Association Behaviour of Human βB1-Crystallin and its Truncated Forms

Exp. Eye Res. (2001) 73, 321±331 doi:10.1006/exer.2001.1038, available online at http://www.idealibrary.com on

Association Behaviour of Human bB1-Crystallin and its Truncated Forms O . A. B AT E M AN a, N . H . LU B SEN b

AND

C. S L I N GS BY a*

a

Birkbeck College, Department of Crystallography, Malet Street, London, WC1E 7HX, U.K. and b Department of Biochemistry, University of Nijmegen, Nijmegen, The Netherlands (Received Oxford 3 January 2001, accepted in revised form 27 April 2001 and published electronically 25 June 2001) bB1-crystallin plays an important role in the assembly of bH-crystallin yet is known to be subject to Nterminal sequence truncations during human lens development and ageing. Here we have over-expressed human bB1-crystallin, and various truncated forms in Escherichia coli and used mass spectrometry to monitor the monomer molecular weight. Gel permeation chromatography and laser light scattering have been used to estimate the assembly size of the various polypeptides as a function of protein concentration. The full-length bB1-crystallin behaves as a dimer, like recombinant human bB2-crystallin, but undergoes further self-association at high protein concentrations, unlike the bB2-crystallin. Major truncations from the N-terminal extension lead to anomalous behaviour on gel permeation chromatography indicative of altered interactions with the column matrix, whereas light scattering indicated dimers at low protein concentration that self-associate as a function of protein concentration. Loss of 41 residues from the Nterminus, equivalent to an in vivo truncation site, resulted in temperature-dependent phase separation behaviour of the shortened bB1-crystallin. Good crystals have been grown of a truncated version of # 2001 Academic Press human bB1-crystallin using an in vitro cleavage protocol. Key words: bB1; bH-crystallin; crystals; dimers; extensions; lens; phase separation; truncations.

1. Introduction The transparency of the normal eye lens is dependent on its ability to bring crystallins to a high concentration inside the ®bre cells where they exhibit liquid or glass-like short range order which in turn creates a medium of high refractive index (Delaye and Tardieu, 1983). Light scattering in the eye lens increases with age and causes cataract because the ageing crystallin proteins are no longer evenly distributed on the scale of light wavelength (Benedek, 1997). The bulk soluble proteins of eye lenses consist of the hetero-polymer a-crystallin, the monomeric family of g-crystallins and the complex mixture of b-crystallin oligomers formed from seven related polypeptide chains (de Jong, Lubsen and Kraft, 1994). Differential gene activation during development creates different levels of these various crystallin subunits along the optical axis (Piatigorsky and Zelenka, 1992). Sequencing studies have substantiated the class division of b-crystallins into basic (bB1, bB2, bB3) and acidic (bA1, bA2, bA3, bA4) branches with characteristic structural differences (Berbers et al., 1984), although this classi®cation does not hold in terms of charge properties for all species (Duncan et al., 1996). Recent 2D protein analyses have shown that the relative proportions of the different b-crystallin subunits is species speci®c (David et al., 2000). * Author for correspondence. E-mail: [email protected]. ac.uk

0014-4835/01/090321‡11 $35.00/0

Sequencing and 3D structural studies have shown that members of the bg-crystallin superfamily are each formed from two similar compact domains joined by a short linker (Bax et al., 1990; de Jong et al., 1994; Slingsby et al., 1997). The major structural difference between the b- and g-crystallin families is the intramolecular domain pairing of the monomeric g-crystallins as contrasted with the intermolecular domain pairing of partner subunits in the dimeric bB2-crystallin. b-Crystallins are, however, distinct from g-crystallins in that they have variable sequence extensions, with basic b-crystallins having both Nand C-terminal extensions (de Jong et al., 1994). As neither X-ray crystallography (Lapatto et al., 1991) nor 2D NMR (Carver, Cooper and Truscott, 1993) could assign a stabilizing function for sequence extensions in the bB2 dimer, extensions became prime candidates for a role in higher assembly (Cooper et al., 1994). Recent evidence suggests that the sequence extensions of bB2 are involved in stabilizing higher hetero-oligomeric interactions with bA3 (Werten et al., 1999). When the concentrated cytoplasm of the eye lens is diluted with aqueous buffers, gel permeation chromatography indicates three size classes of b-crystallin oligomers. In bovine lens these are named in order of size bH-, bL1- and bL2-crystallin, with the latter being mainly comprised of bB2-crystallin dimer (Bindels, Koppers and Hoenders, 1981; Slingsby and Bateman, 1990; Zarina et al., 1994). Separation of these three fractions is sensitive to buffer conditions and # 2001 Academic Press

322

bH-crystallin exhibits a concentration dependent equilibrium with smaller oligomers (Siezen, Anello and Thomson, 1986; Bateman and Slingsby, 1992). Analysis of the bovine subunit compositions of differently sized oligomers clearly indicated a correlation of bB1 with the approximately 200 kDa bHcrystallin (Berbers et al., 1982; Slingsby and Bateman, 1990; Cooper et al., 1994) although a confounding factor is the age of the lens, which correlates with posttranslational modi®cations. In adult human lens the b-crystallin components also associate to form three size fractions (Zigler, Horwitz and Kinoshita, 1980). However, in fetal lenses, the higher molecular weight b-crystallins predominate with the smaller oligomers increasing in proportion with development (Thomson and Augusteyn 1985; Alcala et al., 1988). More recently, Ma et al. (1998) observed two b-crystallin peaks in the water soluble fraction of human fetal lens, bH- and bL2-crystallin (as was also found for fetal bovine lens, Bateman and Slingsby, unpublished), with the intermediate bL1-crystallin peak only appearing at 1 year. Mass spectroscopy technology has shown extensive degradation of the Nterminal bB1 polypeptide in humans, ranging from the removal of 15 to 41 amino acids (see Fig. 1), with substantial cleavage of the ®rst 15 residues occurring in a new-born lens (David et al., 1996). In the young human lens bB1 accounts for approximately 9 % of the total soluble protein (Lampi et al., 1997) whereas in the adult lens, truncated bB1 is a major component of the soluble protein (Lampi et al., 1998). The subunit components of the three size classes of b-crystallin oligomers from a 56 year old human lens have been identi®ed: full-length bB1 was a major component of bH-crystallin, as was bB1 missing 15 residues (Ajaz et al., 1997). This parallels the situation in the bovine lens where both full-length bB1 and a version lacking the ®rst 14 residues are

F IG . 1. The cleavage sites of human bB1-crystallin. The N- and C-terminal extensions are underlined and annotated to show in vivo (m) and in vitro (n) cleavage sites.

O . A . B AT E M A N E T A L .

found only in the higher molecular weight bHcrystallin (Berbers et al., 1982) suggesting a similar protease is responsible (David et al., 1996). Progressive N-terminal truncations of human bB1 were found in the differently sized oligomers (Ajaz et al., 1997) and the degree of truncation increases with age (Ma et al., 1998). These observations provided strong support for the importance of bB1 in controlling higher oligomer assembly, and furthermore that the higher-order bH-crystallin is made early with some of the smaller assemblies being derived from them through N-terminal clipping of bB1. Obviously the inter-relationships among the b-crystallins are very complex, involving interfaces and sequence extensions in dynamic equilibrium. Analysis of the single component bB1-crystallin is one way to start to de®ne the detailed molecular interactions involved. Although bovine bB1 can be isolated from urea-denatured lens derived bH-crystallin oligomers (Bateman and Slingsby, 1992), it cannot be refolded in a soluble form, a feature that may be related to the large number of Ala-Pro repeats in the bovine N-terminal extension (Berbers et al., 1983). The aim of this work is to investigate some biophysical properties of recombinant full-length and truncated human bB1-crystallins as a ®rst step towards de®ning the solution properties of human b-crystallins and the higher oligomer quaternary organization of b-crystallins. 2. Materials and Methods Cloning and Transformation of Expression Plasmids Containing Human bB1 (and Truncated Forms) and Human bB2-crystallins The human bB1 coding sequence was isolated from a human fetal lens cDNA library by PCR using the primers CATATGTCTCAGGCTGCAAAGGCCTCG (forward) and GGATCCGACTCACTTGGGGGGCTCTGTGGC (reverse). These primers introduce a NdeI site at the ATG start codon and a BamHI site 30 of the stop codon. The PCR product was cloned in pBluescript and sequenced. The insert was then recloned NdeI/ BamHI in pET3a (Rosenberg et al., 1987). For the truncation mutants, the shortened coding sequences were ampli®ed from the pBluescript cDNA clone using the appropriate 50 and 30 primers. The 50 truncation primers were: DN6, CATATGTCGGCCTCGGCCACAGTGGCG; DN41, CATATGACCGTGCCTATTACCAGCGCCAAG; DN49, CATATGGCGGCGGAACTGCCTCCTGGG. The 30 truncation primers were: DC6, CTCACAGGACAGGGAAGGACCCCTC; DC12, CTCACTCGAGGTGCCACTGCTTGTCAC. The PCR products were cloned in pBluescript, sequenced and transferred to the pET3a vector using the 50 NdeI site introduced by the primer and the 30 BamHI site present in the vector polylinker. The human bB2 coding sequence was isolated essentially as described for the bB1 coding sequence

B E H AV I O U R O F b B 1 - C R Y S TA L L I N

323

TABLE I The calculated molecular masses of human bB1 and the truncated forms

glucose) with Pefabloc SC (Merck, Leicester, U.K.) added as a protease inhibitor before storage at ÿ208C. Human bB1 Expressed in E. coli Strain HMS 174

Mass (MrDa)

Sequence

27892 27335 26649 23992 23523 22770 22170 24192

1-251 (HbB1) 7-251 (HbB1DN6) 15-251 (HbB1DN14) 44-251 (HbB1DN43) 49-251 (HbB1DN48) 50-245 (HbB1DN49C6) 50-239 (HbB1DN49C12) 42-251 (HbB1DN41)

Full length In vitro cleavage sites In vitro cleavage sites In vitro cleavage sites In vitro cleavage sites In vitro cleavage sites In vitro cleavage sites In vivo cleavage site

using the primers: GCATATGGCCTCAGATCACCAGA (forward); CGGATCCTGGGAAGGAGGCATG (reverse). After cloning in pBluescript and sequencing, the bB2 coding sequence was inserted using NdeI/BamHI into the pET3a vector. Protein Expression in Escherichia coli Strain BL21 The expression constructs for human bB1, bB1DN6, bB1DN41, bB1DN49/DC12 and human bB2 (Table I) were transformed into E. coli strain BL21(DE3) pLysS competent cells and then colonies picked to inoculate and grow up overnight at 378C with shaking in 10 ml 2YT medium (5 g l ÿ1 NaCl, 10 g l ÿ1 yeast extract, 16 g l ÿ1 select peptone 140) with 10 ml ampicillin and 15 ml chloramphenicol (100 mg ml ÿ1) (34 mg ml ÿ1). Large-scale growth was performed using an inoculation at 1 % v/v with overnight culture of 500 ml 2YT medium containing 500 ml ampicillin (100 mg ml ÿ1 aqueous solution). The ¯asks were shaken at 378C and induced by the addition of isopropyl-b-D-thiogalactopyranoside (IPTG) to give a concentration of 0.5 mM when the OD550 was between 0.4 and 0.6, about 2 hr after inoculation. Growth was rapid such that cells could be harvested 3±4 hr after induction by centrifugation at 5000 rpm and 48C for 15 min. Pellets were resuspended in 10 ml TEG lysis buffer (25 mM Tris±HCl, pH 8.0, 10 mM EDTA, 50 mM

The expression construct for full length human bB1 was transformed into E. coli strain HMS174(DE3) pLysS competent cells. Induction was performed 3.5±4.5 hr after inoculation and cell growth was then continued overnight when the cell pellets were harvested. Protein Puri®cation The ®rst step in the isolation of each of these proteins was the preparation of whole cell lysate. The cell pellet was thawed, MgCl2 and DNAse 1 added to the suspension (i.e. cells in TEG) to ®nal concentrations of 10 mM and 10 mg ml ÿ1, respectively, and then sonicated on ice using pulses of 10 sec with cooling between pulses. The pellet was then spun down at 18 000 rpm at 48C for 30 min when the supernatant was placed in dialysis tubing and dialysed overnight at 48C against buffer A (25 mM Tris±HCl, pH 8.0, 1 mM EDTA, 1 mM DTT). The solution was then ®ltered through 0.4 mm followed by 0.2 mm nitrocellulose ®lters before being loaded onto a HiLoad 16/10 Q Sepharose high performance column (Pharmacia, Bucks, U.K.). The column was run at 4 ml min ÿ1. Following an initial step of 20 ml of buffer A, the protein was eluted with a salt gradient of 0±70 % buffer B over 160 ml. The column was then equilibrated for the next sample application with 60 ml of buffer B and ®nally with 100 ml of buffer A. Details of calculated pIs for each protein construct and the various elution buffers for the Q Sepharose columns are given in Table II. The location of the protein was determined by running peak samples on SDS±PAGE. The protein in the indicated peak was further characterized by desalting a sample on a 1 ml Resource RPC column (Pharmacia) and then mass spectrometry was used to ensure that there was agreement with the calculated sequence mass (Table I).

TABLE II Calculated pIs and ion-exchange characteristics of recombinant human b-crystallins Q Sepharose Recombinant protein HbB1 HbB1DN6 HbB1DN6 HbB1DN41 HbB1DN49DC12 HbB2

Calculated pI

Buffer pH

9.4 9.2 9.2 7.8 6.2 6.6

8.0 8.0 8.0 8.0 8.0 8.0

Mono Q

% Buffer B 18 19 ± 24 28 22

Buffer pH

% Buffer B

8.5 8.0 8.5 8.0 8.0 8.0

5±6 4 8±9 7±8 17 7

324

The proteins were further puri®ed following desalting and concentration of the protein solution using an Amicon stirred ultra®ltration cell ®tted with a YM 30 membrane. The protein samples were loaded onto an 8 ml Mono Q column (Pharmacia) at pH 8.0 or 8.5 (buffer A). The column was run at 4 ml min ÿ1. The elution programme ®rst ran 2 bed volumes of buffer A, then a gradient of buffer B from 0 to 15 % over 10 bed volumes, followed by 2 bed volumes of 100 % buffer B and ®nally 2 bed volumes of buffer A. The elution salt concentration for each of the proteins from the Mono Q column is given in Table II. The eluted proteins were again desalted, concentrated and equilibrated into buffer for crystallization, gel permeation chromatography and dynamic light scattering studies. Mass Spectrometry The molecular mass of expressed proteins was monitored regularly before and during crystallization trials and general sizing experiments using an Electrospray ionization mass spectrometer (ESIMS) (Micromass, Cheshire, U.K.). Sample preparation depended upon the source of the protein solution. Samples that had been run on the Resource RPC column eluted in TFA/CH3CN/H2O and so could be injected directly into the mass spectrometer without further sample preparation. Protein samples that had been desalted and concentrated were diluted to give a concentration of around 0.2 mg ml ÿ1 in 0.5 % HCOOH/CH3CN/H2O. When only very small amounts of protein samples were available then a C4 ZipTip (Millipore, Herts, U.K.) was used to obtain 10 ml of desalted solution in HCOOH/CH3CN/H2O which could then be injected directly into the instrument. The instrument was run in positive ion mode with a continuous phase of 50 % v/v CH3CN/H2O pumped at 10 ml min ÿ1. Scans of 10 sec duration were collected for 2 min over the range of 750±1150 m/z from an injected 10 ml of sample. Data were processed using the MassLynx 3.4 software. Gel Permeation Chromatography Samples of the proteins (200 ml) were loaded onto a Superose 12 HR 10/30 column (Pharmacia) on an FPLC. The column was run at 0.5 ml min ÿ1 with a 25 mM Bis±Tris±Propane±HCl, 200 mM NaCl, pH 7.0 buffer. The Superose 12 column was calibrated with low molecular weight markers (Pharmacia). The elution volume (Ve) of the b-crystallin solutions at a range of concentrations was determined. Measurement of Protein Concentration Protein concentration was determined by diluting the protein solution such that it gave an A280 in the range of 0.1±0.5 and then the extinction coef®cient was used to calculate the concentration of the full

O . A . B AT E M A N E T A L .

strength solution. The calculated extinction coef®cients [absorption of 0.1 % (1 g l ÿ1) at 280 nm with a 1 cm path length] for the human recombinant proteins are: bB1 ˆ 2.05, bB1DN6 ˆ 2.1, bB1DN41 ˆ 2.4, bB1DN49/DC12 ˆ 2.6. The extinction coef®cients and pIs for the proteins examined were obtained from the L'Atelier Bioinformatique de Marseille (ABIM) site (http://www. up.univ-mrs.fr/  wabim/d_abim/compo-p.html). Dynamic Light Scattering A DynaPro-801 from Protein Solutions was used to obtain right angle laser light scattering (RALLS) data. Samples were diluted as required using the gel permeation chromatography (GPC) running buffer. The range of concentrations investigated was devised to match those used in the GPC measurements provided that the scattering obtained fell within the range which could be detected by the instrument. Data were processed using the Protein Solutions Dynamics software package, version 5.25.44. The instrument required a volume of approximately 250 ml of the protein solution but this could be retrieved for further measurements at other concentrations to be made. Extrapolation to zero protein concentration for the RALLS data yielded values for Mr. The polydispersity (Cp) of the protein samples was determined from the standard deviation of the distribution of values obtained for the hydrodynamic radii (RH). An indication of the presence of a reasonably narrow range of monomodal apparent molecular weight species present in the sample was given if the polydispersity index (Cp/RH) was typically less than 30 % (Ferre-D'Amare and Burley, 1997). However, Protein Solutions suggested that a polydispersity index of 515 % indicated an essentially monodisperse solution whereas a value 415 % meant that the sample was polydisperse (DynaProÐ801 Operator's Manual Version 4.0). Crystallization For each of the samples, the puri®ed protein peaks were batched and the concentration was estimated from the total volume and the extinction coef®cient. The solution was concentrated initially using an Amicon stirred ultra®ltration cell ®tted with a YM30 membrane (Amicon, Millipore). The reduced volume was then transferred to Microcon 30 (Amicon, Millipore) when the volume was further reduced. Desalting and equilibration into 25 mM Tris±HCl, pH 8.0, 1 mM DTT was performed by repeated spinning down to a small volume and then by addition of the buffer. Proteins at around 10 mg ml ÿ1 were scanned for crystallization conditions using crystal screens (Hampton Research, CA, U.S.A.). All crystallization trials were set up in VDX plates (Hampton) the crystals being grown by vapour

B E H AV I O U R O F b B 1 - C R Y S TA L L I N

diffusion. Usually the hanging drop technique was employed but occasionally sitting drops were set up in micro bridges. Drop size varied between 1 ml protein solution plus 1 ml well solution in hanging drops up to 5 ml protein solution plus 5 ml well solution used in sitting drops. During optimization, the ratio of protein solution : well solution was varied in an attempt to improve crystal morphology and/or size. All trials were set up at room temperature after initial trials showed that crystal growth was not improved by keeping the trays at a lower temperature. Promising conditions were then pursued in order to optimize crystal size and morphology. Phase Separation Solutions of recombinant human bB1, bB1DN6 and bB1DN41 at a concentration of around 20 mg ml ÿ1 in 0.05 M sodium phosphate pH 7.0 were examined for their ability to undergo reversible cryo-precipitation or phase separation. The initial concentrations of the solutions were determined after they were spun down at 14 000 rpm at 208C for 5 min by removing 5 ml samples followed by dilution into 370 ml of sodium phosphate at pH 7.0 and the absorption at 280 nm (A280) measured. The protein concentration was then determined using the calculated extinction coef®cients. The protein solutions were then placed at 48C for 1 hr when they were then spun down at 1400 rpm at 48C for 5 min. The concentration of protein in the supernatant was determined by carefully removing 5 ml samples and again diluting into 370 ml of sodium phosphate at pH 7.0 in order to measure the A280 . The solutions were then allowed to return to room temperature in order to verify the reversibility of the process. 3. Results Expression, Puri®cation and Sizing of Human bB2-Crystallin Recombinant human bB2 was expressed in high yield as a soluble protein and was puri®ed from the E. coli soluble proteins and nucleic acids by chromatography on successive Q Sepharose and Mono Q columns, eluting under conditions in line with its calculated pI of 6.5 (Table II). The identity of the protein was con®rmed by ESIMS which indicated a measured mass in agreement with the calculated mass for human bB2 minus the start methionine and with a free N-terminus. The protein eluted as a narrow, symmetrical peak on gel ®ltration [Fig. 2(c)], with an identical elution volume as calf lens bB2crystallin that has previously been well characterized as a dimer (Zarina et al., 1994). Furthermore, human bB2-crystallin eluted at the same position over a broad protein concentration range, showing no evidence of higher-order solution interactions at

325

higher protein concentrations (Fig. 3). The estimated molecular weight based on the calibration curve derived from marker proteins was slightly lower than a dimer. The protein behaved as a dimer over a broad protein concentration range when size was estimated by light scattering (Fig. 4). The human bB2 sample could be considered to be monodisperse over the whole concentration range examined. It is concluded that recombinant human bB2-crystallin is a dimer, like lens bovine bB2-crystallin. Expression, Puri®cation and Sizing of Human bB1 and an in vivo Truncated Form Recombinant human bB1-crystallin is highly expressed as a soluble protein in E. coli strain BL21(DE3) pLysS. SDS±PAGE indicated the elution position on Q Sepharose [Fig. 2(a)] showing that it behaves as a basic protein during chromatography in line with its calculated pI (Table II) and the identity of the molecule was con®rmed using ESIMS (Fig. 5). The protein was further puri®ed on Mono Q [Fig. 2(b) and Table II] (Fig. 6). However, human bB1 did not elute as a symmetrical peak during gel permeation chromatography and the peak half-width is wider than that of human bB2 [Fig. 2(c)]. Furthermore, the elution volume was anomalously high at very low protein concentrations indicating a molecular weight less than a monomer, but at protein concentrations above approximately 0.5 mg ml ÿ1 the elution volume was similar to human bB2, though decreasing gradually with increasing protein concentration (Fig. 3). Light scattering indicated a size that was a function of protein concentration, starting with a dimer at low protein concentration (Fig. 4), although the polydispersity values were higher than human bB2. These data indicate that recombinant human bB1 is assembled into a dimer that self-associates as a function of protein concentration, although it did not reach the size of calf lens bH-crystallin at the equivalent protein concentration (Fig. 4). It is not possible to give a precise estimate of the higher oligomer size of such a self-associating system using these methods. Crystallization trials with the full length HbB1 failed to produce any crystals. A common strategy to aid crystallization of proteins is to remove sequence extensions if they are considered to be ¯exible. The bB1DN41 truncated form is found in aged human lenses in which 41 residues have been removed from the N-terminus (David et al., 1996) (Fig. 1; Table I]. Therefore a construct that mimicked the in vivo severely truncated form was engineered and expressed. Recombinant human bB1DN41 is highly expressed as a soluble protein, and behaves as a slightly basic protein during chromatography on Q Sepharose and Mono Q [Fig. 2(a) and (b)] in line with its calculated pI of 7.8 [Table II]. The identity of the molecule was con®rmed using ESIMS. However, the protein did not elute as a symmetrical peak during gel

326

F IG . 2. Chromatography of recombinant human bcrystallins. (a) Q Sepharose elution pro®le of full-length bB1indicating the peak where bB1 elutes. Arrows indicate the elution positions of A (bB1DN6), B (bB1DN41), C (bB1DN49DC12) and D (human bB2-crystallin). (b) Mono Q elution pro®le of human bB1DN41 indicating where the protein elutes when chromatography is performed at pH 8.0. Arrows indicate the elution positions of A (bB1 at pH 8.5), B (bB1DN6 at pH 8.0), C (bB1DN6 at pH 8.5), D (bB1DN49DC12 at pH 8.0) and E (human bB2-crystallin at pH 8.0). (c) The elution pro®les from gel permeation chromatography on Superose 12 of protein samples loaded at 4 mg ml ÿ1. Proteins elute after the void volume of the column which is 7 ml. Solid line is full-length bB1, ± ± ± ± bB1DN6, ± . ± . ± bB1DN41, ± ± ± bB1DN49DC12, . . . . . human bB2-crystallin.

permeation chromatography and the peak half-width is wider than that of human bB2-crystallin [Fig. 2(c)]. Furthermore, the elution volume was anomalously high at all protein concentrations indicating a molecular weight less than a monomer (Fig. 3). Light

O . A . B AT E M A N E T A L .

F IG . 3. A plot of the measured Mrs of human bB2, human bB1 and the various truncated forms estimated from gel permeation chromatography as a function of protein concentration. The calculated dimer masses from the sequences (Table I) are also indicated. The plot shows that the estimated size of bB2 (35 000 Da) is lower than that calculated from the sequence for a tight dimer (46 500) and is independent of the protein concentration over the given range. The estimated size of bB1 is markedly dependent on the extension truncations and the protein concentration. The full length bB1 behaves as a dimer (approximately 56 000 Da), but only at the highest protein concentration, whereas the molecule bearing sequence truncations to both extensions behaved as an approximately 10 000 Da molecule, independent of protein concentration. The N-terminally truncated bB1 molecule with just six residues missing behaved like full-length bB1 whereas when 41 residues were missing, it showed intermediary behaviour with a size of approximately 25 000 Da. Thus, full length bB1 only behaves as a dimer at 10 mg ml ÿ1 when size measurement was based on interaction with a solid support.

scattering indicated a size that was a function of protein concentration, starting with a dimer at low protein concentration (Fig. 4). Crystallization trials produced small needle-like crystals that could not be improved. Crystallization of Truncated Human bB1 Expressed in E. coli Strain HMS 174 As crystallization of lens b-crystallin oligomers and their truncated forms was a major goal of this work,

B E H AV I O U R O F b B 1 - C R Y S TA L L I N

327

F IG . 5. Identi®cation of human bB1-crystallin ESMS con®rms that the protein is full length bB1-crystallin.

F IG . 4. A plot of the measured Mrs of human bB2, human bB1 and the various truncated forms estimated from laser light scattering as a function of protein concentration. The calculated dimer masses from the sequences (Table I) are also indicated. The plot shows that the Mr of bB2 is close to the calculated value for a dimer (46 500 Da) over the given protein concentration range. The measured Mrs for bB1 increase as a function of protein concentration. At low protein concentration (51 mg ml ÿ1) all forms of bB1 behave approximately as dimers. The full-length molecule gradually increases in size as a function of protein concentration, giving an apparent size of approximately 125 000 Da at a protein concentration of 10 mg ml ÿ1, which is larger than the calculated tetramer size (111 570 Da). The two severely truncated forms behaved similarly to the full-length molecule, which is in contrast to their behaviour on gel permeation chromatography shown in Fig. 3. Thus the bB1 molecules all behave as larger oligomers when their size measurement is performed in free solution.

F IG . 6. The second ion exchange chromatography step on Mono Q of human bB1 expressed in HMS 174 shows two peaks, indicating heterogeneity, whereas in the prior chromatography on Q Sepharose the protein sample was more homogeneous.

and as neither the full-length human bB1 nor the form bearing a severely truncated N-terminal extension formed good crystals, an alternative strategy was employed. The plasmid was expressed in a strain of E. coli, HMS 174, that contains higher levels of proteases than the commonly used BL21 strain which is de®cient in the lon protease and lacks the ompT outer membrane protease (Grodberg and Dunn, 1988). Human bB1 was highly expressed and subjected to the same puri®cation protocol as was previously employed. The ®rst indication that the

protein expressed in the HMS 174 strain was undergoing proteolysis was when the protein which had eluted as a single mass species from the Q Sepharose column produced two peaks when run on the Mono Q column (Fig. 6). Mass measurements made over several isolation runs showed that the truncated protein species had masses that were consistent with a loss of a number of residues as a function of time (Fig. 1; Table I). Several species were observed including those that had been truncated by six, 14 and up to 49 residues from the N-terminus.

328

O . A . B AT E M A N E T A L .

F IG . 7. Photographs of crystals of truncated human bB1-crystallin: top left, ®ne needles of bB1DN6 expressed in HMS 174 grew immediately; top right, a new form of crystal growth appeared in the bB1DN6 solution after many months; bottom left: ®ne needles of bB1DN6 expressed in BL21; and bottom right: octahedral crystals of bB1DN41 expressed in HMS 174.

Truncation from the C-terminus could not be used to account for mass changes until 49 residues had been lost from the N-terminus. Truncation from the C-terminus appeared to occur in two stages, the loss of six and then of 12 residues. (The proteins that had been expressed in the BL21 strain were similarly monitored and found to be intact over the course of the studies.) The ®rst cleavages occurred in a few days. Concentrated solutions were screened for crystallization on freshly prepared protein and large numbers of rather ®ne needle-like crystals grew from the solution overnight when the protein was at the bB1DN6 stage (Fig. 7). The needle forms of the protein were obtained under several crystal screen and crystal screen 2 conditions but the condition for best rate of growth, morphology and reproducibility was crystal screen condition 6 (0.1 M Tris±HCl, pH 8.5, 0.2 M MgCl2 , 30 % PEG 4000). During the trials, the effect of changes in each of the constituents was examined. These changes included the pH of the buffer, the type and concentration of the PEG and the concentration and type of salt employed. The best condition was also tested with the three Additive Screens available from Hampton. Trays which yielded good quality crystals were set up with a pH scan

between 7.0 and 8.5 and with a PEG 4000 concentration between 24 and 30 %. After several months the needle-shaped crystals started to acquire a further growth of an entirely different morphology crystal. They were octahedral. When the needles transformed into the octahedra then a needle-like crystal was observed to be growing through the middle of it (Fig. 7). Monitoring of the protein solution by mass spectrometry indicated that the new, octahedral morphology crystals were further truncated species. Expression, Puri®cation, Sizing and Crystallization of in vitro Truncated Forms of Human bB1 in E. coli BL21 Two protein constructs were engineered to mimic the in vitro cleavage sites, bB1DN6 and bB1DN49DC12, and expressed in BL21 in order to prevent further truncation by proteolysis. Both were highly expressed in a soluble form and chromatographed on successive Q Sepharose and Mono Q columns in line with their calculated pIs [Table II and Fig. 2(a) and (b)]. ESIMS showed that the puri®ed proteins had measured monomer masses consistent with the engineered truncations (Table I). bB1DN6 on gel permeation chromatography behaves very

B E H AV I O U R O F b B 1 - C R Y S TA L L I N

similarly to full length bB1 over equivalent protein concentrations (Fig. 3). However, the severely truncated form behaved extremely anomalously on gel permeation chromatography, eluting smaller than monomers over a wide protein concentration range (Fig. 3) and with wide asymmetrical peak shapes [Fig. 2(c)]. At lower protein concentrations it behaved as a dimer by light scattering, whereas at higher protein concentrations the molecular weight increased with protein concentration (Fig. 4). The results indicate that human bB1 bearing either a severely truncated N-terminal extension, or an additional truncation of the C-terminal extension is expressed as a soluble dimer that self-associates as a function of increasing protein concentration. Furthermore, these truncated dimers interact strongly with the Superose matrix of the chromatography column. The bB1DN6 crystals grew as needles (Fig. 7) and did not grow as octahedra over time, consistent with the lack of further proteolysis as monitored by mass spectrometry. However, octahedral crystals did grow from bB1DN41 that had been expressed in E. coli strain HMS 174. It was found that the new morphology crystals then appeared quite quickly (under optimized `octahedral' crystallization conditions) and without a needle shaped intermediate form (Fig. 7). It could thus be assumed that the new crystal form was at least truncated by 41 residues if not even shorter. However, it has not been possible to grow the octahedral crystals from bB1DN49DC12 and so the exact length of the molecule in the crystal is not known. Phase Separation The solutions of both human bB1 and bB1DN6 remained clear after standing at 48C for 1 hr. However, the solution of human bB1DN41 was completely opaque after only 10 min at 48C and when spun down produced a signi®cant white pellet. The concentrations of the supernatant solutions of bB1 and bB1DN6 were effectively unaltered having changed by only 1 % which is well within the limit of the accuracy of the Gilson pipettes whereas the concentration of the supernatant of the bB1DN41 solution had decreased by 38 %. The pellet of human bB1DN41 re-dissolved when brought back to 208C. 4. Discussion Human bB1-crystallin and various truncated forms can be highly expressed in E. coli in a soluble form. The full-length and truncated forms were characterized in terms of their oligomeric molecular size by two different methods and compared with recombinant human bB2 and bovine lens bB2-crystallin. Human bB2-crystallin eluted at the same position on size exclusion chromatography as bovine bB2 that has previously been well characterized as a dimer. Both human and bovine bB2-crystallin behave as

329

monodisperse dimers on light scattering over a broad range of protein concentrations, in agreement with their close sequence identity of 97 %. Both human and bovine bB2-crystallin gave slightly low estimates of Mr from size exclusion chromatography as compared with light scattering and ultracentrifugation data (Zarina et al., 1994), which probably indicates a slight interaction between the bB2-dimers and the column matrix, rather than re¯ecting the equilibrium distribution between monomer and dimer. In contrast with bB2, the size of human bB1 appeared highly concentration dependent and the size estimations by the two different methods show large differences. For example, at a concentration of 10 mg ml ÿ1 the Mr of bB1 measured by gel chromatography is approximately 56 000 Da (Fig. 3), whereas by light scattering it is approximately 125 000 Da (Fig. 4). The estimated increase in Mr of full-length bB1-crystallin as a function of protein concentration during gel permeation chromatography was over a much smaller size range than that determined by light scattering. This suggested that bB1 might be interacting with the column matrix thus causing a delayed elution, even though chromatography was performed in the presence of 0.2 M NaCl. The best estimate of the size of bB1 was thus obtained by dynamic light scattering when full-length human bB1-crystallin behaved as a dimer that underwent higher association as a function of protein concentration. Nevertheless, the size did not approach that of bovine bH-crystallin at an equivalent protein concentration as estimated using light scattering. A striking observation was the effect of the extension truncations on the gel permeation chromatography behaviour of human bB1-crystallin. There is a clear correlation between the elution volume of the truncated bB1 species and the degree of truncation. The greater the degree of truncation then the greater the extent to which the protein is retained on the column matrix and hence the smaller the apparent Mr (Fig. 3). Yet light scattering measurements show that they all behave as dimers at low protein concentration. This is in agreement with Lampi et al. (2001) who also found that truncated human bB1 behaves anomalously on gel permeation chromatography as compared with light scattering results. The truncated forms of bB1 do show evidence of increasing self-association as a function of increasing protein concentration when measured using light scattering, like full-length bB1 and unlike bB2 (Fig. 4). These results thus suggest that it is the truncated dimers that interact with the column matrix and that the anomalous gel permeation chromatography behaviour is likely due to surface features of compact domains of the truncated bB1-crystallins. Interestingly, an N-terminal truncated form of bA3, shown by ultracentrifugation to be a dimer, also behaves in a similarly anomalous manner on gel chromatography (Sergeev, Wing®eld and Hejmancik, 2000). In

330

addition, the monomeric g-crystallins are well known to have anomalously low apparent Mrs as estimated using gel permeation chromatography (Norledge et al., 1997). bB1-crystallin shortened by 41 residues from the Nterminus to mimic an age-related in vivo truncation showed a remarkable difference, compared with the full-length polypeptide, in temperature dependent solubility. The truncated bB1 underwent phase separation whereby moderately concentrated solutions became reversibly opaque on cooling, similar to gcrystallins. It is perhaps signi®cant that although g-crystallins all have molecular weights of around 21 kDa, the gS, gB/D and gE/F crystallins can be readily separated from each other on gel permeation chromatography. Furthermore, the degree of retention/interaction with the column matrix was in proportion to their ease of phase separation (Norledge et al., 1997). In the case of the bB1-crystallins, the gel permeation chromatography and phase separation behaviour both indicate that N-terminally truncated species of human bB1 show evidence of altered interactions as compared with full-length protein. The loss of the extensions may thus be uncovering surface interaction sites on the compact domains of dimers. The distribution of water-soluble and insoluble proteins is uniform throughout the lens in human lenses younger than 30 years, but in the deeper layers of the lens insolubilization gradually increases during the ®fth decade (Li, Roy and Spector, 1986). Recent mass spectrometric analyses have found that the truncated forms of crystallins are more abundant among the water-insoluble than the water-soluble crystallins, and that the bB1 polypeptide is even more severely truncated in the water-insoluble fraction (Hanson et al., 2000). The results described here lend further support to the general idea that bB1crystallin sequence extensions interact with surface patches on compact domains and that this is part of the assembly process of bH-crystallin. Since agerelated cleavages of the N-terminal extension lead to smaller oligomers, this suggests that the extensions are interacting with compact domains between dimers (or higher oligomers) in bH-crystallin. This work shows that the resultant smaller homodimers/ oligomers bearing unshielded sites do have altered solution behaviour. Now that we have good crystals of the `unshielded form' we will have the opportunity to see how these truncated polypeptides engage in the various higher-order assemblies that can be visualized in the crystal lattice. However, in the work reported here, only the human bB1-crystallin homo-oligomers were investigated and these were not as large as lens bH-crystallin, indicating that other members of the b-crystallin family are required. The next step is to de®ne how these arm-domain interactions are in¯uenced by the other b-crystallins present in the complex assemblies found in the lens.

O . A . B AT E M A N E T A L .

Acknowledgements The ®nancial support of the Medical Research Council is gratefully acknowledged. The work has also been supported by an EU BioMed Grant (BMH4-CT98-3895).

References Ajaz, M. S., Ma, Z., Smith, D. L. and Smith, J. B. (1997). Size of human lens b-crystallin aggregates are distinguished by N-terminal truncation of bB1. J. Biol. Chem. 272, 11250±5. Alcala, J., Katar, M., Rudner, G. and Maisel, H. (1988). Human b-crystallins: regional and age related changes. Curr. Eye Res. 7, 353±9. Bateman, O. A. and Slingsby, C. (1992). Structural studies on bH-crystallin from bovine eye lens. Exp. Eye Res. 55, 127±33. Bax, B., Lapatto, R., Nalini, V., Driessen, H., Lindley, P. F., Mahadevan, D., Blundell, T. L. and Slingsby, C. (1990). X-ray analysis of bB2-crystallin and evolution of oligomeric lens proteins. Nature 347, 776±80. Benedek, G. B. (1997). Cataract as a protein condensation disease. Invest. Ophthalmol. Vis. Sci. 38, 1911±21. Berbers, G. A. M., Boermann, O. C., Bloemendal, H. and de Jong, W. W. (1982). Primary gene products of bovine b-crystallin and reassociation behaviour of its aggregates. Eur. J. Biochem. 128, 495±502. Berbers, G. A. M., Hoekman, W. A., Bloemendal, H., de Jong, W. W., Kleinschmidt, T. and Braunitzer, G. (1983). Proline- and alanine-rich N-terminal extension of the basic bovine b-crystallin B1 chains. FEBS Lett. 161, 225±9. Berbers, G. A. M., Hoekman, W. A., Bloemendal, H., de Jong, W. W., Kleinschmidt, T. and Braunitzer, G. (1984). Homology between the primary structures of the major b-crystallin chains. Eur. J. Biochem. 139, 467±79. Bindels, J. G., Koppers, A. and Hoenders, H. J. (1981). Structural aspects of bovine b-crystallins: physical characterization including dissociation-association behavior. Exp. Eye Res. 33, 333±43. Carver, J. A., Cooper, P. G. and Truscott, R. J. W. (1993). 1NMR spectroscopy of bB2-crystallin from bovine eye lens: conformation of the N- and C-terminal extensions. Eur. J. Biochem. 213, 313±20. Cooper, P. G., Aquilina, J. A., Truscott, R. J. W. and Carver, J. A. (1994). Supramolecular order within the lens: 1 NMR spectroscopic evidence for speci®c crystallin± crystallin interactions. Exp. Eye Res. 59, 607±16. David, L. L., Lampi, K. J., Lund, A. L. and Smith, J. B. (1996). The sequence of human bB1-crystallin cDNA allows mass spectrometric detection of bB1 protein missing portions of its N-terminal extension. J. Biol. Chem. 271, 4273±9. David, L. L., Lampi, K. J., Ueda, Y., Shih, M. and Shearer, T. R. (2000). Are b-crystallins proproteins?. Proc. Int. Soc. Eye Res. XIV, S.149. de Jong, W. W., Lubsen, N. H. and Kraft, H. J. (1994). Molecular evolution of the eye lens. Prog. Ret. Eye Res. 13, 391±442. Delaye, M. and Tardieu, A. (1983). Short-range order of crystallin proteins accounts for eye lens transparency. Nature (London) 302, 415±7. Duncan, M. K., Banerjee-Basu, S., McDermott, J. B. and Piatigorksy, J. (1996). Sequence and expression of chicken bA2- and bB3-crystallins. Exp. Eye Res. 62, 111±9. Ferre-D'Amare, A. R. and Burley, S. K. (1997). Dynamic light scattering in evaluating crystallizability of macromolecules. Meth. Enzymol. 276, 157±66.

B E H AV I O U R O F b B 1 - C R Y S TA L L I N

Grodberg, J. and Dunn, J. J. (1988). ompT encodes the Escherichia coli outer membrane protease that cleaves T7 RNA polymerase during puri®cation. J. Bacteriol. 180, 1245±53. Hanson, S. R. A., Hasan, A., Smith, D. L. and Smith, J. B. (2000). The major in vivo modi®cations of the human water-insoluble lens crystallins are disul®de bonds, deamidation, methionine oxidation and backbone cleavage. Exp. Eye Res. 71, 195±207. Lampi, K. J., Ma, Z., Hanson, S. R. A., Azuma, M., Shih, M., Shearer, T. R., Smith, D. L., Smith, J. B. and David, L. L. (1998). Age-related changes in human lens crystallins identi®ed by two-dimensional electrophoresis and mass spectrometry. Exp. Eye Res. 67, 31±43. Lampi, K. J., Ma, Z., Shih, M., Shearer, T. R., Smith, J. B., Smith, D. L. and David, L. L. (1997). Sequence analysis of bA3, bB3, and bA4 crystallins completes the identi®cation of the major proteins in young human lens. J. Biol. Chem. 272, 2268±75. Lampi, K. J., Oxford, J. T., Bachinger, H. P., Shearer, T. R., David, L. L. and Kapfer, D. M. (2001). Deamidation of human bB1 alters the elongated structure of the dimer. Exp. Eye Res. 72, 279±88. Lapatto, R., Nalini, V., Bax, B., Driessen, H., Lindley, P. F., Blundell, T. L. and Slingsby, C. (1991). High resolution structure of an oligomeric eye lens b-crystallin: loops, arches, linkers and interfaces in bB2 dimer compared to a monomeric g-crystallin. J. Mol. Biol. 222, 1067±83. Li, L.-K., Roy, D. and Spector, A. (1986). Changes in lens proteins in concentric fractions from individual normal human lenses. Curr. Eye Res. 5, 127±35. Ma, Z., Hanson, S. R. A., Lampi, K. J., David, L. L., Smith, D. L. and Smith, J. B. (1998). Age-related changes in human lens crystallins identi®ed by HPLC and mass spectrometry. Exp. Eye Res. 67, 21±30. Norledge, B. V., Hay, R. E., Bateman, O. A., Slingsby, C. and Driessen, H. P. C. (1997). Towards a molecular understanding of phase separation in the lens: a comparison of the X-ray structures of two high Tc g-crystallins, gE

331

and gF, with two low Tc g-crystallins, gB and gD. Exp. Eye Res. 65, 609±30. Piatigorsky, J. and Zelenka, P. S. (1992). Transcriptional regulation of crystallin genes: cis elements, trans-factors and signal transduction systems in the lens. Adv. Devl. Biochem. 1, 211±56. Rosenberg, A. H., Lade, B. N., Chui, D.-C., Lin, S.-W., Dunn, J. J. and Studier, F. W. (1987). Vectors for selective expression of cloned DNAs by T7 RNA polymerase. Gene 56, 125±35. Sergeev, Y. V., Wing®eld, P. T. and Hejtmancik, J. F. (2000). Monomer-dimer equilibrium of normal and modi®ed bA3-crystallins: experimental determination and molecular modeling. Biochemistry 39, 15799±806. Siezen, R. J., Anello, R. D. and Thomson, J. A. (1986). Interactions of lens proteins. Concentration dependence of b-crystallin aggregation. Exp. Eye Res. 43, 293±303. Slingsby, C. and Bateman, O. A. (1990). Rapid separation of bovine b-crystallin subunits bB1, bB2, bB3, bA3 and bA4. Exp. Eye Res. 51, 21±6. Slingsby, C., Norledge, B., Simpson, A., Bateman, O. A., Wright, G., Driessen, H. P. C., Lindley, P. F., Moss, D. S. and Bax, B. (1997). X-ray diffraction and structure of crystallins. Prog. Ret. Eye Res. 16, 3±29. Thomson, J. A. and Augusteyn, R. C. (1985). Ontogeny of human lens crystallins. Exp. Eye Res. 40, 393±410. Werten, P. L. J., Lindner, R. A., Carver, J. A. and de Jong, W. W. (1999). Formation of bA3/bB2-crystallin mixed complexes: involvement of N- and C-terminal extensions. BBA- Prot. Struc. M 1432, 286±92. Zarina, S., Slingsby, C., Jaenicke, R., Zaidi, Z. H., Driessen, H. and Srinivasan, N. (1994). Three-dimensional model and quaternary structure of the human eye lens protein gS-crystallin based on b- and g-crystallin X-ray coordinates and ultracentrifugation. Prot. Sci. 3, 1840±6. Zigler, J. S., Jr., Horwitz, J. and Kinoshita, J. H. (1980). Human b-crystallin I. Comparative studies on the b1 , b2 and b3-crystallins. Exp. Eye Res. 31, 41±55.