- Email: [email protected]
Association between the G1001C polymorphism in the GRIN1 gene promoter region and schizophrenia
BRIEF REPORTS Association between the G1001C Polymorphism in the GRIN1 Gene Promoter Region and Schizophrenia Silvia Begni, Stefania Moraschi, Stefano Bignotti, Fabio Fumagalli, Luciana Rillosi, Jorge Perez, and Massimo Gennarelli Background: The GRIN1 gene plays a fundamental role in many brain functions, and its involvement in the pathogenesis of the schizophrenia has been widely investigated. Non-synonymous polymorphisms have not been identified in the coding regions. To investigate the potential role of GRIN1 in the susceptibility to schizophrenia, we analyzed the G1001C polymorphism located in the promoter region in a case-control association study. Methods: The G1001C polymorphism allele distribution was analyzed in a sample of 139 Italian schizophrenic patients and 145 healthy control subjects by a polymerase chain reaction amplification followed by digestion with a restriction endonuclease. Results: We found that the C allele may alter a consensus sequence for the transcription factor NF-B and that its frequency was higher in patients than in control subjects (p ⫽ .0085). The genotype distribution also was different, with p ⫽ .034 (if C allele dominant, p ⫽ .0137, odds ratio 2.037, 95% confidence interval 1.1502-3.6076). Conclusions: The association reported in this study suggests that the GRIN1 gene is a good candidate for the susceptibility to schizophrenia. Biol Psychiatry 2003;53: 617– 619 © 2003 Society of Biological Psychiatry Key Words: Schizophrenia, ionotropic glutamate receptor, GRIN1, functional polymorphism, promoter region, association
Introduction
S
chizophrenia is a severe mental illness characterized by hallucinations, delusions, and disorganized thought and behavior. Family, twin, and adoption studies have demonstrated that genetic factors play an important role in the etiology of schizophrenia (Gottesmann 1991). Several studies have been conducted in search for polymorphic susceptibility variants in candidate genes, and in particular
From the Genetics Unit (SBe, SM, JP, MG) and the Psychiatric Rehabilitation Unit (SBi, LR), IRCCS “S. Giovanni di Dio,” Fatebenefratelli, Brescia; and the Center of Neuropharmacology (FF), Institute of Pharmacological Sciences, University of Milan, Milan, Italy. Address reprint requests to Massimo Gennarelli, IRCCS Centro S. Giovanni de Dio –Fatebenefratelli, Via Pilastroni 4, Brescia 25123 Italy. Received June 6, 2002; revised September 19, 2002; accepted September 27, 2002.
© 2003 Society of Biological Psychiatry
the involvement of the N-methyl-D-aspartate (NMDA) ionotropic glutamate receptors (NMDARs) genes in the pathophysiology of schizophrenia have been widely investigated (Jurewicz et al 2001; Olney et al 1999). The NMDARs play a fundamental role in neurodevelopment and in the majority of the processes underlying learning and memory (Dingledine et al 1999). They are composed of three or four subunits, designated NR2A–D, and a common NR1 subunit that is the key for the complete functionality of the receptor (Moriyoshi et al 1991). It has been proposed that the hypofunction of the NMDARs might be involved in the pathophysiology of schizophrenia (Olney et al 1999). This hypothesis has been recently confirmed by the demonstration that a mouse line expressing very low levels of NR1 shows behavioral abnormalities that have been related to schizophrenia. Interestingly, the treatment with typical or atypical antipsychotics noticeably ameliorated symptoms in these mice (Mohn et al 1999). NR1 is encoded by the GRIN1 gene located on chromosome 9q34.3. The screening of the complete sequence of GRIN1 has been performed in a search for polymorphic changes or mutations. Numerous, widespread single nucleotide polymorphisms (SNPs) and some rare variants have been identified in regulative, exonic, and intronic regions (Rice et al 2001; Sakurai et al 2000; Williams et al 2002). The four SNPs identified among Japanese patients was found to not be associated with schizophrenia (Sakurai et al 2000). Williams et al (2002) identified six SNPs in UK patients, none of which provided evidence for association with schizophrenia. The more extensive analysis of the nucleotide diversity made by Rice et al (2001) in U.S. Caucasian, African American, Asian, and Native American patients led to the characterization of 28 sequence changes, but a case-control association study with schizophrenia has not been conducted. Because non-synonymous polymorphisms have not been identified in the GRIN1 coding regions, we performed a case-control association study analyzing the G1001C polymorphism located in the promoter region (Rice et al 2001), with the aim of investigating the potential role of this gene in the susceptibility to schizophrenia. 0006-3223/03/$30.00 doi:10.1016/S0002-3223(03)01783-3
618
S. Begni et al
BIOL PSYCHIATRY 2003;53:617– 619
Table 1. Demographic and Clinical Characteristics of the Patients Considered in the Study
Table 2. Allele Frequencies and Genotype Distribution of the G1001C Polymorphism in the 5⬘UTR of GRIN1 Gene
Characteristic
Mean
SD
Age (years) Age at Onset (years)
44.38 26.62
13.87 11.44
n
%
Gender Male Female DSM-IV Diagnosis Schizophrenia Paranoid Undifferentiated Disorganized Schizoaffective Disorder
84 55
60.43 39.57
113 55 40 18 26
81.3 39.55 28.75 13.0 18.7
Methods and Materials Patient Recruitment and Clinical Assessment All the patients, recruited from the Psychiatric Rehabilitation Center IRCCS S. Giovanni di Dio, Fatebenefratelli (Brescia, Italy), met the diagnostic criteria of DSM-IV for schizophrenia (assessed using the Structured Clinical Interview for DSM-IV, Patient Edition). Patients and control subjects gave written informed consent to participate in this study, as recommended by the Ethics Committee of the Center. The demographic and clinical characteristics of the schizophrenic sample are reported in Table 1. The control subjects were 85 men and 60 women with a mean age (⫾ SD) of 52 ⫾ 13 years. All the individuals were Caucasians living in Northern Italy.
Analysis of Functional Sequences in the Promoter Region The analysis of the GRIN1 5⬘untranslated region (UTR) was performed with the public domain software MatInspector Professional 5.2, based on the TRANSFAC database (Quandt et al 1995; Wingender et al 2000). The MatInspector program detects potential matches of sequences by automatic search within a library of matrices based on the transcription factors binding sites database.
Sample Collection, Nucleic Acid Purification, and Polymerase Chain Reaction A 7–10 mL peripheral blood sample was collected from each individual, and genomic deoxyribonucleic acid was extracted from leukocytes according to a standard method (Miller et al 1988). The G1001C polymorphism in the GRIN1 5⬘UTR (GenBank accession number Z32772) was screened by a polymerase chain reaction (PCR) amplification followed by digestion with a restriction endonuclease. The primers used for the PCR were GRIN1-F (forward) 5⬘-GTCCAGTTTCCAGGCTCTC–3⬘ and GRIN1-R (reverse) 5⬘–CTCCCCACAAGGTTCAGAAA–3⬘. The amplification conditions were denaturation at 94°C for 5 min followed by 30 cycles at 94°C for 1 min, 58°C for 30 sec, 72°C
Control Subjects (n ⫽ 145) Allele Frequenciesa C G Genotype Distributionsb CC GC GG
Patients (n ⫽ 139)
.086 .914 1 23 121
.16 .84 4 36 99
C allele as dominant, patients vs. control subjects: 2 ⫽ 6.076, p ⫽ .0137, odds ratio 2.037, 95% confidence interval 1.1502–3.6076. a Patients vs. control subjects: 2 ⫽ 6.907, p ⫽ .0085. b Patients vs. control subjects: 2 ⫽ 6.74, p ⫽ .034.
for 30 sec, with a final elongation step at 72°C for 5 min. The PCR products were digested overnight at 37°C with 6 units of the restriction endonuclease BseRI (New England Biolabs Inc., Beverly, MA) and electrophoresed on a 3% Agarose 1000 gel (GIBCO BRL, Life Technologies, Paisley, UK).
Statistical Analysis The 2 test was performed to assess the significance of our results. The Hardy-Weinberg equilibrium was tested by using Arlequin 2.0 software (Schneider et al 2000). Odds ratios (ORs) and their 95% confidence intervals (CIs) were calculated to evaluate the effects of different genotypes with the statistical package SPSS 10.0 (SPSS, Chicago, IL). The sample power was calculated with the program Power Calculator of the UCLA Department of Statistics (available at: http://calculators.stat. ucla.edu/powercalc/binomial/case-control/b-case-control-power. php), based on DSTPLAN 4.2. (Brown et al 2000).
Results We first analyzed the sequence surrounding the G1001C polymorphism to elucidate its potential functional role. The analysis performed with a specific software showed that the G3 C transversion alters the first nucleotide of the GGGG consensus sequence for the p50 subunit of the transcription factor NF-B. The G1001C allele frequencies, genotype distributions, and statistical analysis are shown in Table 2. There were no deviations from Hardy-Weinberg equilibrium. The C allele frequency was different between patients and control subjects (p ⫽ .0085), as was the genotype distribution (p ⫽ .034). Considering the C allele as dominant, the difference was even more significant (p ⫽ .0137, OR 2.037, 95% CI 1.1502-3.6076; power analysis 0.7903).
Discussion Numerous SNPs have been identified in the GRIN1 gene full sequence among Japanese, UK, and U.S. Caucasian, African
Association between GRIN1 and Schizophrenia
American, Asian, and Native American schizophrenic patients (Rice et al 2001; Sakurai et al 2000; Williams et al 2002). None of the variations identified among Japanese patients has been found in association with schizophrenia, probably owing to their very low frequency in this population and to the ethnic background (Sakurai et al 2000). The SNPs characterized in the GRIN1 coding sequence among U.S. patients of different ethnic backgrounds were all synonymous, and it has been supposed that some of the changes in the 5⬘UTR region may interrupt consensus binding sites for transcription factors, but no case-control study was conducted (Rice et al 2001). The five SNPs analyzed in the UK population did not provide evidence for association, but the authors did not exclude the possibility that rare SNPs might alter the transcriptional efficiency of the gene (Williams et al 2002). We report here that in the Italian population the G1001C polymorphism in the promoter region of GRIN1 is associated with schizophrenia, and it could alter a consensus sequence for the p50 subunit of the transcription factor NF-B. In vitro studies demonstrated that NF-B regulates the transcription of the human tumor necrosis factor (TNF) gene, recently investigated as a candidate for susceptibility to schizophrenia (Boin et al 2001). A single base change in an NF-B binding site in the TNF promoter region specifically inhibits the p50 binding affinity and affects the enhancer activity of this transcription factor (Udalova et al 2000). Although it is known that glutamate ionotropic receptors trigger the activation of NF-B in neurons (O’Neill et al 1997), nothing is known about a possible feedback interaction of NF-B on such receptors. Further functional studies are necessary to elucidate the hypotheses that this transcription factor may regulate GRIN1 expression and that the C allele could alter its activity. Moreover, the replication of this study with a haplotype analysis involving other polymorphisms in independent samples could increase the significance of these results. In conclusion, this is the first report of a GRIN1 polymorphic variant in association with schizophrenia that suggests a role for GRIN1 as a susceptibility gene for this illness. Furthermore, our results, when associated with the observation that in mice antipsychotics ameliorate the symptoms due to a low expression of GRIN1, suggest that this gene is a good candidate for future studies in the pharmacogenetics of typical and atypical antipsychotics.
This research was supported by a grant from the Italian Ministry of Health and the Cariplo Foundation.
BIOL PSYCHIATRY 2003;53:617– 619
619
References Boin F, Zanardini R, Pioli R, Altamura CA, Maes M, Gennarelli M (2001): Association between -G308A tumor necrosis factor alpha gene polymorphism and schizophrenia. Mol Psychiatry 6:79 –82. Brown B, Brauner C, Chan A, Gutierrez D, Herson J, Lovato J, Polsley J, Russell K, Venier J (2000): DSTPLAN Version 4.2 Calculations for Sample Sizes and Related Problems. Houston, TX: The University of Texas M.D. Anderson Cancer Center, Department of Biomathematics. Dingledine R, Borges K, Bowie D, Traynelis SF (1999): The glutamate receptor ion channels. Pharmacol Rev 51:7–61. Gottesman II (1991): Schizophrenia Genesis: The Origins of Madness. New York: W.H. Freeman. Jurewicz I, Owen RJ, O’Donovan MC, Owen MJ (2001): Searching for susceptibility genes in schizophrenia. Eur Neuropsychopharmacol 11:395–398. Miller SA, Dykes DD, Polesky HF (1988): A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 16:1215. Mohn AR, Gainetdinov RR, Caron MG, Koller BH (1999): Mice with reduced NMDA receptor expression display behaviors related to schizophrenia. Cell 98:427–436. Moriyoshi K, Masu M, Ishii T, Shigemoto R, Mizuno N, Nakanishi S (1991): Molecular cloning and characterization of the rat NMDA receptor. Nature 354:31–37. Olney JW, Newcomer JW, Farber NB (1999): NMDA receptor hypofunction model of schizophrenia. J Psychiatr Res 33:523–533. O’Neill LA, Kaltschmidt C (1997): NF-kappa B: A crucial transcription factor for glial and neuronal cell function. Trends Neurosci 20:252–258. Quandt K, Frech K, Karas H, Wingender E, Werner T (1995): MatInd and MatInspector—New fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Research 23:4878 –4884. Rice SR, Niu N, Berman DB, Heston LL, Sobell JL (2001): Identification of single nucleotide polymorphisms (SNPs) and other sequence changes and estimation of nucleotide diversity in coding and flanking regions of the NMDAR1 receptor gene in schizophrenic patients. Mol Psychiatry 6:274 –284. Sakurai K, Toru M, Yamakawa-Kobayashi K, Arinami T (2000): Mutation analysis of the N-methyl-D-aspartate receptor NR1 subunit gene (GRIN1) in schizophrenia. Neurosci Lett 296:168 –170. Schneider S, Roessli D, Excofier L (2000): Arlequin: A Software for Population Genetics Data Analysis, Version 2.000. Geneva, Switzerland: University of Geneva, Genetics and Biometry Laboratory, Department of Anthropology. Udalova IA, Richardson A, Denys A, Smith C, Ackerman H, Foxwell B, Kwiatkowski D (2000): Functional consequences of a polymorphism affecting NF-kappaB p50-p50 binding to the TNF promoter region. Mol Cell Biol 20:9113–9119. Williams NM, Bowen T, Spurlock G, Norton N, Williams HJ, Hoogendoorn B, Owen MJ, O’Donovan MC (2002): Determination of the genomic structure and mutation screening in schizophrenic individuals for five subunits of the N-methylD-aspartate glutamate receptor. Mol Psychiatry 7:508 –514. Wingender E, Chen X, Hehl R, Kara H, Liebich I, Matys V, Meinhardt T, et al (2000): TRANSFAC: An integrated system for gene expression regulation. Nucleic Acids Res 28:316 – 319.
Introduction
S
chizophrenia is a severe mental illness characterized by hallucinations, delusions, and disorganized thought and behavior. Family, twin, and adoption studies have demonstrated that genetic factors play an important role in the etiology of schizophrenia (Gottesmann 1991). Several studies have been conducted in search for polymorphic susceptibility variants in candidate genes, and in particular
From the Genetics Unit (SBe, SM, JP, MG) and the Psychiatric Rehabilitation Unit (SBi, LR), IRCCS “S. Giovanni di Dio,” Fatebenefratelli, Brescia; and the Center of Neuropharmacology (FF), Institute of Pharmacological Sciences, University of Milan, Milan, Italy. Address reprint requests to Massimo Gennarelli, IRCCS Centro S. Giovanni de Dio –Fatebenefratelli, Via Pilastroni 4, Brescia 25123 Italy. Received June 6, 2002; revised September 19, 2002; accepted September 27, 2002.
© 2003 Society of Biological Psychiatry
the involvement of the N-methyl-D-aspartate (NMDA) ionotropic glutamate receptors (NMDARs) genes in the pathophysiology of schizophrenia have been widely investigated (Jurewicz et al 2001; Olney et al 1999). The NMDARs play a fundamental role in neurodevelopment and in the majority of the processes underlying learning and memory (Dingledine et al 1999). They are composed of three or four subunits, designated NR2A–D, and a common NR1 subunit that is the key for the complete functionality of the receptor (Moriyoshi et al 1991). It has been proposed that the hypofunction of the NMDARs might be involved in the pathophysiology of schizophrenia (Olney et al 1999). This hypothesis has been recently confirmed by the demonstration that a mouse line expressing very low levels of NR1 shows behavioral abnormalities that have been related to schizophrenia. Interestingly, the treatment with typical or atypical antipsychotics noticeably ameliorated symptoms in these mice (Mohn et al 1999). NR1 is encoded by the GRIN1 gene located on chromosome 9q34.3. The screening of the complete sequence of GRIN1 has been performed in a search for polymorphic changes or mutations. Numerous, widespread single nucleotide polymorphisms (SNPs) and some rare variants have been identified in regulative, exonic, and intronic regions (Rice et al 2001; Sakurai et al 2000; Williams et al 2002). The four SNPs identified among Japanese patients was found to not be associated with schizophrenia (Sakurai et al 2000). Williams et al (2002) identified six SNPs in UK patients, none of which provided evidence for association with schizophrenia. The more extensive analysis of the nucleotide diversity made by Rice et al (2001) in U.S. Caucasian, African American, Asian, and Native American patients led to the characterization of 28 sequence changes, but a case-control association study with schizophrenia has not been conducted. Because non-synonymous polymorphisms have not been identified in the GRIN1 coding regions, we performed a case-control association study analyzing the G1001C polymorphism located in the promoter region (Rice et al 2001), with the aim of investigating the potential role of this gene in the susceptibility to schizophrenia. 0006-3223/03/$30.00 doi:10.1016/S0002-3223(03)01783-3
618
S. Begni et al
BIOL PSYCHIATRY 2003;53:617– 619
Table 1. Demographic and Clinical Characteristics of the Patients Considered in the Study
Table 2. Allele Frequencies and Genotype Distribution of the G1001C Polymorphism in the 5⬘UTR of GRIN1 Gene
Characteristic
Mean
SD
Age (years) Age at Onset (years)
44.38 26.62
13.87 11.44
n
%
Gender Male Female DSM-IV Diagnosis Schizophrenia Paranoid Undifferentiated Disorganized Schizoaffective Disorder
84 55
60.43 39.57
113 55 40 18 26
81.3 39.55 28.75 13.0 18.7
Methods and Materials Patient Recruitment and Clinical Assessment All the patients, recruited from the Psychiatric Rehabilitation Center IRCCS S. Giovanni di Dio, Fatebenefratelli (Brescia, Italy), met the diagnostic criteria of DSM-IV for schizophrenia (assessed using the Structured Clinical Interview for DSM-IV, Patient Edition). Patients and control subjects gave written informed consent to participate in this study, as recommended by the Ethics Committee of the Center. The demographic and clinical characteristics of the schizophrenic sample are reported in Table 1. The control subjects were 85 men and 60 women with a mean age (⫾ SD) of 52 ⫾ 13 years. All the individuals were Caucasians living in Northern Italy.
Analysis of Functional Sequences in the Promoter Region The analysis of the GRIN1 5⬘untranslated region (UTR) was performed with the public domain software MatInspector Professional 5.2, based on the TRANSFAC database (Quandt et al 1995; Wingender et al 2000). The MatInspector program detects potential matches of sequences by automatic search within a library of matrices based on the transcription factors binding sites database.
Sample Collection, Nucleic Acid Purification, and Polymerase Chain Reaction A 7–10 mL peripheral blood sample was collected from each individual, and genomic deoxyribonucleic acid was extracted from leukocytes according to a standard method (Miller et al 1988). The G1001C polymorphism in the GRIN1 5⬘UTR (GenBank accession number Z32772) was screened by a polymerase chain reaction (PCR) amplification followed by digestion with a restriction endonuclease. The primers used for the PCR were GRIN1-F (forward) 5⬘-GTCCAGTTTCCAGGCTCTC–3⬘ and GRIN1-R (reverse) 5⬘–CTCCCCACAAGGTTCAGAAA–3⬘. The amplification conditions were denaturation at 94°C for 5 min followed by 30 cycles at 94°C for 1 min, 58°C for 30 sec, 72°C
Control Subjects (n ⫽ 145) Allele Frequenciesa C G Genotype Distributionsb CC GC GG
Patients (n ⫽ 139)
.086 .914 1 23 121
.16 .84 4 36 99
C allele as dominant, patients vs. control subjects: 2 ⫽ 6.076, p ⫽ .0137, odds ratio 2.037, 95% confidence interval 1.1502–3.6076. a Patients vs. control subjects: 2 ⫽ 6.907, p ⫽ .0085. b Patients vs. control subjects: 2 ⫽ 6.74, p ⫽ .034.
for 30 sec, with a final elongation step at 72°C for 5 min. The PCR products were digested overnight at 37°C with 6 units of the restriction endonuclease BseRI (New England Biolabs Inc., Beverly, MA) and electrophoresed on a 3% Agarose 1000 gel (GIBCO BRL, Life Technologies, Paisley, UK).
Statistical Analysis The 2 test was performed to assess the significance of our results. The Hardy-Weinberg equilibrium was tested by using Arlequin 2.0 software (Schneider et al 2000). Odds ratios (ORs) and their 95% confidence intervals (CIs) were calculated to evaluate the effects of different genotypes with the statistical package SPSS 10.0 (SPSS, Chicago, IL). The sample power was calculated with the program Power Calculator of the UCLA Department of Statistics (available at: http://calculators.stat. ucla.edu/powercalc/binomial/case-control/b-case-control-power. php), based on DSTPLAN 4.2. (Brown et al 2000).
Results We first analyzed the sequence surrounding the G1001C polymorphism to elucidate its potential functional role. The analysis performed with a specific software showed that the G3 C transversion alters the first nucleotide of the GGGG consensus sequence for the p50 subunit of the transcription factor NF-B. The G1001C allele frequencies, genotype distributions, and statistical analysis are shown in Table 2. There were no deviations from Hardy-Weinberg equilibrium. The C allele frequency was different between patients and control subjects (p ⫽ .0085), as was the genotype distribution (p ⫽ .034). Considering the C allele as dominant, the difference was even more significant (p ⫽ .0137, OR 2.037, 95% CI 1.1502-3.6076; power analysis 0.7903).
Discussion Numerous SNPs have been identified in the GRIN1 gene full sequence among Japanese, UK, and U.S. Caucasian, African
Association between GRIN1 and Schizophrenia
American, Asian, and Native American schizophrenic patients (Rice et al 2001; Sakurai et al 2000; Williams et al 2002). None of the variations identified among Japanese patients has been found in association with schizophrenia, probably owing to their very low frequency in this population and to the ethnic background (Sakurai et al 2000). The SNPs characterized in the GRIN1 coding sequence among U.S. patients of different ethnic backgrounds were all synonymous, and it has been supposed that some of the changes in the 5⬘UTR region may interrupt consensus binding sites for transcription factors, but no case-control study was conducted (Rice et al 2001). The five SNPs analyzed in the UK population did not provide evidence for association, but the authors did not exclude the possibility that rare SNPs might alter the transcriptional efficiency of the gene (Williams et al 2002). We report here that in the Italian population the G1001C polymorphism in the promoter region of GRIN1 is associated with schizophrenia, and it could alter a consensus sequence for the p50 subunit of the transcription factor NF-B. In vitro studies demonstrated that NF-B regulates the transcription of the human tumor necrosis factor (TNF) gene, recently investigated as a candidate for susceptibility to schizophrenia (Boin et al 2001). A single base change in an NF-B binding site in the TNF promoter region specifically inhibits the p50 binding affinity and affects the enhancer activity of this transcription factor (Udalova et al 2000). Although it is known that glutamate ionotropic receptors trigger the activation of NF-B in neurons (O’Neill et al 1997), nothing is known about a possible feedback interaction of NF-B on such receptors. Further functional studies are necessary to elucidate the hypotheses that this transcription factor may regulate GRIN1 expression and that the C allele could alter its activity. Moreover, the replication of this study with a haplotype analysis involving other polymorphisms in independent samples could increase the significance of these results. In conclusion, this is the first report of a GRIN1 polymorphic variant in association with schizophrenia that suggests a role for GRIN1 as a susceptibility gene for this illness. Furthermore, our results, when associated with the observation that in mice antipsychotics ameliorate the symptoms due to a low expression of GRIN1, suggest that this gene is a good candidate for future studies in the pharmacogenetics of typical and atypical antipsychotics.
This research was supported by a grant from the Italian Ministry of Health and the Cariplo Foundation.
BIOL PSYCHIATRY 2003;53:617– 619
619
References Boin F, Zanardini R, Pioli R, Altamura CA, Maes M, Gennarelli M (2001): Association between -G308A tumor necrosis factor alpha gene polymorphism and schizophrenia. Mol Psychiatry 6:79 –82. Brown B, Brauner C, Chan A, Gutierrez D, Herson J, Lovato J, Polsley J, Russell K, Venier J (2000): DSTPLAN Version 4.2 Calculations for Sample Sizes and Related Problems. Houston, TX: The University of Texas M.D. Anderson Cancer Center, Department of Biomathematics. Dingledine R, Borges K, Bowie D, Traynelis SF (1999): The glutamate receptor ion channels. Pharmacol Rev 51:7–61. Gottesman II (1991): Schizophrenia Genesis: The Origins of Madness. New York: W.H. Freeman. Jurewicz I, Owen RJ, O’Donovan MC, Owen MJ (2001): Searching for susceptibility genes in schizophrenia. Eur Neuropsychopharmacol 11:395–398. Miller SA, Dykes DD, Polesky HF (1988): A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 16:1215. Mohn AR, Gainetdinov RR, Caron MG, Koller BH (1999): Mice with reduced NMDA receptor expression display behaviors related to schizophrenia. Cell 98:427–436. Moriyoshi K, Masu M, Ishii T, Shigemoto R, Mizuno N, Nakanishi S (1991): Molecular cloning and characterization of the rat NMDA receptor. Nature 354:31–37. Olney JW, Newcomer JW, Farber NB (1999): NMDA receptor hypofunction model of schizophrenia. J Psychiatr Res 33:523–533. O’Neill LA, Kaltschmidt C (1997): NF-kappa B: A crucial transcription factor for glial and neuronal cell function. Trends Neurosci 20:252–258. Quandt K, Frech K, Karas H, Wingender E, Werner T (1995): MatInd and MatInspector—New fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Research 23:4878 –4884. Rice SR, Niu N, Berman DB, Heston LL, Sobell JL (2001): Identification of single nucleotide polymorphisms (SNPs) and other sequence changes and estimation of nucleotide diversity in coding and flanking regions of the NMDAR1 receptor gene in schizophrenic patients. Mol Psychiatry 6:274 –284. Sakurai K, Toru M, Yamakawa-Kobayashi K, Arinami T (2000): Mutation analysis of the N-methyl-D-aspartate receptor NR1 subunit gene (GRIN1) in schizophrenia. Neurosci Lett 296:168 –170. Schneider S, Roessli D, Excofier L (2000): Arlequin: A Software for Population Genetics Data Analysis, Version 2.000. Geneva, Switzerland: University of Geneva, Genetics and Biometry Laboratory, Department of Anthropology. Udalova IA, Richardson A, Denys A, Smith C, Ackerman H, Foxwell B, Kwiatkowski D (2000): Functional consequences of a polymorphism affecting NF-kappaB p50-p50 binding to the TNF promoter region. Mol Cell Biol 20:9113–9119. Williams NM, Bowen T, Spurlock G, Norton N, Williams HJ, Hoogendoorn B, Owen MJ, O’Donovan MC (2002): Determination of the genomic structure and mutation screening in schizophrenic individuals for five subunits of the N-methylD-aspartate glutamate receptor. Mol Psychiatry 7:508 –514. Wingender E, Chen X, Hehl R, Kara H, Liebich I, Matys V, Meinhardt T, et al (2000): TRANSFAC: An integrated system for gene expression regulation. Nucleic Acids Res 28:316 – 319.