- Email: [email protected]
Association analysis between anterior-pharynx defective-1 genes polymorphisms and Alzheimer's disease
Neuroscience Letters 350 (2003) 77–80 www.elsevier.com/locate/neulet
Association analysis between anterior-pharynx defective-1 genes polymorphisms and Alzheimer’s disease Maura Polia, Luisa Benerini Gattaa, Silvana Archettib, Alessandro Padovanic, Alberto Albertinia,b, Dario Finazzia,b,* a
Institute of Chemistry, Faculty of Medicine, University of Brescia, viale Europa 11, 25123 Brescia, Italy b III Servizio di Analisi, Spedali Civili di Brescia, 25123 Brescia, Italy c Department of Neurology, Faculty of Medicine, University of Brescia, viale Europa 11, 25123 Brescia, Italy Received 28 April 2003; received in revised form 3 July 2003; accepted 10 July 2003
Abstract Recent biological studies indicate the importance of anterior-pharynx defective-1 (APH-1) proteins in Alzheimer’s disease (AD) pathogenesis. We scanned APH-1 genes for the presence of sequence variations by denaturing high performance liquid chromatography and analyzed their distribution in an Italian sample of 113 AD patients and 132 controls. We found six different polymorphisms: three of them, all in APH-1b, predict an aminoacid substitution (T27I, V199L and F217L); the others are either silent or in non-coding regions. None of them is significantly associated with the disease; data stratification by the apolipoprotein E e4 carrier status show a trend for coexistence of the transversion c þ 651T . G (F217L) with the e4 allele. Our data suggest that polymorphisms in APH-1a/b coding regions are not linked with higher risk for sporadic AD in our Italian population sample. q 2003 Published by Elsevier Ireland Ltd. Keywords: Alzheimer’s disease; Anterior-pharynx defective-1 genes; Mutation screening; Denaturing high performance liquid chromatography
Alzheimer’s disease (AD) is the most common cause of dementia in the elderly. Different genetic and environmental factors are involved in the development of the disease; heterozygous, highly penetrant mutations in the genes encoding for amyloid precursor protein (APP) [6], presenilin-1 (PS1) [16] and presenilin-2 (PS2) [11] have been linked with the rare cases of familial AD, whereas the apolipoprotein E (APOE) e4 allele has been associated to a higher risk for the more prevalent form of sporadic AD (SAD) [1]. The APOEe4 allele does not account for the entire genetic effect in SAD [2,7] and probably many other common polymorphisms with relatively low penetrance are involved in determining the disease onset. The amyloid cascade hypothesis suggests that b-amyloid (Ab) production is a key event in the pathogenesis of AD. The peptide derives from the proteolysis of APP by two distinct enzymatic activities, generically named beta- and gamma-secretase [5]. Beta-secretase is identified as Betasite APP-cleaning enzyme (BACE) [18], a membrane*
Corresponding author. Tel.: þ 39-30-399-5367; fax: þ39-30-307-251. E-mail address: [email protected] (D. Finazzi).
0304-3940/03/$ - see front matter q 2003 Published by Elsevier Ireland Ltd. doi:10.1016/S0304-3940(03)00857-7
bound aspartyl protease, whereas PS1 and PS2 are required for the g-secretase-mediated process [3,20]. Biochemical evidence actually indicate that g-secretase activity is present in a high molecular weight complex [12,13], which includes presenilins and other cofactors. Recent work [4,10,14,17, 19] has shown that Nicastrin, anterior-pharynx defective-1a (APH-1a), APH-1b and presenilin enhancer 2 (PEN-2) physically interact with presenilins and are necessary for intramembrane proteolysis of APP and other g-secretase substrates. Downregulation of APH-1a and APH-1b by small RNA interference alters the formation of the multimeric complex and strongly reduces the production of Ab [14]. It is therefore possible that sequence variations in APH-1 genes affect g-secretase activity and have a role in determining the risk for sporadic AD. We tested this hypothesis by analysing APH-1a and APH-1b exons and nearby intronic regions for the presence of polymorphisms in an Italian population sample of sporadic AD cases and controls. Patients with probable AD (113) and controls (132) were recruited from the Neurological Clinic of the University of
78
M. Poli et al. / Neuroscience Letters 350 (2003) 77–80
Brescia. They were all included in the study after giving informed consent and the study was conducted in accordance with local research regulations. The diagnosis was assessed according to a standardized protocol meeting the Neurological and Communicative Disorders and Stroke – Alzheimer’s Disease and Related Disorders Association criteria for probable AD [15]. Sporadic AD patients had a mean age of 72 ^ 9 (mean ^ standard deviation); 41 were male and 72 were female. Control subjects had a mean age of 67 ^ 7; 59 were male and 73 female. Genomic DNA was isolated from whole blood and stored at 48C until use. Genotyping for the APOE polymorphisms was performed according to Hixson and Vernier [8]. APH1a and APH-1b (GenBank Accession Number BC001230 and BC020905, respectively) genomic structures consist of seven and six exons respectively, all of which contain coding sequence. Primer pairs and annealing temperatures for the polymerase chain reaction (PCR) amplification of each exon and flanking intronic regions are shown in Table 1. The PCR was performed in a total volume of 50 ml with 200 ng of genomic DNA, 1.5 units of Taq Gold polymerase and Buffer II from Applied Biosystems, 200 mMol of each dNTP and 20 picomoles of each primer. The presence of Table 1 Primers, annealing temperatures and DHPLC analysis temperatures Gene APH1-a Exon 1 Exon 2 Exon 3 Exon 4/5 Exon 6 Exon 7
APH-1b Exon 1 Exon 2 Exon 3 Exon 4 Exon 5 Exon 6
Primers
A.T. (8C)
L. (bp)
T. (8C)
catttgcctgtcctggtcaggc cctctctcttcgacgctctccc gcttgtctcactgcccctgtc cccctccagaccactccatct cctcatgtttcccctaccccac gtccaactccctcctccagtcc gggtcagtggtgaacaggcaatag tctccctaactcaggcccctgtc ggggattaggtcgagggagaatc cagtcatgggcagtggacagg caggactccccctgtgtca tgtccagaactggagatggag
61
209
65.2
61
228
62.8
61
144
61.5
60
499
58.9
60
246
60.5
59
214
63.8
62
188
65.8
60
285
54.8
61
179
54.7
59
214
57.9
61
223
59.8
60
349
56.2
gcatctcgcgtccccaacg gtccgggtttcccgacgc cattattaatcctgtactgatgttcacttg ccaaatcataactaaaatctaactgggg ttggactttcctgatatattgctcttc ttccttaatgaaaccatgtggttctaac acttgaaatcttggcaggaaaagag agactagaagcctgaatgttgacag tcctcagtggttctgtgatacctg tccagaatacagtctgagcatggc gcttgctgttattacccaagctga gccaagtcaatggaacgcatatct
Forward and reverse primers for the amplification of each exon of APH1a and APH-1b are shown together with the annealing temperature (A.T.) applied in PCR cycles, the length (L) in base pairs (bp) of each amplicon and the starting temperature (T) applied for DHPLC analysis.
sequence variations was searched for by denaturing high performance liquid chromatography (DHPLC), a highly sensitive and specific technique for detecting mutations. All DHPLC analysis were performed on WAVEe DNA fragment Analysis System (Transgenomic) equipped with a DNASepe column. Chromatography was performed with Buffer A (0.1 M triethilammonium acetate) and B (0.1 M triethilammonium acetate in 25% acetonitrile), with eluent conditions determined by WAVEMAKER software (version 4.1; Transgenomic). The analysis temperatures for mutation detection were derived from software predicted melting profiles (Table 1). In order to reach the maximal sensitivity, a second analysis at a temperature 28C higher was performed whenever the first run did not detect any sequence variation [9]. Direct sequencing of PCR products with aberrant DHPLC elution patterns revealed two types of single nucleotide polymorphism (SNP) in APH-1a and four in APH-1b. SNPs in APH-1a were found in exon 1 (c20C . A) and in the intronic region between exons 4 and 5 (IVS4 þ 34C . T); those in APH-1b were in exon 1 (c þ 80C . T), in intron 2 (IVS2-28C . A), in exon 5 (c þ 595G . T), and in exon 6 (c þ 651T . G). The transversion c-20C . A in APH-1a and the transition c þ 80C . T in APH-1b are the most frequent in our sample of 245 subjects, with an incidence of 15 and 26%, respectively. The others are rare (5% incidence for the transversion c þ 651T . G and less than 1% for IVS4 þ 34C . T and IVS2-28C . A). Interestingly, c þ 80C . T, c þ 595G . T and c þ 651T . G predict aminoacid substitutions at codon 27 (T27I), at codon 199 (V199L) and at codon 217 (F217L) of APH-1b protein, respectively. The others are in non-coding or intronic regions. To evaluate the possibility that the two most frequent DNA variations (c-20C . A and c þ 80C . T) affect susceptibility to SAD, the distributions of their genotypes and alleles were determined in patients and controls and statistically analyzed by the standard Chisquare test and the Fisher’s Exact test when necessary. Differences at P , 0:05 were considered significant. Our study had 80% power to detect an odds ratio (OR) of 2.4 for a risk effect and an OR of 0.4 for a protective effect. Even though the incidence of the c þ 651T . G substitution is too low to guarantee sufficient statistical power, we analyzed also its distribution. As shown in Table 2, no difference in genotype or allele frequencies in AD subjects and controls reached the statistical significance. The transversion c-20C . A in APH-1a had a genotype OR of 0.77 (95% confidence interval, CI 1.55– 0.37) and an allelotype OR of 0.84 (95% CI 1.63– 0.42); the transition c þ 80C . T in APH-1b had a genotype OR of 1.0 (95% CI 1.77– 0.57) and an allelotype OR of 0.95 (95% CI 1.58– 0.57); the transversion c þ 651T . G in APH-1b had a genotype OR of 2.4 (95% CI 6.83 – 0.87, P ¼ 0:39) and an allelotype OR of 1.95 (95% CI 4.91 –0.73, P ¼ 0:52). The APOE genotyping confirmed the association between the presence of the e4 allele and AD in our sample
M. Poli et al. / Neuroscience Letters 350 (2003) 77–80
79
Table 2 APH-1a and APH-1b polymorphisms: genotypes and alleles distribution in AD and controls APH-1/SNP
Genotype frequency (%)
P
Sporadic AD a/c-20C . A e4 þ e4 2 b/c þ 80C . T e4 þ e4 2 b/c þ 651T . G e4 þ e4 2
Allele frequency (%)
Controls
Sporadic AD
P Controls
CC 98 (86.7) 40 (83.3) 58 (89.2)
CA 14 (12.4) 8 (16.7) 6 (9.2)
AA 1 (0.9) 0 (0) 1 (1.6)
CC 110 (83) 21 (80.8) 89 (84)
CA 22 (17) 5 (19.2) 17 (16)
AA 0 (0) 0 (0) 0 (0)
0.76 0.78 0.34
C 210 (93) 88 (91.7) 122 (93.8)
A 16 (7) 8 (8.3) 8 (6.2)
C 242 (92) 47 (90.4) 195 (92)
A 22 (8) 5 (9.6) 17 (8)
0.87 0.78 0.52
CC 83 (73.4) 37 (77) 46 (70.8)
CT 29 (25.7) 11 (23) 18 (27.7)
TT 1 (0.9) 0 (0) 1 (1.5)
CC 97 (73.5) 19 (73) 78 (73.6)
CT 32 (24.2) 7 (27) 25 (23.6)
TT 3 (2.3) 0 (0) 3 (2.8)
0.68 0.7 0.74
C 195 (86) 85 (88.5) 110 (48.7)
T 31 (14) 11 (11.5) 20 (8.8)
C 226 (86) 45 (86.5) 181 (85.4)
T 38 (14) 7 (13.5) 31 (14.6)
0.83 0.72 0.85
TT 105 (93) 41 (85.4) 64 (98.5)
TG 8 (7) 7 (14.6) 1 (1.5)
GG 0 (0) 0 (0) 0 (0)
TT 128 (97) 26 (100) 102 (96.2)
TG 3 (2.3) 0 (0) 3 (2.9)
GG 1 (0.7) 0 (0) 1 (0.9)
0.39 ,0.05 0.42
T 218 (96) 89 (92.7) 129 (99.2)
G 8 (4) 7 (7.3) 1 (0.8)
T 259 (98) 52 (100) 207 (97.6)
G 5 (2) 0 (0) 5 (2.4)
0.52 ,0.05 0.28
Distribution of genotypes and alleles of the most frequent polymorphisms found in APH-1a/b. Standard Chi-square test or Fisher’s Exact test were applied to evaluate the association with AD. SNP ¼ single nucleotide polymorphism.
(P , 0:001, OR 3.0, 95% CI 4.8– 1.8); when APH-1a/b genotype and allele frequencies were stratified by the APOEe4 carrier status (Table 2), no statistically significant difference was found (c-20C . A and APOE e4: OR 0.84, 95% CI ¼ 2.89 –0.24; c þ 80C . T and APOE e4: OR 0.81, 95% CI ¼ 2.42 – 0.27) with the exception for the coexistence of the transversion c þ 651T . G (F217L) in APH-1b and the APOEe4 allele in AD patients (P , 0:05): of the eight patients carrying the F217L substitution, seven had at least one copy of APOEe4, whereas in control individuals none of the four c þ 651T . G mutations was associated with an APOEe4 allele. Interestingly, in the same group of AD patients (F217L and APOEe4 carriers) three also had the mutation in exon 1 of APH1-b (T27I); none among the four control individuals had the same haplotype. Our study describes sequence variations in exons and nearby intronic regions of APH-1a and APH-1b genes and evaluates their possible association with AD in a group of Italian patients and controls. We detected different SNPs both in APH-1a and APH-1b, but the analysis of genotypes and alleles of the most frequent variations in AD cases and controls did not reveal any statistically significant difference. C-20C . A in APH-1a is located in the non-coding region of exon 1 and is not likely to affect APH1a expression levels. C þ 80C . T predicts the aminoacid substitution T27I but the alignment of APH-1b aminoacidic sequence with different orthologs indicate that threonine 27 is not conserved among species and therefore its substitution with isoleucine probably does not influence protein activity. This could explain the lack of association of these SNPs with AD. As for the c þ 651T . G substitution, even though our study lacks the statistical power to draw definitive conclusion, it is interesting to observe a trend for a possible
risk effect (OR 2.4, 95% CI ¼ 6.83 – 0.87). The variation predicts the aminoacidic substitution F217L; phenylalanine 217 is conserved among different species and could be a relevant aminoacid for APH-1b function, even though its substitutions with leucine should have little chance to determine an important effect on APH-1b structure. Finally, the significance of the association between the c þ 651T . G polymorphism and APOEe4 allele in AD patients is difficult to assess, as the incidence of the mutation is small in our sample and no data about APH-1 protein, structure exist yet. Even though it is interesting to observe that three of these patients also carried a missense substitution in exon 1 of APH-1b, the result could simply reflect the higher prevalence of the APOEe4 allele among AD patients. In conclusion, our current study suggest that sequence variations in APH-1a/b do not affect the risk for SAD in our Italian population sample. The distribution of SNPs in APH1a/b in familial AD cases and in very large populations of SAD should be investigated to fully evaluate their potential as genetic risk factors for AD.
Acknowledgements This work was partially funded by M.I.U.R.COFIN2002 to Alberto Albertini; the authors would like to thank Daniela Beltrami, Selene Romele and Michela Cossandi for technical support.
References [1] E.H. Corder, A.M. Saunders, W.J. Strittmatter, D.E. Schmechel, P.C. Gaskell, G.W. Small, A.D. Roses, J.L. Haines, M.A. Pericak-Vance,
80
[2]
[3]
[4]
[5] [6]
[7]
[8]
[9]
[10]
[11]
[12]
M. Poli et al. / Neuroscience Letters 350 (2003) 77–80 Gene dose of apolipoprotein E type 4 allele and the risk of Alzheimer’s disease in late onset families, Science 261 (1993) 921–923. E.W. Daw, S.C. Heath, E.M. Wijsman, Multipoint oligogenic analysis of age-at-onset data with applications to Alzheimer disease pedigrees, Am. J. Hum. Genet. 64 (1999) 839–851. B. De Strooper, P. Saftig, K. Craessaerts, H. Vanderstichele, G. Guhde, W. Annaert, K. Von Figura, F. Van Leuven, Deficiency of presenilin-1 inhibits the normal cleavage of amyloid precursor protein, Nature 22 (1998) 387–390. D. Edbauer, E. Winkler, C. Haass, H. Steiner, Presenilin and nicastrin regulate each other and determine amyloid beta-peptide production via complex formation, Proc. Natl. Acad. Sci. USA 99 (2002) 8666–8671. W.P. Esler, M.S. Wolfe, A portrait of Alzheimer secretases – new features and familiar faces, Science 293 (2001) 1449–1454. A. Goate, M.C. Chartier-Harlin, M. Mullan, J. Brown, F. Crawford, L. Fidani, L. Giuffra, A. Haynes, N. Irving, L. James, R. Mant, P. Newton, K. Rooke, P. Roques, C. Talbot, M. Pericak-Vance, A. Roses, R. Williamson, M. Rossor, M. Owen, J. Hardy, Segregation of a missense mutation in the amyloid precursor protein gene with familial Alzheimer’s disease, Nature 349 (1991) 704 –706. A.S. Henderson, S. Easteal, A.F. Jorm, A.J. Mackinnon, A.E. Korten, H. Christensen, L. Croft, P.A. Jacomb, Apolipoprotein E allele epsilon 4, dementia, and cognitive decline in a population sample, Lancet 346 (1995) 1387–1390. J.E. Hixson, D.T. Vernier, Restriction isotyping of human apolipoprotein E by gene amplification and cleavage with Hha I, J. Lipid Res. 31 (1990) 545 –548. A.C. Jones, J. Austin, N. Hansen, B. Hoogendoorn, P.J. Oefner, J.P. Cheadle, C. O’Donovan, Optimal temperature selection for mutation detection by denaturing HPLC and comparison to single-stranded conformation polymorphism and heteoduplex analysis, Clin. Chem. 45 (1999) 1133–1140. S.F. Lee, S. Shah, H. Li, C. Yu, W. Han, G. Yu, Mammalian APH-1 interacts with presenilin and nicastrin and is required for intramembrane proteolysis of amyloid-beta precursor protein and Notch, J. Biol. Chem. 277 (2002) 45013–45019. E. Levy-Lahad, E.M. Wijsman, E. Nemens, L. Anderson, K.A. Goddard, J.L. Weber, T.D. Bird, G.D. Schellenberg, A familial Alzheimer’s disease locus on chromosome 1, Science 269 (1995) 970–973. Y.M. Li, M.T. Lai, M. Xu, Q. Huang, J. DiMuzio-Mower, M.K. Sardana, X.P. Shi, K.C. Yin, J.A. Shafer, S.J. Gardell, Presenilin 1 is linked with gamma-secretase activity in the detergent solubilized state, Proc. Natl. Acad. Sci. USA 97 (2000) 6138–6143.
[13] Y.M. Li, M. Xu, M.T. Lai, Q. Huang, J.L. Castro, J. DiMuzio-Mower, T. Harrison, C. Lellis, A. Nadin, J.G. Neduvelil, R.B. Register, M.K. Sardana, M.S. Shearman, A.L. Smith, X.P. Shi, K.C. Yin, J.A. Shafer, S.J. Gardell, Photoactivated gamma-secretase inhibitors directed to the active site covalently label presenilin 1, Nature 405 (2000) 689 –694. [14] W.J. Luo, H. Wang, H. Li, B.S. Kim, S. Shah, H.J. Lee, G. Thinakaran, T.W. Kim, G. Yu, H. Xu, PEN-2 and APH-1 coordinately regulate proteolytic processing of presenilin 1, J. Biol. Chem. 278 (2003) 7850–7854. [15] G. McKhann, D. Drachman, M. Folstein, R. Katzman, D. Price, E.M. Stadlan, Clinical diagnosis of Alzheimer’s disease: report of the NINCDS-ADRDA Work Group under the auspices of Department of Health and Human Services Task Force on Alzheimer’s disease, Neurology 34 (1984) 939–944. [16] R. Sherrington, E.I. Rogaev, Y. Liang, E.A. Rogaeva, G. Levesque, M. Ikeda, H. Chi, C. Lin, G. Li, K. Holman, T. Tsuda, L. Mar, J.-F. Foncin, A.C. Bruni, M.P. Montesi, S. Sorbi, I. Rainero, L. Pinessi, L. Nee, I. Chumakov, D. Pollen, A. Brookes, P. Senseau, R.J. Polinsky, W. Wasco, H.A.R. Da Silva, J.L. Haines, M.A. Pericak-Vance, R.E. Tanzi, A.D. Roses, P.E. Fraser, J.M. Rommens, P.H. St GeorgeHyslop, Cloning of a gene bearing missense mutations in early-onset familial Alzheimer’s disease, Nature 375 (1995) 754 –760. [17] H. Steiner, E. Winkler, D. Edbauer, S. Prokop, G. Basset, A. Yamasaki, M. Kostka, C. Haass, PEN-2 is an integral component of the gamma-secretase complex required for coordinated expression of presenilin and nicastrin, J. Biol. Chem. 277 (2002) 39062–39065. [18] R. Vassar, B.D. Bennett, S. Babu-Khan, S. Kahn, E.A. Mendiaz, P. Denis, D.B. Teplow, S. Ross, P. Amarante, R. Loeloff, Y. Luo, S. Fisher, J. Fuller, S. Edenson, J. Lile, M.A. Jarosinski, A.L. Biere, E. Curran, T. Burgess, J.C. Louis, F. Collins, J. Treanor, G. Rogers, M. Citron, Beta-secretase cleavage of Alzheimer’s amyloid precursor protein by the transmembrane aspartic protease BACE, Science 286 (1999) 735 –741. [19] G. Yu, M. Nishimura, S. Arawaka, D. Levitan, L. Zhang, A. Tandon, Y.Q. Song, E. Rogava, F. Chen, T. Kawarai, A. Supala, L. Levesque, H. Yu, D.S. Yang, E. Holmes, P. Milman, Y. Liang, D.M. Zhang, D.H. Xu, C. Sato, E. Rogaev, M. Smith, C. Janus, Y. Zhang, R. Aebersold, L.S. Farrer, S. Sorbi, A. Bruni, P. Fraser, P. St George-Hyslop, Nicastrin modulates presenilin-mediated notch/glp-1 signal transduction and betaAPP processing, Nature 407 (2000) 48–54. [20] Z. Zhang, P. Nadeau, W. Song, D. Donoviel, M. Yuan, A. Bernstein, B.A. Yankner, Presenilins are required for gamma-secretase cleavage of beta-APP and transmembrane cleavage of Notch-1, Nat. Cell Biol. 2 (2000) 463 –465.
Association analysis between anterior-pharynx defective-1 genes polymorphisms and Alzheimer’s disease Maura Polia, Luisa Benerini Gattaa, Silvana Archettib, Alessandro Padovanic, Alberto Albertinia,b, Dario Finazzia,b,* a
Institute of Chemistry, Faculty of Medicine, University of Brescia, viale Europa 11, 25123 Brescia, Italy b III Servizio di Analisi, Spedali Civili di Brescia, 25123 Brescia, Italy c Department of Neurology, Faculty of Medicine, University of Brescia, viale Europa 11, 25123 Brescia, Italy Received 28 April 2003; received in revised form 3 July 2003; accepted 10 July 2003
Abstract Recent biological studies indicate the importance of anterior-pharynx defective-1 (APH-1) proteins in Alzheimer’s disease (AD) pathogenesis. We scanned APH-1 genes for the presence of sequence variations by denaturing high performance liquid chromatography and analyzed their distribution in an Italian sample of 113 AD patients and 132 controls. We found six different polymorphisms: three of them, all in APH-1b, predict an aminoacid substitution (T27I, V199L and F217L); the others are either silent or in non-coding regions. None of them is significantly associated with the disease; data stratification by the apolipoprotein E e4 carrier status show a trend for coexistence of the transversion c þ 651T . G (F217L) with the e4 allele. Our data suggest that polymorphisms in APH-1a/b coding regions are not linked with higher risk for sporadic AD in our Italian population sample. q 2003 Published by Elsevier Ireland Ltd. Keywords: Alzheimer’s disease; Anterior-pharynx defective-1 genes; Mutation screening; Denaturing high performance liquid chromatography
Alzheimer’s disease (AD) is the most common cause of dementia in the elderly. Different genetic and environmental factors are involved in the development of the disease; heterozygous, highly penetrant mutations in the genes encoding for amyloid precursor protein (APP) [6], presenilin-1 (PS1) [16] and presenilin-2 (PS2) [11] have been linked with the rare cases of familial AD, whereas the apolipoprotein E (APOE) e4 allele has been associated to a higher risk for the more prevalent form of sporadic AD (SAD) [1]. The APOEe4 allele does not account for the entire genetic effect in SAD [2,7] and probably many other common polymorphisms with relatively low penetrance are involved in determining the disease onset. The amyloid cascade hypothesis suggests that b-amyloid (Ab) production is a key event in the pathogenesis of AD. The peptide derives from the proteolysis of APP by two distinct enzymatic activities, generically named beta- and gamma-secretase [5]. Beta-secretase is identified as Betasite APP-cleaning enzyme (BACE) [18], a membrane*
Corresponding author. Tel.: þ 39-30-399-5367; fax: þ39-30-307-251. E-mail address: [email protected] (D. Finazzi).
0304-3940/03/$ - see front matter q 2003 Published by Elsevier Ireland Ltd. doi:10.1016/S0304-3940(03)00857-7
bound aspartyl protease, whereas PS1 and PS2 are required for the g-secretase-mediated process [3,20]. Biochemical evidence actually indicate that g-secretase activity is present in a high molecular weight complex [12,13], which includes presenilins and other cofactors. Recent work [4,10,14,17, 19] has shown that Nicastrin, anterior-pharynx defective-1a (APH-1a), APH-1b and presenilin enhancer 2 (PEN-2) physically interact with presenilins and are necessary for intramembrane proteolysis of APP and other g-secretase substrates. Downregulation of APH-1a and APH-1b by small RNA interference alters the formation of the multimeric complex and strongly reduces the production of Ab [14]. It is therefore possible that sequence variations in APH-1 genes affect g-secretase activity and have a role in determining the risk for sporadic AD. We tested this hypothesis by analysing APH-1a and APH-1b exons and nearby intronic regions for the presence of polymorphisms in an Italian population sample of sporadic AD cases and controls. Patients with probable AD (113) and controls (132) were recruited from the Neurological Clinic of the University of
78
M. Poli et al. / Neuroscience Letters 350 (2003) 77–80
Brescia. They were all included in the study after giving informed consent and the study was conducted in accordance with local research regulations. The diagnosis was assessed according to a standardized protocol meeting the Neurological and Communicative Disorders and Stroke – Alzheimer’s Disease and Related Disorders Association criteria for probable AD [15]. Sporadic AD patients had a mean age of 72 ^ 9 (mean ^ standard deviation); 41 were male and 72 were female. Control subjects had a mean age of 67 ^ 7; 59 were male and 73 female. Genomic DNA was isolated from whole blood and stored at 48C until use. Genotyping for the APOE polymorphisms was performed according to Hixson and Vernier [8]. APH1a and APH-1b (GenBank Accession Number BC001230 and BC020905, respectively) genomic structures consist of seven and six exons respectively, all of which contain coding sequence. Primer pairs and annealing temperatures for the polymerase chain reaction (PCR) amplification of each exon and flanking intronic regions are shown in Table 1. The PCR was performed in a total volume of 50 ml with 200 ng of genomic DNA, 1.5 units of Taq Gold polymerase and Buffer II from Applied Biosystems, 200 mMol of each dNTP and 20 picomoles of each primer. The presence of Table 1 Primers, annealing temperatures and DHPLC analysis temperatures Gene APH1-a Exon 1 Exon 2 Exon 3 Exon 4/5 Exon 6 Exon 7
APH-1b Exon 1 Exon 2 Exon 3 Exon 4 Exon 5 Exon 6
Primers
A.T. (8C)
L. (bp)
T. (8C)
catttgcctgtcctggtcaggc cctctctcttcgacgctctccc gcttgtctcactgcccctgtc cccctccagaccactccatct cctcatgtttcccctaccccac gtccaactccctcctccagtcc gggtcagtggtgaacaggcaatag tctccctaactcaggcccctgtc ggggattaggtcgagggagaatc cagtcatgggcagtggacagg caggactccccctgtgtca tgtccagaactggagatggag
61
209
65.2
61
228
62.8
61
144
61.5
60
499
58.9
60
246
60.5
59
214
63.8
62
188
65.8
60
285
54.8
61
179
54.7
59
214
57.9
61
223
59.8
60
349
56.2
gcatctcgcgtccccaacg gtccgggtttcccgacgc cattattaatcctgtactgatgttcacttg ccaaatcataactaaaatctaactgggg ttggactttcctgatatattgctcttc ttccttaatgaaaccatgtggttctaac acttgaaatcttggcaggaaaagag agactagaagcctgaatgttgacag tcctcagtggttctgtgatacctg tccagaatacagtctgagcatggc gcttgctgttattacccaagctga gccaagtcaatggaacgcatatct
Forward and reverse primers for the amplification of each exon of APH1a and APH-1b are shown together with the annealing temperature (A.T.) applied in PCR cycles, the length (L) in base pairs (bp) of each amplicon and the starting temperature (T) applied for DHPLC analysis.
sequence variations was searched for by denaturing high performance liquid chromatography (DHPLC), a highly sensitive and specific technique for detecting mutations. All DHPLC analysis were performed on WAVEe DNA fragment Analysis System (Transgenomic) equipped with a DNASepe column. Chromatography was performed with Buffer A (0.1 M triethilammonium acetate) and B (0.1 M triethilammonium acetate in 25% acetonitrile), with eluent conditions determined by WAVEMAKER software (version 4.1; Transgenomic). The analysis temperatures for mutation detection were derived from software predicted melting profiles (Table 1). In order to reach the maximal sensitivity, a second analysis at a temperature 28C higher was performed whenever the first run did not detect any sequence variation [9]. Direct sequencing of PCR products with aberrant DHPLC elution patterns revealed two types of single nucleotide polymorphism (SNP) in APH-1a and four in APH-1b. SNPs in APH-1a were found in exon 1 (c20C . A) and in the intronic region between exons 4 and 5 (IVS4 þ 34C . T); those in APH-1b were in exon 1 (c þ 80C . T), in intron 2 (IVS2-28C . A), in exon 5 (c þ 595G . T), and in exon 6 (c þ 651T . G). The transversion c-20C . A in APH-1a and the transition c þ 80C . T in APH-1b are the most frequent in our sample of 245 subjects, with an incidence of 15 and 26%, respectively. The others are rare (5% incidence for the transversion c þ 651T . G and less than 1% for IVS4 þ 34C . T and IVS2-28C . A). Interestingly, c þ 80C . T, c þ 595G . T and c þ 651T . G predict aminoacid substitutions at codon 27 (T27I), at codon 199 (V199L) and at codon 217 (F217L) of APH-1b protein, respectively. The others are in non-coding or intronic regions. To evaluate the possibility that the two most frequent DNA variations (c-20C . A and c þ 80C . T) affect susceptibility to SAD, the distributions of their genotypes and alleles were determined in patients and controls and statistically analyzed by the standard Chisquare test and the Fisher’s Exact test when necessary. Differences at P , 0:05 were considered significant. Our study had 80% power to detect an odds ratio (OR) of 2.4 for a risk effect and an OR of 0.4 for a protective effect. Even though the incidence of the c þ 651T . G substitution is too low to guarantee sufficient statistical power, we analyzed also its distribution. As shown in Table 2, no difference in genotype or allele frequencies in AD subjects and controls reached the statistical significance. The transversion c-20C . A in APH-1a had a genotype OR of 0.77 (95% confidence interval, CI 1.55– 0.37) and an allelotype OR of 0.84 (95% CI 1.63– 0.42); the transition c þ 80C . T in APH-1b had a genotype OR of 1.0 (95% CI 1.77– 0.57) and an allelotype OR of 0.95 (95% CI 1.58– 0.57); the transversion c þ 651T . G in APH-1b had a genotype OR of 2.4 (95% CI 6.83 – 0.87, P ¼ 0:39) and an allelotype OR of 1.95 (95% CI 4.91 –0.73, P ¼ 0:52). The APOE genotyping confirmed the association between the presence of the e4 allele and AD in our sample
M. Poli et al. / Neuroscience Letters 350 (2003) 77–80
79
Table 2 APH-1a and APH-1b polymorphisms: genotypes and alleles distribution in AD and controls APH-1/SNP
Genotype frequency (%)
P
Sporadic AD a/c-20C . A e4 þ e4 2 b/c þ 80C . T e4 þ e4 2 b/c þ 651T . G e4 þ e4 2
Allele frequency (%)
Controls
Sporadic AD
P Controls
CC 98 (86.7) 40 (83.3) 58 (89.2)
CA 14 (12.4) 8 (16.7) 6 (9.2)
AA 1 (0.9) 0 (0) 1 (1.6)
CC 110 (83) 21 (80.8) 89 (84)
CA 22 (17) 5 (19.2) 17 (16)
AA 0 (0) 0 (0) 0 (0)
0.76 0.78 0.34
C 210 (93) 88 (91.7) 122 (93.8)
A 16 (7) 8 (8.3) 8 (6.2)
C 242 (92) 47 (90.4) 195 (92)
A 22 (8) 5 (9.6) 17 (8)
0.87 0.78 0.52
CC 83 (73.4) 37 (77) 46 (70.8)
CT 29 (25.7) 11 (23) 18 (27.7)
TT 1 (0.9) 0 (0) 1 (1.5)
CC 97 (73.5) 19 (73) 78 (73.6)
CT 32 (24.2) 7 (27) 25 (23.6)
TT 3 (2.3) 0 (0) 3 (2.8)
0.68 0.7 0.74
C 195 (86) 85 (88.5) 110 (48.7)
T 31 (14) 11 (11.5) 20 (8.8)
C 226 (86) 45 (86.5) 181 (85.4)
T 38 (14) 7 (13.5) 31 (14.6)
0.83 0.72 0.85
TT 105 (93) 41 (85.4) 64 (98.5)
TG 8 (7) 7 (14.6) 1 (1.5)
GG 0 (0) 0 (0) 0 (0)
TT 128 (97) 26 (100) 102 (96.2)
TG 3 (2.3) 0 (0) 3 (2.9)
GG 1 (0.7) 0 (0) 1 (0.9)
0.39 ,0.05 0.42
T 218 (96) 89 (92.7) 129 (99.2)
G 8 (4) 7 (7.3) 1 (0.8)
T 259 (98) 52 (100) 207 (97.6)
G 5 (2) 0 (0) 5 (2.4)
0.52 ,0.05 0.28
Distribution of genotypes and alleles of the most frequent polymorphisms found in APH-1a/b. Standard Chi-square test or Fisher’s Exact test were applied to evaluate the association with AD. SNP ¼ single nucleotide polymorphism.
(P , 0:001, OR 3.0, 95% CI 4.8– 1.8); when APH-1a/b genotype and allele frequencies were stratified by the APOEe4 carrier status (Table 2), no statistically significant difference was found (c-20C . A and APOE e4: OR 0.84, 95% CI ¼ 2.89 –0.24; c þ 80C . T and APOE e4: OR 0.81, 95% CI ¼ 2.42 – 0.27) with the exception for the coexistence of the transversion c þ 651T . G (F217L) in APH-1b and the APOEe4 allele in AD patients (P , 0:05): of the eight patients carrying the F217L substitution, seven had at least one copy of APOEe4, whereas in control individuals none of the four c þ 651T . G mutations was associated with an APOEe4 allele. Interestingly, in the same group of AD patients (F217L and APOEe4 carriers) three also had the mutation in exon 1 of APH1-b (T27I); none among the four control individuals had the same haplotype. Our study describes sequence variations in exons and nearby intronic regions of APH-1a and APH-1b genes and evaluates their possible association with AD in a group of Italian patients and controls. We detected different SNPs both in APH-1a and APH-1b, but the analysis of genotypes and alleles of the most frequent variations in AD cases and controls did not reveal any statistically significant difference. C-20C . A in APH-1a is located in the non-coding region of exon 1 and is not likely to affect APH1a expression levels. C þ 80C . T predicts the aminoacid substitution T27I but the alignment of APH-1b aminoacidic sequence with different orthologs indicate that threonine 27 is not conserved among species and therefore its substitution with isoleucine probably does not influence protein activity. This could explain the lack of association of these SNPs with AD. As for the c þ 651T . G substitution, even though our study lacks the statistical power to draw definitive conclusion, it is interesting to observe a trend for a possible
risk effect (OR 2.4, 95% CI ¼ 6.83 – 0.87). The variation predicts the aminoacidic substitution F217L; phenylalanine 217 is conserved among different species and could be a relevant aminoacid for APH-1b function, even though its substitutions with leucine should have little chance to determine an important effect on APH-1b structure. Finally, the significance of the association between the c þ 651T . G polymorphism and APOEe4 allele in AD patients is difficult to assess, as the incidence of the mutation is small in our sample and no data about APH-1 protein, structure exist yet. Even though it is interesting to observe that three of these patients also carried a missense substitution in exon 1 of APH-1b, the result could simply reflect the higher prevalence of the APOEe4 allele among AD patients. In conclusion, our current study suggest that sequence variations in APH-1a/b do not affect the risk for SAD in our Italian population sample. The distribution of SNPs in APH1a/b in familial AD cases and in very large populations of SAD should be investigated to fully evaluate their potential as genetic risk factors for AD.
Acknowledgements This work was partially funded by M.I.U.R.COFIN2002 to Alberto Albertini; the authors would like to thank Daniela Beltrami, Selene Romele and Michela Cossandi for technical support.
References [1] E.H. Corder, A.M. Saunders, W.J. Strittmatter, D.E. Schmechel, P.C. Gaskell, G.W. Small, A.D. Roses, J.L. Haines, M.A. Pericak-Vance,
80
[2]
[3]
[4]
[5] [6]
[7]
[8]
[9]
[10]
[11]
[12]
M. Poli et al. / Neuroscience Letters 350 (2003) 77–80 Gene dose of apolipoprotein E type 4 allele and the risk of Alzheimer’s disease in late onset families, Science 261 (1993) 921–923. E.W. Daw, S.C. Heath, E.M. Wijsman, Multipoint oligogenic analysis of age-at-onset data with applications to Alzheimer disease pedigrees, Am. J. Hum. Genet. 64 (1999) 839–851. B. De Strooper, P. Saftig, K. Craessaerts, H. Vanderstichele, G. Guhde, W. Annaert, K. Von Figura, F. Van Leuven, Deficiency of presenilin-1 inhibits the normal cleavage of amyloid precursor protein, Nature 22 (1998) 387–390. D. Edbauer, E. Winkler, C. Haass, H. Steiner, Presenilin and nicastrin regulate each other and determine amyloid beta-peptide production via complex formation, Proc. Natl. Acad. Sci. USA 99 (2002) 8666–8671. W.P. Esler, M.S. Wolfe, A portrait of Alzheimer secretases – new features and familiar faces, Science 293 (2001) 1449–1454. A. Goate, M.C. Chartier-Harlin, M. Mullan, J. Brown, F. Crawford, L. Fidani, L. Giuffra, A. Haynes, N. Irving, L. James, R. Mant, P. Newton, K. Rooke, P. Roques, C. Talbot, M. Pericak-Vance, A. Roses, R. Williamson, M. Rossor, M. Owen, J. Hardy, Segregation of a missense mutation in the amyloid precursor protein gene with familial Alzheimer’s disease, Nature 349 (1991) 704 –706. A.S. Henderson, S. Easteal, A.F. Jorm, A.J. Mackinnon, A.E. Korten, H. Christensen, L. Croft, P.A. Jacomb, Apolipoprotein E allele epsilon 4, dementia, and cognitive decline in a population sample, Lancet 346 (1995) 1387–1390. J.E. Hixson, D.T. Vernier, Restriction isotyping of human apolipoprotein E by gene amplification and cleavage with Hha I, J. Lipid Res. 31 (1990) 545 –548. A.C. Jones, J. Austin, N. Hansen, B. Hoogendoorn, P.J. Oefner, J.P. Cheadle, C. O’Donovan, Optimal temperature selection for mutation detection by denaturing HPLC and comparison to single-stranded conformation polymorphism and heteoduplex analysis, Clin. Chem. 45 (1999) 1133–1140. S.F. Lee, S. Shah, H. Li, C. Yu, W. Han, G. Yu, Mammalian APH-1 interacts with presenilin and nicastrin and is required for intramembrane proteolysis of amyloid-beta precursor protein and Notch, J. Biol. Chem. 277 (2002) 45013–45019. E. Levy-Lahad, E.M. Wijsman, E. Nemens, L. Anderson, K.A. Goddard, J.L. Weber, T.D. Bird, G.D. Schellenberg, A familial Alzheimer’s disease locus on chromosome 1, Science 269 (1995) 970–973. Y.M. Li, M.T. Lai, M. Xu, Q. Huang, J. DiMuzio-Mower, M.K. Sardana, X.P. Shi, K.C. Yin, J.A. Shafer, S.J. Gardell, Presenilin 1 is linked with gamma-secretase activity in the detergent solubilized state, Proc. Natl. Acad. Sci. USA 97 (2000) 6138–6143.
[13] Y.M. Li, M. Xu, M.T. Lai, Q. Huang, J.L. Castro, J. DiMuzio-Mower, T. Harrison, C. Lellis, A. Nadin, J.G. Neduvelil, R.B. Register, M.K. Sardana, M.S. Shearman, A.L. Smith, X.P. Shi, K.C. Yin, J.A. Shafer, S.J. Gardell, Photoactivated gamma-secretase inhibitors directed to the active site covalently label presenilin 1, Nature 405 (2000) 689 –694. [14] W.J. Luo, H. Wang, H. Li, B.S. Kim, S. Shah, H.J. Lee, G. Thinakaran, T.W. Kim, G. Yu, H. Xu, PEN-2 and APH-1 coordinately regulate proteolytic processing of presenilin 1, J. Biol. Chem. 278 (2003) 7850–7854. [15] G. McKhann, D. Drachman, M. Folstein, R. Katzman, D. Price, E.M. Stadlan, Clinical diagnosis of Alzheimer’s disease: report of the NINCDS-ADRDA Work Group under the auspices of Department of Health and Human Services Task Force on Alzheimer’s disease, Neurology 34 (1984) 939–944. [16] R. Sherrington, E.I. Rogaev, Y. Liang, E.A. Rogaeva, G. Levesque, M. Ikeda, H. Chi, C. Lin, G. Li, K. Holman, T. Tsuda, L. Mar, J.-F. Foncin, A.C. Bruni, M.P. Montesi, S. Sorbi, I. Rainero, L. Pinessi, L. Nee, I. Chumakov, D. Pollen, A. Brookes, P. Senseau, R.J. Polinsky, W. Wasco, H.A.R. Da Silva, J.L. Haines, M.A. Pericak-Vance, R.E. Tanzi, A.D. Roses, P.E. Fraser, J.M. Rommens, P.H. St GeorgeHyslop, Cloning of a gene bearing missense mutations in early-onset familial Alzheimer’s disease, Nature 375 (1995) 754 –760. [17] H. Steiner, E. Winkler, D. Edbauer, S. Prokop, G. Basset, A. Yamasaki, M. Kostka, C. Haass, PEN-2 is an integral component of the gamma-secretase complex required for coordinated expression of presenilin and nicastrin, J. Biol. Chem. 277 (2002) 39062–39065. [18] R. Vassar, B.D. Bennett, S. Babu-Khan, S. Kahn, E.A. Mendiaz, P. Denis, D.B. Teplow, S. Ross, P. Amarante, R. Loeloff, Y. Luo, S. Fisher, J. Fuller, S. Edenson, J. Lile, M.A. Jarosinski, A.L. Biere, E. Curran, T. Burgess, J.C. Louis, F. Collins, J. Treanor, G. Rogers, M. Citron, Beta-secretase cleavage of Alzheimer’s amyloid precursor protein by the transmembrane aspartic protease BACE, Science 286 (1999) 735 –741. [19] G. Yu, M. Nishimura, S. Arawaka, D. Levitan, L. Zhang, A. Tandon, Y.Q. Song, E. Rogava, F. Chen, T. Kawarai, A. Supala, L. Levesque, H. Yu, D.S. Yang, E. Holmes, P. Milman, Y. Liang, D.M. Zhang, D.H. Xu, C. Sato, E. Rogaev, M. Smith, C. Janus, Y. Zhang, R. Aebersold, L.S. Farrer, S. Sorbi, A. Bruni, P. Fraser, P. St George-Hyslop, Nicastrin modulates presenilin-mediated notch/glp-1 signal transduction and betaAPP processing, Nature 407 (2000) 48–54. [20] Z. Zhang, P. Nadeau, W. Song, D. Donoviel, M. Yuan, A. Bernstein, B.A. Yankner, Presenilins are required for gamma-secretase cleavage of beta-APP and transmembrane cleavage of Notch-1, Nat. Cell Biol. 2 (2000) 463 –465.