Association of CYP3A5, CYP2C8, and ABCB1 Polymorphisms With Early Renal Injury in Chinese Liver Transplant Recipients Receiving Tacrolimus

Association of CYP3A5, CYP2C8, and ABCB1 Polymorphisms With Early Renal Injury in Chinese Liver Transplant Recipients Receiving Tacrolimus R. Denga, Y. Liaob, Yi Lib, and J. Tangb,* a Department of Infectious Disease Center, West China Hospital of Sichuan University, Chengdu, Sichuan, China; and bDepartment of Laboratory Medicine, West China Hospital of Sichuan University, Chengdu, Sichuan, China

ABSTRACT Background. The purpose of this study is to explore the association of CYP3A5, ABCB1, and CYP2C8 polymorphisms with the risk of developing early kidney impairment in Chinese liver transplant recipients receiving tacrolimus. Methods. CYP3A5, ABCB1, and CYP2C8 polymorphisms were genotyped in the Chinese liver transplant recipients in the study receiving tacrolimus for at least 2 years by polymerase chain reaction and high-resolution melting method. Serum cystatin C and urine microprotein (a1-microglobulin, microalbumin, transferrin, and immunoglobulin) of liver transplant recipients were used to determine both the status of early renal injury and the lesion part. Results. We documented 3 genotypes of CYP3A5 and ABCB1 and only 2 genotypes of CYP2C8 in our cohort. The levels of cystatin C and all 4 indicators of the urine microprotein in the recipient group were significantly higher than those in the control group (P < .05). The concentrations of transferrin differed significantly in each CYP3A5 genotype group (P < .05). Based on diverse CYP2C8 genotypes, we divided all the recipients into 2 groups: CYP2C8*1*1 group and CYP2C8*3*1 group. The concentrations of a1-microglobulin and cystatin C differed significantly between the 2 groups (P < .05). For CYP2C8*3, the positive predictive value is 68.5% and negative predictive value is 70.2%. For CYP3A5*3, the positive predictive value is 55.3% and negative predictive value is 60.4%. Conclusions. CYP2C8*3 and CYP3A5*3 appear to be predictive of risk of tacrolimusinduced early renal impairment. CYP3A5*3 was associated with the risk of early renal glomerular lesion, while CYP2C8*3 was associated with the risk of the tubulointerstitial injury. ABCB1 polymorphisms (both C3435T and C1236T) were not associated with the early renal injury in liver transplant recipients.

C

ALCINEURIN inhibitors (CNIs) are the mainstay of immunosuppressant therapy for most solid organ transplant recipients. Having been introduced in 1995 [1,2], the CNI drug tacrolimus (Tac) was included in many treatment protocols from 1997 onward [1]. Tac originates from a fungus (Streptomyces tsukubaensis) and is an effective immunosuppressant agent. Despite their beneficial immunosuppressive actions in transplantation and many autoimmune disorders, the clinical use of CNIs is compromised by their chronic nephrotoxicity [3e6]. Extensive alterations in 0041-1345/18 https://doi.org/10.1016/j.transproceed.2018.06.040

3258

the renal architecture including glomerular sclerosis, tubular atrophy, and interstitial fibrosis may lead to endstage renal failure. As is well known, dose is not This study is funded by the Natural Science Foundation of China (81571561). *Address correspondence to Jiangtao Tang, Department of Laboratory Medicine, West China Hospital, Sichuan University, Chengdu 610041, Sichuan, China. Tel: þ86 28 85422752, Fax: þ86 28 85422751. E-mail: [email protected] ª 2018 Elsevier Inc. All rights reserved. 230 Park Avenue, New York, NY 10169

Transplantation Proceedings, 50, 3258e3265 (2018)

CYP3A5, CYP2C8, AND ABCB1 POLYMORPHISMS

predictive of chronic CNI-induced nephrotoxicity. The risk factors contributing to the development of nephrotoxicity have been investigated, including genetic variation in renal CNI metabolism and transport genes. In liver recipients, a possible association between recipients ACE, CYP3A5, ABCB1, and CYP2C8 genetic polymorphisms and Tac-induced nephrotoxicity was surmised. Limited evidence suggests that variation in genes involved in pharmacokinetics (ABCB1 and CYP3A5) and pharmacodynamics (TGF-b, CYP2C8, ACE, CCR5) of Tac may impact the risk of transplant recipients to develop Tac-induced nephrotoxicity. Renal impairment after liver transplant may be reversible if it is diagnosed early, so it needs to be identified and treated promptly [7]. We therefore need to gain better understanding of the risk factors and useful markers of early renal injury after transplant. To date, current studies have been conducted to elucidate factors that are associated with the development of post-transplant chronic kidney disease, but few have paid attention to early renal impairment after transplant. The purpose of this study was to explore the association between known ABCB1, CYP3A5, and CYP2C8 polymorphisms and the risk of developing early kidney impairment in liver transplant recipients receiving Tac. We hypothesize that liver transplant recipients carrying 1 or more variant ABCB1, CYP3A5, and CYP2C8 allele may be at a higher risk of developing early renal injury when challenged with Tac.

MATERIALS AND METHODS Patients and Sample Collecting Between January 2000 and May 2008, 136 patients who had a liver transplant in the center of Liver Transplantation in West China Hospital of Sichuan University were selected, including 107 male patients and 29 female patients. All patients accepted the operation of living donor liver transplant. The age ranges between 22 and 68 years, with a mean (SD) age of 46 (5) years. All the recipients took the regimen of Tac (Tac þ mycophenolate mofetil þ prednisone) to resist the rejection for more than 2 years without interruption after liver transplant. Additionally, all the patients had normal renal function (normal serum creatinine, cystatin C [Cys-C], and normal urine microprotein) before transplant. The recipients with abnormal serum creatinine or detectable microproteinuria before transplant were excluded. Recipients with acute or chronic rejection or abnormal serum alanine aminotransferase and creatinine levels were excluded. The daily Tac dose was adjusted to achieve trough concentration (C0: 5-10 ng/mL). After 3 months, target C0 was decreased to 3 to 6 ng/mL for long-term maintenance; 1500 mg/d mycophenolate mofetil was given as 2 equally divided doses. The steroid regimen was 1000 mg of methylprednisolone at the time of surgery and 500 mg/d daily for the next 2 days. This schedule was followed by 80 mg/d of oral prednisone, progressively tapered by 10 mg/d to 20 mg/d until 3 months after transplant, then reduced to a maintenance dose of 5 mg daily or withdrawn. A total of 150 controls were included (120 male, 30 female). Their ages vary from 22 to 68 years with a mean (SD) of 40 (6) years. Routine physical examination excluded the subjects with liver or kidney diseases. This study was approved by the West China Hospital review board. All organ donations were legal and according to the procedure for

3259 examination and approval of the People’s Republic of China in West China Hospital.

Genomic DNA Extraction Preoperative blood samples (3 mL) were collected in ethylenediaminetetraacetic acid tubes from the liver transplant recipients, genomic DNA were isolated from whole blood samples using the whole blood DNA kit (Biotake Corporation, Beijing, China), and DNA was extracted according to the manufacturer’s protocol. The concentration of DNA was diluted to 10 ng/mL for working solutions, and the isolated DNA was stored at 20 C.

CYP3A5, CYP2C8, and ABCB1 Single Nucleotide Polymorphism Measurements CYP3A5, CYP2C8 and ABCB1 single nucleotide polymorphisms were assessed. Some samples were previously genotyped by sequencing as controls for the single nucleotide polymorphisms. The polymerase chain reaction (PCR) and melting curve analyses were performed under the same conditions in a 96-well plate on the Light Cycler 480 (Roche Diagnostics, Penzberg, Bavaria, Germany). The PCR primers are listed in Table 1. The reaction mixtures contained 1.0 mL purified genomic DNA (10 ng/mL), 0.1 mL forward primer, 0.1 mL reverse primer, 5 mL Roche Mix (including 20  EVA-GREEN, dNTP (10 mM), Hot Star Taq Plus DNA Polymerase, 10  buffer), 1.4 mL 25 mM Mgcl2, and 2.4 mL H2O. Real-time PCR was performed under the following conditions: an initial denaturation step at 95 C for 15 minutes, continued with 50 cycles of 95 C for 10 seconds, 60 C for 15 seconds, and 72 C for 20 seconds. After the amplification phase, a melting curve analysis was performed at 95 C for 1 minute, 40 C for 1 minute, 65 C for 1 second, followed by slow heating at 0.01 C/s to 95 C. Collected data were analyzed by the Light Cycler 480 Gene Scanning software v1.2 (Roche Diagnostics). Temperature was shifted by selecting threshold, then automatic grouping was made by calculation. The exact same setting of the normalization was used for all experiments. The genotype of subset was defined according to known genotypes of controls.

Markers of Renal Function, Microproteinuria and Tac Blood Concentration Measurements Blood samples were collected exactly before morning doses of Tac. The Tac concentration (C0) was measured in whole blood by the enzyme-multiplied immunoassay on V-Twin (Syva Company/ SIMENS). Serum levels of creatinine (SCr), blood urea nitrogen (BUN), and Cys-C were measured by Turbidimetric Immunoassay on COBAS (Roche Diagnostics). Clean catch midstream morning urine samples were collected and centrifuged. The levels of a1-microglobulin (a1M), Table 1. Primer Sequences of CYP3A5, ABCB1, and CYP2C8 Polymorphisms Allele

Primer Sequence

CYP3A5(6986A>G) (forward) CYP3A5(6986A>G) (reverse) ABCB1 3435C>T (forward) ABCB1 3435C>T (reverse) ABCB1 1236C>T (forward) ABCB1 1236C>T (reverse) CYP2C8 (rs11572080) (Forward) CYP2C8 (rs11572080) (Reverse)

5’ACCACCCAGCTTAACGAATG3’ 5’TTGTACGACACACAGCAACCT3’ 5’GCTGAGAACATTGCCTATGGA3’ 5’GCATGTATGTTGGCCTCCTT3’ 5’TTTTTCTCACTCGTCCTGGT3’ 5’TCAGCTGGACTGTTGTGCTC3’ 5’CTCACAACCTTGCGGAATTT3’ 5’CCACCCTTGGTTTTTCTCAA3’

3260

DENG, LIAO, LI ET AL Table 2. Characteristics of Clinical Information of Liver Transplant Recipients Recipients (n ¼ 136)

Age, mean (SD), y Sex (male/female) Time after transplant, mean (SD), y Tac, mean (SD), ng/mL ALT, mean (SD), U/L AST, mean (SD), U/L TP, mean (SD), g/L GLB, mean (SD), g/L Crea, mean, umol/L BUN, mean (SD), mmol/L Cys-C, median (IQR), mg/L* a1M, median (IQR), mg/L* MA, median (IQR), mg/L* TRU, median (IQR), mg/L* IgU, median (IQR), mg/L*

Control Group (n ¼ 150)

46 (5) 107/29 3.82 (2.07) 4.32 (2.14) 48.5 (3.85) 39.7 (2.85) 79.5 (5.45) 33.7 (2.25) 87.5 (12.) 7.02 (2.55) 0.88 (0.68w1.12) 24.35 (12.8w40.25) 15.55 (9.88w47.55) 6.33 (3.02w11.22) 12.5 (6.55w21.3)

40 (6) 120/30

P Value

.72 .81

49.6 42.5 77.6 34.5 79 6.88 0.70 8.1 7.2

(6.58) (3.65) (5.32) (2.59) (11.5) (1.25) (0.58w0.89) (6.88w9.82) (6.5w8.9) <2 3.24 (3.52w4.89)

.57 .24 .58 .32 .42 .72 .04 .02 .03 .03 .04

Abbreviations: a1M, alpha 1 microglobulin; ALT, alanine aminotransferase; AST, aspartate aminotransferase; BUN, blood urea nitrogen; Crea, creatinine; Cys-C, cystatin C; GLB, globulin; IgU, urinary immunoglobulin G; IQR, interquartile range; MA, microalbumin; Tac, tacrolimus; TRU, urinary transferrin; TP, total protein. *P < .05.

microalbumin (MA), transferrin (TRU) and immunoglobulin (IgU) in the urine sample were measured by rate nephelometry on IMMAGE 800 (Beckman Coulter, Brea, Calif, United States). Proficiency testing was performed by participation of the College of American Pathologists in the USA Quality Assessment Scheme.

Statistical Analysis Statistical analysis was performed with SPSS (version 11.0, IBM, Armonk, NY, United States). Mean and standard deviation were used to present the data of normal distribution, median, and interquartile range to illustrate data of abnormal distribution; t test was applied to analyze the difference between 2 groups. KruskalWallis test was used to make the comparison among 3 groups, and Nemenyi test was used for each other comparison among groups. P values less than .05 were considered significant.

RESULTS Genotype Identification

We could clearly distinguish 3 genotype melting profiles from the normalized melting curves of CYP3A5 and ABCB1 genotypes. There were only 2 genotypes of CYP2C8 in Chinese liver transplant recipients. The genotype

frequencies of the recipients did not show significant deviation from the Hardy-Weinberg equilibrium (P > .05). Allelic frequencies were as follows: CYP3A5(6986A>G): *1/*3:36.4% /63.6%; ABCB1(3435C>T): C/T: 58.2%/41.8%; ABCB1(1236C>T): C/T: 40.9%/ 59.1%; and CYP2C8: *1/*3:8.8%/91.2%. Characteristics of Clinical Information of the Liver Transplant Recipients

As shown in Table 2, there is no difference between the recipient group and the control group in age and sex. The mean (SD) postoperative time of the 136 recipients was 3.82 (2.07) years, of whom the dosage of Tac was 1.5w3.5mg/d. The mean (SD) concentration of Tac in whole blood was 4.32 (2.14) ng/mL. There was no difference between the recipient group and the control group in liver function either. For the renal function, the levels of Cys-C as well as all 4 indicators of urine microprotein in the recipient group were significantly higher than those in the control group (P < .05), while the levels of SCr and BUN had no significant difference between the recipient group and the control group (P > .05).

Table 3. Effects of CYP3A5 Polymorphisms on Renal Function and Microproteinuria in Liver Transplant Recipients CYP3A5(6986A>G)

N

a1M, median (IQR), mg/L IgU, median (IQR), mg/L MA, median (IQR), mg/L TRU, median (IQR) mg/L* Cys-C, median (IQR), mg/L Crea, mean (SD), umol/L BUN, mean (SD), mmol/L

16.2 10.9 15.95 2 0.85 77.5 6.88

*1/*1

*1*3

*3*3

12

59

65

(11.34w42.5) (5.77w14.33) (10.95w22.75) (2w2) (0.74w0.95) (11.5) (2.51)

24.1 11.75 20.6 2.1 0.82 81.5 6.55

(11.55e39.13) (5.45w26.95) (9.14w69.93) (2w7.27) (0.74w0.95) (11.5) (1.25)

24.8 10.4 17 2 0.87 80.5 7.12

(11.7e39.8) (5.49w17.8) (9.18w37.5) (2w4.36) (0.76w1.03) (10.5) (1.09)

P Value

.10 .88 .46 .03 .33 .57 .77

Abbreviations: a1M, alpha 1 microglobulin; BUN, blood urea nitrogen; Crea, creatinine; Cys-C, cystatin C; IgU, urinary immunoglobulin G; IQR, interquartile range; MA, microalbumin; TRU, urinary transferrin. *P < .05.

CYP3A5, CYP2C8, AND ABCB1 POLYMORPHISMS

3261

Fig 1. Levels of TRU (urinary transferrin) in diverse CYP3A5 genotype groups.

Analysis of Levels of Urine Microprotein and Renal Function in Distinct Groups With Diverse CYP3A5 Genotypes (6986A>G)

Analysis of Levels of Urine Microprotein and Renal Function in Distinct Groups With Diverse ABCB1 Genotypes (1236C>T)

Based on diverse CYP3A5 genotypes, we divided all the recipients into 3 groups: *1*1 genotype group, *1*3 genotype group, and *3*3 genotype group. The concentrations of TRU differed substantially in diverse CYP3A5 genotypes (P < .05) (Table 3, Fig 1). However, there is no significant difference among the 3 CYP3A5 genotype groups in terms of the concentration of a1M (P > .05), but there was a tendency for the concentration of a1M in *1*1 genotype group to be lower than that of the *1*3 and *3*3 genotype groups. No significant difference was observed in diverse CYP3A5 genotype groups when it came to SCr and BUN.

Based on diverse ABCB1 genotypes, we divided all the recipients into 3 groups: CC genotype group, TC genotype group, and TT genotype group. There was no significant difference in the levels of urine microprotein and the renal function in diverse ABCB1 genotypes (Table 5).

Analysis of Levels of Urine Microprotein and Renal Function in Distinct Groups With Diverse ABCB1 Genotypes (3435C>T)

Based on diverse ABCB1 genotype, we divided all the recipients into 3 groups: CC genotype group, TC genotype group, and TT genotype group. There was no significant difference in levels of urine microprotein and renal function among the three ABCB1 genotypes (Table 4).

Analysis of Levels of Urine Microprotein and Renal Function in Distinct Groups With Diverse CYP2C8 Genotype

Based on diverse CYP2C8 genotypes, we divided all the recipients into groups: CYP2C8*1*1 group and CYP2C8*3*1 group. The concentrations of a1M and Cys-C differed significantly between the 2 groups (P < .05) (Table 6, Fig 2, Fig 3). There were no significant differences of SCr and BUN between the 2 groups. Analysis of Diagnostic Efficiency of CYP2C8*3 and CYP3A5*3 for Early Renal Injury

We adopted urine microprotein and Cys-C as the early indicators for renal injury. Serum Cys-C was assessed to identify early renal injuries. The patients were separated

Table 4. Effects of ABCB1(3435C>T) Polymorphisms on Renal Function and Microproteinuria in Liver Transplant Recipients ABCB1(3435C>T)

N

a1M, median (IQR), mg/L IgU, median (IQR), mg/L MA, median (IQR), mg/L TRU, median (IQR), mg/L Cys-C, median (IQR), mg/L Crea, mean (SD), umol/L BUN, mean (SD), mmol/L

22.9 8.52 15.7 2 0.86 80.5 7.12

CC

TC

TT

52

65

19

(11.45e38.3) (4.97e17.35) (8.52e32.05) (2e6.65) (0.75e0.97) (10.5) (2.65)

23.9 12.1 21.35 2 0.83 79.5 7.08

(10.2e37.13) (5.64e21.8) (10.92e50.37) (2e4.44) (0.74e0.97) (10.5) (1.56)

30.9 10.4 14.6 2 0.9 80.5 6.79

(14.3e61.25) (7.64e14.5) (7.82e39.7) (2e3.83) (0.79e1.07) (10.5) (1.19)

P Value

.24 .21 .46 .33 .46 .53 .71

Abbreviations: a1M, alpha 1 microglobulin; BUN, blood urea nitrogen; Crea, creatinine; Cys-C, cystatin C; IgU, urinary immunoglobulin G; IQR, interquartile range; MA, microalbumin; TRU, urinary transferrin.

3262

DENG, LIAO, LI ET AL

Table 5. Effects of ABCB1(1236C>T) Polymorphisms on Renal Function and Microproteinuria in Liver Transplant Recipients ABCB1(1236C>T)

N

a1M, median (IQR), mg/L IgU, median (IQR), mg/L MA, median (IQR), mg/L TRU, median (IQR), mg/L Cys-C, median (IQR), mg/L Crea, mean (SD), umol/L BUN, mean (SD), mmol/L

35 7.59 12.2 2.15 0.79 82.5 7.11

CC

TC

19

62

(12.4e25.7) (5.43e15.35) (9.06e50.3) (2e7.06) (0.68e0.88) (10.5) (1.65)

22.9 10.4 17 2 0.87 78.9 7.09

TT 55

(10.45e35.6) (5.24e24.55) (10.55e42.85) (2e3.77) (0.78e0.95) (10.5) (1.89)

25.1 11.8 20.4 2 0.84 81.5 6.99

(11.8e51.3) (6.19e17.95) (8.85e41.05) (2e4.41) (0.71e1.04) (10.5) (1.29)

P Value

.63 .46 .55 .26 .33 .42 .71

Abbreviations: a1M, alpha 1 microglobulin; BUN, blood urea nitrogen; Crea, creatinine; Cys-C, cystatin C; IgU, urinary immunoglobulin G; IQR, interquartile range; MA, microalbumin; TRU, urinary transferrin.

into 2 groups based on a cutoff value of Cys-C  1 mg/L or >1 mg/L for early renal injury. Abnormal urine microprotein can reflect the exact location of renal injury: a1M > 12.5 mg/L, MA > 19 mg/L, TRU >2 mg/L, and IgU >8 mg/ L. Those patients with any of the above abnormal indicators were included in the early renal function injury group, and the others were assigned to the normal control group. We chose 2 genotypes (CYP2C8*3 and CYP3A5*3) appearing to be predictive of risk of early renal impairment to evaluate their diagnostic efficiency for early renal injury. For CYP2C8*3, the positive predictive value is 68.5% and negative predictive value is 70.2%. For CYP3A5*3, the positive predictive value is 55.3% and negative predictive value is 60.4%. DISCUSSION

The earlier diagnosis of renal injury in liver transplant recipients could contribute to timely intervention and avoidance of CNI-induced nephrotoxicity. The renal biopsy is the criterion standard in the diagnosis of the CNI-induced nephrotoxicity; however, the renal biopsy in liver transplant recipients was difficult to obtain and was performed only when clinically indicated, especially in recipients with increasing SCr (an indication of progressive deterioration in renal function) [8,9]. There are still some classical indicators monitoring post-transplant renal injury, like SCr and BUN. Reliance on SCr typically leads to an overestimation of

renal function in recipients after transplant, particularly in those with poor nutritional status, low muscle mass, weight loss, and edema [10]. Elevation of SCr cannot provide the exact location of renal impairment. Early renal injury may be masked in these cases if SCr is used as the renal function marker. Our study adopted urine microprotein and Cys-C as the early indicators for renal injury. Cys-C has been one of the most sensitive indicators along with glomerular filtration rate, of which the escalating level in serum indicates the early stage of abnormal renal function. Abnormal urine microprotein appears in the early stage of renal impairment. In addition, the level can reflect the exact location of renal injury. The appearance of a1M indicates the tubulointerstitial injury of kidney, whereas the existence of MA, TRU, and IgU indicates the glomerular injury of kidney. As far as we know, this is the first time the relationship between CYP3A5, CYP2C8, and ABCB1 polymorphisms and early renal injury after liver transplant has been studied. The levels of Cys-C as well as all 4 indicators of urine microprotein in the recipient group were significantly higher than those in the control group (P < .05). The results suggested that early renal injury was present in the glomerulus and renal tubule. Tac-induced nephrotoxicity is likely to be related to intrarenal concentrations of Tac, which may not be properly reflected by whole-blood Tac concentrations [11e14]. CYP3A5 is the only CYP3A isozyme expressed in the kidney and may limit local exposure to CNIs by intrarenal

Table 6. Effects of CYP2C8 Polymorphisms on Renal Function and Microproteinuria in Liver Transplant Recipients CYP2C8 *3*3/*1*3

*1*1

12

124

N

a1M, median (IQR), mg/L* IgU, median (IQR), mg/L MA, median (IQR), mg/L TRU, median (IQR), mg/L Cys-C, median (IQR), mg/L* Crea, mean (SD), umol/L BUN, mean (SD), mmol/L

33.5 11.2 15.5 2 0.95 85.5 7.23

(19.4e72.5) (7.43e19.3) (9.36e40.5) (2e4.45) (0.83e1.25) (13.5) (1.95)

16.5 9.25 11.3 2 0.80 80.7 7.09

(11.8e45.8) (6.22e16.5) (7.25e32.5) (2e5.22) (0.66e0.99) (12.5) (1.65)

P Value

.03 .10 .13 .25 .02 .35 .68

Abbreviations: a1M, alpha 1 microglobulin; BUN, blood urea nitrogen; Crea, creatinine; Cys-C, cystatin C; IgU, urinary immunoglobulin G; IQR, interquartile range; MA, microalbumin; TRU, urinary transferrin. *P < .05.

CYP3A5, CYP2C8, AND ABCB1 POLYMORPHISMS

Fig 2. Levels of a1M (alpha 1 microglobulin) in diverse CYP2C8 genotype groups.

metabolism [15,16]. Studies on the relationship between CYP3A5 genotype and the risk of Tac-induced nephrotoxicity have reported contradictory results. Fukudo et al [17] studied 60 adult liver transplant recipients who received Tac-based immunosuppression. They observed recipients who had homozygote for CYP3A5*3 had a significantly higher risk of developing nephrotoxicity compared with CYP3A5*1 allele carriers: 46% vs 17%; hazard ratio 3.16 (1.01e6.16). Chen et al also found a higher incidence of nephrotoxicity in CYP3A5 nonexpressers (CYP3A5*3/*3 variants) at 1 month post-transplant in 67 Chinese kidney recipients [18]. In contrast to the previous 2 studies, Kuypers et al found that CYP3A5 expressers have an increased risk for biopsy-proven Tac-induced nephrotoxicity [19,20]. These counterintuitive findings may be explained by the fact that it is not Tac itself but its metabolites that are responsible for its nephrotoxicity. These metabolites might

Fig 3. Levels of Cys-C (cystatin C) in diverse CYP2C8 genotype groups.

3263

be formed at an increased rate in the renal parenchyma of CYP3A5 expressers. However, there is at present little evidence to support this hypothesis. In our study, we found that the relatively common mutation CYP3A5*3 in the CYP3A5 gene encoding lower CYP3A5 was associated with higher TRU and the risk of early renal glomerular injury. Specifically, recipients with a wild type of CYP3A5*1/*1 genotype were more likely to have better renal function compared with those with either a CYP3A5*1/*3 or CYP3A5*3/*3 genotype. Our results were consistent with the studies by Fukudo and Chen. There are many reasons for these discrepancies, including differences in ethnicity, sample size, and definition of nephrotoxicity. ABCB1 is expressed in the apical membrane of renal tubular epithelial cells, where it may facilitate excretion of CNIs (and their metabolites) in urine and thus protect the kidney against intrarenal CNI accumulation. In addition to physiological and environmental factors, its expression and function are modified by genetic polymorphisms of the ABCB1 gene [21]. Studies on the relationship between ABCB1 genotype and the risk of Tac-induced nephrotoxicity are more consistent compared with those on CYP3A5. Several studies have addressed the relevance of a causal relationship among renal P-glycoprotein expression and function, intrarenal CNI accumulation, and CNI-induced nephrotoxicity [22e25]. All these studies suggest that ABCB1 activity within renal cells is important to prevent local drug accumulation and can protect the donor kidney against Tac-related toxicity. In our study, we did not find any significant difference of urine microprotein in diverse ABCB1 genotypes (both C3435C>T and C1236C>T). This result implied that ABCB1 genotypes (both C3435 C>T and C1236 C>T) are not associated with early renal injury in liver transplant recipients. CYP2C8 is an important member of the P450 superfamily that is expressed in the kidney and is involved in the metabolism of arachidonic acid to biologically active epoxyeicosatrienoic acids (EETs) [26,27]. EETs have several significant physiological roles that help maintain blood pressure homeostasis, including tubular reabsorption of water and Naþ transport, protection against inflammation, and maintenance of vascular smooth muscle tone [28e32]. The CYP2C8 polymorphism is associated with chronic kidney disease, especially CNI-associated nephrotoxicity. Smith et al [33] found the positive association between inheritance of the CYP2C8*3 allele and the risk of developing CNI-induced kidney disease post liver transplant. Our data showed that the mutation CYP2C8*3 in the CYP2C8 gene encoding lower CYP2C8 was associated with higher a1M and Cys-C levels. Li et al [34] suggested that urinary b2m and a1M were sensitive urinary markers for detecting CNI-related nephrotoxicity in liver transplant recipients, which indicated that tubular epithelial dysfunction defined by elevation of tubular injury biomarkers (b2m or a1M) was very common when CNI exposure continued. This signifies that, in patients with good kidney function at the time of transplant, expressing the CYP2C8*3 allele is a major risk

3264

factor for developing kidney disease. Smith et al [33] found that the use of Tac may cause a greater risk for developing CNI-induced kidney disease than cyclosporine A in subjects carrying the CYP2C8*3 allele because the present in vitro studies show that Tac is a more potent inhibitor of CYP2C8 than cyclosporine A. Our data suggest that carrying 1 or more CY2C8*3 variants confers an increased risk for the development of early renal injury in recipients receiving Tac therapy, especially the tubulointerstitial injury of the kidney. The reason was that decreased production of EETs in patients with the variant CYP2C8*3 allele may reduce the capacity of the kidney to counter the vasoconstrictive effects of CNIs and lead to chronic CNI-induced nephrotoxicity. CONCLUSION

CYP2C8*3 and CYP3A5*3 appear to be predictive of risk of early renal impairment. CYP3A5*3 was associated with the risk of early renal glomerular injury, while CYP2C8*3 was associated with the risk of the tubulointerstitial injury. ABCB1 polymorphisms (both C3435T and C1236T) were not associated with the chronic CNI-induced nephrotoxicity in liver transplant recipients. This appears to be the first study investigating the association of CYP3A5, CYP2C8, and ABCB1 polymorphisms with early renal injury in liver transplant recipients. The findings presented in this manuscript appear to have significant clinical relevance in transplant recipients receiving Tac-based immunosuppression. The ultimate goal is to discover renal impairment after liver transplant much earlier and to identify potential pathways for therapeutic interventions so that we can prevent or minimize the development of Tac-induced kidney disease and thereby improve the survival rate of liver transplant recipients. REFERENCES [1] Chandrakantan A, de Mattos AM, Naftel D, Crosswy A, Kirklin J, Curtis JJ. Increasing referral for renal transplant evaluation in recipients of nonrenal solid-organ transplants: a singlecenter experience. Clin J Am Soc Nephrol 2006;1:832e6. [2] Venkataramanan R, Swaminathan A, Prasad T, Jain A, Zuckerman S, Warty V, et al. Clinical pharmacokinetics of tacrolimus. Clin Pharmacokinet 1995;29:404e30. [3] Hesselink DA, Bouamar R, van Gelder T. The pharmacogenetics of calcineurin inhibitor-related nephrotoxicity. Ther Drug Monit 2010;32:387e93. [4] Staatz CE, Goodman LK, Tett SE. Effect of CYP3A and ABCB1 single nucleotide polymorphisms on the pharmacokinetics and pharmacodynamics of calcineurin inhibitors: part II. Clin Pharmacokinet 2010;49:207e21. [5] Malinowski M, Pratschke J, Lock J, Neuhaus P, Stockmann M. Effect of tacrolimus dosing on glucose metabolism in an experimental rat model. Ann Transplant 2010;15:60e5. [6] Lewandowska L, Matuszkiewicz-Rowinska J. Acute kidney injury after procedures of orthotopic liver transplantation. Ann Transplant 2011;16:103e8. [7] Velidedeoglu E, Bloom RD, Crawford MD, Desai NM, Campos L, Abt PL, et al. Early kidney dysfunction post liver transplantation predicts late chronic kidney disease. Transplantation 2004;77:553e6.

DENG, LIAO, LI ET AL [8] D’Amico G, Bazzi C. Urinary protein and enzyme excretion as markers of tubular damage. Curr Opin Nephrol Hypertens 2003;12:639e43. [9] Franchini I, Alinovi R, Bergamaschi E, Mutti A. Contribution of studies on renal effects of heavy metals and selected organic compounds to our understanding of the progression of chronic nephropathies towards renal failure. Acta Biomed 2005;76(Suppl. 2):58e67. [10] Schaub S, Mayr M, Honger G, Bestland J, Steiger J, Regeniter A, et al. Detection of subclinical tubular injury after renal transplantation: comparison of urine protein analysis with allograft histopathology. Transplantation 2007;84:104e12. [11] Naesens M, Kuypers DR, Sarwal M. Calcineurin inhibitor nephrotoxicity. Clin J Am Soc Nephrol 2009;4:481e508. [12] van Gelder T, Balk AH, Zietse R, et al. Renal insufficiency after heart transplantation: a case-control study. Nephrol Dial Transplant 1998;13:2322e6. [13] Noll BD, Coller JK, Somogyi AA, et al. Measurement of cyclosporine A in rat tissues and human kidney transplant biopsiesea method suitable for small (<1 mg) samples. Ther Drug Monit 2011;33:688e93. [14] Noll BD, Coller JK, Somogyi AA, et al. Validation of an LC-MS/MS method to measure tacrolimus in rat kidney and liver tissue and its application to human kidney biopsies. Ther Drug Monit 2013;35:617e23. [15] Murray GI, McFadyen MC, Mitchell RT, et al. Cytochrome P450 CYP3A in human renal cell cancer. Br J Cancer 1999;79: 1836e42. [16] Koch I, Weil R, Wolbold R, et al. Interindividual variability and tissue-specificity in the expression of cytochrome P450 3A mRNA. Drug Metab Dispos 2002;30:1108e14. [17] Fukudo M, Yano I, Yoshimura A, Masuda S, Uesugi M, Hosohata K, et al. Impact of MDR1 and CYP3A5 on the oral clearance of tacrolimus and tacrolimus-related renal dysfunction in adult living-donor liver transplant patients. Pharmacogenet Genomics 2008;18:413e23. [18] Chen JS, Li LS, Cheng DR, et al. Effect of CYP3A5 genotype on renal allograft recipients treated with tacrolimus. Transplant Proc 2009;41:1557e61. [19] Kuypers DR, de Jonge H, Naesens M, et al. CYP3A5 and CYP3A4 but not MDR1 single-nucleotide polymorphisms determine long-term tacrolimus disposition and drug-related nephrotoxicity in renal recipients. Clin Pharmacol Ther 2007;82:711e25. [20] Kuypers DR, Naesens M, de Jonge H, et al. Tacrolimus dose require-ments and CYP3A5 genotype and the development of calcineurin inhibitor-associated nephrotoxicity in renal allograft recipients. Ther Drug Monit 2010;32:394e404. [21] Eichelbaum M, Fromm MF, Schwab M. Clinical aspects of the MDR1 (ABCB1) gene polymorphism. Ther Drug Monit 2004;26:180e5. [22] Hauser IA, Schaeffeler E, Gauer S, Scheuermann EH, Wegner B, Gossmann J, et al. ABCB1 genotype of the donor but not of the recipient is a major risk factor for cyclosporine-related nephrotoxicity after renal transplantation. J Am Soc Nephrol 2005;16:1501e11. [23] Hebert MF, Dowling AL, Gierwatowski C, Lin YS, Edwards KL, Davis CL, et al. Association between ABCB1 (multidrug resistance transporter) genotype and post-liver transplantation renal dysfunction in patients receiving calcineurin inhibitors. Pharmacogenetics 2003;13:661e74. [24] Naesens M, Lerut E, de Jonge H, et al. Donor age and renal P-glycoprotein expression associate with chronic histological damage in renal allografts. J Am Soc Nephrol 2009;20:2468e80. [25] Ma J, Divers J, Palmer ND, et al. Deceased donor multidrug resistance protein 1 and caveolin 1 gene variants may influence allograft survival in kidney transplantation. Kidney Int 2015;88: 584e92. [26] Spiecker M, Darius H, Hankeln T, Soufi M, Sattler AM, Schaefer JR, et al. Risk of coronary artery disease associated with

CYP3A5, CYP2C8, AND ABCB1 POLYMORPHISMS polymorphism of the cytochrome P450 epoxygenase CYP2J2. Circulation 2004;110:2132e6. [27] Zeldin DC, Moomaw CR, Jesse N, Tomer KB, Beetham J, Hammock BD, et al. Biochemical characterization of the human liver cytochrome P450 arachidonic acid epoxygenase pathway. Arch Biochem Biophys 1996;330:87e96. [28] Imig JD. Eicosanoid regulation of the renal vasculature. Am J Physiol Renal Physiol 2000;279:F965e81. [29] Mallat Z, Nakamura T, Ohan J, Leseche G, Tedgui A, Maclouf J, et al. The relationship of hydroxyeicosatetraenoic acids and F2-isoprostanes to plaque instability in human carotid atherosclerosis. J Clin Invest 1999;103:421e7. [30] Node K, Huo Y, Ruan X, Yang B, Spiecker M, Ley K, et al. Anti-inflammatory properties of cytochrome P450 epoxygenasederived eicosanoids. Science (New York, NY) 1999;285:1276e9.

3265 [31] Rifkind AB, Lee C, Chang TK, Waxman DJ. Arachidonic acid metabolism by human cytochrome P450S 2C8, 2C9, 2E1, and 1A2: regioselective oxygenation and evidence for a role for CYP2C enzymes in arachidonic acid epoxygenation in human liver microsomes. Arch Biochem Biophys 1995;320:380e9. [32] Roman RJ. P-450 metabolites of arachidonic acid in the control of cardiovascular function. Physiol Rev 2002;82:131e85. [33] Smith HE, Jones 3rd JP, Kalhorn TF, Farin FM, Stapleton PL, Davis CL, et al. Role of cytochrome P450 2C8 and 2J2 genotypes in calcineurin inhibitor-induced chronic kidney disease. Pharmacogenet Genomics 2008;18:943e53. [34] Li J, Liu B, Yan LN, Wang LL, Lau WY, Li B, et al. Microproteinuria for detecting calcineurin inhibitor-related nephrotoxicity after liver transplantation. World J Gastroenterol 2009;15:2913e7.