad). Reactions were assembled according to manufacturer’s instructions with individual 20 µl reactions consisting of 10µl SYBR® Green PCR master mix (2x), 200 nM primers and 2 µl of cDNA template. All reactions were run in the Bio-Rad CFX384 Real-Time PCR Detection System (Bio-Rad Laboratories, USA), under the protocol: 95 °C for 5 min, 40 cycles of 95 ºC for 30 s, 58 ºC for 30 s, followed by melting curve to verify the amplification of a single product. All samples were run in triplicate. The expression data obtained from three independent biological replicates were used to calculate the threshold cycle (Ct) value. After checking for primers efficiency, RT-qPCR analysis of all the individual samples was determined following the same protocol described above.

2.6. Normalization strategy Accurate normalization is an absolute prerequisite for correct analysis of RTqPCR data. The most commonly used normalization strategy involves standardization to a single constitutively expressed control gene. In recent years, it has become clear that the expression of the housekeeping genes can change, for example between tissues, developmental stages and experimental conditions. Thus, the expression stability of the potential housekeeping gene should be evaluated in each experimental assay (Andersen et al., 2004). In the present study, we used the NormFinder application to evaluate the most appropriate housekeeping gene among four (β-actin, elongation factor-1α - EF1α; 18S ribosomal RNA gene - 18S, and glyceraldehyde 3-phosphate dehydrogenase GADPH). This application is based on an algorithm for identifying the most appropriate normalization gene among a set of candidates. A ranking according to the expression stability of each gene in a given sample set and experimental design is performed. Intraand inter-group variation calculations are another feature of this program (Andersen et al., 2004). According to NormFinder results, the expression of the target genes was normalized using the best combination of two housekeeping genes. Relative gene expression was calculated with the ΔΔCt method including the PCR efficiencies of the target and housekeeping gene according to Pfaffl (2001). 9   

2.7. Biochemical analysis TOS was measured as previously described (Erel, 2005). The method is based on the reaction that the ferric ion makes a colored complex with xylenol orange in an acidic medium. The color intensity, which was measured spectrophotometrically at 560 nm (Olympus Diagnostica, GmbH) using 800 nm as the reference, is related to the total amount of oxidant molecules present in the sample. The assay is calibrated with hydrogen peroxide and the results are expressed in terms of micromol hydrogen peroxide equivalent per litre (μmolH2O2Equiv L-1). Intra- and inter-assay coefficient of variation (CV) was below 3% and 5%, respectively. TAC was determined as described elsewhere (Erel, 2004). The method used was based

on

2,2'-azinobis-(3-ethylbenzothiazoline-6-sulfonate)

decolorization

by

antioxidants according to their concentrations and antioxidant capacities. The color change was measured as a change in light absorbance at 660 nm. For the process, the assay was calibrated with 6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid ((R)(+)-6-hydroxy-2,5,7,8-tetramethylchroman-2-carboxylic acid (Erel, 2004), and the activity was expressed as mmol.L-1. Intra- and inter-assay CV were below 6% and 7%, respectively. EA was measured in plasma using p-nitrophenyl acetate as substrate (Haagen and Brock, 1992). The reaction was monitored at 405 nm. The nonenzymatic hydrolysis of phenyl acetate, which was based on the hydrolysis rate in the absence of sample, was subtracted from the total hydrolysis rate. EA is reported in UI.mL-1. Intra- and inter-assay CV were below 9% and 10%, respectively. Oxidative stress index (OSI) was calculated as the percent ratio of TOS to TAC. OSI (arbitrary units)=TOS (μmol H2O2 Eq.L-1)/TAC (mmol Trolox Eq.L-1) (Esen et al., 2015). Aspartate aminotrasferase (AST) and alkaline phosphatase (ALP) activities were determined using commercially available kits (Olympus Systems Reagents; Olympus life and Material Science Europe GmbH, Hamburg, Germany) following manufacturers indications. Intra- and inter-CV were below 10% in all cases. All parameters were determined with an automatic analyzer (Olympus Diagnostica, GmbH).   2.8. Integrated biomarker response (IBR) 10   

The selected endpoints were combined into one general index termed IBR (Beliaeff and Burgeot, 2002), allowing evaluation of the integrated response of all biomarkers. Considering that the results, directly dependent on the number of biomarkers in the set, obtained values were presented divided by n, as suggested by Broeg and Lehtonen (2006). Results of data standardization procedure needed for IBR calculation were presented in experimental conditions star plots.   2.9. Statistical analysis Results are expressed as mean±SE (standard error). A statistical data analysis was done using SPSS software 22 (SPSS Inc, IBM, IL, USA). The assumptions of normality and homogeneity of data were verified. One-way analysis of variance (one-way ANOVA) was performed in order to assess significant effects of the two types of AuNP. This analysis was followed by post-hoc Tukey test to signal significant differences between groups (Zar, 1999). Statistically significant differences between groups are denoted with: * vs. control (**P<0.01 and *P<0.05); ▲ AuNP coating (AuNP-citrate vs. AuNP-PVP; ▲▲P<0.01 and ▲P<0.05).

3. Results 3.1. AuNP characterization AuNP synthesized for the present study were characterized in ultrapure water immediately after synthesis. The AuNP-citrate displayed a round shape (Figure 1), and an average size of 37 nm and polydispersity index of 0.3. The zeta potential of these particles in ultrapure water displayed a medium value of – 44.5 mv. After coating with a PVP layer, AuNP displayed an average total size of 50 nm with a polydispersity index of 0.2. With the PVP coating, the zeta potential was altered to -17 mv. In the artificial seawater, contrary to AuNP-citrate, that immediately displayed a change in color to light blue, AuNP-PVP displayed no detectable color alterations. The UV-Vis spectra revealed that AuNP-citrate lost the characteristic plasmon absorption within a few minutes whereas AuNP-PVP maintained the peak position and intensity throughout the 96 h period.

The

DLS

data

revealed

that

AuNP-citrate,

in

ASW,

formed

agglomerates/aggregates with sizes up to 600 nm in the first 24 h with no considerable variation within 96 h, whereas AuNP-PVP maintained the same size range of approximately 50 nm.

11   

3.2. Molecular responses In the present study, the variation of each housekeeping gene in the liver of S. aurata, control or exposed to AuNP (Figure 2), was assessed prior to the analysis of the target genes. According to NormFinder calculations the stability values of the candidate housekeeping genes were: 0.014 for β-actin, 0.018 for EF1α, 0.026 for 18S and 0.024 for GADPH. The most stable gene was β-actin, and thus this gene was considered the best gene to be used in RT-qPCR data analysis. The best combination of two-genes was βactin and GADPH, with a stability value of 0.014. Considering that multiple housekeeping gene approaches are recommended as normalization strategy (Urbatzka et al 2013), in this study, the combination of β-actin and GADPH was used for the calculations. Concerning the expression of target genes associated with antioxidant defenses, we found a significant increase in mRNA abundance of GPx1, CAT and GST3 in the liver of S. aurata after 96 h exposure to 4 and 80 μg.L-1 AuNP-PVP when compared to the control group. Furthermore, GPx1, CAT and GST3 mRNA levels were also significantly higher the groups exposed to 4 and 80 μg.L-1 AuNP-PVP when compared to the groups exposed to the same concentrations of AuNP-citrate (Figure 3). GPx4 presented increased mRNA abundance in the groups exposed to 4 µg.L-1 of both AuNP-citrate and AuNPPVP. However, SOD2 and PRDX6 mRNA levels were at control levels for all tested conditions. GR transcriptional levels were increased only in the group exposed to 4 µg.L1

AuNP-PVP when compared to the control group. MT mRNA abundance was

significantly increased in 4 and 80 µg.L-1 AuNP-PVP exposed groups when compared to the control group. Furthermore, MT transcriptional levels were increased in group exposed to 80 µg.L-1 AuNP-PVP when compared to AuNP coated with citrate. With respect to immune genes, TF showed increased mRNA abundance for 4 and 80 µg.L-1 AuNP-PVP when compared to control (Figure 4). IL10 mRNA levels increased for 4 µg.L-1 AuNP-PVP (vs. control or AuNP-citrate groups). IL1β, TNFα and COX2 mRNA abundance were unaltered, as were HSP70 and GRP75, associated with cell/tissue repair (Figure 5). In terms of genes associated with apoptosis (Figure 6), BAX mRNA levels increased for 4 µg.L-1 AuNP-PVP (vs. control or AuNP-citrate groups). CASP3 showed a significant upregulation in the liver of S. aurata after exposure to 4, 80 µg.L-1 AuNP-PVP (vs. control or AuNP-citrate). Moreover, CASP3 was upregulated in the group exposed to the highest concentration of AuNP-citrate (1600 µg.L-1). The overall S.

12   

aurata mRNA response profile to AuNP is presented in Figure 7, represented as a heatmap.

3.3. Biochemical responses After exposure to 4 µg.L-1 AuNP-PVP a significant increase in plasma TOS was observed, when compared to the control group. Moreover, OSI index was significantly increased for the same condition (Figure 8). TAC and EA activity showed no statistically significant changes among study groups. AST activity was significantly decreased for 80 and 1600 µg.L-1 AuNP-PVP compared to control, while ALP activity was unaltered in the plasma of fish (Figure 9).

3.4. Integrated biomarker response index (IBR) To perform an integrated evaluation of the AuNP effects in S. aurata data were standardized and then an IBR index was calculated and presented as a star plot (Figure 10). The highest IBR values were found for AuNP-PVP, particularly for 4 and 80 µg.L-1, which emphasize that this particular coating induced more alterations in S. aurata than citrate coated. Accordingly, IBR data confirms that AuNP-PVP are inducing more alterations in S. aurata and rank AuNP, according to detected effects as 80 µg.L-1 AuNPPVP> 4 µg.L-1 AuNP-PVP> 16000 µg.L-1 AuNP-PVP> 4 µg.L-1 AuNP-PVP> 16000 µg.L-1 AuNP-citrate > 4 µg.L-1 AuNP-citrate >80µg.L-1 AuNP-citrate.

4. Discussion The characterization of AuNP in the test media support the data obtained by Barreto et al. (2015) in terms of behavior of AuNP-citrate and AuNP-PVP in ASW. AuNP-citrate immediately agglomerated/aggregated whereas AuNP-PVP maintained its characteristics during the experimental assay (96 h). These data suggest that AuNP-PVP remain available in the water column for a longer period, whereas AuNP-citrate, in the mg.L-1 range will only temporarily be available tending to agglomerate/aggregate and precipitates become visible in the tanks within 24 h. The characterization of AuNP in low concentrations as used in the present study can be extremely challenging considering that no information can be obtained by the surface plasmon resonance absorption and other techniques like DLS are not feasible (García-Negrete et al., 2015). Furthermore, EM 13   

observation may also be problematic due to sample preparation requirements associated with the low number of particles and high number of salt crystals that may be found in the samples. In the study of García-Negrete et al. (2013) with ASW the authors were able to observe by EM that AuNP-citrate, at low concentrations (in the range of low µg.L-1) forms agglomerates that may dissociate easily. This water-resistant nature at low concentrations can be considered expectable taking into account the lower probability of particles to collide. The transcriptional levels of genes encoding the antioxidant enzymes assessed in the liver of S. aurata exposed to AuNP via water demonstrated that the low and intermediate concentrations of AuNP-PVP induced a significant overexpression of hepatic GPx, CAT, GST3, GR and MT, whereas AuNP-citrate induced almost no effects. The increase in the mRNA levels of the antioxidant-related genes showed that AuNPPVP induced an activation of the antioxidant system in the liver of S. aurata to cope with the potential oxidative stress generated by AuNP exposure. The increase in mRNA levels of MT, suggests a possible MT involvement in the detoxification of AuNP, since MT gene promoter region contains not only genetic elements involved in oxidative stress response, but also sequences thought to be responsive to metals (Haq et al., 2003). Overall, our results indicated that AuNP-PVP activates the transcriptional machinery in S. aurata liver, leading to de novo synthesis of antioxidant enzymes. In fish, the majority of studies have been performed in freshwater fish, such as Danio rerio (zebrafish) (Bar-Ilan et al., 2009; Geffroy et al., 2012). In one of these studies, the authors did not find differences in the expression of antioxidant genes in zebrafish exposed to AuNP-citrate for 20 days (Dedeh et al., 2015). In bivalves, studies have shown that AuNPs induced an increase in the activity/gene expression of antioxidant enzymes/genes encoding antioxidant enzymes, including MT (Joubert et al., 2013; Pan et al., 2012; Tedesco et al., 2010a; Volland et al., 2015) (Table 2). Under present experimental conditions AuNP did not induce changes in the expression of HSP70 or GRP75, indicating an absence of cellular stress strong enough to induce de novo synthesis of these cell chaperones. The activation of the antioxidant defense-related genes in conjugation with the already available pool of HSP might have been sufficient to counteract the oxidative stress induced by AuNP-PVP. Previous studies showed that mice injected with 20 nm AuNP have increased HSP70 protein levels in brain after 72 h of injection. However, this study is in mammals and the mode of administration

14   

does not represent an environmentally occurring exposure route for fish (Siddiqi et al., 2012). In order to clarify the immunotoxicity of AuNP in S. aurata, expression of some genes related to the innate immune function in fish were also evaluated. The present findings showed unaltered transcriptional levels of IL1β, TNFα and COX2, concomitantly with an upregulation of the anti-inflammatory cytokine IL10. Thus, we suggest that IL10 may be limiting the formation of IL1β and TNFα, giving protection against the oxidative stress induced by AuNP, as previously suggested in mammals (Bourdi et al., 2002). Bourdi et al. (2002) proposed that anti-inflammatory cytokines protect the liver against acetaminophen toxicity by attenuating iNOS induction and avoiding the increase in proinflammatory cytokines in mice. TF mRNA levels were increased in the present study after exposure to the lowest AuNP-PVP, suggesting that AuNP have an iron-dependent intracellular mechanism in fish. TF encodes for a protein with a primary role in maintaining proper iron concentrations in the blood. Furthermore, TF is able to transport other metals like cadmium or zinc. Our results are in agreement with previous findings showing that Gadus morhua exposed to mercury-contaminated sediments (Olsvik et al., 2011) have increased TF gene expression. Taking altogether we propose TF gene as a molecular biomarker of S. aurata exposure to AuNP. The expression of genes related to the apoptotic pathway, namely the proapoptotic BAX and the executioner, CASP3, both were increased in response to AuNPPVP. Moreover, it should be highlighted that CASP3 is the only gene that presents changes after exposure to the highest concentration of AuNP-citrate. Present results revealed an activation of the apoptotic machinery in the liver of S. aurata after AuNP exposure via water, as previously observed in the brain of rats after 72 h injection with AuNP (Siddiqi et al., 2012). TOS levels in plasma reflect overall oxidative status. In the present study, the lowest concentrations AuNP-PVP induced an increase in TOS, which reflects a situation of possible oxidative stress if antioxidant defenses are not effective. This result reinforces the hypothesis that the possible mechanism of AuNP toxicity is through the generation of ROS (Lapresta-Fernández et al., 2012; Volland et al., 2015). For TOS we observed a nonmonotonic concentration response curve, which is a major finding since low concentrations potentially found in the environment induce effects in a marine fish species. Under present exposure conditions, TAC activity was unaltered indicating that 15   

the overall antioxidant capacity was not depleted due to the oxidative stress generated by AuNP-PVP, corroborating previous finding in mussels exposed to copper (Franco et al., 2015). Thus, it seems that S. aurata was able to counteract the increased oxidant status. Despite the increased TOS and OSI, the unaltered levels of TAC suggest that the animals efficiently maintain the production of antioxidants that may be translocated from liver, as previously suggested by Oliveira et al. (2008) in Liza aurata exposed to pollutants. In the present study, EA was also unaltered after exposure to AuNP, suggesting that this enzyme is not involved in the protection against oxidative effects generating by AuNP-PVP, also corroborating the study of Franco et al. (2015) with mussels exposed to metals. Present results do not point out to liver injury induced by AuNP exposure, since ALP activity was unaltered and AST activity decreased after AuNP-PVP exposure. This finding may be due to an increased liver antioxidant capacity, as it was previously suggested that some nutrients with hepato-protective effects increase liver antioxidant capacity preventing lipid peroxidation, which is reflected by decreased AST and ALP activity levels (Panigrahi et al., 2010). To our knowledge, the only study looking at these parameters after AuNP exposure, was performed in rats orally fed with AuNP-citrate (10 nm) during 21 days. The authors found increased levels of ALP and AST activities in plasma suggesting that AuNP adversely affects hepatocytes. The present research revealed that AuNP-PVP induced the majority of the observed effects. If on the one hand this might be considered an unexpected finding if we contemplate that PVP coating is considered safer and more biocompatible than citrate (Min et al., 2009), the dissimilar behavior in seawater leads to a lower presence of AuNPcitrate in the water column, whereas AuNP-PVP stability make them more dispersible and likely to be more incorporated by organisms present in the water column like fish (Barreto et al., 2015). After fish uptake, AuNP properties can also change inside the body, since blood contains proteins and electrolytes that can change NP characteristics. For example, it was previously demonstrated that gold nanorods aggregated when mixed with mouse blood. However, when these nanorods where coated with poly(ethylene) glycol, the aggregation was prevented (Eghtedari et al. 2009). Our findings support the proposition that the toxicity of NPs is dependent on various properties of the particles, including size, shape and surface functionalization (García-Negrete et al., 2013; Tedesco et al., 2010a). Thus, further studies are recommended in order to assess absorption, biodistribution, metabolism and elimination processes of the two forms of AuNP in S. aurata. Another important finding of this study was that changes in mRNA transcriptional 16   

levels of antioxidant related-genes occurred at the tested low and intermediate concentrations of AuNP-PVP. This result clearly reveals a non-monotonic dose response curve, in which low doses of AuNP caused a greater impact than high doses, a pattern of response frequently found for endocrine disrupting chemicals (Lagarde et al., 2015). Nonetheless, the interpretation of the data obtained in the present study should also consider that changes at the molecular level may not strictly correlate with protein levels, despite the relevant information provided. Thus, further studies should assess effects at protein levels, as well as endpoints with more obvious reflexes at the population level, such as alterations on behavior (e.g. swimming performance). The IBR index is frequently used to diminish the degree of uncertainty on the interpretation of results although the information provided by this index should be carefully interpreted taking into account that the same importance is given to all included biomarkers, regardless of their nature. In the present study, IBR clearly signaled AuNPPVP as inducing more effects, mainly at 80 µg.L-1. Nonetheless, it must be highlighted that the information obtained by IBR resulted from the incorporation of all data in the calculations and thus, is highly influenced by the higher number of oxidative stress related biomarkers. In summary, our study provides information on the molecular mechanisms underpinning modes of action of AuNPs in a marine fish cultured in all Mediterranean area. AuNP-PVPs exert a higher influence on the transcriptional response and plasma biochemical parameters than AuNP-citrate. AuNP-PVPs are able to generate oxidative stress, as reflected by increased TOS but the increased mRNA levels of genes encoding antioxidant enzymes together with lack of decreased TAC found after AuNP challenge suggest that fish are able to compensate for the disturbance. AuNPs were not able to induce a pro-inflammatory reaction in liver, possibly due to the protective effect of the antioxidant enzymes and anti-inflammatory cytokine. Despite the increased expression of some apoptosis-related genes, liver was not damaged by AuNPs as the hepatic health indicators did not increase in plasma. Taken together, we propose the use of TOS, GPx, CAT and MT as important biochemical/molecular biomarkers to be used in future AuNP monitoring studies.

Acknowledgements

17   

This research was supported through the COMPETE – Operational Competitiveness Program and national funds through FCT – Foundation for Science and Technology, under the project “NANOAu - Effects of Gold Nanoparticles to Aquatic Organisms” (FCTPTDC/MAR-EST/3399/2012)

(FCOMP-01-0124-FEDER-029435);

CESAM:

UID/AMB/50017/2013 and by the “Plan Nacional de Investigación”, Government of Spain (AGL2013-48835-C2-2-R).; M.T. and M.O. have a post-doctoral fellowships from FCT (SFRH/BPD/85107/2012 and SFRH/BPD/109219/2015, respectively) supported by the European Social Fund and national funds from the “Ministério da Educação e Ciência (POPH – QREN – Tipologia 4.1)” of Portugal. A.T. have a post-doctoral fellowshisp “Juan de la Cierva” supported by the “Ministerio de Economia y Competitividad“, Spain. J.C. Balasch is thankfully acknowledged for the graphic design of the figures.

References Alkilany, A.M., Murphy, C.J., 2010. Toxicity and cellular uptake of gold nanoparticles: what we have learned so far? J. Nanopart. Res. 12, 2313-2333. Andersen, C.L., Jensen, J.L., Ørntoft, T.F., 2004. Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res. 64, 5245-5250. Bar-Ilan, O., Albrecht, R.M., Fako, V.E., Furgeson, D.Y., 2009. Toxicity assessments of multisized gold and silver nanoparticles in zebrafish embryos. Small 5, 1897-1910. Barreto, A., Luis, G.L., Girão, A.V., Trindade, T., Soares, A.M.V.M., Oliveira, M., 2015. Behavior of colloidal gold nanoparticles in different ionic strength media. J. Nanopart. Res. 17, 1-13. Behera, M., Ram, S., 2014. Inquiring the mechanism of formation, encapsulation, and stabilization of gold nanoparticles by poly(vinyl pyrrolidone) molecules in 1butanol. Appl. Nanosci. 4, 247-254. Beliaeff, B., Burgeot, T., 2002. Integrated biomarker response: a useful tool for ecological risk assessment. Environ. Toxicol. Chem. 21, 1316-1322. Bourdi, M., Masubuchi, Y., Reilly, T.P., Amouzadeh, H.R., Martin, J.L., George, J.W., Shah, A.G., Pohl, L.R., 2002. Protection against acetaminophen-induced liver injury and lethality by interleukin 10: Role of inducible nitric oxide synthase. Hepatology 35, 289-298. 18   

Broeg, K., Lehtonen, K.K., 2006. Indices for the assessment of environmental pollution of the Baltic Sea coasts: Integrated assessment of a multi-biomarker approach. Mar. Pollut. Bull. 53, 508-522. Chen, H., Dorrigan, A., Saad, S., Hare, D. J., Cortie, M. B., and Valenzuela, S. M., 2013. In vivo study of spherical gold nanoparticles: Inflammatory effects and distribution in mice. Plos One 8, 1-8. Dedeh, A., Ciutat, A., Treguer-Delapierre, M., Bourdineaud, J.P., 2015. Impact of gold nanoparticles on zebrafish exposed to a spiked sediment. Nanotoxicology 9, 71-80. Del Valls, T.A., Blasco, J., Sarasquete, C., Forja, J.M., Gomez-Parra, A., 1998. Evaluation of heavy metal sediment toxicity in littoral ecosystems using juvenile of the fish Sparus aurata. Ecotoxicol. Environ. Saf. 41, 157-167. Eghtedari, M., Liopo, A.V., Copland, J.A., Oraevsky, A.A., Motamedi, M., 2009. Engineering of hetero-functional gold nanorods for the in vivo molecular targeting of breast cancer cells. Nano Lett. 9, 287-291. Erel, O., 2004. A novel automated direct measurement method for total antioxidant capacity using a new generation, more stable ABTS radical cation. Clin. Biochem. 37, 277-285. Erel, O., 2005. A new automated colorimetric method for measuring total oxidant status. Clin. Biochem. 38, 1103-1111. Esen, R., Aslan, M., Kucukoglu, M.E., Cıkman, A., Yakan, U., Sunnetcioglu, M., Selek, S., 2015. Serum paraoxonase activity, total thiols levels, and oxidative status in patients with acute brucellosis. Wien Klin. Wochenschr. 127, 427-433. Ferreira, P., Fonte, E., Soares, M.E., Carvalho, F., Guilhermino, L., 2016. Effects of multi-stressors on juveniles of the marine fish Pomatoschistus microps: Gold nanoparticles, microplastics and temperature. Aquat. Toxicol. 170, 89-103. Ferry, J.L., Craig, P., Hexel, C., Sisco, P., Frey, R., Pennington, P.L., Fulton, M.H., Scott, I.G., Decho, A.W., Kashiwada, S., Murphy, C.J., Shaw, T.J., 2009. Transfer of gold nanoparticles from the water column to the estuarine food web. Nat. Nanotechnol. 4, 441-444. Franco, L., Romero, D., García-Navarro, J.A., Teles, M., Tvarijonaviciute, A., Esterase activity (EA), total oxidant status (TOS) and total antioxidant capacity (TAC) in gills of Mytilus galloprovincialis exposed to pollutants: Analytical validation and effects evaluation by single and mixed heavy metal exposure. Mar. Pollut. Bull. (in press). 19   

García-Negrete, C.A., Blasco, J., Volland, M., Rojas, T.C., Hampel, M., LaprestaFernández, A., Jiménez de Haro, M.C., Soto, M., Fernández, A., 2013. Behaviour of Au-citrate nanoparticles in seawater and accumulation in bivalves at environmentally relevant concentrations. Environm. Pollut. 174, 134-141. Garcia-Negrete, C.A., Jimenez de Haro, M.C., Blasco, J., Soto, M., Fernandez, A., 2015. STEM-in-SEM high resolution imaging of gold nanoparticles and bivalve tissues in bioaccumulation experiments. Analyst 140, 3082-3089. Geffroy, B., Ladhar, C., Cambier, S., Treguer-Delapierre, M., Brethes, D., Bourdineaud, J.P., 2012. Impact of dietary gold nanoparticles in zebrafish at very low contamination pressure: The role of size, concentration and exposure time. Nanotoxicology 6, 144-160. Haagen, L., Brock, A., 1992. A new automated-method for phenotyping arylesterase (EC 3112) based upon inhibition of enzymatic-hydrolysis of 4-nitrophenyl acetate by phenyl acetate. Eur. J. Clin. Chem. Clin. Biochem. 30, 391-395. Hansen, S.F., Baun, A., Ganzleben, C., 2011. Nanomaterials and the European Water Framework Directive. Haq, F., Mahoney, M., Koropatnick, J., 2003. Signaling events for metallothionein induction. Mutat. Res. Fund. Mol. M. 533, 211-226. Joubert, Y., Pan, J.-F., Buffet, P.E., Pilet, P., Gilliland, D., Valsami-Jones, E., Mouneyrac, C., Amiard-Triquet, C., 2013. Subcellular localization of gold nanoparticles in the estuarine bivalve Scrobicularia plana after exposure through the water. Gold Bull. 46, 47-56. Kloas, W., Urbatzka, R., Opitz, R., Würtz, S., Behrends, T., Hermelink, B., Hofmann, F., Jagnytsch, O., Kroupova, H., Lorenz, C., Neumann, N., Pietsch, C., Trubiroha, A., Van Ballegooy, C., Wiedemann, C., Lutz, I., 2009. Endocrine disruption in aquatic vertebrates. Ann. N. Y. Acad. Sci. 1163, 187-200. Lagarde, F., Beausoleil, C. Belcher. S.M., Belzunces, L.P., Emond, C., Guerbet, M., Rousselle, C., 2015. Non-monotonic dose-response relationships and endocrine disruptors: a qualitative method of assessment. Environ. Health 14, 1-15. Lapresta-Fernández, A., Fernández, A., Blasco, J., 2012. Nanoecotoxicity effects of engineered silver and gold nanoparticles in aquatic organisms. Trends Anal. Chem. 32, 40-59.

20   

Lekeufack, D.D., Brioude, A., Mouti, A., Alauzun, J.G., Stadelmann, P., Coleman, A.W., Miele, P., 2010. Core-shell Au@(TiO2, SiO2) nanoparticles with tunable morphology. Chem. Commun. 46, 4544-4546. Liu, X., Atwater, M., Wang, J., Huo, Q., 2007. Extinction coefficient of gold nanoparticles with different sizes and different capping ligands. Colloids Surf. B 58, 3-7. Min, Z., Baoxiang, W., Zbigniew, R., Zhaohui, X., Jon Otto, F., Xiaofeng, Y., Steinar, R., 2009. Minute synthesis of extremely stable gold nanoparticles. Nanotechnology 20, 505606. OECD, 2010. Series on the safety of manufactured nanomaterial No. 27. (2010). List of manufactured nanomaterials and list of endpoints for phase one of the sponsorship programme for the testing of manufactured nanomaterials: revision. . ENV/JM/MONO(2010)46. Oliveira, M., Pacheco, M., Santos, M.A., 2008. Organ specific antioxidant responses in golden grey mullet (Liza aurata) following a short-term exposure to phenanthrene. Sci.Total Environ. 396, 70-78. Olsvik, P.A., Brattås, M., Lie, K.K., Goksøyr, A., 2011. Transcriptional responses in juvenile Atlantic cod (Gadus morhua) after exposure to mercury-contaminated sediments obtained near the wreck of the German WW2 submarine U-864, and from Bergen Harbor, Western Norway. Chemosphere 83, 552-563. Pan, J.F., Buffet, P.-E., Poirier, L., Amiard-Triquet, C., Gilliland, D., Joubert, Y., Pilet, P., Guibbolini, M., Risso de Faverney, C., Roméo, M., Valsami-Jones, E., Mouneyrac, C., 2012. Size dependent bioaccumulation and ecotoxicity of gold nanoparticles in an endobenthic invertebrate: The Tellinid clam Scrobicularia plana. Environ. Pollut. 168, 37-43. Panigrahi, A., Kiron, V., Satoh, S., Watanabe, T., 2010. Probiotic bacteria Lactobacillus rhamnosus influences the blood profile in rainbow trout Oncorhynchus mykiss (Walbaum). Fish Physiol. Biochem. 36, 969-977. Paramelle, D., Sadovoy, A., Gorelik, S., Free, P., Hobley, J., Fernig, D.G., 2014. A rapid method to estimate the concentration of citrate capped silver nanoparticles from UV-visible light spectra. Analyst 139, 4855-4861. Pereira, S. O., Barros-Timmons, A., and Trindade, T. (2014). Biofunctionalisation of colloidal gold nanoparticles via polyelectrolytes assemblies. Colloid. Polym. Sci. 292, 33-50. 21   

Pérez-Sánchez, J., Borrel, M., Bermejo-Nogales, A., Benedito-Palos, L., Saera-Vila, A., Calduch-Giner, J.A., Kaushik, S., 2013. Dietary oils mediate cortisol kinetics and the hepatic mRNA expression profile of stress-responsive genes in gilthead sea bream (Sparus aurata) exposed to crowding stress. Implications on energy homeostasis and stress susceptibility. Comp. Biochem. Physiol. D 8, 123-130. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 29, e45. Prieto, A.I., Jos, A., Pichardo, S., Moreno, I., Camean, A.M., 2006. Differential oxidative stress responses to microcystins LR and RR in intraperitoneally exposed tilapia fish (Oreochromis sp.). Aquat. Toxicol. 77, 314-321. Rather, M.A., Sharma, R., Aklakur, M., Ahmad, S., Kumar, N., Khan, M., Ramya, V.L., 2011. Nanotechnology: A Novel Tool for Aquaculture and Fisheries Development. A Prospective Mini-Review. Fish. Aquacult. J. 2011: FAJ-16. Shaw, B.J., Handy, R.D., 2011. Physiological effects of nanoparticles on fish: A comparison of nanometals versus metal ions. Environ. Int. 37, 1083-1097. Siddiqi, N., Abdelhalim, M., El-Ansary, A., Alhomida, A., Ong, W., 2012. Identification of potential biomarkers of gold nanoparticle toxicity in rat brains. J. Neuroinflamm. 9, 123. Tedesco, S., Doyle, H., Blasco, J., Redmond, G., Sheehan, D., 2010a. Exposure of the blue mussel, Mytilus edulis, to gold nanoparticles and the pro-oxidant menadione. Comp. Biochem. Physiol. C 151, 167-174. Tedesco, S., Doyle, H., Blasco, J., Redmond, G., Sheehan, D., 2010b. Oxidative stress and toxicity of gold nanoparticles in Mytilus edulis. Aquat. Toxicol. 100, 178-186. Teles, M., Pacheco, M., Santos, M.A., 2005. Sparus aurata L. liver EROD and GST activities, plasma cortisol, lactate, glucose and erythrocytic nuclear anomalies following short-term exposure either to 17 beta-estradiol (E2) or E2 combined with 4-nonylphenol. Sci. Total Environ. 336, 57-69. Tiede, K., Hassellöv, M., Breitbarth, E., Chaudhry, Q., Boxall, A.B.A., 2009. Considerations for environmental fate and ecotoxicity testing to support environmental risk assessments for engineered nanoparticles. J. Chromatogr. A 1216, 503-509. Truong, L., Tilton, S.C., Zaikova, T., Richman, E., Waters, K.M., Hutchison, J.E., Tanguay, R.L., 2013. Surface functionalities of gold nanoparticles impact embryonic gene expression responses. Nanotoxicology 7, 192-201. 22   

Urbatzka, R., Galante-Oliveira, S., Rocha, E., Castro, L.F.C., Cunha, I., 2013. Normalization strategies for gene expression studies by real-time PCR in a marine fish species, Scophthalmus maximus. Mar. Genomics 10, 17-25. Volland, M., Hampel, M., Martos-Sitcha, J., Trombini, C., Martínez-Rodríguez, G., Blasco, J., 2015. Citrate gold nanoparticle exposure in the marine bivalve Ruditapes philippinarum: uptake, elimination and oxidative stress response. Environ. Sci. Pollut. Res. 22, 17414-17424. Zar, J.H., 1999. Biostatistical Analysis, Fourth Edition ed. Prentice Hall, New Jersey. Zena, R., Speciale, A., Calabrò, C., Caló, M., Palombieri, D., Saija, A., Cimino, F., Trombetta, D., Lo Cascio, P., 2015. Exposure of sea bream (Sparus aurata) to toxic concentrations of benzo[a]pyrene: possible human health effect. Ecotoxicol. Environ. Saf. 122, 116-125.

23   

Legends to figures Figure 1. a) UV–Vis spectra of citrate coated gold nanoparticles (AuNP-citrate); b) Transmission electron microscopy image AuNP-citrate; c) UV–Vis spectra of PVP coated gold nanoparticles (AuNP-PVP); scanning electron microscopy image of AuNP-PVP. Figure 2. Transcript levels of housekeeping genes of all experimental groups (n=7) in the liver of Sparus aurata. Boxes indicated the 25/75 percentiles and the median is marked with a bold line. Figure 3. Transcriptional levels of antioxidant-related genes in the liver of Sparus aurata after 96 h exposure to gold nanoparticles coated with citrate (AuNP-citrate; open bars) or gold nanoparticles coated with PVP (AuNP-PVP; closed bars) in water. Normalization was done to the best combination of the two housekeeping genes (β-Actin and GADPH). The horizontal line originating at y=1 denote the control group against which the expression was normalized. Values represent the means ± S.E. (n=7 per group). Differences were determined by two-way ANOVA followed by Tukey’s test. Statistically significant differences between groups are: * vs. control (**P<0.01 and *P<0.05); ▲ vs. AuNP-PVP (▲▲P<0.01 and ▲P<0.05). Figure 4. Transcriptional levels of immune-related genes in the liver of Sparus aurata after 96 h exposure to gold nanoparticles coated with citrate (AuNP-citrate; open bars) or gold nanoparticles coated with PVP (AuNP-PVP; closed bars) in water. Normalization was done to the best combination of the two housekeeping genes (β-Actin and GADPH). The horizontal line originating at y=1 denotes the control group against which the expression was normalized. Values represent the means ± S.E. (n=7 per group). Differences were determined by two-way ANOVA followed by Tukey’s test. Statistically significant differences between groups are: * vs. control (**P<0.01 and *P<0.05); ▲ vs. AuNP-PVP (▲▲P<0.01 and ▲P<0.05). Figure 5. Transcriptional levels of cell tissue repair-related genes in the liver of Sparus aurata after 96 h exposure to gold nanoparticles coated with citrate (AuNP-citrate; open bars) or gold nanoparticles coated with PVP (AuNP-PVP; closed bars) in water. Normalization was done to the best combination of the two housekeeping genes (β-Actin 24   

and GADPH). The horizontal line originating at y=1 denotes the control group against which the expression was normalized. Values represent the means ± S.E. (n=7 per group). Differences were determined by two-way ANOVA followed by Tukey’s test. Statistically significant differences between groups are: * vs. control (**P<0.01 and *P<0.05); ▲ vs. AuNP-PVP (▲▲P<0.01 and ▲P<0.05). Figure 6. Transcriptional levels of apoptosis-related genes in the liver of Sparus aurata after 96 h exposure to gold nanoparticles coated with citrate (AuNP-citrate; open bars) or gold nanoparticles coated with PVP (AuNP-PVP; closed bars) in water. Normalization was done to the best combination of the two housekeeping genes (β-Actin and GADPH). The horizontal line originating at y=1 denotes the control group against which the expression was normalized. Values represent the means ± S.E. (n=7 per group). Differences were determined by two-way ANOVA followed by Tukey’s test. Statistically significant differences between groups are: * vs. control (**P<0.01 and *P<0.05); ▲ vs. AuNP-PVP (▲▲P<0.01 and ▲P<0.05). Figure 7. Overall S. aurata mRNA response profile to AuNP represented as a heatmap. SOD2 (superoxide dismutase [Mn]), CAT (catalase), GPx1, GPx4 (glutathione peroxidase 1 and 4), GST3 (glutathione-S-transferase 3), PRDX6 (peroxiredoxin 6), MT (metallothionein), TF (transferrin), GR (glutathione reductase), IL1β (interleukin 1β), IL10 (interleukin 10), TNFα (tumor necrosis factor-α), COX2 (cyclooxygenase 2), HSP70 (heat-shock protein 70), GRP75 (glucose-regulated protein, 75 kDa), CASP3 (caspase 3), BAX (Bcl-2 associated X protein). Figure 8. Total oxidative status (TOS), total antioxidant capacity (TAC), esterase activity (EA) and oxidative stress index (OSI) in the plasma of Sparus aurata after 96 h exposure to gold nanoparticles coated with citrate (AuNP-citrate; open bars) or gold nanoparticles coated with PVP (AuNP-PVP; closed bars) in water. Values represent the means ± S.E. (n=7 per group). Differences were determined by two-way ANOVA followed by Tukey’s test. Statistically significant differences between groups are: * vs. control (**P<0.01 and *P<0.05); ▲ vs. AuNP-PVP (▲▲P<0.01 and ▲P<0.05). Figure 9. Aspartate aminotrasferase (ALP) and alkaline phosphatase (AST) activities in the plasma of Sparus aurata after 96 h exposure to gold nanoparticles coated with citrate 25   

(AuNP-citrate; open bars) or gold nanoparticles coated with PVP (AuNP-PVP; closed bars) in water. Values represent the means ± S.E. (n=7 per group). Differences were determined by two-way ANOVA followed by Tukey’s test. Statistically significant differences between groups are: * vs. control (**P<0.01 and *P<0.05); ▲ vs. AuNP-PVP (▲▲P<0.01 and ▲P<0.05). Figure 10. Integrated biomarker response (IBR) and assessed endpoint star plots for each experimental condition. SOD2 (superoxide dismutase [Mn]), CAT (catalase), GPx1, GPx4 (glutathione peroxidase 1 and 4), GST3 (glutathione-S-transferase 3), PRDX6 (peroxiredoxin 6), MT (metallothionein), TF (transferrin), GR (glutathione reductase), IL1β (interleukin 1β), IL10 (interleukin 10), TNFα (tumor necrosis factor-α), COX2 (cyclooxygenase 2), HSP70 (heat-shock protein 70), GRP75 (glucose-regulated protein, 75 kDa), CASP3 (caspase 3), BAX (Bcl-2 associated X protein), TOS (total oxidative status), TAC (total antioxidant capacity), EA (esterase activity), ALP (aspartate aminotransferase) and AST (alkaline phosphatase) activities.

26   

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8

Figure 9

Figure 10

Table 1 Sequences and efficiencies of primers used for quantitative real-time PCR analysis in the liver of Sparus aurata. Gene name

Acronym

Genbank ID

Forward

Reverse

Efficiency (%)

EF1α

AF184170

CCCGCCTCTGTTGCCTTCG

CAGCAGTGTGGTTCCGTTAGC

99.7

18S

AY993930

GCATTTATCAGACCCAAAACC

AGTTGATAGGGCAGACATTCG

97.8

X89920

TCCTGCGGAATCCATGAGA

GACGTCGCACTTCATGATGCT

99.7

GADPH

DQ641630

TGCCCAGTACGTTGTTGAGTCCAC

CAGACCCTCAATGATGCCGAAGTT

102.6

SOD2

JQ308833

CCTGACCTGACCTACGACTATGG

AGTGCCTCCTGATAT TTCTCCTCTG

100.8

CAT

JQ308823

TGGTCGAGAACTTGAAGGCTGTC

AGGACGCAGAAATGGCAGAGG

101.1

Glutathione peroxidase 1

GPx1

DQ524992

GAAGGTGGATGTGAATGGAAAAGATG

CTGACGGGACTCCAAATGATGG

100.1

Glutathione peroxidase 4

GPx4

AM977818

TGCGTCTGATAGGGTCCACTGTC

GTCTGCCAGTCCTCTGTCGG

100.2

Glutathione-S-transferase3

GST3

JQ308828

CCAGATGATCAGTACGTGAAGACCGTC

CTGCTGATGTGAGGAATGTACCGTAAC

98.8

Peroxiredoxin 6

PRDX6

GQ252684

AGAGACAAGGACGGAATGC

TGTGGCGACCTTCTTCTG

99.5

Metallothionein

MT

U93206

CTCTAAGACTGGAACCTG

GGGCAGCATGAGCAGCAG

102.6

Transferrin

TF

JF309047

CAGGACCAGCAGACCAAGTT

TGGTGGAGTCCTTGAAGAGG

99.6

Glutathione reductase

GR

AJ937873

TGTTCAGCCACCCACCCATCGG

GCGTGATACATCGGAGTGAATGAAGTCTTG

97.6

Interleukin 1β

IL1β

AJ277166

GGGCTGAACAACAGCACTCTC

TTAACACTCTCCACCCTCCA

99.5

Interleukin 10

IL10

JX976621

AACATCCTGGGCTTCTATCTG

TGTCCTCCGTCTCATCTG

98.8

Elongation factor-1α

18S ribosomal RNA gene  β-Actin β-Actin Glyceraldehyde 3-phosphate dehydrogenase Superoxide dismutase [Mn] Catalase

27   

Tumor necrosis factor-α

TNFα

AJ413189

CAGGCGTCGTTCAGAGTCTC

CTGTGGCTGAGAGGTGTGTG

99.3

Cyclooxygenase 2

COX2

AM296029

GAGTACTGGAAGCCGAGCAC

GATATCACTGCCGCCTGAGT

99.7

Heat-shock protein 70

HSP70

EU805481

AATGTTCTGCGCATCATCAA

GCCTCCACCAAGATCAAAGA

100.8

Glucose-regulated protein, 75 kDa

GRP75

DQ524993

TCCGGTGTGGATCTGACCAAAGAC

TGTTTAGGCCCAGAAGCATCCATG

100

Caspase 3

CASP3

EU722334

CTGATCTGGATGGAGGCATT

AGTAGTAGCCTGGGGCTGTG

89

BAX

AM963390

CAACAAGATGGCATCACACC

TGAACCCGCTCGTATATGAAA

100.4

Bcl-2 associated X protein

 

Table 2 Summary of main gold nanoparticle effects on estuarine/marine species after exposure via water.  

Coating 

Size (nm) 

Conc. 

Time 

Tissue1 

Main effect2 

Tedesco et al. 2008  Mytilus edulis 

Citrate 

13 

750 ppb 

24 h 

DG, G, H, M 

Increased oxidative stress (DG) and CAT (DG, M); Increased  ubiquination (G, DG) and carbonylation (G). No LMS damage.

Tedesco et al. 2010  Mytilus edulis 

Citrate 

15 

750 ppb 

24 h 

DG, G, M 

Decreased GSH/GSSG ratio; decreased protein thiol group; No  LPO; No changes on thioredoxin reductase activity. 

Tedesco et al. 2010  Mytilus edulis 

DDAB 

5.3 

750 ppb 

24 h 

DG, G, H, M 

Increased oxidative stress and cytotoxixity; Decreased Thiol‐ containing proteins; Decreased LMS (H). 

Pan et al. 2012  Scrobicularia  plana 

Citrate 

5, 15, 40 

100 µg.L‐1 

16 d 

Whole body 

Increased MT; Increased CAT, SOD, GST and AChE; Impaired  burrowing behavior; No LPO. 

Joubert et al. 2013  Scrobicularia  plana 

Citrate 

5, 15, 40 

100 µg.L‐1 

16 d 

DG, G 

Increased perinuclear space; Increased swollen nuclei;  Decreased heterochromatin. 

Reference  Species 

28   

García‐Negrete et al. 2013  Ruditapes  philippinarum 

Citrate 

21 

6, 30 µg.L‐1 

28 d 

DG, G 

No LPO. 

Volland et al. 2015  Ruditapes  philippinarum 

Citrate 

20 

0.75 µg.L‐1 

 

DG, G 

Increased GPx, CAT, LPO (DG); Increased SOD (G). Increased  expression in GPx, MT and TNFα genes (DG). 

  1

DG: Digestive gland; G: Gills; H: Hemolymph/Hemocyte; M: Mantle.

2

CAT: Catalase; LMS: Lysosomal membrane stability; GSH: Glutathione; GSSG: Glutathione disulphide; LPO: Lipid peroxidation; MT: Metallothionein; SOD:  Superoxide dismutase; GST: Glutathione‐S‐transferase; AChE: Acetylcholinesterase; GPx: Glutathione peroxidase; TNFα: Tumor necrosis factor‐α.   

 

29