Association between polymorphism in the insulin receptor-related receptor gene and growth traits in the Pacific oyster Crassostrea gigas

Biochemical Systematics and Ecology 54 (2014) 144–149

Contents lists available at ScienceDirect

Biochemical Systematics and Ecology journal homepage: www.elsevier.com/locate/biochemsyseco

Association between polymorphism in the insulin receptorrelated receptor gene and growth traits in the Pacific oyster Crassostrea gigas Rihao Cong, Lingfeng Kong, Hong Yu, Qi Li* Key Laboratory of Mariculture, Ministry of Education, Ocean University of China, Qingdao 266003, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 21 October 2013 Accepted 1 February 2014 Available online

Insulin receptor-related receptor (IRR) is an orphan receptor tyrosine kinase of the insulin receptor family, and involved in the growth and reproduction processes of the Pacific oyster Crassostrea gigas. Polymorphisms of the IRR gene were evaluated for associations with growth performance of 336 individuals in five families, and further confirmed in 206 individuals from three selectively bred strains for fast growth. Two of the six identified synonymous mutations (C.1996G > A and C.2110C > T) were significantly associated with growth performance in the families and strains. Five diplotypes were constructed based on the two growth-related SNPs, and diplotypes analysis revealed that D3 (GGTT) might be the most advantageous diplotype for growth traits. The results suggest that two SNPs (C.1996G > A and C.2110C > T) in IRR gene are potentially associated with growth performance of C. gigas, and could serve as genetic markers for fast growth in oyster breeding. Ó 2014 Elsevier Ltd. All rights reserved.

Keywords: Crassostrea gigas Insulin receptor-related receptor Growth trait SNP

1. Introduction The Pacific oyster Crassostrea gigas, which was naturally distributed along coasts of Japan, Korea, and China, has been introduced into many countries (Li and Guo, 2004) because of its fast growth rate, high disease resistance and ability to acclimatize. Reported heritability values and additive genetic effects indicate that artificial selection has high potential for growth improvement of C. gigas (Langdon et al., 2003; Evans and Langdon, 2006), and genetic breeding programs with the initial objectives of breeding faster-growing oysters have recently been launched in several countries (Ward et al., 2000; Nell, 2001). Therefore, identification of genes with putative functions in growth regulation or genetic markers associated with growth performance could accelerate these breeding programs. Several genes possibly responsible for growth traits were revealed in fishes (Tao and Boulding, 2003; Xu et al., 2006; Yu et al., 2010) and crustaceans (Glenn et al., 2005; Prasertlux et al., 2010; Thanh et al., 2010). Due to the inadequacy knowledge about biological pathways and genes involved in growth regulation of bivalves, only a few genes have been detected to be significantly associated with growth performance. For example, the polymorphism of the amylase gene (Prudence et al., 2006; Huvet et al., 2008) was associated with the growth rate of C. gigas and the myostatin gene (Wang et al., 2010) and the transforming growth factor beta type I receptor gene (Orban et al., 2012) polymorphism correlated with growth traits of Chlamys farreri. In C. gigas, the insulin-like family is involved in the regulation of growth, reproduction and carbohydrate

* Corresponding author. Tel.: þ86 532 82031622; fax: þ86 532 82032773. E-mail address: [email protected] (Q. Li). http://dx.doi.org/10.1016/j.bse.2014.02.003 0305-1978/Ó 2014 Elsevier Ltd. All rights reserved.

R. Cong et al. / Biochemical Systematics and Ecology 54 (2014) 144–149

145

metabolism, and several members of the family, such as insulin-related peptide (oIRP) (Hamano et al., 2005), insulin receptorrelated receptor (IRR) (Gricourt et al., 2003), and three potential elements of the oyster insulin pathway (Ras, Pten and p70S6K) (Jouaux et al., 2012) have been identified recently. Six SNPs identified in the oIRP gene were found to be significantly associated with growth performance in C. gigas (Cong et al., 2013). IRR is an orphan receptor tyrosine kinase of the insulin receptor family, and has been shown to engage in heterodimer formation with insulin or insulin-like growth factor-1 receptors (IGF-IR) (Kitamura et al., 2001). It has functional roles in reproduction (Nef et al., 2003; Dissen et al., 2006) and is required for neurogenesis (Reinhardt et al., 1993) and b-cell growth (Kitamura et al., 2001) throughout embryonic development in mammals. In C. gigas, IRR highly expressed in the gonadal area during gonial mitosis phase, but also in maturating oocytes, suggesting its involvement in gonial proliferation and maturation (Gricourt et al., 2006). IRR was also detected in mantle edges, indicating its involvement in shell synthesis and soft tissue growth in C. gigas (Gricourt et al., 2003). All these observations implied the possible role of the IRR gene in the regulation of reproduction and growth, and raised the obvious expectation about identification of SNPs in IRR associated with growth performance of C. gigas. A selective breeding program aimed for fast-growing C. gigas strains was initiated in 2006 in China (Li et al., 2011). The objective of this work was to search for polymorphisms within the IRR gene and to perform an association study with different families and strains in the C. gigas breeding program. 2. Materials and methods 2.1. Animals and traits Seeds from wild populations of the hatchery oysters were collected in June 2008 from Rushan Bay, Shandong province, and were cultured with lantern nets suspended from rafts along the coastal region. In June 2009, 80 of them were adopted as parents and 54 full-sib families were established according to a nested mating design with each male oyster mated to three females. In July 2009 three strains were developed with geographically isolated populations in Rushan, Shandong province, China (Strain C), Onagawa Bay in Miyagi Prefecture, Japan (Strain J), and Pusan, South Korea (Strain K), representing the third generation of selection for fast growth (Wang, 2011). All three successive generations were constructed following procedure described by Li et al. (2011). The rearing of larvae, spat and adults were carried out with standard practice (Li et al., 2011). Embryos were put into 100-L tanks with the initial stocking density of about 10 larvae mL1 and was decreased to one larva mL1 with larval growth. To maintain the genetic variability, no culling of small individuals was employed. Water temperature was maintained at 23– 24  C. Larvae were fed daily with a mixture of Isochrysis galbana and Platymonas helgolandica at concentrations of 30,000– 80,000 cells mL1. Spats attached to the collectors were inserted into nylon ropes and cultured on suspended longlines with the density of about 15–20 individuals per collector. For SNP discovery and preliminary association analysis, a total of 336 two-year-old offspring from five full-sib C. gigas families were randomly collected in Shuangdao Bay, Shandong province. To further confirm the associations, 206 individuals were randomly sampled from the three strains in Weihai Bay, Shandong province. Their shell height, shell length, shell width were measured using an electronic Vernier caliper (0.01 mm accuracy), while their body mass and soft-tissue mass were weighed using an electronic balance (0.1 g accuracy). 2.2. DNA extraction, primer design and PCR amplification Genomic DNA was obtained from adductor muscles using the phenol-chloroform method. PCR primers (Table 1) were designed according to the IRR gene (GenBank accession no. AJ535669) (Gricourt et al., 2003). PCR amplification was performed in 10-ml volumes containing 100 ng template DNA, 1  PCR buffer, 1.5 mM MgCl2, 0.2 mM dNTP, 1 mM of each primer, and 0.25 U Taq DNA polymerase. The condition for PCR was as follows: 5 min at 94  C; 35 cycles of 45 s at 94  C, 45 s at 50– 53  C, 45 s at 72  C; and a final 5 min extension at 72  C. Each amplification production was verified by electrophoresis on a 1.5% agarose gel. Gels were stained with ethidium bromide.

Table 1 Primer sets used for analysis of SNPs in the IRR gene in Crassostrea gigas. Name

Primer sequence (50 to 30 )

Location

Length (bp)

Annealing temp. ( C)

CIR2.1

CCAAAACAAAGACCAACCT TTTGAGCGTAACTGCTACTG AGCTCCCAGACCAAGATA TGTGGACGAGAATACAACA CCGAGCTGAGGATTGATA CACTGTAGGGATTGGAACA CCATCGTTCGCTAACAAGT TAATCCTCCCCGAGGTCTA

1796–2351

556

53

2019–2172

154

50

2124–2296

165

51

1853–2017

215

51

C2 C4 C19

146

R. Cong et al. / Biochemical Systematics and Ecology 54 (2014) 144–149

2.3. SNP confirmation and single-strand conformation polymorphism analysis Individuals were genotyped using the single-strand conformation polymorphism (SSCP) technique and confirmed by random sequencing. First, 5 mL of each PCR product was added to 10 ml denaturing buffer (98% formamide, 0.09% xylene cyanole FF, and 0.09% bromophenol blue). Then the samples were denatured at 94  C for 5 min and placed on ice for 10 min. Electrophoresis of the denatured DNA was conducted in 8–12% nondenaturing polyacrylamide gel; 120 V for 12–14 h; 4  C. SSCP patterns on the gels were visualized by silver staining (Ou et al., 2005). To confirm the genotypes, at least three individual PCR products with the same SSCP pattern were sequenced for both directions using an ABI 3730 sequencer (Applied Biosystems). 2.4. Statistical analysis The allelic frequencies, heterozygosity and polymorphism information content (PIC) were calculated using PowerMarker v3.25 software (http://statgen.ncsu.edu/powermarker/). The linkage disequilibrium (LD) was performed by SHEsis software (Shi and He, 2005). SNP-trait association analysis was performed using the General Linear Model procedure of SAS, release 8.2 (SAS Institute Inc.). The genetic effects were analyzed using the model as follows: yij ¼ m þ Gi or Di þ eij Where yij is the observed value of jth individual of genotype or diplotype i, m is the mean of observed values, Gi or Di is the fixed effects of the genotype or diplotype i, and eij is the random residual effect corresponding to the observed values. The global effect of genotypes or diplotypes was further assessed through multiple comparisons using a Bonferroni correction. 3. Results 3.1. SNP identification and allele frequencies Six synonymous mutations (C.1996G > A, C.2044C > T, C.2110C > T, C.2185G > A, C.2239C > T and C.2257G > A), located in the coding sequence of the IRR gene, were detected in a comparison of the 485 bp cDNA sequences from the five families, and two of them (C.1996G > A and C.2110C > T) were associated with growth performance (Table 2). Allelic frequencies of the three strains at the two loci are shown in Table 3, and they were in linkage equilibrium. At the C.1996G > A locus all the three strains were in Hardy–Weinberg equilibrium, while at the C.2110C > T locus only the strain K was in Hardy–Weinberg equilibrium. 3.2. Association between SNPs of CIR gene and growth traits Preliminary association analysis was first tested in the five families, and two SNPs (C.1996G > A and C.2110C > T) were significantly associated with all the five growth traits (P < 0.01) (Table 2). At the C.1996G > A locus the GG oysters had higher values in shell height (P < 0.01), shell length (P < 0.01), body mass (P < 0.05) and soft-tissue mass (P < 0.01) than those with the genotype AA. Similarly, individuals of genotype TT at the C.2110C > T locus had significantly higher values in all the five growth traits (shell height (P < 0.05), shell length (P < 0.01), shell width (P < 0.05), body mass (P < 0.01) and soft-tissue mass (P < 0.01)) than those of genotype CC. Table 2 Effect of two SNPs in the IRR gene on growth performance in five families and three strains of C. gigas. SNP

Genotype

N

Preliminary associations analyzed in five C.1996G > A GG 206 GA 87 AA 25 P-value C.2110C > T CC 279 CT 24 TT 18 P-value Associations tested in three strains C.1996G > A GG 165 GA 32 P-value C.2110C > T CC 147 CT 31 TT 20 P-value

Shell height (mm) families 72.50  70.84  66.36  0.01** 70.91  74.36  77.94  0.009** 57.20  50.76  0.002** 54.76  56.46  62.54  0.02*

10.53a 10.22ab 9.76b 10.09a 12.14a 12.79b

9.50a 15.79b 10.19a 16.73ab 11.78b

Shell length (mm)

Shell width (mm)

Body mass (g)

Soft-tissue mass (g)

46.33  8.09a 43.15  5.94b 41.69  4.76b 0.0003** 44.54  7.42a 46.78  6.97a 51.16  6.98b 0.0006**

24.53  4.72a 22.61  3.84b 22.99  3.82a,b 0.002** 23.43  4.31a 27.22  5.43b 26.37  4.25b 0.0001**

39.00  15.51a 30.84  10.32b 32.46  9.82b 0.0001** 35.30  13.09a 44.26  19.38b 51.89  20.71b 0.0001**

5.42  2.21a 4.06  1.45b 4.20  1.46b 0.0001** 4.78  1.93a 5.84  2.40b 6.53  2.86b 0.0002**

34.72  8.25a 31.63  8.54a 0.056 32.54  7.56a 36.62  10.95b 41.96  8.09b 0.0001**

20.15  17.95  0.036* 18.98  20.30  23.87  0.001**

20.81  11.43a 16.76  12.73a 0.074 17.41  8.86a 25.00  16.65b 34.85  19.71c 0.0001**

2.21  1.15a 1.70  1.20b 0.026* 1.83  0.90a 2.56  1.41b 3.29  1.69b 0.0001**

5.17a 6.08b 5.15a 5.39ab 6.78b

Values with different superscripts within the same column differ significantly at P < 0.05. *P < 0.05; **P < 0.01.

R. Cong et al. / Biochemical Systematics and Ecology 54 (2014) 144–149

147

Table 3 Allelic frequencies of two SNP loci and linkage disequilibrium of C.1996G > A and C.2110C > T loci in three C. gigas strains. Locus C.1996G > A

Allele

C.2110C > T

Heterozygosity PIC Equilibrium c2 test Allele

A G

C T

Heterozygosity PIC Equilibrium c2 test

LD of the two loci r2

Strain C

Strain J

Strain K

0.1 0.9 0.19 0.16 P ¼ 1.00 0.68 0.32 0.25 0.34 P ¼ 0.002 0.01

0.14 0.86 0.28 0.21 P ¼ 0.35 0.74 0.26 0.22 0.31 P < 0.001 0.002

0.05 0.95 0.1 0.09 P ¼ 0.14 0.99 0.01 0.03 0.03 P ¼ 1.00 0.06

The associations between the two SNPs and growth traits were tested in 206 individuals from the strains C, J and K, and similar trend existed in the sampled strains. Though at the C.1996G > A locus the genotype AA was not detected in the three strains, significant difference was confirmed between individuals with genotype GG and GA in shell height (P < 0.01), shell width (P < 0.05) and soft-tissue mass (P < 0.05). At the C.2110C > T locus, oysters with the genotype TT also grew faster than those with the genotype CC in shell height (P < 0.05), shell length (P < 0.01), shell width (P < 0.01), body mass (P < 0.01) and soft-tissue mass (P < 0.01). 3.3. Construction of diplotypes and their correlation with growth traits Five diplotypes with frequencies of above 1% were constructed based on the two growth-related SNPs (C.1996G > A and C.2110C > T) (Table 4). Association analysis indicated that these diplotypes were significantly associated with shell height (P < 0.05), shell length (P < 0.01), shell width (P < 0.01), body mass (P < 0.01) and soft-tissue mass (P < 0.01). Individuals of diplotype D3 (GGTT) had the highest values in all the five growth traits and had significantly higher values in shell length, body mass and soft-tissue mass than individuals with other diplotypes. 4. Discussion Genetic variation is the key to long-term improvement of cultured strains, so the preservation and effective use of genetic resources are critical for sustainable development of aquaculture (Guo, 2009). It is well known that oysters are typically highly heterozygous. In this study, six SNPs were revealed in 485 bp of the coding region of the IRR gene, which is consistent with the report that the average SNP density in C. gigas was to be 1.7% in coding regions (Sauvage et al., 2007). Recently, the complete genome sequence of C. gigas revealed a polymorphism rate of 2.3% (Zhang et al., 2012). In the eastern oyster, Zhang and Guo (2010) also confirmed a remarkable high level of polymorphism (one SNP per 20 bp). Generally, PIC is classified into the following three types: low polymorphism (PIC value < 0.25), intermediate polymorphism (0.25 < PIC value < 0.5) and high polymorphism (PIC value > 0.5) (Ma et al., 2011). According to this PIC classification, all the three strains had low genetic diversity at the C.1996G > A locus. At the C.2110C > T locus, the strains J and K showed low genetic diversity, while the strain C the moderate genetic diversity. And at the C.1996G > A locus, the genotype AA was not detected in the three strains. This may be a result of the loss of genetic diversity during three generations of selection for fast growth. IRR has been identified in a few molluscs, such as Lymnaea stagnalis (Roovers et al., 1995), Biomphalaria glabrata (Lardans et al., 2001), C. gigas (Gricourt et al., 2003) and Pinctada fucata (Shi et al., 2013), and the transcriptional level of the insulin signaling pathway may be affected by the nutrient level (Puig and Tjian, 2005; Arsic and Guerin, 2008). The expression of IRR in the digestive gland of C. gigas may be related to the paracrine function of oIRP produced during digestion, and the increased expression level of IRR in fasting C. gigas may result from the feedback loop which can prime cells to respond rapidly to changing nutritional conditions, allowing a faster response of the tissues to insulin changes (Jouaux et al., 2012). The IRR gene is located within the 1q21–q23 region linked with type-2 diabetes mellitus in human, but none of the detected SNPs

Table 4 Associations between diplotypes of IRR gene and growth traits (means  SD) in C. gigas. Diplotypes

1996

2110

Number

Shell height (mm)

D1 D2 D3 D4 D5

GG GG GG GA GA

CC CT TT CC CT

118 19 18 23 10

54.87 55.43 63.55 53.23 57.77

    

10.07a,b 16.16a,b 11.97b 10.97a 14.22a,b

Shell length (mm) 32.60 36.60 42.50 31.25 36.68

    

7.12a 8.67b 18.35c 9.57a 11.33b

Values with different superscripts within the same column differ significantly at P < 0.05.

Shell width (mm) 18.94 20.38 24.31 18.61 20.47

    

5.09a 5.81a,b 6.86b 5.34a 4.61a,b

Body mass (g) 16.90 20.80 36.15 17.54 26.35

    

8.58a 12.29a,b 20.28c 9.38a 17.34b

Soft-tissue mass (g) 1.79 2.45 3.38 1.86 2.68

    

0.88a 1.19a,b 1.76c 1.05a 1.45b

148

R. Cong et al. / Biochemical Systematics and Ecology 54 (2014) 144–149

contributed to diabetes in the Pima Indians (Wolford et al., 2001). In the study, although the two growth-related SNPs (C.1996G > A and C.2110C > T) were synonymous mutations, they may affect transcriptional efficiency and function as a positive regulator by increasing the expression level. Also these candidate loci may simply be positioned in close physical linkage to the causal mutation that influences phenotypes (Beuzen et al., 2000). A single SNP often provides limited information, and diplotypes constructed by united SNPs would supply more information and make up for the short-coming of single SNP (Daly et al., 2001). In this study, five diplotypes were constructed on the basis of the two growth-related SNPs, and the results showed that D3 (GGTT) was the most advantageous diplotype for growth traits of C. gigas. In conclusion, the major outcome of the current study was recognition of the correlation between polymorphisms in the IRR gene and individual growth performance of C. gigas. Two of the six SNPs identified in the IRR gene were significantly associated with growth performance. The diplotype D3 (GGTT) was the most advantageous diplotype for growth traits in the study. These results suggest that the SNPs of IRR gene could affect growth performance in C. gigas, and provided candidate markers for the selective breeding of C. gigas aimed at improvement of the high performing culture lines. Acknowledgments This study was supported by the grants from National High Technology Research and Development Program (2012AA10A405-6), 973 Program (2010CB126406), and National Natural Science Foundation of China (31372524). References Arsic, D., Guerin, P.M., 2008. Nutrient content of diet affects the signaling activity of the insulin/target of rapamycin/p70 S6 kinase pathway in the African malaria mosquito Anopheles gambiae. J. Insect Physiol. 54, 1226–1235. Beuzen, N., Stear, M., Chang, K., 2000. Molecular markers and their use in animal breeding. Vet. J. 160, 42–52. Cong, R.H., Li, Q., Kong, L.F., 2013. Polymorphism in the insulin-related peptide gene and its association with growth traits in the Pacific oyster Crassostrea gigas. Biochem. Syst. Ecol. 46, 36–43. Daly, M.J., Rioux, J.D., Schaffner, S.F., Hudson, T.J., Lander, E.S., 2001. High-resolution haplotype structure in the human genome. Nat. Genet. 29, 229–232. Dissen, G.A., Garcia-Rudaz, C., Tapia, V., Parada, L.F., Hsu, S.-Y.T., Ojeda, S.R., 2006. Expression of the insulin receptor-related receptor is induced by the preovulatory surge of luteinizing hormone in thecal-interstitial cells of the rat ovary. Endocrinology 147, 155–165. Evans, S., Langdon, C., 2006. Direct and indirect responses to selection on individual body weight in the Pacific oyster (Crassostrea gigas). Aquaculture 261, 546–555. Glenn, K.L., Grapes, L., Suwanasopee, T., Harris, D.L., Li, Y., Wilson, K., Rothschild, M.F., 2005. SNP analysis of AMY2 and CTSL genes in Litopenaeus vannamei and Penaeus monodon shrimp. Anim. Genet. 36, 235–236. Gricourt, L., Bonnec, G., Boujard, D., Mathieu, M., Kellner, K., 2003. Insulin-like system and growth regulation in the Pacific oyster Crassostrea gigas: hrIGF-1 effect on protein synthesis of mantle edge cells and expression of an homologous insulin receptor-related receptor. Gen. Comp. Endocr. 134, 44–56. Gricourt, L., Mathieu, M., Kellner, K., 2006. An insulin-like system involved in the control of Pacific oyster Crassostrea gigas reproduction: hrIGF-1 effect on germinal cell proliferation and maturation associated with expression of an homologous insulin receptor-related receptor. Aquaculture 251, 85–98. Guo, X.M., 2009. Use and exchange of genetic resources in molluscan aquaculture. Rev. Aquac. 1, 251–259. Hamano, K., Awaji, M., Usuki, H., 2005. cDNA structure of an insulin-related peptide in the Pacific oyster and seasonal changes in the gene expression. J. Endocrinol. 187, 55–67. Huvet, A., Jeffroy, F., Fabioux, C., Daniel, J.Y., Quillien, V., Van Wormhoudt, A., Moal, J., Samain, J.F., Boudry, P., Pouvreau, S., 2008. Association among growth, food consumption-related traits and amylase gene polymorphism in the Pacific oyster Crassostrea gigas. Anim. Genet. 39, 662–665. Jouaux, A., Franco, A., Heude-Berthelin, C., Sourdaine, P., Blin, J., Mathieu, M., Kellner, K., 2012. Identification of Ras, Pten and p70S6K homologs in the Pacific oyster Crassostrea gigas and diet control of insulin pathway. Gen. Comp. Endocr. 176, 28–38. Kitamura, T., Kido, Y., Nef, S., Merenmies, J., Parada, L.F., Accili, D., 2001. Preserved pancreatic-cell development and function in mice lacking the insulin receptor-related receptor. Mol. Cell. Biol. 21, 5624–5630. Langdon, C., Evans, F., Jacobson, D., Blouin, M., 2003. Yields of cultured Pacific oysters Crassostrea gigas Thunberg improved after one generation of selection. Aquaculture 220, 227–244. Lardans, V., Coppin, J.F., Vicogne, J., Aroca, E., Delcroix, M., Dissous, C., 2001. Characterization of an insulin receptor-related receptor in Biomphalaria glabrata embryonic cells. BBA-Biomembranes 1510, 321–329. Li, L., Guo, X., 2004. AFLP-based genetic linkage maps of the Pacific oyster Crassostrea gigas Thunberg. Mar. Biotechnol. 6, 26–36. Li, Q., Wang, Q.Z., Liu, S.K., Kong, L.F., 2011. Selection response and realized heritability for growth in three stocks of the Pacific oyster Crassostrea gigas. Fish. Sci. 77, 643–648. Ma, L., Qu, Y., Huai, Y., Li, Z., Wang, J., Lan, X., Zhang, C., Wang, J., Chen, H., 2011. Polymorphisms identification and associations of KLF7 gene with cattle growth traits. Livest. Sci. 135, 1–7. Nef, S., Verma-Kurvari, S., Merenmies, J., Vassalli, J.-D., Efstratiadis, A., Accili, D., Parada, L.F., 2003. Testis determination requires insulin receptor family function in mice. Nature 426, 291–295. Nell, J.A., 2001. The history of oyster farming in Australia. Mar. Fish. Rev. 63, 14–25. Orban, L., Guo, H., Bao, Z., Li, J., Lian, S., Wang, S., He, Y., Fu, X., Zhang, L., Hu, X., 2012. Molecular characterization of TGF-b Type I receptor gene (Tgfbr1) in Chlamys farreri, and the association of allelic variants with growth traits. PLoS ONE 7, e51005. Ou, L.J., Li, X.Y., Wu, G.Q., Yang, N., 2005. Efficient and sensitive method of DNA silver staining in polyacrylamide gels. Electrophoresis 26, 99–101. Prasertlux, S., Khamnamtong, B., Chumtong, P., Klinbunga, S., Menasveta, P., 2010. Expression levels of RuvBL2 during ovarian development and association between its single nucleotide polymorphism (SNP) and growth of the giant tiger shrimp Penaeus monodon. Aquaculture 308, 83–90. Prudence, M., Moal, J., Boudry, P., Daniel, J.Y., Quere, C., Jeffroy, F., Mingant, C., Ropert, M., Bedier, E., Van Wormhoudt, A., Samain, J.F., Huvet, A., 2006. An amylase gene polymorphism is associated with growth differences in the Pacific cupped oyster Crassostrea gigas. Anim. Genet. 37, 348–351. Puig, O., Tjian, R., 2005. Transcriptional feedback control of insulin receptor by dFOXO/FOXO1. Gen. Dev. 19, 2435–2446. Reinhardt, R., Chin, E., Zhang, B., Roth, R., Bondy, C., 1993. Insulin receptor-related receptor messenger ribonucleic acid is focally expressed in sympathetic and sensory neurons and renal distal tubule cells. Endocrinology 133, 3–10. Roovers, E., Vincent, M.E., van Kesteren, E., Geraerts, W.P., Planta, R.J., Vreugdenhil, E., van Heerikhuizen, H., 1995. Characterization of a putative molluscan insulin-related peptide receptor. Gene 162, 181–188. Sauvage, C., Bierne, N., Lapegue, S., Boudry, P., 2007. Single nucleotide polymorphisms and their relationship to codon usage bias in the Pacific oyster Crassostrea gigas. Gene 406, 13–22.

R. Cong et al. / Biochemical Systematics and Ecology 54 (2014) 144–149

149

Shi, Y., Guan, Y., He, M., 2013. Molecular identification of insulin-related peptide receptor and its potential role in regulating development in Pinctada fucata. Aquaculture 408, 118–127. Shi, Y., He, L., 2005. SHEsis, a powerful software platform for analyses of linkage disequilibrium, haplotype construction, and genetic association at polymorphism loci. Cell. Res. 15, 97–98. Tao, W.J., Boulding, E.G., 2003. Associations between single nucleotide polymorphisms in candidate genes and growth rate in Arctic charr (Salvelinus alpinus L.). Heredity 91, 60–69. Thanh, N.M., Barnes, A.C., Mather, P.B., Li, Y., Lyons, R.E., 2010. Single nucleotide polymorphisms in the actin and crustacean hyperglycemic hormone genes and their correlation with individual growth performance in giant freshwater prawn Macrobrachium rosenbergii. Aquaculture 301, 7–15. Wang, Q.Z., 2011. Studies on Selective Breeding and Genetic Parameters Estimation for the Pacific Oyster, Crassostrea gigas. Doctoral dissertation. Ocean university of China, China, pp. 48–54. Wang, X.L., Meng, X.Y., Song, B., Qiu, X.M., Liu, H.Y., 2010. SNPs in the myostatin gene of the mollusk Chlamys farreri: association with growth traits. Comp. Biochem. Phys. B 155, 327–330. Ward, R.D., English, L.J., McGoldrick, D.J., Maguire, G.B., Nell, J.A., Thompson, P.A., 2000. Genetic improvement of the Pacific oyster Crassostrea gigas (Thunberg) in Australia. Aquac. Res. 31, 35–44. Wolford, J.K., Thameem, F., Bogardus, C., Prochazka, M., 2001. Polymorphism screening of the insulin receptor-related receptor gene (INSRR) on 1q in Pima Indians. Mol. Cell. Probe 15, 223–227. Xu, Y.X., Zhu, Z.Y., Lo, L.C., Wang, C.M., Lin, G., Feng, F., Yue, G.H., 2006. Characterization of two parvalbumin genes and their association with growth traits in Asian seabass (Lates calcarifer). Anim. Genet. 37, 266–268. Yu, J.H., Chen, X.F., Li, J.L., Tang, Y.K., Li, H.X., Xu, P., Dong, Z.J., 2010. Isolation of IGF2 and association of IGF2 polymorphism with growth trait in genetically improved farmed tilapias, Oreochromis niloticus L. Aquac. Res. 41, 743–750. Zhang, G., Fang, X., Guo, X., Li, L., Luo, R., Xu, F., Yang, P., Zhang, L., Wang, X., Qi, H., 2012. The oyster genome reveals stress adaptation and complexity of shell formation. Nature 490, 49–54. Zhang, L.S., Guo, X.M., 2010. Development and validation of single nucleotide polymorphism markers in the eastern oyster Crassostrea virginica Gmelin by mining ESTs and resequencing. Aquaculture 302, 124–129.