- Email: [email protected]
Association between high on-treatment platelet reactivity and occurrence of cerebral ischemic events in patients undergoing percutaneous coronary intervention
Thrombosis Research 138 (2016) 49–54
Contents lists available at ScienceDirect
Thrombosis Research journal homepage: www.elsevier.com/locate/thromres
Full Length Article
Association between high on-treatment platelet reactivity and occurrence of cerebral ischemic events in patients undergoing percutaneous coronary intervention☆ A. Komosa a,⁎, J.M. Siller-Matula b, M. Lesiak a, M. Michalak c, J. Kowal d, M. Mączyński a, A. Siniawski a, T. Mularek-Kubzdela a, S. Wiśniewski e, S. Grajek a a
1st Department of Cardiology, Poznan University of Medical Sciences, Poland Department of Cardiology, Medical University of Vienna, Austria c Department of Computer Science and Statistics, Poznan University of Medical Sciences, Poland d 1st Department of Clinical Pharmacology, Poznan University of Medical Sciences, Poland e Pathology Department Greater Poland Cancer Centre, Poznan, Poland b
a r t i c l e
i n f o
Article history: Received 5 October 2015 Received in revised form 25 November 2015 Accepted 23 December 2015 Available online 24 December 2015 Keywords: Aggregation Antiplatelet therapy Clopidogrel Stroke
a b s t r a c t Introduction: Percutaneous coronary angioplasty (PCI) has become a routine treatment in symptomatic patients with coronary artery disease. The use of new generation drug eluting stents (DES) and dual antiplatelet therapy has significantly improved treatment outcomes and increased patients' safety by reducing the risk of stent thrombosis. Aims: The goal of this study was to assess whether high on treatment platelet reactivity (HTPR), despite clopidogrel treatment, measured with Multiplate Electrode Aggregometer (MEA) is associated with the risk of adverse ischemic cerebral events. Methods: Symptomatic patients with coronary artery disease admitted for coronary angiography and angioplasty (PCI) were consecutively enrolled in this study. 249 consecutive patients underwent coronary artery stenting for stable angina (n = 215) or non-ST-elevation acute coronary syndrome (n = 34). Inhibition of platelet aggregation was assessed by MEA. Genetic polymorphism of CYP2C19 was tested by HRM Real-Time PCR method in 150 patients. Results: Patients with HTPR were more frequently diagnosed with ischemic stroke (p = 0.0351, OR = 16.818, 95% CI [1.464–193.23]) and other ischemic cerebral events (stroke or TIA, p = 0.0339, OR = 6.5, 95% CI [1.36– 31.07]). Cumulative assessment of all ischemic and hemorrhagic events showed no statistical significance. Cerebral ischemic event was the only adverse event that correlated with CYP2C19 (*2/*2) allele (p = 0.0489, OR = 10; 95% CI [1.39–71.80]). Conclusions: HTPR assessed by MEA, in patients treated with clopidogrel after coronary artery stenting was found to be an important risk factor of ischemic cerebral events. In concordance, the carriers of CYP2C19*2/*2 allele showed an increased rate of ischemic cerebral events. © 2015 Elsevier Ltd. All rights reserved.
1. Introduction Percutaneous coronary angioplasty (PCI) has become a routine treatment in symptomatic patients with coronary artery disease. New generation drug eluting stents (DES) have significantly improved treatment outcomes and increased patients' safety reducing the risk of stent thrombosis. Several publications have already proven that high on
☆ Authorship declaration: All authors listed meet the authorship criteria according to the latest guidelines of the International Committee of Medical Journal Editors, and all authors are in agreement with the manuscript. ⁎ Corresponding author at: 1st Department of Cardiology, Poznan University of Medical Sciences, Ul. Długa 1/2, 60-848 Poznań, Poland. E-mail address: [email protected] (A. Komosa).
http://dx.doi.org/10.1016/j.thromres.2015.12.021 0049-3848/© 2015 Elsevier Ltd. All rights reserved.
treatment platelet reactivity (HTPR) increased risk of ischemic cardiovascular events (including stent thrombosis) in patients who underwent PCI [1,2,3]. However, there is a lack of data whether HTPR under dual antiplatelet therapy (DAPT) predicts ischemic events after implantation of last generation DES. Similarly, it is unknown whether HTPR in patients treated with clopidogrel may affect the long-term cerebral outcome following the implantation of new generation DES. Platelet reactivity is determined by a variety of genetic markers and no single marker itself can be a target of anti-platelet therapies. Antiplatelet therapies can also fail to suppress platelet function due to high on-treatment systemic inflammation which can be a target of anti-inflammatory agents [4,5]. The CYP2C19 enzyme is of critical importance in a process of clopidogrel bioactivation. Among the several polymorphisms, the
50
A. Komosa et al. / Thrombosis Research 138 (2016) 49–54
CYP2C19*2 loss-of-function allele, was found by Hulot et al. to be associated with impaired antiplatelet response to clopidogrel [6]. There are several studies that have confirmed a correlation between the HTPR on clopidogrel, induced by the expression of CYP2C19*2, and the occurrence of adverse ischemic events, especially stent thrombosis and cerebral ischemic events [7,8]. Bhatt et al. however, have proven no correlation between CYP2C19 genotype and ischemic events [9]. The clinical impact of CYP2C19*2 has to be thoroughly investigated. The goal of this prospective study was to assess whether HTPR, despite clopidogrel treatment, measured with Multiplate Electrode Aggregometer (Multiplate) is associated with the risk of adverse ischemic cerebral events. 2. Methods This was a single-center study conducted at 1st Cardiology Department, Poznan University of Medical Sciences, Poland. Symptomatic patients with coronary artery disease admitted for coronary angiography and angioplasty (PCI) were consecutively enrolled and platelet function analysis and genetic CYP2C19 polymorphism testing was performed in each patient. The study design was approved by the local ethics committee (Policy no. 86/11). Signed informed consent was obtained from all patients. 2.1. Study population A total of 249 consecutive patients underwent coronary artery stenting for stable angina (n = 215; 61 females and 154 males) or non-ST-elevation acute coronary syndrome (NSTE-ACS) (n = 34; 12 females and 22 males) from March 2011 to January 2012. Among the NSTE-ACS patients, positive markers of myocardial necrosis (troponin or CK-MB) were found in 28 persons. The patients pretreated or on clopidogrel therapy for at least 5 days prior to PCI did not receive any additional loading dose of the drug. Clopidogrel naive patients received a loading dose of 300 mg one day prior to elective PCI, followed by a maintenance dose of 75 mg. A loading dose of 600 mg was given to all patients with acute coronary syndrome (ACS) prior to PCI, followed by a maintenance dose of 75 mg. All patients were already on acetylsalicylic acid (ASA) treatment; 75-mg daily dose. Unfractionated heparin was periprocedurally administered to all patients at the dosage of 70 U/kg. None of them required additional GP IIb/IIIa inhibitor infusion. PCI procedure was performed and other medications were administered in accordance with the current guidelines [10,11].
third day after PCI (just before the administration of the next 75-mg daily dose). According to Bonello et al. consensus on definition of HTPR, patients with values higher than 468 AU/min were classified as HTPR and below this cut-off value — as clopidogrel responders: non-HTPR [14].
2.3. Genotyping Genetic polymorphism of CYP2C19 was tested using the HRM RealTime PCR method (HRM, high resolution melting; PCR, polymerase chain reaction) and it was performed in 150 patients. Due to certain technical problems reliable results were obtained in 147 patients. Single nucleotide polymorphism (SNP) was used in order to identify polymorphisms. All genotyping procedures were performed in DNA Center, Poznan, Poland. Genomic DNA was extracted from peripheral blood leukocytes with a commercial Dneasy Blood Mini Kit for genomic DNA isolation. Blood samples (5 ml) were drawn into EDTA-K2 tubes and stored at 20 °C until DNA isolation. The following functional polymorphisms were selected: CYP2C19*2 (c. G681A; rs4244285) and CYP2C19*3 (c G636A; rs4986893). Genotyping of polymorphisms was performed using a high resolution melting analysis — PCR followed by HRM analysis [15] (HRM; Rotor Gene 6000®, Qiagen, Courtaboeuf, France) using specific primers: 5′ TGCAATAATTTTCCCACTATCA 3′ and 5′ CCTTGCTTTTATGG AAAGTGA 3′ and 5′ CCTTGCTTTTATGGAAAGTGA 3′ and 5′ TTTTTGCT TCCTGAGAAACCA 3′.
2.4. Study end points and clinical observation The patients' outcomes were assessed at discharge and 12 months later at follow-up visits or by phone. The data regarding deaths were obtained from Polish national identification number registry. The primary end point of this study was the cumulative incidence of ischemic events such as cardiovascular death, myocardial infarction (MI) and cerebral events (transient ischemic attack (TIA) ischemic stroke). The diagnosis of MI was established according to Thrombolysis in Myocardial Infarction (TIMI) criteria [16] and based on new abnormal Q-wave on the electrocardiogram and/or an increase in CK-MB value of three or more times above the normal limit. TIA was defined as an episode of neurologic dysfunction lasting less than 24 h. Stroke was defined as a sudden neurological deficit persisting over 24 h, confirmed by a computed tomography scan [17].
2.2. Platelet aggregation assessment 2.5. Statistics Blood samples were obtained from all 249 patients in order to determine the inhibition of platelet aggregation using Multiple Electrode Aggregometry (MEA) — Multiplate Analyzer (Dynabyte). Peripheral venous blood was collected from antecubital vein — 5 ml (the first 5 ml were discarded to avoid spontaneous platelet activation) and shot into blood collecting tubes containing hirudin. The tests were performed 30–60 min after blood drawing. In all blood samples platelet aggregation was determined using MEA — Multiplate Analyzer (Dynabyte) using ADP-test (20 μmol/l solution of ADP) as agonist [12]. The mean value of two independent tests is expressed as the area under the curve (AUC) of the aggregation tracing determined as AU/ min units. A mean value is calculated by the device, if the two results don't show a significantly different results. Only if the two results significantly vary, the test must be repeated. This ensures a satisfactory intraassay variability. The inter-assay variability has been reported to be low (b6%) [13]. The patients undergoing elective PCI had their blood samples drawn on the next day after angioplasty (shortly before the administration of a 75-mg daily dose). In ACS patients' blood samples were taken on the
Calculations were determined as an arithmetic mean and standard deviation (SD). The qualitative features are presented as the number and frequency (percentage) of the observed cases. Previously, we checked if data follows normal distribution (Shapiro–Wilks test). The distribution of blood platelet aggregation values did not follow the normal distribution and the comparison of more than 2 groups was performed by Kruskal–Wallis test with Dunn's post-hoc test. Nominal data were compared using chi-square test of independence. The risk of adverse events depended on platelet aggregation tertiles (T1 + T2 vs. T3) was assessed by odds ratio and 95% confidence interval. Differences in frequencies of adverse events in the studied tertiles were analyzed using the Chi-square for dependence or in case of small observed frequencies Fisher exact test was used [18,19,20]. Genotype frequencies were investigated for compatibility with Hardy–Weinberg equilibrium. Survival function was assessed by Kaplan–Meier estimator. The comparison between survival time in the studied groups was performed by log-rank test. The data were analyzed using Statistica 10.0 software (StatSoft, Inc.). The results were considered significant at p b 0.05.
A. Komosa et al. / Thrombosis Research 138 (2016) 49–54
3. Results
51
Table 2 Cut-off points for each tertile depending on the result of platelet aggregation measured by MEA.
3.1. Demographics
AU/min
The study included 249 patients. The mean age was 64.6 years (39 to 89 years). Elective PCI was performed in 215 patients and in 34 ACS patients. Basic clinical and demographic data are presented in the table (Table 1). In the investigated population a total of 251 stents were implanted during PCI, including 218 (87.5%) DES and 33 (13.3%) Bare Metal Stents. In 176 cases the treatment was performed using the radial access (71%) and in 73 patients using the femoral access (29%). The study population was divided into three groups – tertiles – depending on the results of platelet aggregation measured by Multiplate Analyser. The results were collated and arranged in order from the lowest to the highest value, ranging from 45 to 975 AU/min (Table 2). Cut-off values for each tertile determined 1/3 results of platelet aggregation inhibition that were arranged in ascending order (190 AU/min) and 2/3 of the results (312 AU/min). Having used these cut-off values the tertiles were obtained, as presented in Table 2.
Tertile 1 Tertile 2 Tertile 3
(T1) (T2) (T3)
45–190 191–312 313–975
3.3. In-hospital outcomes Periprocedural MI occurred in 6 patients, in all of them as an asymptomatic rise of necrotic markers. Five of them were non-HTPR (3%) and one was HTPR (1.2%). The difference was not statistically significant. Moreover, during hospitalization there were four cases of hemorrhage, these were mild and in the form of a hematoma following femoral artery puncture. No hemorrhagic complication required surgical treatment. All four events were noted in non-HTPR group.
3.4. 12-month follow-up 3.2. CYP2C19 polymorphism impact on platelet aggregation Genetic polymorphism of CYP2C19 was tested in the first 147 patients. There were no cases of CYP2C19*3 in the study population. There was a deviation of CYP2C19 genetic variants (*1/*1, *2/*1 and *2/*2) distribution from Hardy–Weinberg equilibrium proportions (p = 0.013). CYP2C19 polymorphisms distribution in clopidogrel nonHTPR and HTPR patients and in patients assigned to certain tertiles is presented in Tables 3 and 4, respectively. A detailed analysis of genetic study results showed that a genotype has no effect on HTPR nor the assignment to particular tertiles (Tables 3 and 4, Fig. 1A and B). The level of platelet reactivity inhibition was not significantly different among the given variants. The patients carrying CYP2C19*1/*1 showed the greatest variability in values of platelets aggregation inhibition (45–975 AU/min). The CYP2C19*2/*1 and CYP2C19*2/*2 carriers ranged respectively: 48–570 Au/min and 154–780 AU/min (Fig. 2). Table 1 Baseline characteristics of the study population. All
Non-HTPR
HTPR
p
Study population n = 249 Number (%) Age in years (±SD) Male (%) Body mass; kg (±SD) Height; m (±SD) BMI (±SD) Stable coronary disease (%) NSTACS (%) Previous bypass surgery History of stroke/TIA Hypertension Diabetes mellitus Heart failure Renal impairment GFR b 60 Hyperlipidemia Cigarette smoking
249 (100) 64.6 (9.9) 175 (70.3) 82.3 (15.1) 1.7 (0.1) 28.6 (4.5) 215 (86.4) 34 (13.6) 23 (9.2) 16 (6.4) 198 (79.5) 80 (32.1) 13 (5.2) 54 (21.7) 122 (49) 51 (20.5)
221 (88.8) 64.8 (9.9) 152 (68.8) 81.9 (15.1) 1.69 (0.1) 28.5 (4.5) 190 (86.0) 31 (14.0) 21 (9.5) 15 (6.8) 174 (78.7) 69 (31.2) 11 (5.0) 50 (22.6) 105 (47.5) 44 (19.9)
28 (11.2) 63.3 (9.5) 23 (82.1) 85.5 (14.9) 1.7 (0.1) 29.6 (4.5) 25 (89.3) 3 (10.7) 2 (7.1) 1 (3.6) 24 (85.7) 11 (39.3) 2 (7.1) 4 (14.3) 17 (60.7) 7 (25.0)
ns ns ns ns ns ns ns ns ns ns ns ns ns ns ns
Comedication Aspirin Statines PPI Beta blocker ACE-I Ca-blockers Diuretics Nitrates Morphine
249 (100) 248 (99.6) 91 (36.5) 224 (90.0) 195 (78.3) 54 (21.7) 110 (44.2) 46 (18.5) 7 (2.8)
221 (100) 220 (99.5) 78 (35.3) 197 (89.1) 172 (77.8) 48 (21.7) 99 (44.8) 40 (18.1) 6 (2.7)
28 (100) 28 (100) 13 (46.4) 27 (96.4) 23 (82.1) 6 (21.4) 11 (39.3) 6 (21.4) 1 (3.6)
ns ns ns ns ns ns ns ns ns
The data on all-cause mortality were obtained for all patients. Thirty nine patients were lost to the remaining clinical follow-up (15.7%). The patients lost to follow-up did not change the distribution of the platelet reactivity in the studied population. The comparison of platelet reactivity inhibition did not differ significantly between the followed-up and the whole population. The values of platelet reactivity inhibition for patients lost to follow-up ranged from 48 to 690 AU/min (which accounted for the first 2/3 of the range of the whole analyzed group). All ischemic events are listed in Table 5. Death occurred in 9 patients and unfortunately the causes were determined only in four cases. In two cases the death was due to neoplasm. One patient died of myocardial infarction in 12th month of the follow-up observation due to in-stent thrombosis (0.5%). Another patient died six months after the discharge from our ward as a result of ischemic stroke, confirmed by CT scan. Both patients were in non-HTPR group, one was in T1 + T2 group, the other in T3. No death occurred within 30 days following a hospital discharge. Myocardial infarction occurred in 9 patients. The only STEMI event was found in the previously mentioned patient who died. Other cases are NSTEMI events. There was 1 case of intracranial hemorrhage and 37 cases of minor bleedings that did not require medical attention (hematuria, blood in the stools, bleeding from the nose, bleeding from the gums). Tables 5 and 6 present ischemic and hemorrhagic events, which occurred in patients within 12-month period following a hospital discharge. Patients with HTPR were more frequently diagnosed with ischemic stroke (p = 0.0351, OR = 16.818, 95% CI [1.464–193.23]) and other ischemic cerebral events (stroke or TIA, p = 0.0339, OR = 6.5, 95% CI [1.36–31.07]). All hemorrhages, except for the one case of central nervous system hemorrhage, were of mild nature. Cumulative assessment of all ischemic and hemorrhagic events showed no statistical significance (Table 5). T3 patients were significantly more often diagnosed with ischemic stroke (1.4%), when compared with T1 + T2 patients (0%) (p = 0.0376, OR = 14.255, 95% CI [0.7255–280.10]). Also, it was noted that the patients suffering from any ischemic cerebral events (stroke or Table 3 CYP2C19 polymorphisms distribution in clopidogrel non-HTPR/HTPR. Polymorphism
*1/*1 *2/*1 *2/*2
Study group
Non-HTPR
HTPR
n = 147
%
n = 131
%
n = 16
%
106 31 10
72.1 21.1 6.8
95 27 9
72.5 20.6 6.9
11 4 1
68.8 25.0 6.3
52
A. Komosa et al. / Thrombosis Research 138 (2016) 49–54
Table 4 CYP2C19 polymorphisms distribution in patients assigned to certain tertile depending on the result of platelet aggregation measured by MEA. Polymorphism
*1/*1 *2/*1 *2/*2
Tertile 1 + 2
Tertile 3
n = 147
Study group %
n = 95
%
n = 52
%
106 31 10
72.1 21.1 6.8
71 19 5
74.7 20.0 5.3
35 12 5
67.3 23.1 9.6
TIA) significantly more often were found in T3 group (p = 0.0452, OR = 5.19, 95% CI [0.98–27.47]). Moreover, T3 patients were significantly more often diagnosed with hematuria (5.6%) than T1 + T2 patients (0.7%) (p = 0.0457, OR = 8.239, 95% CI [0.9027–75.193]). Cumulative assessment of all hemorrhagic complications showed no statistical significance. However, cumulative assessment of deaths and all ischemic events showed a significant correlation with T3 assignment (p = 0.0481, OR = 2.37, 95% CI [0.99–5.67]) (Table 6). 3.5. Assessment of CYP2C2C19 allele impact on clinical events Cerebral ischemic event was the only adverse event that was dependent on CYP2C19 (*2/*2) allele (p = 0.0489, OR = 10; 95% CI [1.39– 71.80]). This event more often occurred among patients with CYP2C19 (*2/*2) allele comparing to (*1/*1) allele 25% vs. 3.23%. There was no significant correlation between the genotype and hemorrhagic events. 3.6. Kaplan–Meier survival curve analysis Fig. 3 shows survival curves of non-HTPR group and patients with HTPR. The survival after 12-month follow-up was not significantly different and amounted to 95.83% vs. 95.76% (p = 0.9933), respectively.
Fig. 2. Levels of platelet aggregation inhibition in CYP2C19 genetic polymorphism variants.
Similarly, no differences were found with relations to T1 + T2 and T3 patients' survival, which amounted to 96.45% vs. 94.44% (p = 0.7071, Fig. 4) respectively. 4. Discussion It is known that insufficient platelet inhibition in patients undergoing PCI increases the risk of stent thrombosis and recurrent cardiovascular ischemic events [21,22,23]. Patients on DAPT are also at risk of major cerebral complications such as ischemic and hemorrhagic events. The aim off this study was to investigate if there's any association between HTPR and cerebral adverse events. Recently, Taglieri et al. have published a meta-analysis of 14 studies including 11,959 patients focused at determining whether patients undergoing PCI with HTPR are also at increased risk of stroke [24]. They have demonstrated that patients with HTPR had higher risk of stroke compared to patients with an adequate response to clopidogrel treatment (1.2% vs. 0.7%, relative risk on fixed effect 1.84, 95% CI [1.21– 2.80]). We demonstrated that patients with HTPR were more frequently diagnosed with ischemic stroke (p = 0.0351, OR = 16.818, 95% CI [1.464–193.23]) and other cerebral ischemic events that is consistent with the results of the meta-analysis. Numerous factors are associated with HTPR: acute coronary syndrome, renal impairment, obesity, older age, reduced left ventricle function, inflammatory disorders, diabetes mellitus, drug–drug interactions [25]. The role of genetic component in modulation of platelet activation pathways is also of great importance [26]. There are many uncertainties associated with genetic tests being used for detection of patients who carry the gene of impaired metabolism of antiplatelet drugs. It is
Table 5 Ischemic and hemorrhagic events in 12-month follow-up. Patients divided into non-HTPR and HTPR (n = 210). Clinical outcome
Fig. 1. (A) The percentage distribution of CYP2C19 polymorphism variants in the study population: HTPR and non-HTPR. (B) The percentage distribution of CYP2C19 polymorphism variants in the study population divided into tertiles.
Ischemic events Death Myocardial infarction Stroke TIA Cumulative incidence of cerebral ischemic events Composite of all ischemic events Total Hemorrhagic events Cumulative incidence of Hemorrhagic events
Study group
Non-HTPR HTPR
N
N
9 9 3 4 7
% 4.3 4.3 1.4 1.9 3.3
%
p
N %
8 8 1 3 4
4.3 4.3 0.5 1.6 2.2
1 1 2 1 3
4.2 4.2 8.3 4.2 12.5
ns ns 0.0351 ns 0.0339
16 7.6 12 23 11.0 18
6.5 9.7
4 5
16.7 ns 20.8 ns
38 18.1 33
17.7
5
20.8 ns
A. Komosa et al. / Thrombosis Research 138 (2016) 49–54
53
Table 6 Ischemic and hemorrhagic events during 12-month follow-up; assignment of patients to tertiles (n = 210). Clinical outcome
Ischemic events Death Myocardial infarction Stroke TIA Cumulative incidence of cerebral ischemic events Composite of all ischemic events Total Hemorrhagic events Cumulative incidence of Hemorrhagic events
Study group
Tertiles 1+2
Tertile 3
N
N
N
9 9 3 4 7
% 4.3 4.3 1.4 1.9 3.3
4 6 0 2 2
16 7.6 8 23 11.0 11
% 2.9 4.3 0 1.4 1.4
5 3 3 2 5
p
% 7.0 4.2 4.2 2.8 7.0
ns ns 0.0376 ns 0.0452
5.8 8 11.3 ns 7.9 12 16.9 0.0481
38 18.1 20 14.4 18 25.4 ns
estimated that as many as 30% of the Caucasian race are the carriers of a defective gene variation, which results in the increased risk of adverse cardiovascular events [27]. Although it is possible to detect gene variants predisposing to impaired response to antiplatelet drug there is still insufficient information related to genetic poor responsiveness and its impact on clinical events in patients. The area of greatest research is HTPR on clopidogrel conditioned by the expression of mutated CYP2C19*2 allele of clopidogrel impaired metabolism [28]. There have been many significant studies confirming that CYP2C19*2 or *3 correlates with a lower platelet inhibition, which is associated with the increased risk of ischemic events, such as stent thrombosis [29]. The meta-analysis published by Hulot et al. showed that CYP2C19*2 allele carriers diagnosed with cardiac ischemia are over 30% more likely to develop adverse cardiac events when compared with the so called “noncarriers” (9.7% v. 7.8%; (OR):1.29, p b 0.001) [6]. The results of metaanalysis involving 32 major studies investigating the relations of CYP2C19 polymorphism and platelet aggregation inhibition and clinical events in over 42 thousand patients were published in 2011. A lower level of active clopidogrel metabolite and increased platelet activity, despite antiaggregation treatment, were found in carriers of impaired clopidogrel metabolite allele. Despite such a considerable number of investigated patients no significant relation between a particular genotype and its impact on cardiovascular events was observed [30]. The presented study group (n = 147) involved 106 cases of *1/*1 (72.1%) polymorphism, 31 cases of *2/*1 (21.1%) polymorphism and 10 cases of *2/*2 (6.8) polymorphism; the total percentage of *2/*2 and *2/*1 homozygous and heterozygous genotypes was 27%. Sibbing's paper published in 2009 investigating the population of 2485 patients showed
Fig. 4. Kaplan–Meier survival curves assigned to particular tertiles.
that the percentage distribution of individual polymorphisms was: *1/ *1 (73%) respectively and a total sum of polymorphisms was *2/*2 and *2/*1 (27%) respectively. The presented population included more cases of *2/*2 polymorphism i.e. 6.8%, whereas only 4% had been expected. Thus, the Hardy–Weinberg equilibrium model was not met (p = 0.013), which was to be considered in favor of the study. However, despite the more frequent occurrence of *2/*2 impaired variant no significant dependency between a genotype and the frequency of HTPR on clopidogrel was shown. Similarly, the frequency of certain genotype occurrences did not differ significantly with regard to the analyzed tertiles: T1 + T2 + T3. Interestingly enough, our study showed that a significant correlation between CYP2C19 allele (*2/ *2) and ischemic cerebral events (p = 0.0489, OR = 10; 95% CI [1.39–71.80]). However, no significant correlation was found between a genotype and other ischemic events and hemorrhagic complications. This lack of correlation with such events as death or stroke may be related to a low number of these events occurring in a lowrisk population however, numerous contradictory findings can be found in other relevant papers. The majority of recent clinical randomized trials (GRAVITAS, TRIGGER-PCI and ARCTIC) have not supported the hypothesis that platelet function or genetic testing and tailored antiplatelet therapy are providing a favorable clinical outcome. However, these trials have multiple limitations e.g. different study populations, follow-ups, treatment strategies, study endpoints or time-points of blood sampling, therapy adjustment, inclusion of low-to-moderate risk patients [31]. A possible solution would be to use an algorithm for personalized antiplatelet therapy in patients who are at high thrombotic risk as recently proposed [25]. This global risk algorithm is based on clinical (PREDICT score), biological (platelet function) and genetic (CYP2C19*2 carrier status) information. Nevertheless, this algorithm has to be evaluated in a prospective study.
4.1. Limitations
Fig. 3. Kaplan–Meier survival curve for HTPR and non-HTPR.
The main limitation of this study is the low number of adverse events. Taking this into account, we used Fisher exact test instead of chi-square, however, the power of the analysis is limited. We used only a single platelet function test, the MEA. MEA has been shown to predict thrombotic events quite effectively (OR: 9–37; AUC: 0.78–0.92; sensitivity: 70–90% and specificity: 84– 100%) [32]. The major reason for choosing MEA and not VerifyNow was the cost of a single measurement, which is 5-fold lower for MEA that for VerifyNow. Moreover, the additional limitation of VerifyNow is a poor correlation with the P2Y12 receptor occupancy, where the sensitivity of the VerifyNow P2Y12 assay decreased at higher clopidogrel responses [33]. As LTA and VASP assay are labor intensive, we decided to use MEA.
54
A. Komosa et al. / Thrombosis Research 138 (2016) 49–54
5. Conclusions High on-treatment platelet reactivity, assessed by MEA, in patients treated with clopidogrel after PCI was an important risk factor of ischemic cerebral events. Despite the fact that CYP2C19 polymorphism correlated poorly with the occurrence of HTPR, carriers of CYP2C19*2/*2 allele showed an increased rate of ischemic cerebral events. Acknowledgments We are thankful to Grzegorz Matusiak for his contribution to this manuscript. References [1] W. Hochholzer, D. Trenk, H.P. Bestehorn, et al., Impact of the degree of periinterventional platelet inhibition after loading with clopidogrel on early clinical outcome of elective coronary stent placement, J. Am. Coll. Cardiol. 48 (2006) 1742–1750. [2] G.W. Stone, B. Witzenbichler, G. Weisz, et al., Platelet reactivity and clinical outcomes after coronary artery implantation of drug-eluting stents (ADAPT-DES): a prospective multicentre registry study, Lancet 382 (2013) 614–623. [3] K.P. Bliden, J. DiChiara, U.S. Tantry, A.K. Bassi, S.K. Chaganti, P.A. Gurbel, Increased risk in patients with high platelet aggregation receiving chronic clopidogrel therapy undergoing percutaneous coronary intervention is the current antiplatelet therapy adequate? JACC 49 (2007) 657–666. [4] A.Y. Gasparyan, et al., The role of aspirin in cardiovascular prevention: implications of aspirin resistance, J. Am. Coll. Cardiol. 51 (19) (2008 May 13) 1829–1843. [5] U.S. Tantry, et al., Resistance to antiplatelet drugs: what progress has been made? Expert. Opin. Pharmacother. 15 (17) (2014 Dec) 2553–2564. [6] J.S. Hulot, J.P. Collet, A. Pena, et al., Cardiovascular risk in clopidogrel-treated patients according to cytochrome P450 2C10*2 loss-of-function allele or proton pump inhibitor coadministration: a systematic metaanalysis, J. Am. Coll. Cardiol. 56 (2010) 134–143. [7] B. Giusti, A.M. Gori, R. Marcucci, C. Saracini, I. Sestini, et al., Relation of cytochrome P450 2C19 loss-of-function polymorphism to occurrence of drug-eluting coronary stent thrombosis, Am. J. Cardiol. 103 (2009) 806–811. [8] D. Sibbing, J. Stegherr, W. Latz, et al., Cytochrome P450 2C19 loss-of-function polymorphism and stent thrombosis following percutaneous coronary intervention, Eur. Heart J. 30 (2009) 916–922. [9] D.L. Bhatt, G. Paré, J.W. Eikelboom, K.L. Simonsen, E.S. Emison, K.A. Fox, et al., The relationship between CYP2C19 polymorphisms and ischaemic and bleeding outcomes in stable outpatients: the CHARISMA genetics study, Eur. Heart J. 33 (2012) 2143–2150. [10] J.M. Siller-Matula, G. Delle-Karth, I.M. Lang, et al., Phenotyping vs. genotyping for prediction of clopidogrel efficacy and safety: the PEGASUS-PCI study, J. Thromb. Haemost. 10 (4) (2012) 529–542. [11] J.M. Siller-Matula, M. Francesconi, C. Dechant, et al., Personalized antiplatelet treatment after percutaneous coronary intervention: the MADONNA study, Int. J. Cardiol. 167 (5) (2013) 2018–2023. [12] P. Harrison, Advances in the monitoring of anti-P2Y12 therapy, Platelets 23 (7) (2012) 510–525. [13] O. Toth, A. Calatzis, S. Penz, H. Losonczy, W. Siess, Multiple electrode aggregometry: a new device to measure platelet aggregation in whole blood, Thromb. Haemost. 96 (6) (2006) 781–788.
[14] L. Bonello, U.S. Tantry, R. Marcucci, et al., Consensus and future directions on the definition of high on-treatment platelet reactivity to adenosine diphosphate, J. Am. Coll. Cardiol. 56 (12) (2010 Sep 14) 919–933. [15] D.G. Santos, M.F. Resende, J.G. Mill, A.J. Mansur, J.E. Krieger, A.C. Pereira, Nuclear factor (NF) kappaB polymorphism is associated with heart function in patients with heart failure, BMC Med. Genet. 11 (1) (2010) 89. [16] TIMI Study Group. Definitions used in TIMI trials. http://www.timi.org (1 August 2008). [17] C.S. Kidwell, S. Warach, Acute ischemic cerebrovascular syndrome: diagnostic criteria, Stroke 34 (12) (December 2003) 2995–2998, http://dx.doi.org/10.1161/ 01.STR.0000098902.69855.A9 (PMID 14605325). [18] T. Geissler, D. Grass, B. Bigalke, et al., The Residual Platelet Aggregation after Deployment of Intracoronary Stent (PREDICT) score, J. Thromb. Haemost. 6 (2008) 54–61. [19] D.P. Fishbein, A.S. Hellkamp, D.B. Mark, et al., Use of the 6-min walk distance to identify variations in treatment benefits from implantable cardioverterdefibrillator and amiodarone results from the SCD-HeFT (Sudden Cardiac Death in Heart Failure Trial), JACC 63 (23) (2014) 2560–2568. [20] C.I. Prodan, J.A. Stoner, G.L. Dale, Original article. Acute hemorrhagic complications are associated with lowercoated-platelet levels in non-lacunar brain infarction, J. Thromb. Haemost. 13 (2015) 1–7. [21] M.J. Price, S. Endemann, R.R. Gollapudi, et al., Prognostic significance of postclopidogrel platelet reactivity assessed by a point-of-care assay on thrombotic events after drug-eluting stent implantation, Eur. Heart J. 29 (2008) 992–1000. [22] P.A. Gurbel, K.P. Bliden, W. Samara, et al., Clopidogrel effect on platelet reactivity in patients with stent thrombosis: results of the CREST study, J. Am. Coll. Cardiol. 46 (2005) 1827–1832. [23] S. Matetzky, B. Shenkman, V. Guetta, et al., Clopidogrel resistance is associated with increased risk of recurrent atherothrombotic events in patients with acute myocardial infarction, Circulation 109 (2004) 3171–3175. [24] N. Taglieri, M.L. Bacchi Reggiani, T. Palmerini, et al., Risk of stroke in patients with high on-clopidogrel platelet reactivity to adenosine diphosphate after percutaneous coronary intervention, Am. J. Cardiol. 113 (2014) 1807–1814. [25] J.M. Siller -Matula, D. Trenk, K. Schrör, et al., How to improve the concept of individualised antiplatelet therapy with P2Y12 receptor inhibitors—is an algorithm the answer? Thromb. Haemost. 113 (1) (2015) 37–52. [26] J. Shanker, et al., Platelet function and antiplatelet therapy in cardiovascular disease: implications of genetic polymorphisms, Curr. Vasc. Pharmacol. 9 (4) (2011) 479–489. [27] I.Y. Gong, N. Crown, C.M. Suen, et al., Clarifying the importance of CYP2C19 and PON1 in the mechanism of clopidogrel bioactivation and in vivo antiplatelet response, Eur. Heart J. 33 (22) (2012) 2856–2864. [28] T. Yin, T. Miyata, Pharmacogenomics of clopidogrel: evidence and perspectives, Thromb. Res. 128 (2011) 307–316. [29] A. Pena, J.P. Collet, J.S. Hulot, et al., Can we override clopidogrel resistance? Circulation 119 (2009) 2854–2857. [30] M. Holmes, P. Perel, T. Shah, A.D. Hingorani, J.P. Casas, CYP2C19 genotype, clopidogrel metabolism, platelet function and cardiovascular events. A systemic review and meta-analysis, JAMA 306 (24) (2011) 2704–2714. [31] J.M. Siller-Matula, B. Jilma, Why have studies of tailored anti-platelet therapy failed so far? Thromb. Haemost. 110 (2013) 628–631. [32] J.M. Siller-Matula, D. Trenk, K. Schrör, M. Gawaz, S.D. Kristensen, R.F. Storey, K. Huber, EPA (European Platelet Academy), Response Variability to P2Y12 Receptor Inhibitors: Expectations and Reality, J. Am. Coll. Cardiol. Intv. 6 (11) (2013) 1111–1128. [33] C. Bal Dit Sollier, N. Berge, B. Boval, et al., Differential sensitivity and kinetics of response of different ex vivo tests monitoring functional variability of platelet response to clopidogrel, Thromb. Haemost. 104 (2010) 571–581.
Contents lists available at ScienceDirect
Thrombosis Research journal homepage: www.elsevier.com/locate/thromres
Full Length Article
Association between high on-treatment platelet reactivity and occurrence of cerebral ischemic events in patients undergoing percutaneous coronary intervention☆ A. Komosa a,⁎, J.M. Siller-Matula b, M. Lesiak a, M. Michalak c, J. Kowal d, M. Mączyński a, A. Siniawski a, T. Mularek-Kubzdela a, S. Wiśniewski e, S. Grajek a a
1st Department of Cardiology, Poznan University of Medical Sciences, Poland Department of Cardiology, Medical University of Vienna, Austria c Department of Computer Science and Statistics, Poznan University of Medical Sciences, Poland d 1st Department of Clinical Pharmacology, Poznan University of Medical Sciences, Poland e Pathology Department Greater Poland Cancer Centre, Poznan, Poland b
a r t i c l e
i n f o
Article history: Received 5 October 2015 Received in revised form 25 November 2015 Accepted 23 December 2015 Available online 24 December 2015 Keywords: Aggregation Antiplatelet therapy Clopidogrel Stroke
a b s t r a c t Introduction: Percutaneous coronary angioplasty (PCI) has become a routine treatment in symptomatic patients with coronary artery disease. The use of new generation drug eluting stents (DES) and dual antiplatelet therapy has significantly improved treatment outcomes and increased patients' safety by reducing the risk of stent thrombosis. Aims: The goal of this study was to assess whether high on treatment platelet reactivity (HTPR), despite clopidogrel treatment, measured with Multiplate Electrode Aggregometer (MEA) is associated with the risk of adverse ischemic cerebral events. Methods: Symptomatic patients with coronary artery disease admitted for coronary angiography and angioplasty (PCI) were consecutively enrolled in this study. 249 consecutive patients underwent coronary artery stenting for stable angina (n = 215) or non-ST-elevation acute coronary syndrome (n = 34). Inhibition of platelet aggregation was assessed by MEA. Genetic polymorphism of CYP2C19 was tested by HRM Real-Time PCR method in 150 patients. Results: Patients with HTPR were more frequently diagnosed with ischemic stroke (p = 0.0351, OR = 16.818, 95% CI [1.464–193.23]) and other ischemic cerebral events (stroke or TIA, p = 0.0339, OR = 6.5, 95% CI [1.36– 31.07]). Cumulative assessment of all ischemic and hemorrhagic events showed no statistical significance. Cerebral ischemic event was the only adverse event that correlated with CYP2C19 (*2/*2) allele (p = 0.0489, OR = 10; 95% CI [1.39–71.80]). Conclusions: HTPR assessed by MEA, in patients treated with clopidogrel after coronary artery stenting was found to be an important risk factor of ischemic cerebral events. In concordance, the carriers of CYP2C19*2/*2 allele showed an increased rate of ischemic cerebral events. © 2015 Elsevier Ltd. All rights reserved.
1. Introduction Percutaneous coronary angioplasty (PCI) has become a routine treatment in symptomatic patients with coronary artery disease. New generation drug eluting stents (DES) have significantly improved treatment outcomes and increased patients' safety reducing the risk of stent thrombosis. Several publications have already proven that high on
☆ Authorship declaration: All authors listed meet the authorship criteria according to the latest guidelines of the International Committee of Medical Journal Editors, and all authors are in agreement with the manuscript. ⁎ Corresponding author at: 1st Department of Cardiology, Poznan University of Medical Sciences, Ul. Długa 1/2, 60-848 Poznań, Poland. E-mail address: [email protected] (A. Komosa).
http://dx.doi.org/10.1016/j.thromres.2015.12.021 0049-3848/© 2015 Elsevier Ltd. All rights reserved.
treatment platelet reactivity (HTPR) increased risk of ischemic cardiovascular events (including stent thrombosis) in patients who underwent PCI [1,2,3]. However, there is a lack of data whether HTPR under dual antiplatelet therapy (DAPT) predicts ischemic events after implantation of last generation DES. Similarly, it is unknown whether HTPR in patients treated with clopidogrel may affect the long-term cerebral outcome following the implantation of new generation DES. Platelet reactivity is determined by a variety of genetic markers and no single marker itself can be a target of anti-platelet therapies. Antiplatelet therapies can also fail to suppress platelet function due to high on-treatment systemic inflammation which can be a target of anti-inflammatory agents [4,5]. The CYP2C19 enzyme is of critical importance in a process of clopidogrel bioactivation. Among the several polymorphisms, the
50
A. Komosa et al. / Thrombosis Research 138 (2016) 49–54
CYP2C19*2 loss-of-function allele, was found by Hulot et al. to be associated with impaired antiplatelet response to clopidogrel [6]. There are several studies that have confirmed a correlation between the HTPR on clopidogrel, induced by the expression of CYP2C19*2, and the occurrence of adverse ischemic events, especially stent thrombosis and cerebral ischemic events [7,8]. Bhatt et al. however, have proven no correlation between CYP2C19 genotype and ischemic events [9]. The clinical impact of CYP2C19*2 has to be thoroughly investigated. The goal of this prospective study was to assess whether HTPR, despite clopidogrel treatment, measured with Multiplate Electrode Aggregometer (Multiplate) is associated with the risk of adverse ischemic cerebral events. 2. Methods This was a single-center study conducted at 1st Cardiology Department, Poznan University of Medical Sciences, Poland. Symptomatic patients with coronary artery disease admitted for coronary angiography and angioplasty (PCI) were consecutively enrolled and platelet function analysis and genetic CYP2C19 polymorphism testing was performed in each patient. The study design was approved by the local ethics committee (Policy no. 86/11). Signed informed consent was obtained from all patients. 2.1. Study population A total of 249 consecutive patients underwent coronary artery stenting for stable angina (n = 215; 61 females and 154 males) or non-ST-elevation acute coronary syndrome (NSTE-ACS) (n = 34; 12 females and 22 males) from March 2011 to January 2012. Among the NSTE-ACS patients, positive markers of myocardial necrosis (troponin or CK-MB) were found in 28 persons. The patients pretreated or on clopidogrel therapy for at least 5 days prior to PCI did not receive any additional loading dose of the drug. Clopidogrel naive patients received a loading dose of 300 mg one day prior to elective PCI, followed by a maintenance dose of 75 mg. A loading dose of 600 mg was given to all patients with acute coronary syndrome (ACS) prior to PCI, followed by a maintenance dose of 75 mg. All patients were already on acetylsalicylic acid (ASA) treatment; 75-mg daily dose. Unfractionated heparin was periprocedurally administered to all patients at the dosage of 70 U/kg. None of them required additional GP IIb/IIIa inhibitor infusion. PCI procedure was performed and other medications were administered in accordance with the current guidelines [10,11].
third day after PCI (just before the administration of the next 75-mg daily dose). According to Bonello et al. consensus on definition of HTPR, patients with values higher than 468 AU/min were classified as HTPR and below this cut-off value — as clopidogrel responders: non-HTPR [14].
2.3. Genotyping Genetic polymorphism of CYP2C19 was tested using the HRM RealTime PCR method (HRM, high resolution melting; PCR, polymerase chain reaction) and it was performed in 150 patients. Due to certain technical problems reliable results were obtained in 147 patients. Single nucleotide polymorphism (SNP) was used in order to identify polymorphisms. All genotyping procedures were performed in DNA Center, Poznan, Poland. Genomic DNA was extracted from peripheral blood leukocytes with a commercial Dneasy Blood Mini Kit for genomic DNA isolation. Blood samples (5 ml) were drawn into EDTA-K2 tubes and stored at 20 °C until DNA isolation. The following functional polymorphisms were selected: CYP2C19*2 (c. G681A; rs4244285) and CYP2C19*3 (c G636A; rs4986893). Genotyping of polymorphisms was performed using a high resolution melting analysis — PCR followed by HRM analysis [15] (HRM; Rotor Gene 6000®, Qiagen, Courtaboeuf, France) using specific primers: 5′ TGCAATAATTTTCCCACTATCA 3′ and 5′ CCTTGCTTTTATGG AAAGTGA 3′ and 5′ CCTTGCTTTTATGGAAAGTGA 3′ and 5′ TTTTTGCT TCCTGAGAAACCA 3′.
2.4. Study end points and clinical observation The patients' outcomes were assessed at discharge and 12 months later at follow-up visits or by phone. The data regarding deaths were obtained from Polish national identification number registry. The primary end point of this study was the cumulative incidence of ischemic events such as cardiovascular death, myocardial infarction (MI) and cerebral events (transient ischemic attack (TIA) ischemic stroke). The diagnosis of MI was established according to Thrombolysis in Myocardial Infarction (TIMI) criteria [16] and based on new abnormal Q-wave on the electrocardiogram and/or an increase in CK-MB value of three or more times above the normal limit. TIA was defined as an episode of neurologic dysfunction lasting less than 24 h. Stroke was defined as a sudden neurological deficit persisting over 24 h, confirmed by a computed tomography scan [17].
2.2. Platelet aggregation assessment 2.5. Statistics Blood samples were obtained from all 249 patients in order to determine the inhibition of platelet aggregation using Multiple Electrode Aggregometry (MEA) — Multiplate Analyzer (Dynabyte). Peripheral venous blood was collected from antecubital vein — 5 ml (the first 5 ml were discarded to avoid spontaneous platelet activation) and shot into blood collecting tubes containing hirudin. The tests were performed 30–60 min after blood drawing. In all blood samples platelet aggregation was determined using MEA — Multiplate Analyzer (Dynabyte) using ADP-test (20 μmol/l solution of ADP) as agonist [12]. The mean value of two independent tests is expressed as the area under the curve (AUC) of the aggregation tracing determined as AU/ min units. A mean value is calculated by the device, if the two results don't show a significantly different results. Only if the two results significantly vary, the test must be repeated. This ensures a satisfactory intraassay variability. The inter-assay variability has been reported to be low (b6%) [13]. The patients undergoing elective PCI had their blood samples drawn on the next day after angioplasty (shortly before the administration of a 75-mg daily dose). In ACS patients' blood samples were taken on the
Calculations were determined as an arithmetic mean and standard deviation (SD). The qualitative features are presented as the number and frequency (percentage) of the observed cases. Previously, we checked if data follows normal distribution (Shapiro–Wilks test). The distribution of blood platelet aggregation values did not follow the normal distribution and the comparison of more than 2 groups was performed by Kruskal–Wallis test with Dunn's post-hoc test. Nominal data were compared using chi-square test of independence. The risk of adverse events depended on platelet aggregation tertiles (T1 + T2 vs. T3) was assessed by odds ratio and 95% confidence interval. Differences in frequencies of adverse events in the studied tertiles were analyzed using the Chi-square for dependence or in case of small observed frequencies Fisher exact test was used [18,19,20]. Genotype frequencies were investigated for compatibility with Hardy–Weinberg equilibrium. Survival function was assessed by Kaplan–Meier estimator. The comparison between survival time in the studied groups was performed by log-rank test. The data were analyzed using Statistica 10.0 software (StatSoft, Inc.). The results were considered significant at p b 0.05.
A. Komosa et al. / Thrombosis Research 138 (2016) 49–54
3. Results
51
Table 2 Cut-off points for each tertile depending on the result of platelet aggregation measured by MEA.
3.1. Demographics
AU/min
The study included 249 patients. The mean age was 64.6 years (39 to 89 years). Elective PCI was performed in 215 patients and in 34 ACS patients. Basic clinical and demographic data are presented in the table (Table 1). In the investigated population a total of 251 stents were implanted during PCI, including 218 (87.5%) DES and 33 (13.3%) Bare Metal Stents. In 176 cases the treatment was performed using the radial access (71%) and in 73 patients using the femoral access (29%). The study population was divided into three groups – tertiles – depending on the results of platelet aggregation measured by Multiplate Analyser. The results were collated and arranged in order from the lowest to the highest value, ranging from 45 to 975 AU/min (Table 2). Cut-off values for each tertile determined 1/3 results of platelet aggregation inhibition that were arranged in ascending order (190 AU/min) and 2/3 of the results (312 AU/min). Having used these cut-off values the tertiles were obtained, as presented in Table 2.
Tertile 1 Tertile 2 Tertile 3
(T1) (T2) (T3)
45–190 191–312 313–975
3.3. In-hospital outcomes Periprocedural MI occurred in 6 patients, in all of them as an asymptomatic rise of necrotic markers. Five of them were non-HTPR (3%) and one was HTPR (1.2%). The difference was not statistically significant. Moreover, during hospitalization there were four cases of hemorrhage, these were mild and in the form of a hematoma following femoral artery puncture. No hemorrhagic complication required surgical treatment. All four events were noted in non-HTPR group.
3.4. 12-month follow-up 3.2. CYP2C19 polymorphism impact on platelet aggregation Genetic polymorphism of CYP2C19 was tested in the first 147 patients. There were no cases of CYP2C19*3 in the study population. There was a deviation of CYP2C19 genetic variants (*1/*1, *2/*1 and *2/*2) distribution from Hardy–Weinberg equilibrium proportions (p = 0.013). CYP2C19 polymorphisms distribution in clopidogrel nonHTPR and HTPR patients and in patients assigned to certain tertiles is presented in Tables 3 and 4, respectively. A detailed analysis of genetic study results showed that a genotype has no effect on HTPR nor the assignment to particular tertiles (Tables 3 and 4, Fig. 1A and B). The level of platelet reactivity inhibition was not significantly different among the given variants. The patients carrying CYP2C19*1/*1 showed the greatest variability in values of platelets aggregation inhibition (45–975 AU/min). The CYP2C19*2/*1 and CYP2C19*2/*2 carriers ranged respectively: 48–570 Au/min and 154–780 AU/min (Fig. 2). Table 1 Baseline characteristics of the study population. All
Non-HTPR
HTPR
p
Study population n = 249 Number (%) Age in years (±SD) Male (%) Body mass; kg (±SD) Height; m (±SD) BMI (±SD) Stable coronary disease (%) NSTACS (%) Previous bypass surgery History of stroke/TIA Hypertension Diabetes mellitus Heart failure Renal impairment GFR b 60 Hyperlipidemia Cigarette smoking
249 (100) 64.6 (9.9) 175 (70.3) 82.3 (15.1) 1.7 (0.1) 28.6 (4.5) 215 (86.4) 34 (13.6) 23 (9.2) 16 (6.4) 198 (79.5) 80 (32.1) 13 (5.2) 54 (21.7) 122 (49) 51 (20.5)
221 (88.8) 64.8 (9.9) 152 (68.8) 81.9 (15.1) 1.69 (0.1) 28.5 (4.5) 190 (86.0) 31 (14.0) 21 (9.5) 15 (6.8) 174 (78.7) 69 (31.2) 11 (5.0) 50 (22.6) 105 (47.5) 44 (19.9)
28 (11.2) 63.3 (9.5) 23 (82.1) 85.5 (14.9) 1.7 (0.1) 29.6 (4.5) 25 (89.3) 3 (10.7) 2 (7.1) 1 (3.6) 24 (85.7) 11 (39.3) 2 (7.1) 4 (14.3) 17 (60.7) 7 (25.0)
ns ns ns ns ns ns ns ns ns ns ns ns ns ns ns
Comedication Aspirin Statines PPI Beta blocker ACE-I Ca-blockers Diuretics Nitrates Morphine
249 (100) 248 (99.6) 91 (36.5) 224 (90.0) 195 (78.3) 54 (21.7) 110 (44.2) 46 (18.5) 7 (2.8)
221 (100) 220 (99.5) 78 (35.3) 197 (89.1) 172 (77.8) 48 (21.7) 99 (44.8) 40 (18.1) 6 (2.7)
28 (100) 28 (100) 13 (46.4) 27 (96.4) 23 (82.1) 6 (21.4) 11 (39.3) 6 (21.4) 1 (3.6)
ns ns ns ns ns ns ns ns ns
The data on all-cause mortality were obtained for all patients. Thirty nine patients were lost to the remaining clinical follow-up (15.7%). The patients lost to follow-up did not change the distribution of the platelet reactivity in the studied population. The comparison of platelet reactivity inhibition did not differ significantly between the followed-up and the whole population. The values of platelet reactivity inhibition for patients lost to follow-up ranged from 48 to 690 AU/min (which accounted for the first 2/3 of the range of the whole analyzed group). All ischemic events are listed in Table 5. Death occurred in 9 patients and unfortunately the causes were determined only in four cases. In two cases the death was due to neoplasm. One patient died of myocardial infarction in 12th month of the follow-up observation due to in-stent thrombosis (0.5%). Another patient died six months after the discharge from our ward as a result of ischemic stroke, confirmed by CT scan. Both patients were in non-HTPR group, one was in T1 + T2 group, the other in T3. No death occurred within 30 days following a hospital discharge. Myocardial infarction occurred in 9 patients. The only STEMI event was found in the previously mentioned patient who died. Other cases are NSTEMI events. There was 1 case of intracranial hemorrhage and 37 cases of minor bleedings that did not require medical attention (hematuria, blood in the stools, bleeding from the nose, bleeding from the gums). Tables 5 and 6 present ischemic and hemorrhagic events, which occurred in patients within 12-month period following a hospital discharge. Patients with HTPR were more frequently diagnosed with ischemic stroke (p = 0.0351, OR = 16.818, 95% CI [1.464–193.23]) and other ischemic cerebral events (stroke or TIA, p = 0.0339, OR = 6.5, 95% CI [1.36–31.07]). All hemorrhages, except for the one case of central nervous system hemorrhage, were of mild nature. Cumulative assessment of all ischemic and hemorrhagic events showed no statistical significance (Table 5). T3 patients were significantly more often diagnosed with ischemic stroke (1.4%), when compared with T1 + T2 patients (0%) (p = 0.0376, OR = 14.255, 95% CI [0.7255–280.10]). Also, it was noted that the patients suffering from any ischemic cerebral events (stroke or Table 3 CYP2C19 polymorphisms distribution in clopidogrel non-HTPR/HTPR. Polymorphism
*1/*1 *2/*1 *2/*2
Study group
Non-HTPR
HTPR
n = 147
%
n = 131
%
n = 16
%
106 31 10
72.1 21.1 6.8
95 27 9
72.5 20.6 6.9
11 4 1
68.8 25.0 6.3
52
A. Komosa et al. / Thrombosis Research 138 (2016) 49–54
Table 4 CYP2C19 polymorphisms distribution in patients assigned to certain tertile depending on the result of platelet aggregation measured by MEA. Polymorphism
*1/*1 *2/*1 *2/*2
Tertile 1 + 2
Tertile 3
n = 147
Study group %
n = 95
%
n = 52
%
106 31 10
72.1 21.1 6.8
71 19 5
74.7 20.0 5.3
35 12 5
67.3 23.1 9.6
TIA) significantly more often were found in T3 group (p = 0.0452, OR = 5.19, 95% CI [0.98–27.47]). Moreover, T3 patients were significantly more often diagnosed with hematuria (5.6%) than T1 + T2 patients (0.7%) (p = 0.0457, OR = 8.239, 95% CI [0.9027–75.193]). Cumulative assessment of all hemorrhagic complications showed no statistical significance. However, cumulative assessment of deaths and all ischemic events showed a significant correlation with T3 assignment (p = 0.0481, OR = 2.37, 95% CI [0.99–5.67]) (Table 6). 3.5. Assessment of CYP2C2C19 allele impact on clinical events Cerebral ischemic event was the only adverse event that was dependent on CYP2C19 (*2/*2) allele (p = 0.0489, OR = 10; 95% CI [1.39– 71.80]). This event more often occurred among patients with CYP2C19 (*2/*2) allele comparing to (*1/*1) allele 25% vs. 3.23%. There was no significant correlation between the genotype and hemorrhagic events. 3.6. Kaplan–Meier survival curve analysis Fig. 3 shows survival curves of non-HTPR group and patients with HTPR. The survival after 12-month follow-up was not significantly different and amounted to 95.83% vs. 95.76% (p = 0.9933), respectively.
Fig. 2. Levels of platelet aggregation inhibition in CYP2C19 genetic polymorphism variants.
Similarly, no differences were found with relations to T1 + T2 and T3 patients' survival, which amounted to 96.45% vs. 94.44% (p = 0.7071, Fig. 4) respectively. 4. Discussion It is known that insufficient platelet inhibition in patients undergoing PCI increases the risk of stent thrombosis and recurrent cardiovascular ischemic events [21,22,23]. Patients on DAPT are also at risk of major cerebral complications such as ischemic and hemorrhagic events. The aim off this study was to investigate if there's any association between HTPR and cerebral adverse events. Recently, Taglieri et al. have published a meta-analysis of 14 studies including 11,959 patients focused at determining whether patients undergoing PCI with HTPR are also at increased risk of stroke [24]. They have demonstrated that patients with HTPR had higher risk of stroke compared to patients with an adequate response to clopidogrel treatment (1.2% vs. 0.7%, relative risk on fixed effect 1.84, 95% CI [1.21– 2.80]). We demonstrated that patients with HTPR were more frequently diagnosed with ischemic stroke (p = 0.0351, OR = 16.818, 95% CI [1.464–193.23]) and other cerebral ischemic events that is consistent with the results of the meta-analysis. Numerous factors are associated with HTPR: acute coronary syndrome, renal impairment, obesity, older age, reduced left ventricle function, inflammatory disorders, diabetes mellitus, drug–drug interactions [25]. The role of genetic component in modulation of platelet activation pathways is also of great importance [26]. There are many uncertainties associated with genetic tests being used for detection of patients who carry the gene of impaired metabolism of antiplatelet drugs. It is
Table 5 Ischemic and hemorrhagic events in 12-month follow-up. Patients divided into non-HTPR and HTPR (n = 210). Clinical outcome
Fig. 1. (A) The percentage distribution of CYP2C19 polymorphism variants in the study population: HTPR and non-HTPR. (B) The percentage distribution of CYP2C19 polymorphism variants in the study population divided into tertiles.
Ischemic events Death Myocardial infarction Stroke TIA Cumulative incidence of cerebral ischemic events Composite of all ischemic events Total Hemorrhagic events Cumulative incidence of Hemorrhagic events
Study group
Non-HTPR HTPR
N
N
9 9 3 4 7
% 4.3 4.3 1.4 1.9 3.3
%
p
N %
8 8 1 3 4
4.3 4.3 0.5 1.6 2.2
1 1 2 1 3
4.2 4.2 8.3 4.2 12.5
ns ns 0.0351 ns 0.0339
16 7.6 12 23 11.0 18
6.5 9.7
4 5
16.7 ns 20.8 ns
38 18.1 33
17.7
5
20.8 ns
A. Komosa et al. / Thrombosis Research 138 (2016) 49–54
53
Table 6 Ischemic and hemorrhagic events during 12-month follow-up; assignment of patients to tertiles (n = 210). Clinical outcome
Ischemic events Death Myocardial infarction Stroke TIA Cumulative incidence of cerebral ischemic events Composite of all ischemic events Total Hemorrhagic events Cumulative incidence of Hemorrhagic events
Study group
Tertiles 1+2
Tertile 3
N
N
N
9 9 3 4 7
% 4.3 4.3 1.4 1.9 3.3
4 6 0 2 2
16 7.6 8 23 11.0 11
% 2.9 4.3 0 1.4 1.4
5 3 3 2 5
p
% 7.0 4.2 4.2 2.8 7.0
ns ns 0.0376 ns 0.0452
5.8 8 11.3 ns 7.9 12 16.9 0.0481
38 18.1 20 14.4 18 25.4 ns
estimated that as many as 30% of the Caucasian race are the carriers of a defective gene variation, which results in the increased risk of adverse cardiovascular events [27]. Although it is possible to detect gene variants predisposing to impaired response to antiplatelet drug there is still insufficient information related to genetic poor responsiveness and its impact on clinical events in patients. The area of greatest research is HTPR on clopidogrel conditioned by the expression of mutated CYP2C19*2 allele of clopidogrel impaired metabolism [28]. There have been many significant studies confirming that CYP2C19*2 or *3 correlates with a lower platelet inhibition, which is associated with the increased risk of ischemic events, such as stent thrombosis [29]. The meta-analysis published by Hulot et al. showed that CYP2C19*2 allele carriers diagnosed with cardiac ischemia are over 30% more likely to develop adverse cardiac events when compared with the so called “noncarriers” (9.7% v. 7.8%; (OR):1.29, p b 0.001) [6]. The results of metaanalysis involving 32 major studies investigating the relations of CYP2C19 polymorphism and platelet aggregation inhibition and clinical events in over 42 thousand patients were published in 2011. A lower level of active clopidogrel metabolite and increased platelet activity, despite antiaggregation treatment, were found in carriers of impaired clopidogrel metabolite allele. Despite such a considerable number of investigated patients no significant relation between a particular genotype and its impact on cardiovascular events was observed [30]. The presented study group (n = 147) involved 106 cases of *1/*1 (72.1%) polymorphism, 31 cases of *2/*1 (21.1%) polymorphism and 10 cases of *2/*2 (6.8) polymorphism; the total percentage of *2/*2 and *2/*1 homozygous and heterozygous genotypes was 27%. Sibbing's paper published in 2009 investigating the population of 2485 patients showed
Fig. 4. Kaplan–Meier survival curves assigned to particular tertiles.
that the percentage distribution of individual polymorphisms was: *1/ *1 (73%) respectively and a total sum of polymorphisms was *2/*2 and *2/*1 (27%) respectively. The presented population included more cases of *2/*2 polymorphism i.e. 6.8%, whereas only 4% had been expected. Thus, the Hardy–Weinberg equilibrium model was not met (p = 0.013), which was to be considered in favor of the study. However, despite the more frequent occurrence of *2/*2 impaired variant no significant dependency between a genotype and the frequency of HTPR on clopidogrel was shown. Similarly, the frequency of certain genotype occurrences did not differ significantly with regard to the analyzed tertiles: T1 + T2 + T3. Interestingly enough, our study showed that a significant correlation between CYP2C19 allele (*2/ *2) and ischemic cerebral events (p = 0.0489, OR = 10; 95% CI [1.39–71.80]). However, no significant correlation was found between a genotype and other ischemic events and hemorrhagic complications. This lack of correlation with such events as death or stroke may be related to a low number of these events occurring in a lowrisk population however, numerous contradictory findings can be found in other relevant papers. The majority of recent clinical randomized trials (GRAVITAS, TRIGGER-PCI and ARCTIC) have not supported the hypothesis that platelet function or genetic testing and tailored antiplatelet therapy are providing a favorable clinical outcome. However, these trials have multiple limitations e.g. different study populations, follow-ups, treatment strategies, study endpoints or time-points of blood sampling, therapy adjustment, inclusion of low-to-moderate risk patients [31]. A possible solution would be to use an algorithm for personalized antiplatelet therapy in patients who are at high thrombotic risk as recently proposed [25]. This global risk algorithm is based on clinical (PREDICT score), biological (platelet function) and genetic (CYP2C19*2 carrier status) information. Nevertheless, this algorithm has to be evaluated in a prospective study.
4.1. Limitations
Fig. 3. Kaplan–Meier survival curve for HTPR and non-HTPR.
The main limitation of this study is the low number of adverse events. Taking this into account, we used Fisher exact test instead of chi-square, however, the power of the analysis is limited. We used only a single platelet function test, the MEA. MEA has been shown to predict thrombotic events quite effectively (OR: 9–37; AUC: 0.78–0.92; sensitivity: 70–90% and specificity: 84– 100%) [32]. The major reason for choosing MEA and not VerifyNow was the cost of a single measurement, which is 5-fold lower for MEA that for VerifyNow. Moreover, the additional limitation of VerifyNow is a poor correlation with the P2Y12 receptor occupancy, where the sensitivity of the VerifyNow P2Y12 assay decreased at higher clopidogrel responses [33]. As LTA and VASP assay are labor intensive, we decided to use MEA.
54
A. Komosa et al. / Thrombosis Research 138 (2016) 49–54
5. Conclusions High on-treatment platelet reactivity, assessed by MEA, in patients treated with clopidogrel after PCI was an important risk factor of ischemic cerebral events. Despite the fact that CYP2C19 polymorphism correlated poorly with the occurrence of HTPR, carriers of CYP2C19*2/*2 allele showed an increased rate of ischemic cerebral events. Acknowledgments We are thankful to Grzegorz Matusiak for his contribution to this manuscript. References [1] W. Hochholzer, D. Trenk, H.P. Bestehorn, et al., Impact of the degree of periinterventional platelet inhibition after loading with clopidogrel on early clinical outcome of elective coronary stent placement, J. Am. Coll. Cardiol. 48 (2006) 1742–1750. [2] G.W. Stone, B. Witzenbichler, G. Weisz, et al., Platelet reactivity and clinical outcomes after coronary artery implantation of drug-eluting stents (ADAPT-DES): a prospective multicentre registry study, Lancet 382 (2013) 614–623. [3] K.P. Bliden, J. DiChiara, U.S. Tantry, A.K. Bassi, S.K. Chaganti, P.A. Gurbel, Increased risk in patients with high platelet aggregation receiving chronic clopidogrel therapy undergoing percutaneous coronary intervention is the current antiplatelet therapy adequate? JACC 49 (2007) 657–666. [4] A.Y. Gasparyan, et al., The role of aspirin in cardiovascular prevention: implications of aspirin resistance, J. Am. Coll. Cardiol. 51 (19) (2008 May 13) 1829–1843. [5] U.S. Tantry, et al., Resistance to antiplatelet drugs: what progress has been made? Expert. Opin. Pharmacother. 15 (17) (2014 Dec) 2553–2564. [6] J.S. Hulot, J.P. Collet, A. Pena, et al., Cardiovascular risk in clopidogrel-treated patients according to cytochrome P450 2C10*2 loss-of-function allele or proton pump inhibitor coadministration: a systematic metaanalysis, J. Am. Coll. Cardiol. 56 (2010) 134–143. [7] B. Giusti, A.M. Gori, R. Marcucci, C. Saracini, I. Sestini, et al., Relation of cytochrome P450 2C19 loss-of-function polymorphism to occurrence of drug-eluting coronary stent thrombosis, Am. J. Cardiol. 103 (2009) 806–811. [8] D. Sibbing, J. Stegherr, W. Latz, et al., Cytochrome P450 2C19 loss-of-function polymorphism and stent thrombosis following percutaneous coronary intervention, Eur. Heart J. 30 (2009) 916–922. [9] D.L. Bhatt, G. Paré, J.W. Eikelboom, K.L. Simonsen, E.S. Emison, K.A. Fox, et al., The relationship between CYP2C19 polymorphisms and ischaemic and bleeding outcomes in stable outpatients: the CHARISMA genetics study, Eur. Heart J. 33 (2012) 2143–2150. [10] J.M. Siller-Matula, G. Delle-Karth, I.M. Lang, et al., Phenotyping vs. genotyping for prediction of clopidogrel efficacy and safety: the PEGASUS-PCI study, J. Thromb. Haemost. 10 (4) (2012) 529–542. [11] J.M. Siller-Matula, M. Francesconi, C. Dechant, et al., Personalized antiplatelet treatment after percutaneous coronary intervention: the MADONNA study, Int. J. Cardiol. 167 (5) (2013) 2018–2023. [12] P. Harrison, Advances in the monitoring of anti-P2Y12 therapy, Platelets 23 (7) (2012) 510–525. [13] O. Toth, A. Calatzis, S. Penz, H. Losonczy, W. Siess, Multiple electrode aggregometry: a new device to measure platelet aggregation in whole blood, Thromb. Haemost. 96 (6) (2006) 781–788.
[14] L. Bonello, U.S. Tantry, R. Marcucci, et al., Consensus and future directions on the definition of high on-treatment platelet reactivity to adenosine diphosphate, J. Am. Coll. Cardiol. 56 (12) (2010 Sep 14) 919–933. [15] D.G. Santos, M.F. Resende, J.G. Mill, A.J. Mansur, J.E. Krieger, A.C. Pereira, Nuclear factor (NF) kappaB polymorphism is associated with heart function in patients with heart failure, BMC Med. Genet. 11 (1) (2010) 89. [16] TIMI Study Group. Definitions used in TIMI trials. http://www.timi.org (1 August 2008). [17] C.S. Kidwell, S. Warach, Acute ischemic cerebrovascular syndrome: diagnostic criteria, Stroke 34 (12) (December 2003) 2995–2998, http://dx.doi.org/10.1161/ 01.STR.0000098902.69855.A9 (PMID 14605325). [18] T. Geissler, D. Grass, B. Bigalke, et al., The Residual Platelet Aggregation after Deployment of Intracoronary Stent (PREDICT) score, J. Thromb. Haemost. 6 (2008) 54–61. [19] D.P. Fishbein, A.S. Hellkamp, D.B. Mark, et al., Use of the 6-min walk distance to identify variations in treatment benefits from implantable cardioverterdefibrillator and amiodarone results from the SCD-HeFT (Sudden Cardiac Death in Heart Failure Trial), JACC 63 (23) (2014) 2560–2568. [20] C.I. Prodan, J.A. Stoner, G.L. Dale, Original article. Acute hemorrhagic complications are associated with lowercoated-platelet levels in non-lacunar brain infarction, J. Thromb. Haemost. 13 (2015) 1–7. [21] M.J. Price, S. Endemann, R.R. Gollapudi, et al., Prognostic significance of postclopidogrel platelet reactivity assessed by a point-of-care assay on thrombotic events after drug-eluting stent implantation, Eur. Heart J. 29 (2008) 992–1000. [22] P.A. Gurbel, K.P. Bliden, W. Samara, et al., Clopidogrel effect on platelet reactivity in patients with stent thrombosis: results of the CREST study, J. Am. Coll. Cardiol. 46 (2005) 1827–1832. [23] S. Matetzky, B. Shenkman, V. Guetta, et al., Clopidogrel resistance is associated with increased risk of recurrent atherothrombotic events in patients with acute myocardial infarction, Circulation 109 (2004) 3171–3175. [24] N. Taglieri, M.L. Bacchi Reggiani, T. Palmerini, et al., Risk of stroke in patients with high on-clopidogrel platelet reactivity to adenosine diphosphate after percutaneous coronary intervention, Am. J. Cardiol. 113 (2014) 1807–1814. [25] J.M. Siller -Matula, D. Trenk, K. Schrör, et al., How to improve the concept of individualised antiplatelet therapy with P2Y12 receptor inhibitors—is an algorithm the answer? Thromb. Haemost. 113 (1) (2015) 37–52. [26] J. Shanker, et al., Platelet function and antiplatelet therapy in cardiovascular disease: implications of genetic polymorphisms, Curr. Vasc. Pharmacol. 9 (4) (2011) 479–489. [27] I.Y. Gong, N. Crown, C.M. Suen, et al., Clarifying the importance of CYP2C19 and PON1 in the mechanism of clopidogrel bioactivation and in vivo antiplatelet response, Eur. Heart J. 33 (22) (2012) 2856–2864. [28] T. Yin, T. Miyata, Pharmacogenomics of clopidogrel: evidence and perspectives, Thromb. Res. 128 (2011) 307–316. [29] A. Pena, J.P. Collet, J.S. Hulot, et al., Can we override clopidogrel resistance? Circulation 119 (2009) 2854–2857. [30] M. Holmes, P. Perel, T. Shah, A.D. Hingorani, J.P. Casas, CYP2C19 genotype, clopidogrel metabolism, platelet function and cardiovascular events. A systemic review and meta-analysis, JAMA 306 (24) (2011) 2704–2714. [31] J.M. Siller-Matula, B. Jilma, Why have studies of tailored anti-platelet therapy failed so far? Thromb. Haemost. 110 (2013) 628–631. [32] J.M. Siller-Matula, D. Trenk, K. Schrör, M. Gawaz, S.D. Kristensen, R.F. Storey, K. Huber, EPA (European Platelet Academy), Response Variability to P2Y12 Receptor Inhibitors: Expectations and Reality, J. Am. Coll. Cardiol. Intv. 6 (11) (2013) 1111–1128. [33] C. Bal Dit Sollier, N. Berge, B. Boval, et al., Differential sensitivity and kinetics of response of different ex vivo tests monitoring functional variability of platelet response to clopidogrel, Thromb. Haemost. 104 (2010) 571–581.