- Email: [email protected]
Association between MTHFR variant and diabetic neuropathy
Accepted Manuscript Title: Association between MTHFR variant and diabetic neuropathy Authors: Armita Kakavand Hamidi, Mania Radfar, Mahsa M. Amoli PII: DOI: Reference:
S1734-1140(17)30306-7 http://dx.doi.org/doi:10.1016/j.pharep.2017.04.017 PHAREP 713
To appear in: Received date: Revised date: Accepted date:
14-3-2016 3-4-2017 25-4-2017
Please cite this article as: Armita Kakavand Hamidi, Mania Radfar, Mahsa M.Amoli, Association between MTHFR variant and diabetic neuropathy (2010), http://dx.doi.org/10.1016/j.pharep.2017.04.017 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Association between MTHFR variant and diabetic neuropathy
Armita Kakavand Hamidi, MSc; 1 Mania Radfar, PharmD.;2, 3 *Mahsa M Amoli, MD, PhD; 1*
1
Metabolic Disorders Research Center, Endocrinology and Metabolism Molecular-Cellular
Sciences Institute, Tehran University of Medical Sciences, Tehran, Iran 2
Endocriology and Metabolism Research Center, Edocrinology and Metabolism Clinical Sciences
Institute, Tehran University of Medical Sciences, Tehran, Iran 3
Department of Clinical Pharmacy, Faculty of Pharmacy, Tehran University of Medical Sciences, Tehran,
Iran
* Correspondence to: Mahsa M.Amoli MD,PhD EMRI, Dr Shariati Hospital, North Karegar St., Tehran 1411413137, Iran. Tel: +98 21 88026902-3 Fax: + 98 21 88029399 E-mail: [email protected]
Abstract Background: Methylene-tetrahydrofolate reductase (MTHFR) gene variant may play an important role in the pathophysiology of diabetes and its complications due to its influence on plasma homocysteine levels and also its effect on scavenging peroxynitrite radicals. Diabetic peripheral neuropathy (DPN) is one of the most common diabetic chronic complications.
Purpose of the study: The aim of this study was to investigate the relationship between diabetic neuropathy and MTHFR gene C677T and 1298A ⁄C polymorphisms. Method:Patients with type 2 diabetes N=248 were enrolled in the study, consisting of patients with neuropathy (N=141) and patients without neuropathy (N=107). MTHFR C677T polymorphism was analyzed using polymerase chain reaction followed by restriction fragment length polymorphism (PCR-RFLP) of genomic DNA for genotyping of samples. 1298A ⁄C polymorphism was evaluated using ARMS-PCR. Result:There was a significant difference in MTHFR polymorphism between the groups with and without neuropathy. Conclusion:Our results suggest that MTHFR 677 variant confer risk for diabetic neuropathy among Iranian patients with type 2 diabetes.
Keywords: MTHFR, Diabetic neuropathy, Polymorphism
Introduction Diabetes Mellitus type 2 (DM2) is showing an increasing prevalence worldwide and is known as potential health burden, with a range of systemic complications including, neuropathies. Neuropathies, particularly diabetic peripheral neuropathy (DPN) is recognized as the most frequent chronic complications of diabetes. DPN affects up to 50% of patients with type 2 diabetes at age >60 and is responsible for significant mortality and morbidity as well as decline in quality of life. Approximately half of the cases of DPN might be asymptomatic while patients are at risk of severe foot injury [1-2]. Methylene-tetrahydrofolate reductase (MTHFR) is an enzyme encoded by the MTHFR gene in human[1].MTHFR is an enzyme with major role in folate and homocysteine metabolism. Hyper-homocysteinemia is the result of diminished activity of MTHFR. Mutations of the MTHFR gene might lead to reduced enzymatic activity. In vitro studies revealed that hyper-homocysteinemia damages nervous function through direct cytotoxic
effects or as a result of oxidative injuries of endothelial cell. Therefore, in diabetes macroand microvascular complications associated with higher hyper-homocysteinemia plasma level might be associated with nervous injuries[3]. MTHFR acts in catalyzingthe conversion of 5, 10-methylenetetrahydrofolate to the active form of folate5-methyltetrahydrofolate (5-MTHF), which is co-substrate for homocysteine(Hcy) remethylation to methionine [1].5-MTHF which is a circulating form of folate also act as peroxynitrite scavenger and conduct several effect on endothelial function thorough by diminishing generation of vascular superoxide and enhancement in nitric oxide (NO) level [4]. MTHFR gene is located on chromosome 1p36.3 in humans, consisting of 11 exons[5].Several single nucleotide polymorphisms (SNPs) within this gene have been defined and C677T (rsl80ll33) and Al298C (rsl80ll31) variants are the two most explored ones [1].They both are functional polymorphisms which cause decreased enzyme activity, resulting in diminished amount of folate, vitamins B6, B12 and higher plasma level of homocysteine. It has been demonstrated that each copy of the 677T allele causes substitution of the amino acid alanine to valine at amino acid 222 in the catalytic domain of MTHFR[1] and result in a 35% decline in enzyme activity[6]. Individuals with two copies T allele (677TT) (homozygous) have MTHFR deficiency[1].In comparison to the normal C/C genotype, approximately 35% and 70% enzyme activity have been reported in the heterozygous individuals with C/T genotype and the homozygous T/T genotypes, respectively[7]. Based on its biological functions, this variant which is common in various populations has been considered as a potential candidate polymorphism for studying T2DM and neuropathies [8-9].The frequency of 677C>T, has been approximately estimated as 33%–37% heterozygous and about 10% homozygous in Europeans[6].In a meta-analysis in order to examine whether frequencies of the C677T MTHFR gene polymorphism were population dependent, van der Puta and colleagues (1997) reported that prevalence of homozygosity for this polymorphism was 5% to 16% in various populations and appeared to be very common in Hispanics [10]. Peripheral neuropathy is an unusual feature during the course of MTHFR deficiency [11].Recently, a number of case–control studies have been surveyed the association between the 677C>T polymorphism in the MTHFR gene and T2DM or diabetes-related
complications. Nevertheless, these studies have presented conflicting results, which has prevented a definitive conclusion to date[8]. The aim of this study wasto investigate the association between MTHFR genotype with diabetic neuropathy to determine whether C677T polymorphism can serve as a useful genetic marker of neuropathy among Iranian patients with type 2 diabetes.
Materials and Methods Subjects A total of 248 subjects comprised of patients with type 2 diabetes were enrolled.Patients with diabetes were diagnosed according to American Diabetes Association Criteria.Patients were categorized as diabetics with neuropathy (N=141) and diabetics without neuropathy (N=107). These two groups were matched for age and BMI and all of them were non-related volunteers. Participants were categorized according to validated questionnaires for the United Kingdom screening test (founded on the patients’ selfreported sensory neuropathy symptoms) (UK) and 10-point monofilament testing. The United Kingdom screening test (UKST), (a uncomplicated, precise and reproducible clinical method for evaluating the symptoms and signs of peripheral neuropathy (PN) in diabetes mellitus) is a two element diagnostic examination including scores for symptoms and signs and was used by Young et al. to find out the prevalence of PN in the United Kingdom[12].The UK questionnaire consists of questions concerning the category, harshness, and position of the complaints (symptoms) as well as the neuropathy signs (gathered through history taking). Scores higher than two were considered as the presence of neuropathy. Monofilament examination was applied on 10 diverse points on the sole and dorsum of the foot; the lack of feeling in one or more of these points was regarded as peripheral neuropathy[13]. Demographic data including age, BMI, duration of diabetes, diabetes family history and HbA1cwere collected from patients. Blood sampling (3-5 cc of venous bloods collected in EDTA tubes) was performed on all the patients included in the study.
Exclusion criteria were as follow: Type1 diabetes, gestational diabetes, pregnancy, HbA1c≥ 9, age more than 65 years old, diabetes duration less than 5 years, smoking or being an addict. The study was approved by the Tehran University of Medical Sciences ethical committeeand informed consents were gathered upon enrollment. Genomic DNA analysis Genomic DNA extraction was carried out on whole blood (anticoagulated) using phenol chloroform protocol. DNA was amplified by polymerase chain reaction (PCR) followed by a 2% agarose gel electrophoresis of the PCR products. The primers sequences for PCR were as follows: forward,5’TGAAGGAGAAGGTGTCTGCGGGA3’; reverse: 5’AGGACGGTGCGGTGAGAGTG3’. The total volume of PCR reaction was 20ul.The product of 198 bp was amplified by 35 cycles of denaturation at 95°C for 30 sec; annealing at 67°C for 30 sec and extension at72°C for 30 sec. An initial melting step of 5 min at 95 °C and a final elongation step of 5 min at 72 °C were also included.Restriction fragment length polymorphism (RFLP) was performed for genotyping of common polymorphism in the MTHFR gene (677 C→T). After amplification, the 198 bp PCR product was digested with Hinf I (Thermo scientific) in a 17 μl reaction solution containing 10 μl of PCR product, 1.7 μl of buffer, and 0.1μl of Hinf I, 2000U, at 37˚C overnight. Fragments digested with HinfI were resolved by electrophoresis in 4% agarose gels, stained with SYBR Green viewed with UV transillumination and were photograghed using the gel documentation system.Three potential genotypes, consisting TT, CT, and CC, for the base variation of MTHFR gene at locus 677 were considered. Wild type (CC) individuals were recognized by existence of a 198 bp uncut fragment, heterozygotes (CT) presented 198, 175 and 23 bps fragments, and homozygote variantsknown (TT) by 175 bp band. The prevalence of these genotypes was compared to N=107patients without neuropathy.For genotyping the 1298A ⁄C polymorphism ARMS-PCR with three primers were used: Forward primer (5’CCTTTGGGGAGCTGAAGGACTACTAC3’); reverse primer specific for the wild type (5’CAAAGGACTTCAAAGACAGTC3’) and reverse primer specific for the mutant variants (5’GGTAAAGAACAAAGACTTCAAAGACACTGTG3’) [14].After initial denaturation for 5 min at 95°C a touch-down PCR was undertaken with 14 cycles
consisting of 30 sec denaturation at 95°C 30 sec annealing at 61.7°C and 30 sec elongation at 72°C followed by 25 cycles of 30 sec at 95°C 30 sec at 54.7°C and 30 sec at 72°C. A final elongation step at 72°C for 5 min terminated the program.PCR product were run in 3.5% agarose gels for evaluating the genotype of each sample. Statistical analysis A p value less than 0.05 was considered statistically significant. Numerical data are expressed as mean ± standard deviation (SD) and categorical variables as number and percentage (%).Genotype frequencies were determined for the C677T variant in MTHFR. Allele frequencies werecalculated by counting genes from the observed genotypes. We tested differences in the prevalence of the MTHFR variants between the two groups using the Chi-square test.The level of significance was p<0.05. The software SPSS for Windows version 17.0 was used to perform statistical analysis. Odds ratio (OR) and their 95% confidence intervals (CI) were used to estimate the risk for neuropathy. Results Characteristics of patients N=248 including, family history of diabetes, age, HbA1c, BMI and duration of diabetes are described in Table 1. The prevalence of neuropathy was significantly higher in male group in comparison to the female group (58.2% vs. 41.8%) in our patients. MTHFR C677T polymorphism screening was performed in all patients. We observed a significant difference for MTHFR genotype frequencies between the patients with and without neuropathy (TT 4.3 vs. 11.2%; CT 44 vs. 39.3 %; CC 51.8 vs. 49.5%). The distributions of the MTHFR genotypes in patients and controls are shown in Table 2.Allele and genotype frequencies conform to Hardy-Weinberg equilibrium in our study. In overall, distribution of MTHFR gene C677T polymorphism was significantly different in patients with neuropathy and controls.The frequency of CC+CT Genotype was significantly higher in patients with neuropathy than the patients without neuropathy (p=0.03; OR=2.84, 95%CI:1.03-7.83); The presence of C allele appeared to be a risk allele for the development of neuropathy in patients with type 2 diabetes. After
multivariate analysis for gender, duration of diabetes and HbA1c using regression test the p value still remained significant. 1298A ⁄C polymorphism was screened in 118 patients with neuropathy and 106 patients without neuropathy. No significant result was found between genotype frequency of these groups after merging heterozygous and homozygous mutant genotypes (p= 0.72). Genotype frequencies between the patients with and without neuropathy are shown in Table 3.
Discussion
To investigate the correlation between diabetic neuropathy and MTHFR gene polymorphism a total of 248 patients in two groups of patients with type 2 diabetes with neuropathy and patients with type 2 diabetes without neuropathy were enrolled. Results showed that patients with MTHFR 677C allele were prone to have neuropathy while presence of T allele was a protection against development of neuropathy. The prevalence of neuropathy was significantly higher in male group in our patients. Our observation is supported by previous reports: A study by ThanhDinh and colleagues showed that foot ulcerations predominantly afflict men, with poorer outcomes such as amputations are also more prevalent in men. Finding of this study indicates that women with diabetes are at a lower risk for foot ulceration because they have less severe neuropathy and other risk factors for foot ulceration. Previous data have suggested that men were almost twice as likely as women to develop insensate neuropathy [15]. The results of the study by Fargol Booya confirmed that male gender is associated with neuropathy and this is consistent with the DCCT (Diabetes Control and Complications Trial) report [16]. Aaberg, also demonstrates that the males in the study population developed neuropathy earlier than did the females [17]. Several lines of evidence indicate that susceptibility to the development of diabetic complications is partly under control of genetic factors. Therefore, regarding the role of MTHFR as a potential mediator of diabetes complications[18-20], analysis of C677T
variant of the MTHFR gene in a case-control study will be useful for understanding the impact of genetic factors on the development of diabetic neuropathy. Various prevalence of MTHFR C677T polymorphism has been reported in different populations. The highest frequency has been reported in the Japanese (59.8%), while it is decreased in the western regions of Asia and Europe[21]. The C677T polymorphism has a rather high frequency all over the world and is quite variable according to the geographic and ethnic groups[1, 22].The frequency vary between 40% and 49% in type 2 diabetes mellitus cases inTurkey (49%), Tunisia (45%), Brazil (46%), and China (44%)[5].In Europeans the T allele frequency is 24%-40%, in Japanese populations it has been reported 26%-37%, and in an African American population it is approximately 11%. In Amerindians T allele frequency(%)has been considered as high as 44.9% [1]. Frequency of T homozygous has been estimated about (10%) of the white Americans population. In a study by Garcia-Fragoso et al.,(n=400, unconnected infant individuals), the prevalence of the TT genotype was 14% in Puerto Rican population [1]. The frequency of TT genotype in normal subjects has been reported between 5.6-10.2% in different reports which previously been carried out in various Iranian populations [23-25] Several reports are suggestive of an association between the MTHFR C677T variation and various diseases, while in some of them conflicting results are observed. There is a correlation between high blood levels of homocysteine and risk of cardiovascular disease (CVD) with 677TT individuals who are homozygotes for the C677T variation. There are also reports of arelationship between myocardial infarction (MI) and neural tube defects with the frequency of T allele indicating C677T polymorphism as a risk factor [1]. More recently several meta-analyses with more than 25,000 patients have shown a significant association between the 677T variant and increased risk of CVD [26]. In patients with acute MI from the Eastern Black Sea region of Turkey MTHFR gene homozygote TT variation has been identified as a risk factor [21]. Previous findings suggest that polymorphisms in folate metabolism might increase susceptibility to congenital heart defects (CHD). TT genotype of MTHFR 677 variant has
shown association with the progress of structural congenital heart malformations. In an investigation on 27 children with CHD and their mothers it has been observed that compound heterozygosity for both C677Tand A1298C polymorphisms was 3.7 times more common in children with CHD compared with the newborn controls[10]. Özkulet. Al studied the possibility of genetic factors involvement for the increased plasma Hcy level in patients with Behcet’s disease(BD).Study of an association between the C677T polymorphism and ocular involvement in such patients showed that in BD patients with ocular involvement the frequencies of MTHFR TT genotype (27.8%) was higher and statistically significant compared to patients without ocular involvement[22]. Previous reports have shown that hyperhomocysteinemia has been associated with the increased risk of diabetic neuropathy in diabetic patients independently [27-29]. More recently studies on Chinese population have found that the plasma homocysteine levels were significantly increased in patients with diabetic neuropathy compared with patients without diabetic neuropathy[30-31]. Interestingly, in contrast to previous studies, in the present study T allele was found a protective allele against having neuropathy in Iranian population which means that the MTHFR gene homozygote TT polymorphism is not a risk factor for having neuropathy among Iranian patients with T2DM. In a study by Raza et al.,it has been found that MTHFR CC genotype might be considered as a potential marker for the early detectionof type 2 diabetes mellitus and population at risk of the disease[5]. In acase-control association study among Egyptian cases it has been reported that MTHFR 677 TT genotype have relation with T2DM susceptibility and complications. Similarly, MTHFR 766 T allele carriage was found to be correlated with diabetes among Polish, Indian, Turkish, and Chinese Han1 populations (diabetic retinopathy (DR), diabetic polyneuropathy (DPN) and ischemic heart disease (IHD)) while it was not in association with the pathogenesis or complications of diabetes among Taiwanese and Polish patients.Also another study has shown the association between MTHFR 677 C(rather than the T) allele with diabetes in Czech women.In addition the MTHFR 677 T allele was not
connected with DPN among Turkish patients with diabetes[32].It has been observed that mutant homozygote and heterozygote of C677T polymorphism of MTHFR act on enzyme activity leading to growth of the plasma homocysteine level which is an important factor in pathogenesis of diabetic nephropathy (DN). The same association has also been identified in Caucasians. Compatible with other populations, in Iranian population, no considerable relationship was found between MTHFR polymorphisms and T2DM. Even though, considerable connection of 677T and 1298C alleles with diabetic nephropathy was found. Likewise relations of MTHFR polymorphisms and two more polymorphisms with other genes such as ACE and eNOS showed an association with expansion of DN[33].In our population we checked the association of having neuropathy with C677T polymorphism which showed that presence of C allelewas a risk for development of neuropathy among patients with T2DM. In order to evaluate the effects of MTHFR gene variation Ukinc et al. aimed to study the effect of hyperhomocysteinemia on the development of diabetic microvascular complications. They did not find any particular association between MTHFR gene variant and hyper-homocysteinemia and retinopathy or neuropathy[34]. Numerous studies have examined the involvement of genetic factors for Diabetic Peripheral Neuropathy (DPN) in T2DM in particular, emphasizing a probable relationship with SNPs in several genes including MTHFR. Strong association has been reported between the MTHFR gene C677T polymorphism and diabetic peripheral neuropathy (DPN) in an investigation by Yigit et al. and in their study history of retinopathy was also associated with the MTHFRC677T variationin patients with DPN[3].By contrast, our study has shown that 677CC and 677CT genotypes make patients with diabetes type 2 prone to have neuropathy more than T2DM patients with 677TT genotype. Given all these data it can be speculated that C677T variant of MTHFR gene might be implicated either as a risk or protective marker in various conditions. These discrepancies may be assumed to be due to the effect of epigenetic mechanisms controlling gene expression which are also influenced by genetic and or environmental factors including lifestyle-risk factors and diet. Another mechanism which explains its various effect of might be the functional inference of the polymorphism in a mixture of conditions.
The association between MTHFR polymorphism and several other conditions has been identified as well. Miyao et al. suggested the MTHFR as one of the genetic risk factors for low BMD[35].Other studies have found association of MTHFR gene with cardiac autonomic neuropathy in patients with T1DM or other cardiac complication which might be due to an inflammatory responses leading to neural injury[9]. A correlation between the incidence of the C677T allele and the improvement of renal failure in male patients with type 2 diabetes mellitus after haemodialysis has been also presented by Noiri et al. [5]. In another study MTHFR variants were significantly associated with macroalbuminuria[33]. In conclusion, our study showed the positive association of MTHFR C677T polymorphism with the presence of neuropathy in Iranian patients with type 2 diabetes mellitus. Further studies in a larger population, including studies of other ethnic groups, are necessary to establish this polymorphism as a genetic marker for neuropathy.
Conflict of interest: None to declare
Funding Body: This work has been funded by Endocrinology and Metabolism Clinical
Science Institute, Tehran University of Medical Sciences, Tehran, Iran
Acknowledgment: This work has been funded by Endocrinology and Metabolism Clinical Science Institute, Tehran University of Medical Sciences, Tehran, Iran
References 1. Miranda-Massari JR, Gonzalez MJ, Jimenez FJ, Allende-Vigo MZ, Duconge J. Metabolic correction in the management of diabetic peripheral neuropathy: improving clinical results beyond symptom control. Curr Clin Pharmacol. 2011;6(4):260-73.
2. Setacci C, De Donato G, Setacci F, Chisci E. Diabetic patients: epidemiology and global impact. J Cardiovasc Surg (Torino). 2009;50(3):263. 3. Yigit S, Karakus N, Inanir A. Association of MTHFR gene C677T mutation with diabetic peripheral neuropathy and diabetic retinopathy. Mol Vis. 2013;19:1626. 4. Antoniades C, Shirodaria C, Leeson P, Baarholm OA, Van-Assche T, Cunnington C, et al. MTHFR 677 C>T Polymorphism reveals functional importance for 5methyltetrahydrofolate, not homocysteine, in regulation of vascular redox state and endothelial function in human atherosclerosis. Circulation. 2009;119(18):2507-15. 5. Raza ST, Abbas S, Ahmed F, Fatima J, Zaidi ZH, Mahdi F. Association of MTHFR and PPARγ2 gene polymorphisms in relation to type 2 diabetes mellitus cases among north Indian population. Gene. 2012;511(2):375-9. 6. Hudson G, Yu-Wai-Man P, Zeviani M, Chinnery PF. Genetic variation in the methylenetetrahydrofolate reductase gene, MTHFR, does not alter the risk of visual failure in Leber’s hereditary optic neuropathy. Mol Vis. 2009;15:870. 7. Aleyasin A, Ghazanfari M, Houshmand M. Leber hereditary optic neuropathy: do folate pathway gene alterations influence the expression of mitochondrial DNA mutation? Iran J Public Health. 2010;39(3):53. 8. Huang T, Ren J, Huang J, Li D. Association of homocysteine with type 2 diabetes: a meta-analysis implementing Mendelian randomization approach. BMC genomics. 2013;14(1):867. 9. Witzel I-I, Jelinek HF, Khalaf K, Lee S, Khandoker AH, Alsafar H. Identifying common genetic risk factors of diabetic neuropathies. Front Endocrinol (Lausanne). 2015;6:88. 10. García-Fragoso L, García-García I, Leavitt G, Renta J, Ayala MA, Cadilla CL. MTHFR polymorphisms in Puerto Rican children with isolated congenital heart disease and their mothers. Int J Genet Mol Biol. 2010;2(3):43. 11. Chaabene-Masmoudi A, Mesrati F, Zittoun J, Landrieu P. Insidious peripheral neuropathy occurring under treatment in infantile MTHFR deficiency. J Inherit Metab Dis. 2009;32(1):303-6. 12. Oguejiofor OC,Odenigbo UC, Oguejiofor CB. Screening For Peripheral Neuropathy In Diabetic Patients: The benefits of the United Kingdom Screening Test – UKST- (a clinical scoring system). Trop J Med Res. 2008; 12 (1):45-9.
13. Tabatabaei-Malazy O, Mohajeri-Tehrani M, Madani S, Heshmat R, Larijani B. The prevalence of diabetic peripheral neuropathy and related factors. Iran J Public Health. 2011;40(3):55. 14. Jeddi-Tehrani M, Torabi R, H. Zarnani A, Mohammadzadeh A, Arefi S, Zeraati H, M. Akhondi M, Chamani-Tabriz L, Idali F, Emami S, Zarei S. Analysis of Plasminogen Activator Inhibitor-1, Integrin Beta3, Beta Fibrinogen, and Methylenetetrahydrofolate Reductase Polymorphisms in Iranian Women with Recurrent Pregnancy Loss. Am J Reprod Immunol. 2011;66(2):149-56. 15.Dinh T, Veves A.The influence of gender as a risk factor in diabetic foot ulceration.Wounds. 2008;20(5):127-31. 16.Booya F, Bandarian F, Larijani B, Pajouhi M, Nooraei M, Lotfi J. Potential risk factors for diabetic neuropathy: a case control study.BMC Neurol. 2005;10;5:24. 17.Aaberg ML, Burch DM, Hud ZR, Zacharias MP.Gender differences in the onset of diabetic neuropathy.J Diabetes Complications.2008;22(2):83-7. 18. Mehri S, Koubaa N, Nakbi A, Hammami S, Chaaba R, Mahjoub S, et al. Relationship between genetic polymorphisms of angiotensin-converting enzyme and methylenetetrahydrofolate reductase as risk factors for type 2 diabetes in Tunisian patients. Clin Biochem. 2010;43(3):259-66. 19.Errera FI, Silva ME, Yeh E, Maranduba CM, Folco B, Takahashi W, et al. Effect of polymorphisms of the MTHFR and APOE genes on susceptibility to diabetes and severity of diabetic retinopathy in Brazilian patients. Braz J Med Biol Res. 2006;39(7):883-8. 20.Klerk M, Verhoef P, Clarke R, Blom HJ, Kok FJ, Schouten EG. MTHFR 677C→ T polymorphism and risk of coronary heart disease: a meta-analysis. Jama. 2002;288(16):2023-31. 21.Uçar F, Çelik Ş, Yücel B, Sönmez M, Celep F, Erkut N. MTHFR C677T polymorphism and its relationship to myocardial infarction in the Eastern Black Sea region of Turkey. Arch Med Res. 2011;42(8):709-12. 22.Özkul Y, Evereklioglu C, Borlu M, Taheri S, Calis M, Dündar M, et al. 5, 10Methylenetetrahydrofolate reductase C677T gene polymorphism in Behçet’s patients with or without ocular involvement. Br J Ophthalmol.2005;89(12):1634-7.
23. Jeddi-Tehrani M, Torabi R, Zarnani AH, Mohammadzadeh A, Arefi S, Zeraati H, et al. Analysis of plasminogen activator inhibitor-1, integrin beta3, beta fibrinogen, and methylenetetrahydrofolate reductase polymorphisms in Iranian women with recurrent pregnancy loss. Am J Reprod Immunol. 2011;66(2):149-56. 24. Hosseini M, Houshmand M, Ebrahimi A. MTHFR polymorphisms and breast cancer risk. Arch Med Sci. 2011;7(1):134-7. 25.Naghibalhossaini F, Mokarram P, Khalili I, Vasei M, Hosseini SV, Ashktorab H, et al. MTHFR C677T and A1298C variant genotypes and the risk of microsatellite instability among Iranian colorectal cancer patients. Cancer Genet Cytogenet. 2010;197(2):142-51. 26.van Winkel R, Rutten BP, Peerbooms O, Peuskens J, van Os J, De Hert M. MTHFR and risk of metabolic syndrome in patients with schizophrenia. Schizophr Res. 2010;121(1):193-8. 27.Molina M, Gonzalez R, Folgado J, Real JT, Martinez-Hervas S, Priego A, et al. [Correlation between plasma concentrations of homocysteine and diabetic polyneuropathy evaluated with the Semmes-Weinstein monofilament test in patients with type 2 diabetes mellitus]. Med Clin (Barc). 2013;141(9):382-6. 28.Ambrosch A, Dierkes J, Lobmann R, Kuhne W, Konig W, Luley C, et al. Relation between homocysteinaemia and diabetic neuropathy in patients with Type 2 diabetes mellitus. Diabet Med. 2001;18(3):185-92. 29.Gonzalez R, Pedro T, Martinez-Hervas S, Civera M, Priego MA, Catala M, et al. Plasma homocysteine levels are independently associated with the severity of peripheral polyneuropathy in type 2 diabetic subjects. J Peripher Nerv Syst. 2012;17(2):191-6. 30.Li JB, Cheng YZ, Shi M, Zhang HM, Dai Q, Zhang Y, et al. [The relationship between plasma homocysteine levels and diabetic peripheral neuropathy]. Zhonghua Nei Ke Za Zhi. 2011;50(1):14-7. 31. Jianbo L, Yuche C, Ming S, Jingrong T, Qing D, Yu Z, et al. Association of homocysteine with peripheral neuropathy in Chinese patients with type 2 diabetes. Diabetes Res Clin Pract. 2011;93(1):38-42. 32.Settin A, El-Baz R, Ismaeel A, Tolba W, Allah WA. Association of ACE and MTHFR genetic polymorphisms with type 2 diabetes mellitus: Susceptibility and complications. J Renin Angiotensin Aldosterone Syst. 2015;16(4):838-43
33. Khodaeian M, Enayati S, Tabatabaei-Malazy O, Amoli MM. Association between Genetic Variants and Diabetes Mellitus in Iranian Populations: A Systematic Review of Observational Studies.J Diabetes Res. 2015;2015:21. 34.Ukinc K, Ersoz HO, Karahan C, Erem C, Eminagaoglu S, Hacihasanoglu AB, et al. Methyltetrahydrofolate reductase C677T gene mutation and hyperhomocysteinemia as a novel risk factor for diabetic nephropathy. Endocrine. 2009;36(2):255-61. 35. Miyao M, Morita H, Hosoi T, Kurihara H, Inoue S, Hoshino S, et al. Association of methylenetetrahydrofolate reductase (MTHFR) polymorphism with bone mineral density in postmenopausal Japanese women. Calcif Tissue Int. 2000;66(3):190-4.
Table 1. Demographic data of the diabetic group with neuropathy and without N (%)
Without neuropathy With neuropathy p value
Gender Male (n) (%)
35 (32.7)
82 (58.2)
p<0.001
Female (n) (%)
72 (67.3)
59 (41.8)
Yes
82.7
90.4
no
17.3
9.6
HbA1C (%)
7.5±1.2
7.8±1.1
p=0.02
Duration of diabetes (year) 12.2±5.8
15.2±6.7
p= 0.005
Age (year)
56.3±6.9
56.6±7.1
p=0.9
BMI (kg/m2)
28.4±4.6
28.8±4.3
p=0.7
Diabetes family history
p=0.2
Table2. Prevalence of the MTHFR C677T gene polymorphism in patients with neuropathy and without MTHFR
Patients with neuropathy
Patients without neuropathy
(C677T)
N (%)
N (%)
CC
73 (51.8)
53(49.5)
CT
62(44)
42(39.3)
TT
6(4.3)
12(11.2)
C
208(73.75)
148(69.15)
T
74(26.24)
66(30.84)
p value
genotype 0.03*
Allele 0.2
CC+CT vs. TT: OR=2.84, 95%CI:1.03-7.83.
Table 3. Prevalence of the MTHFR 1298A ⁄ C polymorphism in patients with neuropathy and without MTHFR
Patients with neuropathy
Patients without neuropathy
(1298A ⁄ C)
N (%)
N (%)
HW
68 (57.6)
67(63.2)
H
47(39.8)
39(36.8)
HM
3(2.5)
0(0.00)
p value
genotype
Homozygous wild type= HW; heterozygous=H; Homozygousmutatnt type= HM H+HM vs. HW
0.72*
S1734-1140(17)30306-7 http://dx.doi.org/doi:10.1016/j.pharep.2017.04.017 PHAREP 713
To appear in: Received date: Revised date: Accepted date:
14-3-2016 3-4-2017 25-4-2017
Please cite this article as: Armita Kakavand Hamidi, Mania Radfar, Mahsa M.Amoli, Association between MTHFR variant and diabetic neuropathy (2010), http://dx.doi.org/10.1016/j.pharep.2017.04.017 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Association between MTHFR variant and diabetic neuropathy
Armita Kakavand Hamidi, MSc; 1 Mania Radfar, PharmD.;2, 3 *Mahsa M Amoli, MD, PhD; 1*
1
Metabolic Disorders Research Center, Endocrinology and Metabolism Molecular-Cellular
Sciences Institute, Tehran University of Medical Sciences, Tehran, Iran 2
Endocriology and Metabolism Research Center, Edocrinology and Metabolism Clinical Sciences
Institute, Tehran University of Medical Sciences, Tehran, Iran 3
Department of Clinical Pharmacy, Faculty of Pharmacy, Tehran University of Medical Sciences, Tehran,
Iran
* Correspondence to: Mahsa M.Amoli MD,PhD EMRI, Dr Shariati Hospital, North Karegar St., Tehran 1411413137, Iran. Tel: +98 21 88026902-3 Fax: + 98 21 88029399 E-mail: [email protected]
Abstract Background: Methylene-tetrahydrofolate reductase (MTHFR) gene variant may play an important role in the pathophysiology of diabetes and its complications due to its influence on plasma homocysteine levels and also its effect on scavenging peroxynitrite radicals. Diabetic peripheral neuropathy (DPN) is one of the most common diabetic chronic complications.
Purpose of the study: The aim of this study was to investigate the relationship between diabetic neuropathy and MTHFR gene C677T and 1298A ⁄C polymorphisms. Method:Patients with type 2 diabetes N=248 were enrolled in the study, consisting of patients with neuropathy (N=141) and patients without neuropathy (N=107). MTHFR C677T polymorphism was analyzed using polymerase chain reaction followed by restriction fragment length polymorphism (PCR-RFLP) of genomic DNA for genotyping of samples. 1298A ⁄C polymorphism was evaluated using ARMS-PCR. Result:There was a significant difference in MTHFR polymorphism between the groups with and without neuropathy. Conclusion:Our results suggest that MTHFR 677 variant confer risk for diabetic neuropathy among Iranian patients with type 2 diabetes.
Keywords: MTHFR, Diabetic neuropathy, Polymorphism
Introduction Diabetes Mellitus type 2 (DM2) is showing an increasing prevalence worldwide and is known as potential health burden, with a range of systemic complications including, neuropathies. Neuropathies, particularly diabetic peripheral neuropathy (DPN) is recognized as the most frequent chronic complications of diabetes. DPN affects up to 50% of patients with type 2 diabetes at age >60 and is responsible for significant mortality and morbidity as well as decline in quality of life. Approximately half of the cases of DPN might be asymptomatic while patients are at risk of severe foot injury [1-2]. Methylene-tetrahydrofolate reductase (MTHFR) is an enzyme encoded by the MTHFR gene in human[1].MTHFR is an enzyme with major role in folate and homocysteine metabolism. Hyper-homocysteinemia is the result of diminished activity of MTHFR. Mutations of the MTHFR gene might lead to reduced enzymatic activity. In vitro studies revealed that hyper-homocysteinemia damages nervous function through direct cytotoxic
effects or as a result of oxidative injuries of endothelial cell. Therefore, in diabetes macroand microvascular complications associated with higher hyper-homocysteinemia plasma level might be associated with nervous injuries[3]. MTHFR acts in catalyzingthe conversion of 5, 10-methylenetetrahydrofolate to the active form of folate5-methyltetrahydrofolate (5-MTHF), which is co-substrate for homocysteine(Hcy) remethylation to methionine [1].5-MTHF which is a circulating form of folate also act as peroxynitrite scavenger and conduct several effect on endothelial function thorough by diminishing generation of vascular superoxide and enhancement in nitric oxide (NO) level [4]. MTHFR gene is located on chromosome 1p36.3 in humans, consisting of 11 exons[5].Several single nucleotide polymorphisms (SNPs) within this gene have been defined and C677T (rsl80ll33) and Al298C (rsl80ll31) variants are the two most explored ones [1].They both are functional polymorphisms which cause decreased enzyme activity, resulting in diminished amount of folate, vitamins B6, B12 and higher plasma level of homocysteine. It has been demonstrated that each copy of the 677T allele causes substitution of the amino acid alanine to valine at amino acid 222 in the catalytic domain of MTHFR[1] and result in a 35% decline in enzyme activity[6]. Individuals with two copies T allele (677TT) (homozygous) have MTHFR deficiency[1].In comparison to the normal C/C genotype, approximately 35% and 70% enzyme activity have been reported in the heterozygous individuals with C/T genotype and the homozygous T/T genotypes, respectively[7]. Based on its biological functions, this variant which is common in various populations has been considered as a potential candidate polymorphism for studying T2DM and neuropathies [8-9].The frequency of 677C>T, has been approximately estimated as 33%–37% heterozygous and about 10% homozygous in Europeans[6].In a meta-analysis in order to examine whether frequencies of the C677T MTHFR gene polymorphism were population dependent, van der Puta and colleagues (1997) reported that prevalence of homozygosity for this polymorphism was 5% to 16% in various populations and appeared to be very common in Hispanics [10]. Peripheral neuropathy is an unusual feature during the course of MTHFR deficiency [11].Recently, a number of case–control studies have been surveyed the association between the 677C>T polymorphism in the MTHFR gene and T2DM or diabetes-related
complications. Nevertheless, these studies have presented conflicting results, which has prevented a definitive conclusion to date[8]. The aim of this study wasto investigate the association between MTHFR genotype with diabetic neuropathy to determine whether C677T polymorphism can serve as a useful genetic marker of neuropathy among Iranian patients with type 2 diabetes.
Materials and Methods Subjects A total of 248 subjects comprised of patients with type 2 diabetes were enrolled.Patients with diabetes were diagnosed according to American Diabetes Association Criteria.Patients were categorized as diabetics with neuropathy (N=141) and diabetics without neuropathy (N=107). These two groups were matched for age and BMI and all of them were non-related volunteers. Participants were categorized according to validated questionnaires for the United Kingdom screening test (founded on the patients’ selfreported sensory neuropathy symptoms) (UK) and 10-point monofilament testing. The United Kingdom screening test (UKST), (a uncomplicated, precise and reproducible clinical method for evaluating the symptoms and signs of peripheral neuropathy (PN) in diabetes mellitus) is a two element diagnostic examination including scores for symptoms and signs and was used by Young et al. to find out the prevalence of PN in the United Kingdom[12].The UK questionnaire consists of questions concerning the category, harshness, and position of the complaints (symptoms) as well as the neuropathy signs (gathered through history taking). Scores higher than two were considered as the presence of neuropathy. Monofilament examination was applied on 10 diverse points on the sole and dorsum of the foot; the lack of feeling in one or more of these points was regarded as peripheral neuropathy[13]. Demographic data including age, BMI, duration of diabetes, diabetes family history and HbA1cwere collected from patients. Blood sampling (3-5 cc of venous bloods collected in EDTA tubes) was performed on all the patients included in the study.
Exclusion criteria were as follow: Type1 diabetes, gestational diabetes, pregnancy, HbA1c≥ 9, age more than 65 years old, diabetes duration less than 5 years, smoking or being an addict. The study was approved by the Tehran University of Medical Sciences ethical committeeand informed consents were gathered upon enrollment. Genomic DNA analysis Genomic DNA extraction was carried out on whole blood (anticoagulated) using phenol chloroform protocol. DNA was amplified by polymerase chain reaction (PCR) followed by a 2% agarose gel electrophoresis of the PCR products. The primers sequences for PCR were as follows: forward,5’TGAAGGAGAAGGTGTCTGCGGGA3’; reverse: 5’AGGACGGTGCGGTGAGAGTG3’. The total volume of PCR reaction was 20ul.The product of 198 bp was amplified by 35 cycles of denaturation at 95°C for 30 sec; annealing at 67°C for 30 sec and extension at72°C for 30 sec. An initial melting step of 5 min at 95 °C and a final elongation step of 5 min at 72 °C were also included.Restriction fragment length polymorphism (RFLP) was performed for genotyping of common polymorphism in the MTHFR gene (677 C→T). After amplification, the 198 bp PCR product was digested with Hinf I (Thermo scientific) in a 17 μl reaction solution containing 10 μl of PCR product, 1.7 μl of buffer, and 0.1μl of Hinf I, 2000U, at 37˚C overnight. Fragments digested with HinfI were resolved by electrophoresis in 4% agarose gels, stained with SYBR Green viewed with UV transillumination and were photograghed using the gel documentation system.Three potential genotypes, consisting TT, CT, and CC, for the base variation of MTHFR gene at locus 677 were considered. Wild type (CC) individuals were recognized by existence of a 198 bp uncut fragment, heterozygotes (CT) presented 198, 175 and 23 bps fragments, and homozygote variantsknown (TT) by 175 bp band. The prevalence of these genotypes was compared to N=107patients without neuropathy.For genotyping the 1298A ⁄C polymorphism ARMS-PCR with three primers were used: Forward primer (5’CCTTTGGGGAGCTGAAGGACTACTAC3’); reverse primer specific for the wild type (5’CAAAGGACTTCAAAGACAGTC3’) and reverse primer specific for the mutant variants (5’GGTAAAGAACAAAGACTTCAAAGACACTGTG3’) [14].After initial denaturation for 5 min at 95°C a touch-down PCR was undertaken with 14 cycles
consisting of 30 sec denaturation at 95°C 30 sec annealing at 61.7°C and 30 sec elongation at 72°C followed by 25 cycles of 30 sec at 95°C 30 sec at 54.7°C and 30 sec at 72°C. A final elongation step at 72°C for 5 min terminated the program.PCR product were run in 3.5% agarose gels for evaluating the genotype of each sample. Statistical analysis A p value less than 0.05 was considered statistically significant. Numerical data are expressed as mean ± standard deviation (SD) and categorical variables as number and percentage (%).Genotype frequencies were determined for the C677T variant in MTHFR. Allele frequencies werecalculated by counting genes from the observed genotypes. We tested differences in the prevalence of the MTHFR variants between the two groups using the Chi-square test.The level of significance was p<0.05. The software SPSS for Windows version 17.0 was used to perform statistical analysis. Odds ratio (OR) and their 95% confidence intervals (CI) were used to estimate the risk for neuropathy. Results Characteristics of patients N=248 including, family history of diabetes, age, HbA1c, BMI and duration of diabetes are described in Table 1. The prevalence of neuropathy was significantly higher in male group in comparison to the female group (58.2% vs. 41.8%) in our patients. MTHFR C677T polymorphism screening was performed in all patients. We observed a significant difference for MTHFR genotype frequencies between the patients with and without neuropathy (TT 4.3 vs. 11.2%; CT 44 vs. 39.3 %; CC 51.8 vs. 49.5%). The distributions of the MTHFR genotypes in patients and controls are shown in Table 2.Allele and genotype frequencies conform to Hardy-Weinberg equilibrium in our study. In overall, distribution of MTHFR gene C677T polymorphism was significantly different in patients with neuropathy and controls.The frequency of CC+CT Genotype was significantly higher in patients with neuropathy than the patients without neuropathy (p=0.03; OR=2.84, 95%CI:1.03-7.83); The presence of C allele appeared to be a risk allele for the development of neuropathy in patients with type 2 diabetes. After
multivariate analysis for gender, duration of diabetes and HbA1c using regression test the p value still remained significant. 1298A ⁄C polymorphism was screened in 118 patients with neuropathy and 106 patients without neuropathy. No significant result was found between genotype frequency of these groups after merging heterozygous and homozygous mutant genotypes (p= 0.72). Genotype frequencies between the patients with and without neuropathy are shown in Table 3.
Discussion
To investigate the correlation between diabetic neuropathy and MTHFR gene polymorphism a total of 248 patients in two groups of patients with type 2 diabetes with neuropathy and patients with type 2 diabetes without neuropathy were enrolled. Results showed that patients with MTHFR 677C allele were prone to have neuropathy while presence of T allele was a protection against development of neuropathy. The prevalence of neuropathy was significantly higher in male group in our patients. Our observation is supported by previous reports: A study by ThanhDinh and colleagues showed that foot ulcerations predominantly afflict men, with poorer outcomes such as amputations are also more prevalent in men. Finding of this study indicates that women with diabetes are at a lower risk for foot ulceration because they have less severe neuropathy and other risk factors for foot ulceration. Previous data have suggested that men were almost twice as likely as women to develop insensate neuropathy [15]. The results of the study by Fargol Booya confirmed that male gender is associated with neuropathy and this is consistent with the DCCT (Diabetes Control and Complications Trial) report [16]. Aaberg, also demonstrates that the males in the study population developed neuropathy earlier than did the females [17]. Several lines of evidence indicate that susceptibility to the development of diabetic complications is partly under control of genetic factors. Therefore, regarding the role of MTHFR as a potential mediator of diabetes complications[18-20], analysis of C677T
variant of the MTHFR gene in a case-control study will be useful for understanding the impact of genetic factors on the development of diabetic neuropathy. Various prevalence of MTHFR C677T polymorphism has been reported in different populations. The highest frequency has been reported in the Japanese (59.8%), while it is decreased in the western regions of Asia and Europe[21]. The C677T polymorphism has a rather high frequency all over the world and is quite variable according to the geographic and ethnic groups[1, 22].The frequency vary between 40% and 49% in type 2 diabetes mellitus cases inTurkey (49%), Tunisia (45%), Brazil (46%), and China (44%)[5].In Europeans the T allele frequency is 24%-40%, in Japanese populations it has been reported 26%-37%, and in an African American population it is approximately 11%. In Amerindians T allele frequency(%)has been considered as high as 44.9% [1]. Frequency of T homozygous has been estimated about (10%) of the white Americans population. In a study by Garcia-Fragoso et al.,(n=400, unconnected infant individuals), the prevalence of the TT genotype was 14% in Puerto Rican population [1]. The frequency of TT genotype in normal subjects has been reported between 5.6-10.2% in different reports which previously been carried out in various Iranian populations [23-25] Several reports are suggestive of an association between the MTHFR C677T variation and various diseases, while in some of them conflicting results are observed. There is a correlation between high blood levels of homocysteine and risk of cardiovascular disease (CVD) with 677TT individuals who are homozygotes for the C677T variation. There are also reports of arelationship between myocardial infarction (MI) and neural tube defects with the frequency of T allele indicating C677T polymorphism as a risk factor [1]. More recently several meta-analyses with more than 25,000 patients have shown a significant association between the 677T variant and increased risk of CVD [26]. In patients with acute MI from the Eastern Black Sea region of Turkey MTHFR gene homozygote TT variation has been identified as a risk factor [21]. Previous findings suggest that polymorphisms in folate metabolism might increase susceptibility to congenital heart defects (CHD). TT genotype of MTHFR 677 variant has
shown association with the progress of structural congenital heart malformations. In an investigation on 27 children with CHD and their mothers it has been observed that compound heterozygosity for both C677Tand A1298C polymorphisms was 3.7 times more common in children with CHD compared with the newborn controls[10]. Özkulet. Al studied the possibility of genetic factors involvement for the increased plasma Hcy level in patients with Behcet’s disease(BD).Study of an association between the C677T polymorphism and ocular involvement in such patients showed that in BD patients with ocular involvement the frequencies of MTHFR TT genotype (27.8%) was higher and statistically significant compared to patients without ocular involvement[22]. Previous reports have shown that hyperhomocysteinemia has been associated with the increased risk of diabetic neuropathy in diabetic patients independently [27-29]. More recently studies on Chinese population have found that the plasma homocysteine levels were significantly increased in patients with diabetic neuropathy compared with patients without diabetic neuropathy[30-31]. Interestingly, in contrast to previous studies, in the present study T allele was found a protective allele against having neuropathy in Iranian population which means that the MTHFR gene homozygote TT polymorphism is not a risk factor for having neuropathy among Iranian patients with T2DM. In a study by Raza et al.,it has been found that MTHFR CC genotype might be considered as a potential marker for the early detectionof type 2 diabetes mellitus and population at risk of the disease[5]. In acase-control association study among Egyptian cases it has been reported that MTHFR 677 TT genotype have relation with T2DM susceptibility and complications. Similarly, MTHFR 766 T allele carriage was found to be correlated with diabetes among Polish, Indian, Turkish, and Chinese Han1 populations (diabetic retinopathy (DR), diabetic polyneuropathy (DPN) and ischemic heart disease (IHD)) while it was not in association with the pathogenesis or complications of diabetes among Taiwanese and Polish patients.Also another study has shown the association between MTHFR 677 C(rather than the T) allele with diabetes in Czech women.In addition the MTHFR 677 T allele was not
connected with DPN among Turkish patients with diabetes[32].It has been observed that mutant homozygote and heterozygote of C677T polymorphism of MTHFR act on enzyme activity leading to growth of the plasma homocysteine level which is an important factor in pathogenesis of diabetic nephropathy (DN). The same association has also been identified in Caucasians. Compatible with other populations, in Iranian population, no considerable relationship was found between MTHFR polymorphisms and T2DM. Even though, considerable connection of 677T and 1298C alleles with diabetic nephropathy was found. Likewise relations of MTHFR polymorphisms and two more polymorphisms with other genes such as ACE and eNOS showed an association with expansion of DN[33].In our population we checked the association of having neuropathy with C677T polymorphism which showed that presence of C allelewas a risk for development of neuropathy among patients with T2DM. In order to evaluate the effects of MTHFR gene variation Ukinc et al. aimed to study the effect of hyperhomocysteinemia on the development of diabetic microvascular complications. They did not find any particular association between MTHFR gene variant and hyper-homocysteinemia and retinopathy or neuropathy[34]. Numerous studies have examined the involvement of genetic factors for Diabetic Peripheral Neuropathy (DPN) in T2DM in particular, emphasizing a probable relationship with SNPs in several genes including MTHFR. Strong association has been reported between the MTHFR gene C677T polymorphism and diabetic peripheral neuropathy (DPN) in an investigation by Yigit et al. and in their study history of retinopathy was also associated with the MTHFRC677T variationin patients with DPN[3].By contrast, our study has shown that 677CC and 677CT genotypes make patients with diabetes type 2 prone to have neuropathy more than T2DM patients with 677TT genotype. Given all these data it can be speculated that C677T variant of MTHFR gene might be implicated either as a risk or protective marker in various conditions. These discrepancies may be assumed to be due to the effect of epigenetic mechanisms controlling gene expression which are also influenced by genetic and or environmental factors including lifestyle-risk factors and diet. Another mechanism which explains its various effect of might be the functional inference of the polymorphism in a mixture of conditions.
The association between MTHFR polymorphism and several other conditions has been identified as well. Miyao et al. suggested the MTHFR as one of the genetic risk factors for low BMD[35].Other studies have found association of MTHFR gene with cardiac autonomic neuropathy in patients with T1DM or other cardiac complication which might be due to an inflammatory responses leading to neural injury[9]. A correlation between the incidence of the C677T allele and the improvement of renal failure in male patients with type 2 diabetes mellitus after haemodialysis has been also presented by Noiri et al. [5]. In another study MTHFR variants were significantly associated with macroalbuminuria[33]. In conclusion, our study showed the positive association of MTHFR C677T polymorphism with the presence of neuropathy in Iranian patients with type 2 diabetes mellitus. Further studies in a larger population, including studies of other ethnic groups, are necessary to establish this polymorphism as a genetic marker for neuropathy.
Conflict of interest: None to declare
Funding Body: This work has been funded by Endocrinology and Metabolism Clinical
Science Institute, Tehran University of Medical Sciences, Tehran, Iran
Acknowledgment: This work has been funded by Endocrinology and Metabolism Clinical Science Institute, Tehran University of Medical Sciences, Tehran, Iran
References 1. Miranda-Massari JR, Gonzalez MJ, Jimenez FJ, Allende-Vigo MZ, Duconge J. Metabolic correction in the management of diabetic peripheral neuropathy: improving clinical results beyond symptom control. Curr Clin Pharmacol. 2011;6(4):260-73.
2. Setacci C, De Donato G, Setacci F, Chisci E. Diabetic patients: epidemiology and global impact. J Cardiovasc Surg (Torino). 2009;50(3):263. 3. Yigit S, Karakus N, Inanir A. Association of MTHFR gene C677T mutation with diabetic peripheral neuropathy and diabetic retinopathy. Mol Vis. 2013;19:1626. 4. Antoniades C, Shirodaria C, Leeson P, Baarholm OA, Van-Assche T, Cunnington C, et al. MTHFR 677 C>T Polymorphism reveals functional importance for 5methyltetrahydrofolate, not homocysteine, in regulation of vascular redox state and endothelial function in human atherosclerosis. Circulation. 2009;119(18):2507-15. 5. Raza ST, Abbas S, Ahmed F, Fatima J, Zaidi ZH, Mahdi F. Association of MTHFR and PPARγ2 gene polymorphisms in relation to type 2 diabetes mellitus cases among north Indian population. Gene. 2012;511(2):375-9. 6. Hudson G, Yu-Wai-Man P, Zeviani M, Chinnery PF. Genetic variation in the methylenetetrahydrofolate reductase gene, MTHFR, does not alter the risk of visual failure in Leber’s hereditary optic neuropathy. Mol Vis. 2009;15:870. 7. Aleyasin A, Ghazanfari M, Houshmand M. Leber hereditary optic neuropathy: do folate pathway gene alterations influence the expression of mitochondrial DNA mutation? Iran J Public Health. 2010;39(3):53. 8. Huang T, Ren J, Huang J, Li D. Association of homocysteine with type 2 diabetes: a meta-analysis implementing Mendelian randomization approach. BMC genomics. 2013;14(1):867. 9. Witzel I-I, Jelinek HF, Khalaf K, Lee S, Khandoker AH, Alsafar H. Identifying common genetic risk factors of diabetic neuropathies. Front Endocrinol (Lausanne). 2015;6:88. 10. García-Fragoso L, García-García I, Leavitt G, Renta J, Ayala MA, Cadilla CL. MTHFR polymorphisms in Puerto Rican children with isolated congenital heart disease and their mothers. Int J Genet Mol Biol. 2010;2(3):43. 11. Chaabene-Masmoudi A, Mesrati F, Zittoun J, Landrieu P. Insidious peripheral neuropathy occurring under treatment in infantile MTHFR deficiency. J Inherit Metab Dis. 2009;32(1):303-6. 12. Oguejiofor OC,Odenigbo UC, Oguejiofor CB. Screening For Peripheral Neuropathy In Diabetic Patients: The benefits of the United Kingdom Screening Test – UKST- (a clinical scoring system). Trop J Med Res. 2008; 12 (1):45-9.
13. Tabatabaei-Malazy O, Mohajeri-Tehrani M, Madani S, Heshmat R, Larijani B. The prevalence of diabetic peripheral neuropathy and related factors. Iran J Public Health. 2011;40(3):55. 14. Jeddi-Tehrani M, Torabi R, H. Zarnani A, Mohammadzadeh A, Arefi S, Zeraati H, M. Akhondi M, Chamani-Tabriz L, Idali F, Emami S, Zarei S. Analysis of Plasminogen Activator Inhibitor-1, Integrin Beta3, Beta Fibrinogen, and Methylenetetrahydrofolate Reductase Polymorphisms in Iranian Women with Recurrent Pregnancy Loss. Am J Reprod Immunol. 2011;66(2):149-56. 15.Dinh T, Veves A.The influence of gender as a risk factor in diabetic foot ulceration.Wounds. 2008;20(5):127-31. 16.Booya F, Bandarian F, Larijani B, Pajouhi M, Nooraei M, Lotfi J. Potential risk factors for diabetic neuropathy: a case control study.BMC Neurol. 2005;10;5:24. 17.Aaberg ML, Burch DM, Hud ZR, Zacharias MP.Gender differences in the onset of diabetic neuropathy.J Diabetes Complications.2008;22(2):83-7. 18. Mehri S, Koubaa N, Nakbi A, Hammami S, Chaaba R, Mahjoub S, et al. Relationship between genetic polymorphisms of angiotensin-converting enzyme and methylenetetrahydrofolate reductase as risk factors for type 2 diabetes in Tunisian patients. Clin Biochem. 2010;43(3):259-66. 19.Errera FI, Silva ME, Yeh E, Maranduba CM, Folco B, Takahashi W, et al. Effect of polymorphisms of the MTHFR and APOE genes on susceptibility to diabetes and severity of diabetic retinopathy in Brazilian patients. Braz J Med Biol Res. 2006;39(7):883-8. 20.Klerk M, Verhoef P, Clarke R, Blom HJ, Kok FJ, Schouten EG. MTHFR 677C→ T polymorphism and risk of coronary heart disease: a meta-analysis. Jama. 2002;288(16):2023-31. 21.Uçar F, Çelik Ş, Yücel B, Sönmez M, Celep F, Erkut N. MTHFR C677T polymorphism and its relationship to myocardial infarction in the Eastern Black Sea region of Turkey. Arch Med Res. 2011;42(8):709-12. 22.Özkul Y, Evereklioglu C, Borlu M, Taheri S, Calis M, Dündar M, et al. 5, 10Methylenetetrahydrofolate reductase C677T gene polymorphism in Behçet’s patients with or without ocular involvement. Br J Ophthalmol.2005;89(12):1634-7.
23. Jeddi-Tehrani M, Torabi R, Zarnani AH, Mohammadzadeh A, Arefi S, Zeraati H, et al. Analysis of plasminogen activator inhibitor-1, integrin beta3, beta fibrinogen, and methylenetetrahydrofolate reductase polymorphisms in Iranian women with recurrent pregnancy loss. Am J Reprod Immunol. 2011;66(2):149-56. 24. Hosseini M, Houshmand M, Ebrahimi A. MTHFR polymorphisms and breast cancer risk. Arch Med Sci. 2011;7(1):134-7. 25.Naghibalhossaini F, Mokarram P, Khalili I, Vasei M, Hosseini SV, Ashktorab H, et al. MTHFR C677T and A1298C variant genotypes and the risk of microsatellite instability among Iranian colorectal cancer patients. Cancer Genet Cytogenet. 2010;197(2):142-51. 26.van Winkel R, Rutten BP, Peerbooms O, Peuskens J, van Os J, De Hert M. MTHFR and risk of metabolic syndrome in patients with schizophrenia. Schizophr Res. 2010;121(1):193-8. 27.Molina M, Gonzalez R, Folgado J, Real JT, Martinez-Hervas S, Priego A, et al. [Correlation between plasma concentrations of homocysteine and diabetic polyneuropathy evaluated with the Semmes-Weinstein monofilament test in patients with type 2 diabetes mellitus]. Med Clin (Barc). 2013;141(9):382-6. 28.Ambrosch A, Dierkes J, Lobmann R, Kuhne W, Konig W, Luley C, et al. Relation between homocysteinaemia and diabetic neuropathy in patients with Type 2 diabetes mellitus. Diabet Med. 2001;18(3):185-92. 29.Gonzalez R, Pedro T, Martinez-Hervas S, Civera M, Priego MA, Catala M, et al. Plasma homocysteine levels are independently associated with the severity of peripheral polyneuropathy in type 2 diabetic subjects. J Peripher Nerv Syst. 2012;17(2):191-6. 30.Li JB, Cheng YZ, Shi M, Zhang HM, Dai Q, Zhang Y, et al. [The relationship between plasma homocysteine levels and diabetic peripheral neuropathy]. Zhonghua Nei Ke Za Zhi. 2011;50(1):14-7. 31. Jianbo L, Yuche C, Ming S, Jingrong T, Qing D, Yu Z, et al. Association of homocysteine with peripheral neuropathy in Chinese patients with type 2 diabetes. Diabetes Res Clin Pract. 2011;93(1):38-42. 32.Settin A, El-Baz R, Ismaeel A, Tolba W, Allah WA. Association of ACE and MTHFR genetic polymorphisms with type 2 diabetes mellitus: Susceptibility and complications. J Renin Angiotensin Aldosterone Syst. 2015;16(4):838-43
33. Khodaeian M, Enayati S, Tabatabaei-Malazy O, Amoli MM. Association between Genetic Variants and Diabetes Mellitus in Iranian Populations: A Systematic Review of Observational Studies.J Diabetes Res. 2015;2015:21. 34.Ukinc K, Ersoz HO, Karahan C, Erem C, Eminagaoglu S, Hacihasanoglu AB, et al. Methyltetrahydrofolate reductase C677T gene mutation and hyperhomocysteinemia as a novel risk factor for diabetic nephropathy. Endocrine. 2009;36(2):255-61. 35. Miyao M, Morita H, Hosoi T, Kurihara H, Inoue S, Hoshino S, et al. Association of methylenetetrahydrofolate reductase (MTHFR) polymorphism with bone mineral density in postmenopausal Japanese women. Calcif Tissue Int. 2000;66(3):190-4.
Table 1. Demographic data of the diabetic group with neuropathy and without N (%)
Without neuropathy With neuropathy p value
Gender Male (n) (%)
35 (32.7)
82 (58.2)
p<0.001
Female (n) (%)
72 (67.3)
59 (41.8)
Yes
82.7
90.4
no
17.3
9.6
HbA1C (%)
7.5±1.2
7.8±1.1
p=0.02
Duration of diabetes (year) 12.2±5.8
15.2±6.7
p= 0.005
Age (year)
56.3±6.9
56.6±7.1
p=0.9
BMI (kg/m2)
28.4±4.6
28.8±4.3
p=0.7
Diabetes family history
p=0.2
Table2. Prevalence of the MTHFR C677T gene polymorphism in patients with neuropathy and without MTHFR
Patients with neuropathy
Patients without neuropathy
(C677T)
N (%)
N (%)
CC
73 (51.8)
53(49.5)
CT
62(44)
42(39.3)
TT
6(4.3)
12(11.2)
C
208(73.75)
148(69.15)
T
74(26.24)
66(30.84)
p value
genotype 0.03*
Allele 0.2
CC+CT vs. TT: OR=2.84, 95%CI:1.03-7.83.
Table 3. Prevalence of the MTHFR 1298A ⁄ C polymorphism in patients with neuropathy and without MTHFR
Patients with neuropathy
Patients without neuropathy
(1298A ⁄ C)
N (%)
N (%)
HW
68 (57.6)
67(63.2)
H
47(39.8)
39(36.8)
HM
3(2.5)
0(0.00)
p value
genotype
Homozygous wild type= HW; heterozygous=H; Homozygousmutatnt type= HM H+HM vs. HW
0.72*