Association of Nuclear YB-1 Localization With Lung Resistance-related Protein and Epidermal Growth Factor Receptor Expression in Lung Cancer

Original Study

Association of Nuclear YB-1 Localization With Lung Resistance-related Protein and Epidermal Growth Factor Receptor Expression in Lung Cancer Akira Hyogotani,1 Ken-ichi Ito,1 Kazuo Yoshida,1 Hiroto Izumi,2 Kimitoshi Kohno,2 Jun Amano1 Abstract Nuclear Y-box binding protein 1 (YB-1) expression significantly correlated with positive lung resistance– related protein (LRP) and epidermal growth factor receptor (EGFR) expression. Tumors positive for nuclear YB-1 and LRP had a significantly worse prognosis, and those positive for nuclear YB-1 and EGFR had a significantly worse prognosis as well. Downregulation of YB-1 with small interfering RNA demonstrated an association of these factors in vitro. Thus, YB-1, LRP, and EGFR expression are of prognostic significance in non–small-cell lung cancer. Background: Y-box binding protein 1 (YB-1) is an oncogenic transcription factor that is activated in response to various genotoxic stresses. The purpose of this study was to elucidate whether YB-1 correlates with the expression of lung resistance–related protein (LRP) and epidermal growth factor receptor (EGFR) in primary lung cancer. Patients and Methods: One hundred and five non–small-cell lung cancer (NSCLC) specimens were analyzed by immunohistochemistry. Knockdown of YB-1 messenger RNA by small interfering RNA(siRNA) was tested for the lung cancer cell lines A549 and Calu-3. Results: Nuclear YB-1 expression significantly correlated with positive LRP and EGFR expression (P ⬍ .001). Nuclear YB-1 expression and positive LRP and EGFR expression were independent adverse prognostic factors in patients with NSCLC. Furthermore, patients with tumors positive for nuclear YB-1 and LRP had a significantly worse prognosis than those negative for nuclear YB-1 and LRP (P ⬍ .001). In addition, patients with tumors positive for nuclear YB-1 and EGFR had a significantly worse prognosis than those negative for nuclear YB-1 and EGFR (P ⬍ .001). In in vitro analyses that use the NSCLC cell lines A549 and Calu-3, the downregulation of YB-1 with siRNAs drastically decreased the expression of EGFR. However, downregulation of YB-1 remarkably decreased the expression of LRP in A549 cells; however, a slight decrease in LRP was induced by the downregulation of YB-1 in Calu-3 cells. Conclusion: Our data demonstrate that nuclear YB-1 localization is associated with LRP and EGFR expression in NSCLC, and nuclear YB-1 localization and LRP and EGFR expression are of prognostic significance in NSCLC. Clinical Lung Cancer, Vol. 13, No. 5, 375-84 © 2012 Elsevier Inc. All rights reserved. Keywords: Epidermal growth factor receptor, Lung cancer, Lung resistance–related protein, prognosis, Y-box binding protein 1

Introduction The Y-box binding protein 1 (YB-1) has been identified as a transcription factor that binds to an inverted CCAAT box named Y-box

sequence DNA in the eukaryotic promoter.1 YB-1 plays a critical role in cell proliferation and growth, DNA replication, the cell cycle, and drug resistance. It is an oncogenic transcription factor that is activated in response to various genotoxic stresses. YB-1 is normally

1

Department of Surgery (II), Shinshu University School of Medicine, Matsumoto, Japan Department of Molecular Biology, University of Occupational and Environmental Health, Yahatanishi-ku, Kitakyushu, Japan 2

Submitted: Sep 11, 2011; Revised: Nov 12, 2011; Accepted: Nov 22, 2011; Epub: Jan 25, 2012

1525-7304/$ - see frontmatter © 2012 Elsevier Inc. All rights reserved. doi: 10.1016/j.cllc.2011.11.006

Address for correspondence: Ken-ichi Ito, MD, Department of Surgery (II), Shinshu University School of Medicine, 3-1-1 Asahi, Matsumoto 390-8621, Japan Fax: ⫹81-263-37-2721; e-mail contact: [email protected]

Clinical Lung Cancer September 2012

375

YB-1, LRP, and EGFR Expression in Lung Cancer present in the cytoplasm, although it is translocated into the nucleus when cells are exposed to stresses such as anticancer agents, UV light irradiation, and so on.2-9 YB-1 has been reported to be a negative prognostic factor for several cancers, such as breast, ovarian, and lung cancers and synovial sarcoma.10-13 In addition, YB-1 regulates the expression of several tumor-associated genes, including those of epidermal growth factor receptor (EGFR), matrix metalloproteinase-2, fas, topoisomerase II-␣, and major histocompatibility complex class II.5,14-16 Moreover, YB-1 is associated with drug resistance by regulating the activity of the MDR1, MRP1, and LRP genes.7,17,18 Thus, increasing evidence has indicated the importance of YB-1 in tumor biology. Lung resistance–related protein (LRP) was observed to be overexpressed in a lung cancer cell line selected for resistance to doxorubicin.19 LRP has been identified as the major vault protein (MVP)20; vaults are subcellular particles that have been implicated in transmembrane transport processes. It was postulated that LRP contributed to drug resistance by the sequestration of drugs and transporting drugs away from their intracellular targets.20 LRP has been reported to be a negative prognostic factor for breast and ovarian cancers.21-24 However, it is uncertain whether LRP expression is associated with the prognosis of lung cancer. Interestingly, Stein et al18 reported that transduction of YB-1 complementary DNA led to increased expression of the endogenous LRP/MVP protein in colon cancer, which suggests that LRP expression may correlate with nuclear YB-1 expression in other human malignancies.18 EGFR is a 170-kDa membrane glycoprotein that consists of an extracellular ligand-binding domain, a transmembrane lipophilic part, and an intracellular domain with tyrosine kinase activity.25 EGFR is activated by the binding of specific ligands, such as the epidermal growth factor, and it alters protein expression, which results in the enhancement of tumor cell proliferation and suppression of apoptosis, angiogenesis, and invasion.26 It was overexpressed in cell lines and the clinical specimens of non–small-cell lung cancer (NSCLC). Overexpression of EGFR has been reported to be a negative prognostic factor in NSCLC.27,28 Disruption of YB-1 has been shown to result in the suppression of EGFR expression in breast cancer,29 but there has been no full examination of whether there is a correlation between the expression of YB-1 and that of EGFR in clinical lung cancer. In this study, to elucidate whether YB-1 correlates with the expression of LRP and EGFR in primary lung cancer, we examined the expression of these factors in cell lines and clinical specimens of lung cancers. In addition, we examined whether nuclear YB-1 localization and LRP or EGFR expression were associated with the prognosis of patients with lung cancer.

Materials and Methods Cell Lines Cells of the human adenocarcinoma lines A549 cells and Calu-3 were cultured in Dulbecco’s modified Eagle medium that contained 10% fetal bovine serum. These cell lines were maintained in a 5% CO2 atmosphere at 37°C.

Patients and Tumor Samples Clinical specimens were obtained from 105 patients with primary NSCLC who underwent surgery at Shinshu University Hos-

376

Clinical Lung Cancer September 2012

Table 1 Characteristics of the Patients with Non-small-cell Lung Cancer (n ⴝ 105) Mean (Range) Age, Y

65.3 (29-85)

Sex, No. Patients (%) Men

61 (58.1)

Women

44 (41.9)

Smokers, No. Patients (%) Current or former

63 (60.0)

Never smokers

42 (40.0)

Histology, No. Patients (%) Adenocarcinoma

72 (68.6)

Squamous cell carcinoma

27 (25.7)

Large-cell carcinoma

6 (5.7)

Pathologic Stage, No. Patients (%) IA

52 (49.5)

IB

17 (16.2)

IIA

2 (1.9)

IIB

7 (6.7)

IIIA

7 (6.7)

IIIB

16 (15.2)

IV

4 (3.8)

pital between 2000 and 2001. Informed written consent was obtained from all of the patients included in the study. This study was conducted according to the ethical guidelines of the Declaration of Helsinki, and specific approval was obtained from the Ethics Committee of the Shinshu University School of Medicine. Histologic classification was performed according to the World Health Organization Classification of Tumors. The characteristics of patients are presented in Table 1. The mean age of the patients was 65.3 years (range, 29-85 years). Sixty-one patients were men, and 44 were women. On histologic examination, 72 tumors were adenocarcinomas, 27 were squamous cell carcinomas, and 6 were large-cell carcinomas. Sixty-nine (65.7%) cases were stage I (A, 52; B, 17), 9 (8.6%) were stage II (A, 2; B, 7), 23 (21.9%) were stage III (A, 7; B, 16), and 4 were stage IV. The 5-year survival rate for all patients was 69.7%. None of the patients had received preoperative chemotherapy or radiotherapy. Oral administration of UFT was performed in 1 patient with stage IIB disease as adjuvant chemotherapy. The clinical outcome was evaluated as overall survival. The treatment strategy for each relapsed patient was decided individually according to the state of relapse. Relapsed patients were treated mainly with combination chemotherapy; either cisplatin and docetaxel or carboplatin and paclitaxel were used. Three patients were treated with gefitinib.

Antibodies and Immunohistochemical Analysis Nuclear YB-1, LRP, and EGFR expression were analyzed by immunohistochemistry. The primary antibodies used were the antihuman YB-1 antibody,11,12,16 mouse monoclonal antibody LRP-56 (Nichirei, Tokyo, Japan), and anti-EGFR Ab-1 (Onco-

Akira Hyogotani et al gene Sciences, MA). The dilution of anti-YB-1 was 1:1000 and that of LRP-56 and anti-EGFR was 1:40 in phosphate-buffered saline solution plus 0.1% bovine serum albumin. An antigen retrieval procedure was performed by using 0.01 mol/L EDTA at 100°C in a microwave oven for 10 minutes for YB-1 and by using 0.1% pepsin solution at 37°C for 20 minutes for EGFR. Sections were exposed to the primary antibodies at 4°C overnight. Nuclear expression of YB-1 was calculated from the mean values of the 3 microscopic fields selected from the greatest accumulation of positive signals (hot spots), as described previously.30 A sample with a value of 0%-10% was classified as negative, and a sample with a value of more than 10% was classified as positive. LRP and EGFR expression was evaluated as the ratio of positive cells in 5 microscopic fields, and the mean values of 5 fields were classified. Expression of LRP was classified as follows: 0%-25% negative; more than 25%, positive.31 With regard to EGFR, the cell membrane staining was considered as positive, and the expression levels were classified as follows: 0%-10%, negative or normal expression; and ⬎10%, overexpression.28

YB-1 Knockdown Two kinds of double-stranded YB-1 RNA oligonucleotide were purchased from Stealth Select RNAi interference (UUUGCUGGUAAUUGCGUGGAGGACC and UACUGUGGUCGACGCCCAUAGGGUC) (Invitrogen, CA). Small interfering RNA (siRNA) duplexes were transfected by using Lipofectamine RNA interference MAX and Opti-MEM medium according to the manufacturer’s instructions (Invitrogen). Knockdown of YB-1 messenger RNA was tested for the lung cancer cell lines A549 and Calu-3. Seventy-two hours after siRNA transfection, whole-cell extracts were prepared from the cells, and Western blot analyses were performed. Lysates were subjected to sodium dodecyl sulfate-poly-acrylamide gel electrophoresis and transferred onto a membrane, and the membrane was incubated with primary antibodies at 4°C overnight. The antihuman YB-1 antibody, mouse monoclonal antibody LRP/MVP Ab-2 (Thermo Fisher Scientific, MA), and rabbit monoclonal antibody anti-EGFR C74B9 (Cell Signaling, USA) were used in Western blotting for primary antibodies. The dilutions of anti-YB-1, antiLRP, and anti-EGFR were 1:5000, 1:1000, and 1:2000, respectively, in the blocking solution. Signal intensities on Western blots were analyzed densitometrically by using the Quantity One software (version 4.6.7; CA).

Statistical Analysis Associations between the expression of proteins and clinicopathologic findings were tested with the ␹2 test or the Mann-Whitney U test, depending on the type of data. Overall survival was estimated by the Kaplan-Meier method, and statistical comparisons were performed with the generalized Wilcoxon test. The level of statistical significance was set at P ⬍ .05.

Results Expression of YB-1, LRP, and EGFR in Clinical Lung Cancers To examine whether the expression of YB-1 was associated with that of LRP or EGFR in clinical primary lung cancer, the expression of YB-1, LRP, and EGFR was analyzed by immunohisto-

chemistry. Nuclear staining was considered to be positive for YB-1, cytoplasmic staining was considered to be positive for LRP, and membrane staining was considered to be positive for EGFR. Representative immunohistochemical staining patterns are shown in Figure 1. Nuclear YB-1 expression was positive in 40 (38.1%) of 105 cases and negative in 65 (61.9%) cases (Figure 1A-D; Table 2). LRP expression was positive in 52 (49.5%) of 105 cases and negative in 53 (50.5%) cases (Figure 1EH). EGFR expression was positive in 38 cases (36.2%) and negative in 67 (63.8%) cases (Figure 1I-L).

Correlation Between Nuclear YB-1 Localization and LRP or EGFR Expression We investigated whether the nuclear localization of YB-1 was associated with LRP expression in lung cancer. In 29 cases, nuclear YB-1 expression and cytoplasmic LRP expression were positive. However, neither nuclear YB-1 expression nor cytoplasmic LRP expression was detected in 42 cases (Table 3). Thus, a significant positive correlation between nuclear YB-1 localization and LRP expression was observed in lung cancer (P ⬍ .001). We next examined whether the nuclear localization of YB-1 was associated with expression of EGFR in clinical specimens of lung cancers. In 27 cases, expression of YB-1 and EGFR was positive. In 54 cases, neither nuclear YB-1 expression nor EGFR expression was detected. Thus, a significant positive correlation between nuclear YB-1 localization and EGFR expression was observed (P ⬍ .001).

Association Between the Nuclear Expression of YB-1, LRP, or EGFR With Survival in Patients With Lung Cancer We analyzed whether the expression of nuclear YB-1, LRP, or EGFR was associated with survival time in patients with lung cancer (Figure 2). The 5-year survival rate was 85.6% in patients with negative nuclear YB-1 expression and 47.1% in those with positive nuclear YB-1 expression. The overall survival of patients with nuclear YB-1 expression was significantly worse than that of patients without nuclear YB-1 expression (P ⬍ .001) (Figure 2A). The 5-year survival rate was 80.5% for patients with LRP-negative tumors and 60.6% for those with LRP-positive tumors. The overall survival of the LRP-positive group was significantly worse than that of the LRPnegative group (P ⬍ .05) (Figure 2B). The 5-year survival rate was 79.8% for patients with EGFR-negative tumors and 55.3% for those with EGFR-positive tumors. The overall survival of the EGFR-positive group was significantly worse than that of the EGFR-negative group (P ⬍ .05) (Figure 2C). Thus, nuclear YB-1 expression, positive LRP expression, and EGFR overexpression were independent adverse prognostic factors for patients with NSCLC in the present study.

Effect of the Nuclear Expression of YB-1 and LRP on Survival in Patients With Lung Cancer Because lung cancers positive either for the nuclear expression of YB-1 or for that of LRP showed a worse prognosis and a significant correlation was observed between the expression of nuclear YB-1 and LRP in clinical lung cancer specimens, we analyzed whether the expression status of both YB-1 and LRP in the tumor was associated with the prognosis of patients with lung cancer (Figure 2D). Patients with tumors positive for nuclear YB-1 and LRP showed a significantly worse prognosis than those with tumors negative for nuclear

Clinical Lung Cancer September 2012

377

YB-1, LRP, and EGFR Expression in Lung Cancer Figure 1 Immunohistochemical Analyses in Non–small-lung Cell Cancers

YB-1 positive

YB-1 negative

A

C

B

D

50µm

50µm

LRP positive

LRP negative

E

G

F

H

50µm

50µm

(A-D) Y-box binding protein 1 (YB-1); (A) and (B) show positive nuclear expression of YB-1; (C) and (D) show negative nuclear expression of YB-1; (A) and (C) original magnification ⫻40; (B) and (D) original magnification ⫻400. (E-H) Lung resistance–related protein (LRP); (E) and (F) show positive expression of LRP; (G) and (H) show negative expression of LRP; (E) and (G) original magnification ⫻40; (F) and (H) original magnification ⫻400. (I-L) Epidermal growth factor receptor (EGFR); (I) and (J) show positive expression of EGFR; (K) and (L) show negative expression of EGFR; (I) and (K) original magnification ⫻40; (J) and (L) original magnification ⫻400.

378

Clinical Lung Cancer September 2012

Akira Hyogotani et al Figure 1 (continued)

EGFR positive

EGFR negative

I

K

J

L

50µm

Table 2 Expression of Nuclear YB-1, LRP, and EGFR (A) in NSCLCs (n ⴝ 105) Positive, n (%)

Negative, n (%)

Nuclear YB-1

40 (38.1)

65 (61.9)

LRP

52 (49.5)

53 (50.5)

EGFR

38 (36.2)

67 (63.8)

Abbreviations: EGFR ⫽ epidermal growth factor receptor; LRP ⫽ lung resistance–related protein; NSCLC ⫽ non–small-cell lung cancer; YB-1 ⫽ Y-box binding protein 1.

YB-1 and LRP (P ⬍ .001). No significant difference in prognosis was observed between patients with tumors expressing YB-1 or LRP in other combinations.

Effect of the Nuclear Expression of YB-1 and EGFR on Survival in Patients With Lung Cancer In the clinical lung cancers analyzed in our study, the cancers positive for either nuclear YB-1 expression or LRP expression showed a worse prognosis. Furthermore, because a significant correlation was observed between the expression of YB-1 and that of EGFR, we analyzed whether the expression of YB-1 and EGFR in the tumor was associated with the prognosis of patients with lung cancer (Figure 2E). The patients with tumors positive both for nuclear YB-1 and for EGFR showed a significantly worse prognosis than those with tumors negative for nuclear YB-1 and

50µm

Table 3 Correlation Between the Nuclear Expression of YB-1 and Expression of LRP and EGFR (B) in NSCLCs (n ⴝ 105) Nuclear YB-1 Expression

LRP

EGFR

Positive

Negative

Positive

29

23

Negative

11

42

Positive

27

11

Negative

13

54

P ⬍.001 ⬍.001

Abbreviations: EGFR ⫽ epidermal growth factor receptor; LRP ⫽ lung resistance–related protein; NSCLC ⫽ non–small-cell lung cancer; YB-1 ⫽ Y-box binding protein 1.

EGFR (P ⬍ .001). No significant difference in prognosis was observed between patients with tumors expressing YB-1 or EGFR in other combinations.

Clinicopathologic Features and Expression of YB-1, LRP, and EGFR No significant difference was observed in the expression of YB-1, LRP, or EGFR with regard to age or sex (Table 4). The incidence of positive nuclear YB-1 expression or increased EGFR expression was higher in squamous cell carcinomas compared with adenocarcinomas (P ⬍ .001). Nuclear YB-1 expression and increased EGFR expression were more frequent in moderately

Clinical Lung Cancer September 2012

379

YB-1, LRP, and EGFR Expression in Lung Cancer Figure 2 Overall Survival of Patients With NSCLC According to Immunohistochemical Staining for the Expression of Nuclear YB-1 (A), Lung Resistance–related Protein (LRP) (B), EGFR (C), Nuclear YB-1/LRP (D), and Nuclear YB-1/EGFR (E) in 105 Patients With NSCLC

A %

B %

100 80

100

80 **

60

80

*

60

40 YB1+ YB1-

p < 0.001

0

1

2

3 years

4

5

40

20 6

0

LRP+ LRP-

p = 0.032

20 0

0

1

2

3 years

4

5

6

EGFR+ EGFR-

p = 0.019

0

1

2

3 years

4

5

6

E %

D % 100

100 80

80

**

**

60

20 0

1

2

60 Y+E+ Y+EY-E+ Y-E-

40

Y+L+ Y+LY-L+ Y-L-

40

0

*

60

40

20 0

C %

100

20

*p < 0.001

3 years

4

5

6

0

0

1

2

*p < 0.001

3 years

4

5

6

E⫹ ⫽ positive EGFR expression; E⫺ ⫽ negative EGFR expression; EGFR ⫽ epidermal growth factor receptor; L⫹ ⫽ positive LRP expression; L⫺ ⫽ negative LRP expression; NSCLC ⫽ non–small-cell lung cancer; Y⫹ ⫽ positive YB-1 nuclear expression; Y⫺ ⫽ negative nuclear YB-1 expression; YB-1 ⫽ Y-box binding protein 1.*P ⬍ .01, **P ⬍ .001.

and poorly differentiated tumors than in well-differentiated tumors. Furthermore, nuclear YB-1 and increased EGFR expression was more frequent in lung cancers of advanced stage. Thus, nuclear YB-1 and increased EGFR expression were associated with the progress of lung cancer. However, LRP expression was associated only with poor differentiation of lung cancer.

Effect of the Knockdown of YB-1 Expression on LRP and EGFR Expression in Lung Cancer Cell Lines We examined how YB-1 affected the expression of LRP and EGFR in the 2 EGFR-positive NSCLC cell lines, A549 and Calu-3. In both cell lines, YB-1, LRP, and EGFR were readily detected by Western blot analysis at the steady state. In the Western blot, we detected close double bands for YB-1 both in A549 and Calu-3 cells. When the cells were treated with YB-1 siRNAs, a remarkable decrease of the expression of the upper band and a slight decrease of the lower band have been observed in both cell lines (Figure 3). The downregulation of YB-1 with siRNAs drastically decreased the expression of EGFR both in A549 and Calu-3 cells. The data indicate a close correlation between YB-1 and EGFR in lung cancer cells. With regard to LRP, the downregulation of YB-1 remarkably decreased the expression of LRP in A549 cells. However, a slight decrease of LRP was induced by the downregulation of YB-1 in Calu-3 cells. These data suggest a linkage between YB-1 and LRP in lung cancer cells, however, the degree of linkage may depend on the cell lines.

380

Clinical Lung Cancer September 2012

Discussion Accumulating evidence indicates that YB-1 has indispensable roles in tumor biology. Previous studies have demonstrated that YB-1 regulates several tumor-associated genes as well as those associated with drug resistance in several cancers. However, it has not been clarified whether there is an association between YB-1 and LRP. In the present study, we demonstrated that the nuclear expression of YB-1 correlates with the expression of LRP and EGFR in clinical specimens of NSCLC, and NSCLC expressing nuclear YB-1 together with increased expression of either LRP or EGFR has a worse prognosis. Moreover, the downregulation of YB-1 with siRNA reduced the expression of EGFR and LRP in in vitro analyses. These results suggest that nuclear translocation of YB-1 induces the upregulation of LRP and EGFR expression, which leads to a more aggressive tumor phenotype in NSCLC. To our knowledge, this is the first report that demonstrates the association of YB-1 with LRP in lung cancer. Expression of LRP closely reflected the chemoresistance profile of many tumor cell lines and untreated cancers.19,22,32-36 Elevated LRP levels were observed in cell lines resistant to various classes of cytotoxic agents, including doxorubicin, mitoxantrone, methotrexate, etoposide, vincristine, cytarabine, and cisplatin.19,26,37-41 In NSCLC cell lines, the LRP expression levels determined by protein and messenger RNA analyses correlated with resistance to cisplatin, but the precise cellular role of vaults is currently unclear. Berger et al42 demonstrated that LRP is differ-

Akira Hyogotani et al Table 4 Clinicopathologic Features and Expression of YB-1 and LRP in NSCLCs (n ⴝ 105) Nuclear YB-1 Expression Positive

Negative

Age

LRP

P Value Positive

EGFR

P Value Negative

Positive

P Value

Negative

⬍.001

.200

.252

ⱖ68 y

23

29

24

28

16

36

⬍68 y

17

36

28

25

22

31

Men

28

33

29

32

23

38

Women

12

32

23

21

15

29

Sex

.052

.632

⬍.001

Histology

.704

.176

.373

Adenocarcinoma

19

53

33

39

25

47

Squamous cell carcinoma

17

10

17

10

12

15

Large-cell carcinoma

4

2

2

4

1

5

⬍.001

Pathologic Stage

.186

.001

IA

10

42

22

30

10

42

IB

10

7

10

7

7

10

IIA

1

1

1

1

1

1

IIB

4

3

3

4

4

3

IIIA

5

2

4

3

5

2

IIIB

8

8

11

5

11

5

IV

2

2

1

3

0

4

⬍.001

Differentiation of Cancer

.059

.004

Well

6

40

18

28

9

37

Moderately

22

21

24

19

21

22

Moderate-poorly

1

0

1

0

1

0

Poorly

11

4

9

6

7

8

Abbreviations: EGFR ⫽ epidermal growth factor receptor; LRP ⫽ lung resistance–related protein; NSCLC ⫽ non–small-cell lung cancer; YB-1 ⫽ Y-box binding protein 1.

ently expressed in NSCLC cell lines and correlates with resistance to cisplatin but not to several other drugs. Although Harada et al43 reported that LRP was a predictive marker for the treatment of NSCLC, another study failed to detect any association between YB-1 expression and treatment response.44 Thus, despite LRP being detected in lung cancer cells, the prognostic value of LRP expression in lung cancer remains controversial. In the present study, the patients with lung cancer positive for LRP expression showed a significantly poor prognosis, which indicates the prognostic value of LRP in lung cancer. However, the LRP promoter is known to contain an inverted CCAAT box, termed the Y-box, which is a recognition site for the transcription factor YB-1.45 Stein et al18 recently demonstrated specific interactions of YB-1 with the Y-box binding motif of the LRP promoter and enhanced binding of YB-1 in stably transfected clones in colon cancer. Furthermore, they showed that the transduction of YB-1 complementary DNA into a colon cancer cell line led to the increased expression of endogenous LRP protein and showed strong coexpression of LRP and YB-1 in human colon cancer specimens, which indicate that YB-1 is directly linked to LRP expression.18 In the present study, the downregu-

lation of YB-1 with siRNA reduced the expression of LRP in the NSCLC cell line A549, which indicates a regulatory function of YB-1 to the LRP expression in human lung cancer. However, downregulation of YB-1 produced only a small reduction in expression of LRP in another NSCLC cell line, Calu-3, which suggests that other factors must also contribute to the regulation of LRP expression in lung cancer. EGFR is a cell surface receptor tyrosine kinase that transduces growth signals through dimerization with HER (human epidermal growth factor receptor) family receptors. EGFR is highly expressed in a variety of malignant tumors, including NSCLC. Overexpression of EGFR has been observed in premalignant lesions and malignant tumors of the lung, and occurs in 40%-80% of patients with NSCLC.46,47 When tumor cells overexpress EGFR, the tumor demonstrates aggressive tumor cell growth that leads to a worse prognosis for the patient.48,49 Lung cancers with EGFR amplification had a significantly worse outcome than those without EGFR amplification.27,50 With regard to the correlation of YB-1 with EGFR, YB-1 was shown to bind directly to the promoter of EGFR and regulate the

Clinical Lung Cancer September 2012

381

YB-1, LRP, and EGFR Expression in Lung Cancer Figure 3 Effect of Y-Box Binding Protein 1 (YB-1) Knockdown on the Expression of Lung Resistance–Related Protein (LRP) and Epidermal Growth Factor Receptor (EGFR) in Non–Small-Cell Lung Cancer (NSCLC) Cell Lines

iR NA

co nt ro ls

siR NA #2

YB

-1

s iR NA # YB

-1

co nt ro ls

s iR NA # -1 YB

iR NA

2

1 s iR NA # -1 YB

Calu-3 1

A549

A

YB-1 LRP EGFR β-actin A549

1.2

1.2

control siRNA#1 siRNA#2

1 0.8 0.6 0.4 0.2 0

YB-1

Calu-3

C Relative expression level

Relative expression level

B

LRP

1 0.8 0.6 0.4 0.2 0

EGFR

control siRNA#1 siRNA#2

YB-1

LRP

EGFR

A549 and Calu-3 cells were treated with 2 YB-1 small interfering RNAs (siRNA) for 72 h, and whole-cell lysates were prepared as described in the Materials and Methods section. (A) Western blot analysis of YB-1, LRP, and EGFR. (B, C) Relative protein expression levels of YB-1, LRP, and EGFR in A549 and Calu-3 cells treated with YB-1 siRNAs. Histograms represent relative protein expression levels in control siRNA-treated cells (gray bars) and 2 siRNA-treated cells (dotted bars and hatched bars). Data are representative of 3 independent experiments.

expression of EGFR.29 In the experiments with siRNA, Fujii et al51 demonstrate that knockdown of YB-1 significantly reduced the expression of EGFR and HER2 in breast cancer cell lines. These data suggest that YB-1 may be involved in the regulation of the expression of EGFR family members. In lung cancer, Kashihara et al52 recently demonstrated that the downregulation of YB-1 reduced the expression of EGFR in the NSCLC cell line PC-9, but no reduction of EGFR expression was observed in 4 other lung cancer cell lines, including A549. In addition, no correlation was demonstrated between the nuclear expression of YB-1 and that of EGFR in the clinical specimens of lung cancer. In the present study, the downregulation of YB-1 with siRNA reduced EGFR expression in 2 NSCLC cell lines, A549 and Calu-3. Furthermore, a significantly positive correlation was demonstrated between nuclear YB-1 expression and EGFR in our series of clinical specimens of lung cancer. The discrepancy between these 2 studies by using clinical specimens might be due to differences in patient characteristics, such as ethnicity, sex, age, and history of smoking. Consequently, this is the first report that demonstrates a positive correlation between nuclear YB-1 expression and EGFR in lung cancer. Recently, Kashihara et al52 re-

382

Clinical Lung Cancer September 2012

ported that the therapeutic efficacy of gefitinib was associated with nuclear YB-1 expression in patients with NSCLC. Their study indicates that the effect of gefitinib may be associated with localization of YB-1 in the NSCLC, although further studies are required to examine whether mutation of EGFR may affect the nuclear translocation of YB-1 in lung cancer cells.

Conclusion Our data demonstrate that nuclear localization of YB-1 is associated with LRP and EGFR expression in NSCLC. Although further studies are required to clarify the functional relevance of these factors, our results, together with previous reports, indicate that YB-1 is closely associated with the expression of EGFR and LRP in lung cancer cells, and nuclear YB-1 localization, and LRP and EGFR expression may be of prognostic significance in NSCLC.

Clinical Practice Points ●

YB-1 is an oncogenic transcription factor that is activated in response to various genotoxic stresses. YB-1 has been reported to be a negative prognostic factor for several cancers, including

Akira Hyogotani et al

●

●

lung cancers. In addition, YB-1 regulates the expression of several tumor-associated genes, including EGFR. Moreover, YB-1 is associated with drug resistance by regulating the activity of the MDR1, MRP1, and LRP genes. In the clinical lung cancers, nuclear YB-1 localization is associated with LRP and EGFR expression in NSCLC, and nuclear YB-1 localization and LRP and EGFR expression are of prognostic significance in NSCLC. In in vitro analyses when using 2 NSCLC cell lines, the downregulation of YB-1 with siRNAs decreased the expression of EGFR and LRP, although the degree of linkage differed between the cell lines. Thus, our findings demonstrate, for the first time, that a correlation between YB-1 and EGFR and between YB-1 and LRP in lung cancer cells both in in vivo and in clinical samples. Analysis of our data suggests that YB-1 might have a prognostic importance in lung cancer. Because YB-1 might be associated with EGFR ad LRP, it might be possible to suppress the growth of lung cancer cells by inhibiting the function of YB-1, which suggests that YB-1 is a promising target molecule for cancer therapeutics.

Acknowledgments We thank Dr Tokiko Ito and Ms Shinobu Kmijo for their the excellent technical assistance.

Disclosure The authors have stated that they have no conflicts of interest.

References 1. Didier DK, Schiffenbauer J, Woulfe SL, et al. Characterization of the cDNA encoding a protein binding to the major histocompatibility complex class II Y box. Proc Natl Acad Sci U S A 1988; 85:7322-6. 2. Holm PS, Bergmann S, Jurchott K, et al. YB-1 relocates to the nucleus in adenovirus-infected cells and facilitates viral replication by inducing E2 gene expression through the E2 late promoter. J Biol Chem 2002; 277:10427-34. 3. Kohno K, Izumi H, Uchiumi T, et al. The pleiotropic functions of the Y-boxbinding protein, YB-1. Bioessays 2003; 25:691-8. 4. Kuwano M, Oda Y, Izumi H, et al. The role of nuclear Y-box binding protein 1 as a global marker in drug resistance. Mol Cancer Ther 2004; 3:1485-92. 5. Ohga T, Uchiumi T, Makino Y, et al. Direct involvement of the Y-box binding protein YB-1 in genotoxic stress-induced activation of the human multidrug resistance 1 gene. J Biol Chem 1998; 273:5997-6000. 6. Koike K, Uchiumi T, Ohga T, et al. Nuclear translocation of the Y-box binding protein by ultraviolet irradiation. FEBS Lett 1997; 417:390-4. 7. Ohga T, Koike K, Ono M, et al. Role of the human Y box-binding protein YB-1 in cellular sensitivity to the DNA-damaging agents cisplatin, mitomycin C, and ultraviolet light. Cancer Res 1996; 56:4224-8. 8. Asakuno K, Kohno K, Uchiumi T, et al. Involvement of a DNA binding protein, MDR-NF1/YB-1, in human MDR1 gene expression by actinomycin D. Biochem Biophys Res Commun 1994; 199:1428-35. 9. Ise T, Nagatani G, Imamura T, et al. Transcription factor Y-box binding protein 1 binds preferentially to cisplatin-modified DNA and interacts with proliferating cell nuclear antigen. Cancer Res 1999; 59:342-6. 10. Janz M, Harbeck N, Dettmar P, et al. Y-box factor YB-1 predicts drug resistance and patient outcome in breast cancer independent of clinically relevant tumor biologic factors HER2, uPA and PAI-1. Int J Cancer 2002; 97:278-82. 11. Kamura T, Yahata H, Amada S, et al. Is nuclear expression of Y box-binding protein-1 a new prognostic factor in ovarian serous adenocarcinoma? Cancer 1999; 85:2450-4. 12. Shibahara K, Sugio K, Osaki T, et al. Nuclear expression of the Y-box binding protein, YB-1, as a novel marker of disease progression in non-small cell lung cancer. Clin Cancer Res 2001; 7:3151-5. 13. Gessner C, Woischwill C, Schumacher A, et al. Nuclear YB-1 expression as a negative prognostic marker in nonsmall cell lung cancer. Eur Respir J 2004; 23:14-9. 14. Lasham A, Moloney S, Hale T, et al. The Y-box-binding protein, YB1, is a potential negative regulator of the p53 tumor suppressor. J Biol Chem 2003; 278:35516-23. 15. Lasham A, Lindridge E, Rudert F, et al. Regulation of the human fas promoter by YB-1, Puralpha and AP-1 transcription factors. Gene 2000; 252:1-13.

16. Shibao K, Takano H, Nakayama Y, et al. Enhanced coexpression of YB-1 and DNA topoisomerase II alpha genes in human colorectal carcinomas. Int J Cancer 1999; 83:732-7. 17. Bargou RC, Jurchott K, Wagener C, et al. Nuclear localization and increased levels of transcription factor YB-1 in primary human breast cancers are associated with intrinsic MDR1 gene expression. Nat Med 1997; 3:447-50. 18. Stein U, Bergmann S, Scheffer GL, et al. YB-1 facilitates basal and 5-fluorouracilinducible expression of the human major vault protein (MVP) gene. Oncogene 2005; 24:3606-18. 19. Scheper RJ, Broxterman HJ, Scheffer GL, et al. Overexpression of a M(r) 110,000 vesicular protein in non-P-glycoprotein-mediated multidrug resistance. Cancer Res 1993; 53:1475-9. 20. Scheffer GL, Wijngaard PL, Flens MJ, et al. The drug resistance-related protein LRP is the human major vault protein. Nat Med 1995; 1:578-82. 21. Mossink MH, van Zon A, Scheper RJ, et al. Vaults: a ribonucleoprotein particle involved in drug resistance? Oncogene 2003; 22:7458-67. 22. Izquierdo MA, van der Zee AG, Vermorken JB, et al. Drug resistance-associated marker Lrp for prediction of response to chemotherapy and prognoses in advanced ovarian carcinoma. J Natl Cancer Inst 1995; 87:1230-7. 23. Pohl G, Filipits M, Suchomel RW, et al. Expression of the lung resistance protein (LRP) in primary breast cancer. Anticancer Res 1999; 19:5051-5. 24. Uozaki H, Horiuchi H, Ishida T, et al. Overexpression of resistance-related proteins (metallothioneins, glutathione-S-transferase pi, heat shock protein 27, and lung resistance-related protein) in osteosarcoma. Relationship with poor prognosis. Cancer 1997; 79:2336-44. 25. Ullrich A, Schlessinger J. Signal transduction by receptors with tyrosine kinase activity. Cell 1990; 61:203-12. 26. Volm M, Drings P, Wodrich W. Prognostic significance of the expression of c-fos, c-jun and c-erbB-1 oncogene products in human squamous cell lung carcinomas. J Cancer Res Clin Oncol 1993; 119:507-10. 27. Brabender J, Danenberg KD, Metzger R, et al. Epidermal growth factor receptor and HER2-neu mRNA expression in non-small cell lung cancer is correlated with survival. Clin Cancer Res 2001; 7:1850-5. 28. Selvaggi G, Novello S, Torri V, et al. Epidermal growth factor receptor overexpression correlates with a poor prognosis in completely resected non-small-cell lung cancer. Ann Oncol 2004; 15:28-32. 29. Wu J, Lee C, Yokom D, et al. Disruption of the Y-box binding protein-1 results in suppression of the epidermal growth factor receptor and HER-2. Cancer Res 2006; 66:4872-9. 30. Fujita T, Ito K, Izumi H, et al. Increased nuclear localization of transcription factor Y-box binding protein 1 accompanied by up-regulation of P-glycoprotein in breast cancer pretreated with paclitaxel. Clin Cancer Res 2005; 11:8837-44. 31. Schneider J, Gonzalez-Roces S, Pollan M, et al. Expression of LRP and MDR1 in locally advanced breast cancer predicts axillary node invasion at the time of rescue mastectomy after induction chemotherapy. Breast Cancer Res 2001; 3:183-91. 32. Izquierdo MA, Scheffer GL, Flens MJ, et al. Broad distribution of the multidrug resistance-related vault lung resistance protein in normal human tissues and tumors. Am J Pathol 1996; 148:877-87. 33. Izquierdo MA, Shoemaker RH, Flens MJ, et al. Overlapping phenotypes of multidrug resistance among panels of human cancer-cell lines. Int J Cancer 1996; 65: 230-7. 34. Kickhoefer VA, Rajavel KS, Scheffer GL, et al. Vaults are up-regulated in multidrug-resistant cancer cell lines. J Biol Chem 1998; 273:8971-4. 35. Schroeijers AB, Scheffer GL, Flens MJ, et al. Immunohistochemical detection of the human major vault protein LRP with two monoclonal antibodies in formalin-fixed, paraffin-embedded tissues. Am J Pathol 1998; 152:373-8. 36. Siva AC, Raval-Fernandes S, Stephen AG, et al. Up-regulation of vaults may be necessary but not sufficient for multidrug resistance. Int J Cancer 2001; 92:195202. 37. Versantvoort CH, Withoff S, Broxterman HJ, et al. Resistance-associated factors in human small-cell lung-carcinoma GLC4 sub-lines with increasing adriamycin resistance. Int J Cancer 1995; 61:375-80. 38. Verovski VN, Van den Berge DL, Delvaeye MM, et al. Low-level doxorubicin resistance in P-glycoprotein-negative human pancreatic tumour PSN1/ADR cells implicates a brefeldin A-sensitive mechanism of drug extrusion. Br J Cancer 1996; 73:596-602. 39. Komarov PG, Shtil AA, Holian O, et al. Activation of the LRP (lung resistancerelated protein) gene by short-term exposure of human leukemia cells to phorbol ester and cytarabine. Oncol Res 1998; 10:185-92. 40. Wyler B, Shao Y, Schneider E, et al. Intermittent exposure to doxorubicin in vitro selects for multifactorial non-P-glycoprotein-associated multidrug resistance in RPMI 8226 human myeloma cells. Br J Haematol 1997; 97:65-75. 41. Moran E, Cleary I, Larkin AM, et al. Co-expression of MDR-associated markers, including P-170, MRP and LRP and cytoskeletal proteins, in three resistant variants of the human ovarian carcinoma cell line, OAW42. Eur J Cancer 1997; 33:652-60. 42. Berger W, Elbling L, Micksche M. Expression of the major vault protein LRP in human non-small-cell lung cancer cells: activation by short-term exposure to antineoplastic drugs. Int J Cancer 2000; 88:293-300.

Clinical Lung Cancer September 2012

383

YB-1, LRP, and EGFR Expression in Lung Cancer 43. Harada T, Ogura S, Yamazaki K, et al. Predictive value of expression of P53, Bcl-2 and lung resistance-related protein for response to chemotherapy in non-small cell lung cancers. Cancer Sci 2003; 94:394-9. 44. Dingemans AM, van Ark-Otte J, van der Valk P, et al. Expression of the human major vault protein LRP in human lung cancer samples and normal lung tissues. Ann Oncol 1996; 7:625-30. 45. Lange C, Walther W, Schwabe H, et al. Cloning and initial analysis of the human multidrug resistance-related MVP/LRP gene promoter. Biochem Biophys Res Commun 2000; 278:125-33. 46. Grandis JR, Sok JC. Signaling through the epidermal growth factor receptor during the development of malignancy. Pharmacol Ther 2004; 102:37-46. 47. Merrick DT, Kittelson J, Winterhalder R, et al. Analysis of c-ErbB1/epidermal growth factor receptor and c-ErbB2/HER-2 expression in bronchial dysplasia: evaluation of potential targets for chemoprevention of lung cancer. Clin Cancer Res 2006; 12:2281-8.

384

Clinical Lung Cancer September 2012

48. Normanno N, De Luca A, Bianco C, et al. Epidermal growth factor receptor (EGFR) signaling in cancer. Gene 2006; 366:2-16. 49. Normanno N, Bianco C, Strizzi L, et al. The ErbB receptors and their ligands in cancer: an overview. Curr Drug Targets 2005; 6:243-57. 50. Sholl LM, Yeap BY, Iafrate AJ, et al. Lung adenocarcinoma with EGFR amplification has distinct clinicopathologic and molecular features in never-smokers. Cancer Res 2009; 69:8341-8. 51. Fujii T, Kawahara A, Basaki Y, et al. Expression of HER2 and estrogen receptor alpha depends upon nuclear localization of Y-box binding protein-1 in human breast cancers. Cancer Res 2008; 68:1504-12. 52. Kashihara M, Azuma K, Kawahara A, et al. Nuclear Y-box binding protein-1, a predictive marker of prognosis, is correlated with expression of HER2/ErbB2 and HER3/ErbB3 in non-small cell lung cancer. J Thorac Oncol 2009; 4: 1066-74.