- Email: [email protected]
Association of the FTO and ADRB2 genes with body composition and fat distribution in obese women
Maturitas 76 (2013) 165–171
Contents lists available at ScienceDirect
Maturitas journal homepage: www.elsevier.com/locate/maturitas
Association of the FTO and ADRB2 genes with body composition and fat distribution in obese women Anne Rauhio a,∗ , Kirsti Uusi-Rasi b , Seppo T. Nikkari a,c , Pekka Kannus b,d,e , Harri Sievänen b , Tarja Kunnas c a
Fimlab Laboratories Ltd, Tampere, Finland The UKK Institute for Health Promotion Research, Tampere, Finland c Department of Medical Biochemistry, Medical School, University of Tampere, Tampere, Finland d Medical School, University Hospital of Tampere, Tampere, Finland e Division of Orthopaedics and Traumatology, Department of Trauma, Musculoskeletal Surgery and Rehabilitation, Tampere University Hospital, Tampere, Finland b
a r t i c l e
i n f o
Article history: Received 28 March 2013 Received in revised form 26 June 2013 Accepted 7 July 2013
Keywords: Obesity Genetic variants Weight reduction Weight maintenance DXA
a b s t r a c t Objective: The aim of this study was to investigate whether the polymorphisms of the fat mass and obesity-associated gene (FTO, rs9939609:T > A) and the 2-adrenergic receptor gene (ADRB2, rs1042714:Gln > Glu) are associated with weight loss in dieting obese premenopausal women and the association of these SNPs with body weight, body composition and distribution of fat mass. Methods: 75 obese (BMI > 30) premenopausal women participated in the intervention including a 3month weight reduction period and a subsequent 9-month weight maintenance period. Weight and height were measured and BMI calculated. Body composition and fat mass distribution were assessed by dual energy X-ray absorptiometry. Results: At baseline, the AA homozygotes of the FTO gene were 10.1 kg heavier (p = 0.031), they had higher BMI (p = 0.038), and greater waist and greater hip circumference (p = 0.08 and p = 0.067, respectively) compared to the TT homozygotes. Gln/Gln carriers of the ADRB2 gene had smaller gynoid fat-% compared with both the Gln/Glu and Glu/Glu carriers (p = 0.050 and p = 0.009, respectively). The Gln homozygotes had also smaller total body fat-% and higher total body lean mass-% than that of the Glu homozygotes (p = 0.018 and p = 0.019, respectively). Conclusion: FTO genotype was associated with body weight in general, whereas ADRB2 genotype was associated with fat distribution. However, all women in the study group lost weight similarly independently of their genotypes. Neither the FTO nor ADRB2 genotype had statistically significant effect on weight reduction or weight maintenance. © 2013 Elsevier Ireland Ltd. All rights reserved.
1. Introduction Obesity is one of the major health risks by contributing to the development of many diseases such as cardiovascular diseases, cancer, type 2 diabetes and hypertension [1]. In addition to the environmental and behavioural factors, genetic heredity accounts for obesity and recent research on various candidate
Abbreviations: FTO, fat mass and obesity-associated gene; ADRB2, 2-adrenergic receptor gene; A, adenine; T, thymine; Gln, glutamine; Glu, glutamic acid; BMI, body mass index; SNP, single nucleotide polymorphism; VLED, very-low-energy diet; DXA, dual-energy X-ray absorptiometry; GLM, general linear model. ∗ Corresponding author at: Fimlab Laboratories Ltd, PO Box 66, FIN-33101 Tampere, Finland. Tel.: +358 3311 75576; fax: +358 3311 75554. E-mail address: anne.rauhio@uta.fi (A. Rauhio). 0378-5122/$ – see front matter © 2013 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.maturitas.2013.07.004
genes and genetic mechanisms has been lively [2,3]. However, the genetics of obesity seems very complicated and findings have been inconsistent suggesting polygenic basis for obesity [4]. Genome-wide association studies (GWAS) have suggested that FTO gene (fat mass and obesity-associated gene) is the most significant candidate gene contributing to obesity. In 2007, Frayling et al. showed a strong association between a SNP in the first intron of FTO (rs9939609:T > A) and body mass index (BMI) [5]. Participants homozygous with the risk allele A were approximately 3 kg heavier than those who were homozygous for the non-risk allele T. Since then many studies have confirmed this association [6–10]. In addition, the association of the FTO polymorphism with other obesity traits such as waist and hip circumference has been shown to be strong, but a few studies have shown lack of these associations [11–13].
166
A. Rauhio et al. / Maturitas 76 (2013) 165–171
The association with FTO-genotype and BMI appears in childhood and adolescence, while association with birth weight has not been found [6,8,10]. During adulthood the FTO-associated effect on BMI, or rather on body weight (since changes in BMI during adulthood are due to changes in body mass), remains more or less constant and may even reduce at older age [6,10] but findings are inconsistent [7]. In addition to the cross-sectional and retrospective studies, the effect of the FTO polymorphism on body weight and its changes has been investigated in a few dietary and exercise interventions [9,14]. In general, FTO genotype was not associated with weight loss, but in a 3-year Mediterranean-stylediet-intervention A-allele carriers showed the lowest gain in body weight [9]. Another gene polymorphism that has been shown to be associated with obesity is Gln27Glu polymorphism (rs1042714:Gln > Glu) in the 2-adrenergic receptor gene (ADRB2) [15–17]. As with FTO gene polymorphism, the results have remained contradictory [18,19]. Recently Ruiz et al. demonstrated that women carrying the Glu allele had greater reduction in total body weight, and lean and fat mass, than non-Glu allele carriers [20]. The aim of this study was to investigate whether the polymorphisms of the FTO and the ADRB2 are associated with weight loss in dieting obese premenopausal women and the association of these SNPs with body weight, body composition and distribution of fat mass. Since recent studies have suggested that the AA genotype of the FTO gene variant is a significant risk factor for obesity compared with the TT genotype [5], we focused our study results especially to these homozygous groups.
2. Methods 2.1. Subjects and methods Seventy-five clinically healthy obese (BMI > 30) sedentary premenopausal women with the age range from 25 to 45 years were recruited in the study. A detailed description of the design and data collection of the study is described elsewhere [21]. The total duration of the study was 12 months including an intensive 3-month weight reduction period with very-low-energy diet (VLED, Cambridgekuren, Solna, Sweden), and a subsequent 9-month weight maintenance period. All physical assessments were done at baseline and 3 and 12 months from the beginning. The study protocol was approved by the Ethics Committee of The Pirkanmaa Hospital District, and each participant gave her written informed consent prior to the intervention.
2.2. Anthropometry and body composition Body height was measured to the nearest 0.1 cm and body weight to the nearest 0.1 kg with a high-precision scale with the participants wearing only underwear. Waist circumference was measured midway between the lowest rib and the iliac crest, and hip circumference at the tip of the greater trochanter. Body composition (fat mass and lean mass and their proportions in %) was assessed with dual-energy X-ray absorptiometry (DXA, Lunar Prodigy Advance, GE Lunar, Madison, WI). Besides the total body assessment, android (abdominal region) and gynoid (hip region) fat-% was evaluated according to the manufacturer’s protocol. In our laboratory, the in vivo precision (coefficient of variation, CV %) based on repeated scans of 27 subjects with repositioning is 1.3% for the fat mass, 0.8% for the lean mass, 1.3% for the total body fat-%, 1.6% for the android fat-%, and 2.2% for the gynoid fat-% [21].
2.3. Physical activity Over the entire 12-month study period the participants kept an exercise diary for type, intensity and duration of leisure physical activity lasting for at least 10 min per session including commuting. The intensity was self-rated with a scale from 1 to 4, where 1 = light, no enhanced breathing or sweating; 2 = moderate, enhanced breathing and some sweating; 3 = strenuous, enhanced breathing and sweating; 4 = exhausting. The mean duration of the physical activity was calculated for each quarter of the year. 2.4. DNA extraction and genotyping Genomic DNA was extracted from blood samples using a commercial kit (Qiagen Inc., Valencia, CA, USA). FTO (rs9939609:T > A) was genotyped using TagMan genotyping assay (ID C 30090620 10, Applied Biosystems, Foster City, CA, USA) using probes (VIC/FAM GGTTCCTTGCGACTGCTGTGAATTT[A/T]GTGATGCACTTGGATAGTCTCTGTT). Genotyping was carried out according to manufacturers’ instructions. For ADRB2 (rs1042714:Gln > Glu) genotyping, the following primers were used in polymerase chain reaction: forward 5 GAA TGA GGC TTC CAG GCG TC 3 /reverse 5 GGC CCA TGA CCA GAT CAG CA3 . The amplification product was digested with SatI (Fermentas Inc., USA) and the fragments were separated using 1.5% agarose gel. 2.5. Statistical analyses Means and standard deviations or standard errors were used as descriptive statistics. Total body weight, height, BMI, total body fat mass, lean mass, total body fat-%, lean mass-%, gynoid and android fat-% and waist and hip circumferences were compared using analysis of variance (ANOVA) at the baseline. Post hoc comparisons between the homozygote groups were done using least significant difference (LSD) test for multiple comparisons. The repeated measures analysis (GLM, General linear model) at baseline, after the 3-month weight loss and 9-month weight maintenance periods was used to assess mean differences in body composition. A p-value less than 0.05 was considered significant. 3. Results 3.1. General The main characteristics of the participants broken down by the FTO and ADRB2 genotypes are given in Table 1. The number of women in the FTO genotype groups was 23 (31%) for TT, 36 (48%) for AT and 16 (21%) for AA, and for the ADRB2 genotype groups 22 (29%) for Gln/Gln, 37 (49%) for Gln/Glu and 16 (21%) for Glu/Glu. Of the 75 women who started the intervention, 65 completed the weight loss period and 62 completed the whole one-year study. On the whole group the mean (SD) weight loss during the 3-month dieting period was 9.8 (4.3) kg, the individual changes ranging from an 18.8 kg loss to a 1.9 kg gain. The mean declines in fat mass and lean mass were 8.0 (3.2) kg and 1.4 (2.3) kg, respectively. Waist and hip circumferences declined 7.6 (4.8) cm and 6.3 (3.4) cm, respectively. Based on exercise diaries the women with the FTO genotype AA and the ADRB genotype Glu/Glu, the heaviest genotypes, tended to have less physical activity including commuting and leisure activity throughout the study period (Table 2), although the difference was not statistically significant. By contrast, physically most active were those with homozygote FTO genotype TT and those with heterozygote ADRB2 genotype Gln/Glu. However, the mean intensity
A. Rauhio et al. / Maturitas 76 (2013) 165–171
167
Table 1 Baseline characteristics of the study population by the FTO (rs9939609:T > A) and ADRB2 (rs1042714:Gln > Glu) genotype groups.
Age (years) Weight (kg) Height (cm) BMI (kg/m2 ) Waist (cm) Hip (cm) Total body fat (%) Total body fat (kg) Lean mass (%) Lean mass (kg) Gynoid fat (%) Anroid fat (%)
Age (years) Weight (kg) Height (cm) BMI (kg/m2 ) Waist (cm) Hip (cm) Total body fat (%) Total body fat (kg) Lean mass (%) Lean mass (kg) Gynoid fat (%) Anroid fat (%) a b
TT (n = 23) Mean (sd)
AT (n = 36) Mean (sd)
AA (n = 16) Mean (sd)
Pa
39.2 (6.2) 88.2 (12.9) 164.6 (6.1) 32.5 (4.0) 104.4 (13.4) 114.8 (8.5) 46.5 (4.1) 39.8 (8.8) 51.7 (3.8) 45.1 (5.0) 50.5 (3.9) 52.1 (5.7)
39.3 (5.4) 94.7 (14.6) 166.3 (6.8) 34.2 (4.3) 108.2 (10.4) 119.2 (9.8) 47.8 (4.6) 43.7 (9.2) 50.5 (4.4) 47.2 (7.0) 51.9 (6.6) 53.7 (4.6)
40.9 (6.0) 98.3 (14.3) 166.3 (5.5) 35.6 (5.2) 111.5 (14.2) 120.4 (9.7) 48.7 (4.4) 46.4 (10.8) 49.8 (4.1) 48.1 (4.5) 52.6 (4.0) 54.5 (5.6)
0.38 0.031 0.39 0.038 0.080 0.067 0.14 0.034 0.15 0.12 0.17 0.16
Gln/Gln (n = 22)
Gln/Glu (n = 37)
Glu/Glu (n = 16)
Pb
39.8 (6.5) 91.4 (10.6) 166.1 (5.5) 33.2 (4.0) 108.5 (10.8) 116.0 (7.5) 46.0 (3.8) 40.6 (7.0) 52.3 (3.5) 47.4 (4.9) 49.3 (4.1) 52.5 (5.5)
37.7 (5.8) 93.8 (17.5) 166.3 (7.1) 33.8 (4.9) 107.4 (13.6) 118.1 (10.9) 47.8 (4.7) 43.5 (11.3) 50.5 (4.5) 46.6 (7.1) 51.6 (4.4) 53.3 (5.0)
39.1 (4.6) 95.6 (10.8) 164.2 (5.3) 35.5 (4.1) 107.2 (11.8) 121.1 (8.4) 49.4 (3.9) 45.6 (7.9) 49.1 (3.7) 46.3 (4.6) 53.1 (4.2) 55.0 (5.0)
0.88 0.39 0.36 0.19 0.74 0.11 0.018 0.12 0.019 0.59 0.009 0.14
AA vs. TT. Gln/Gln vs. Glu/Glu.
of the physical activity was only from light to moderate and part of women reported no exercise at all. 3.2. FTO gene When comparing the genotypes AA and TT of the FTO gene, the AA homozygotes were heavier the mean difference in BMI being 3.1 kg/m2 (p = 0.038), in body weight 10.1 kg (p = 0.031), and in total body fat mass 6.6 kg (p = 0.034) (Table 1). They also tended to have greater waist and hip circumferences the mean differences being 7.1 cm (p = 0.08) and 5.7 cm (p = 0.067), respectively. The FTO genotype did not seem to affect weight reduction or weight maintenance. Repeated measures analysis (GLM) showed that all women lost and gained weight similarly during the 3month weight reduction period and 9-month weight maintenance period. The mean difference in BMI between the TT and AA genotypes remained the same as well as unadjusted body weight after weight loss (p = 0.046) and weight maintenance (p = 0.082) (Fig. 1).
The waist and hip circumferences also declined similarly mean difference at the end of weight maintenance being significant between the two homozygote groups (p = 0.026 and p = 0.021, respectively) (Fig. 1). 3.3. ADRB2 gene At baseline, the Gln homozygotes had lower gynoid fat-% compared with the Gln/Glu and Glu/Glu carriers, mean differences being 2.3%-units (p = 0.050) and 3.8%-units (p = 0.009), respectively. The Gln homozygotes had also lower total body fat-% and higher lean mass-% than the Glu homozygotes, mean difference being 3.4%-units (p = 0.018) and 3.2%-units (p = 0.019), respectively. The Glu homozygote had slightly, although not significantly, wider hip circumference, but similar waist circumference compared to two other genotypes (Table 1). The ADRB2 genotype had no effect on weight changes. Mean between-group differences were maintained at all time points of
Table 2 Commuting and leisure physical activity by quarters of the study year for the three FTO (rs9939609:T > A) and ADRB2 (rs1042714:Gln > Glu) genotype groups. Physical activity (min/week)
TT (n = 23) Mean (sd)
AT (n = 36) Mean (sd)
AA (n = 16) Mean (sd)
1st quarter, 1–3 months 2nd quarter, 4–6 months 3rd quarter, 7–9 months 4th quarter, 10–12 months
165 (184) 140 (155) 107 (139) 105 (174)a
143 (113) 108 (140) 79 (104) 99 (145)b
130 (200) 94 (229) 33 (56) 40 (98)
Gln/Gln (n = 22) 1st quarter, 1–3 months 2nd quarter, 4–6 months 3rd quarter, 7–9 months 4th quarter, 10–12 months a b c d
n = 22. n = 35. n = 36. n = 15.
150 (211) 97 (207) 78 (114) 87 (154)
Gln/Glu (n = 37) 164 (136) 130 (152) 85 (118) 93 (154)c
Glu/Glu (n = 16) 105 (105) 104 (136) 61 (88) 79 (125)d
168
A. Rauhio et al. / Maturitas 76 (2013) 165–171
Fig. 1. BMI, weight, waist and hip circumferences (mean, SE) for FTO (rs9939609:T > A) genotypes during the one-year study intervention. Total body fat mass followed the same patterns (data not shown). A p-value less than 0.05 was considered significant.
the 3-month weight reduction and 9-month weight maintenance (Fig. 2). The gynoid fat-% and total body fat-% remained significantly different between the genotypes (p = 0.028 and p = 0.092, respectively). At 3-month time point Gln homozygotes had 2.7%units (p = 0.036) and 4.1%-units (p = 0.011) lower gynoid fat-% than Gln/Glu carriers and Glu/Glu carriers, respectively. After the subsequent 9-month weight maintenance period, gynoid fat-% of the Gln homozygotes was 3.8%-units (p = 0.026) lower than that of Glu-homozygotes. The mean difference in total body fat-% also remained at the same level throughout the study being 4.0%-units (p = 0.032) and 3.4%-units (p = 0.086) lower among Gln homozygotes than among Glu homozygotes at 3 and 12-month time points, respectively (Fig. 2). 4. Discussion Our results confirm the association between the FTO polymorphism and greater body weight presented by several other research groups [5,8–10]. The ADRB2 subgroups showed no difference in total body weight or BMI. However, the homozygote ADRB2
genotype Glu/Glu was associated with the highest total body fat-% and gynoid fat-% and the lowest lean mass-% values. They also had somewhat greater hip circumference but similar waist circumference, which suggests that much of the fat tissue was distributed around the hip. We also found that neither the FTO nor the ADRB2 genotype were associated with weight loss or weight maintenance. On the contrary, the mean differences that existed between the genotypes at baseline remained similar throughout the 3 month weight reduction and 9 month weight maintenance periods. Frayling et al. were the firsts to demonstrate that the AA genotype of the FTO gene is a significant risk factor for obesity, homozygotes with a risk allele A being approximately 3 kg heavier than the homozygotes for the non-risk allele T [5]. Several studies have shown that Glu-allele of the ADRB2 gene is also associated with obesity and elevated BMI [15–17]. In men, this association seems evident [22,23], whereas in women the association with BMI seems not to be so [22–24]. Our findings are in line with these results. In our study all participants were obese (BMI at least 30), and even among them the FTO homozygotes AA were about 10 kg (11%) heavier than the corresponding TT homozygotes,
A. Rauhio et al. / Maturitas 76 (2013) 165–171
169
Fig. 2. BMI, total body fat-%, gynoid fat-% and android fat-% (mean, SE) for ADRB2 (rs1042714:Gln > Glu) genotypes during the one-year study intervention. Total body lean mass-% followed the same patterns (data not shown). A p-value less than 0.05 was considered significant.
while ADRB2 Glu-allele carriers were not significantly heavier than ADRB2 Gln/Gln homozygotes. Earlier studies have demonstrated associations between FTO genotypes and waist and hip circumferences [6,25,26]. Interestingly, in the present study the FTO homozygote genotype AA had somewhat greater waist and hip circumferences than the homozygote TT, but no difference in the DXA-measured android and gynoid fat-%. On the other hand, ADRB2 genotypes had between-group differences in fat distribution, the Glu/Glu homozygotes having greater gynoid fat-%, about 5 cm wider hip circumference, but similar waist circumference than Gln/Gln. Previous research has provided evidence that ADRB2 gene has an effect on fat distribution at the abdominal region [17,24]. In the present study Glu-allele was positively associated with gynoid fat-%, but not with android fat-%, the latter representing abdominal fat deposition. To our best knowledge, ADRB2 polymorphisms’ associations with gynoidal fat distribution have not been reported previously. Although genetic heredity accounts for obesity, the question is complicated and the findings remain inconsistent presuming that obesity has a polygenic basis [2,4]. Although all 75 participants were obese there were 16 individuals representing the heaviest AA and Glu/Glu genotypes, and both genotypes were present only in three women. At the population level in general, only few people have
the most harmful combination and therefore, environmental and behavioural factors should be primarily taken into account when treating and preventing obesity [8,27]. Low physical activity is a known risk factor for obesity [28], and interestingly in our study both heaviest FTO and ADRB2 genotypes (AA and Glu/Glu) tended to be the least active. However, it is not possible to know, if they were heavier due to less physical activity, or they were less active due to greater body mass. There is very little evidence about long-term benefits of exercise on weight loss. In their systematic review, Franz et al. showed that exercise alone did not result in successful weight loss [29]. However, high physical activity may be associated with improved maintenance of body weight [28]. The Gln/Gln genotype has been suggested to benefit from physical activity to reduce weight [30]. However, in our study the ADRB2 polymorphism was not associated with the weight reduction. On the other hand, we did not have any exercise intervention. Although the participants were advised to increase physical activity in their daily life to help to maintain the weight loss results, this counselling did not seem to work, since physical activity rather declined than increased during the study period. It is also possible that there are genderrelated differences, in Meirhaeghe’s study the participants were men [22].
170
A. Rauhio et al. / Maturitas 76 (2013) 165–171
Few studies have investigated the relationship between the FTO or ADRB2 polymorphisms and weight changes during dietary interventions [9,14,20]. Ruiz et al. found that women carrying the ADRB2 Glu allele had greater weight reduction in a 12-week low energy diet-intervention [20]. They suggest a greater weight-loss resistance and higher decrease in resting metabolic rate among Gln homozygotes after diet therapy. We did not find any association between the ADRB2 genotype and weight loss, thus our results are not in line with these findings in spite of similarities between the study groups all participants being premenopausal obese women. Razquin et al., in turn, suggest that the FTO homozygotes AA may benefit the Mediterranean-style-diet [9] indicating that the quality and composition of the diet is more important than the quantity. In the present study, all participants lost weight with VLED products, and therefore it is not possible to speculate about the dietary effect on weight reduction between the genotypes. Unfortunately, we did not have specific dietary data during the weight maintenance period when all genotype groups gained weight similarly during that period. A limitation of this study is the small number of participants. However, the frequency of the FTO minor allele A among them was 0.45, which is similar that is given in the HapMap population frequencies for the rs9939609 A allele in the Europeans [5]. The frequency of ADRB2 minor allele Glu was 0.46 in the present study, which is higher than global frequency of 0.30 given in scientific publications [19]. On the other hand, our Glu frequency has also been found in one Swedish population of obese women [16]. Thus, the allele frequencies may depend on ethnic background of the studied population. Another limitation is that the study participants represented a convenience sample of obese premenopausal women, and the results cannot thus be generalized. Therefore, it is important that further studies assess associations between FTO and ADRB2 gene polymorphisms and obesity traits also among women and men in different ages and in larger sample sizes. The strength of this study is the longitudinal study design; the weight loss intervention and long follow-up period. Further, the body composition measurements were completed by the DXA measured body composition traits; total body fat and lean mass and fat-%, and their distribution. Very few studies have applied DXA or quantitative computed tomography (QCT) in assessing body composition. Most previous studies have used conventional waist and hip circumferences to describe and interpret body composition and fat distribution traits. Furthermore, the circumferences can only roughly describe fat distribution, whereas android and gynoid fat% are more specific traits to describe fat accumulation within the body. In conclusion, among clinically healthy obese (BMI > 30) premenopausal Finnish women the FTO (rs9939609:T > A) and ADRB2 (rs1042714:Gln > Glu) polymorphisms were associated with obesity. FTO genotype was associated with body weight in general, whereas ADRB2 genotype associated with fat distribution. However, all women in the study group lost weight similarly independently of their genotypes. Neither FTO nor ADRB2 polymorphism were associated with weight reduction or weight gain during the follow-up period.
Contributors AR developed the design and conduct of the study. AR, KUR and TK were involved in elaborating specific research questions. SN, PK and HS also contributed to methodological decisions such as study sample and choice of outcome measures. AR, TK and SN provided the methodological support for biochemical laboratory assays. AR and KUR are responsible for data collection management and SN, TK and AR for statistical data analyses. AR drafted the manuscript.
All authors commented on the draft and read and approved the final version of the paper. Competing interests The authors declare that they have no competing interests. Ethical approval The study protocol was approved by the Ethics Committee of The Pirkanmaa Hospital District, and each participant gave her written informed consent prior to the intervention. Funding This study was financially supported by the Competetive Research Funding of the Tampere University Hospital (Grant 9L140) and the Juho Vainio Foundation, Helsinki, Finland. We also wish to thank National Doctoral Programme of Musculoskeletal Disorders and Biomaterials, Finland. References [1] Haslam DW, James WP. Obesity. Lancet 2005;366:1197–209. [2] Day FR, Loos RJ. Developments in obesity genetics in the era of genomewide association studies. Journal of Nutrigenetics and Nutrigenomics 2011;4:222–38. [3] Fawcett KA, Barroso I. The genetics of obesity: FTO leads the way. Trends in Genetics 2010;26:266–74. [4] Leibel RL. Energy in, energy out, and the effects of obesity-related genes. New England Journal of Medicine 2008;359:2603–4. [5] Frayling TM, Timpson NJ, Weedon MN, et al. A common variant in the FTO gene is associated with body mass index and predisposes to childhood and adult obesity. Science 2007;316:889–94. [6] Qi L, Kang K, Zhang C, et al. Fat mass- and obesity-associated (FTO) gene variant is associated with obesity: longitudinal analyses in two cohort studies and functional test. Diabetes 2008;57:3145–51. [7] Mei H, Chen W, Srinivasan SR, et al. FTO influences on longitudinal BMI over childhood and adulthood and modulation on relationship between birth weight and longitudinal BMI. Human Genetics 2010;128:589–96. [8] Kaakinen M, Laara E, Pouta A, et al. Life-course analysis of a fat mass and obesityassociated (FTO) gene variant and body mass index in the Northern Finland Birth Cohort 1966 using structural equation modeling. American Journal of Epidemiology 2010;172:653–65. [9] Razquin C, Martinez JA, Martinez-Gonzalez MA, Bes-Rastrollo M, FernandezCrehuet J, Marti A. A 3-year intervention with a Mediterranean diet modified the association between the rs9939609 gene variant in FTO and body weight changes. International Journal of Obesity 2010;34:266–72. [10] Hertel JK, Johansson S, Sonestedt E, et al. FTO, type 2 diabetes, and weight gain throughout adult life: a meta-analysis of 41,504 subjects from the Scandinavian HUNT, MDC, and MPP studies. Diabetes 2011;60:1637–44. [11] Wahlen K, Sjolin E, Hoffstedt J. The common rs9939609 gene variant of the fat mass- and obesity-associated gene FTO is related to fat cell lipolysis. Journal of Lipid Research 2008;49:607–11. [12] Speakman JR, Rance KA, Johnstone AM. Polymorphisms of the FTO gene are associated with variation in energy intake, but not energy expenditure. Obesity (Silver Spring) 2008;16:1961–5. [13] Jacobsson JA, Riserus U, Axelsson T, Lannfelt L, Schioth HB, Fredriksson R. The common FTO variant rs9939609 is not associated with BMI in a longitudinal study on a cohort of Swedish men born 1920–1924. BMC Medical Genetics 2009;10:131. [14] Muller TD, Hinney A, Scherag A, et al. ‘Fat mass and obesity associated’ gene (FTO): no significant association of variant rs9939609 with weight loss in a lifestyle intervention and lipid metabolism markers in German obese children and adolescents. BMC Medical Genetics 2008;9:85. [15] Large V, Hellstrom L, Reynisdottir S, et al. Human beta-2 adrenoceptor gene polymorphisms are highly frequent in obesity and associate with altered adipocyte beta-2 adrenoceptor function. Journal of Clinical Investigation 1997;100:3005–13. [16] Hellstrom L, Large V, Reynisdottir S, Wahrenberg H, Arner P. The different effects of a Gln27Glu beta 2-adrenoceptor gene polymorphism on obesity in males and in females. Journal of Internal Medicine 1999;245: 253–9. [17] Lange LA, Norris JM, Langefeld CD, et al. Association of adipose tissue deposition and beta-2 adrenergic receptor variants: the IRAS family study. International Journal of Obesity 2005;29:449–57. [18] Gjesing AP, Andersen G, Burgdorf KS, et al. Studies of the associations between functional beta2-adrenergic receptor variants and obesity,
A. Rauhio et al. / Maturitas 76 (2013) 165–171
[19]
[20]
[21]
[22]
[23]
hypertension and type 2 diabetes in 7808 white subjects. Diabetologia 2007;50: 563–8. Jalba MS, Rhoads GG, Demissie K. Association of codon 16 and codon 27 beta 2-adrenergic receptor gene polymorphisms with obesity: a meta-analysis. Obesity (Silver Spring) 2008;16:2096–106. Ruiz JR, Larrarte E, Margareto J, Ares R, Labayen I. Role of beta-adrenergic receptor polymorphisms on body weight and body composition response to energy restriction in obese women: preliminary results. Obesity (Silver Spring) 2011;19:212–5. Uusi-Rasi K, Rauhio A, Kannus P, et al. Three-month weight reduction does not compromise bone strength in obese premenopausal women. Bone 2010;46:1286–93. Meirhaeghe A, Helbecque N, Cottel D, Amouyel P. Impact of polymorphisms of the human beta2-adrenoceptor gene on obesity in a French population. International Journal of Obesity and Related Metabolic Disorders 2000;24:382–7. Gonzalez Sanchez JL, Proenza AM, Martinez Larrad MT, et al. The glutamine 27 glutamic acid polymorphism of the beta2-adrenoceptor gene is associated with abdominal obesity and greater risk of impaired glucose tolerance in men but not in women: a population-based study in Spain. Clinical Endocrinology (Oxford) 2003;59:476–81.
171
[24] Kunnas T, Lahtio R, Kortelainen ML, Kalela A, Nikkari ST. Gln27Glu variant of Beta2-adrenoceptor gene affects male type fat accumulation in women. Lipids in Health and Disease 2009;8:43. [25] Andreasen CH, Stender-Petersen KL, Mogensen MS, et al. Low physical activity accentuates the effect of the FTO rs9939609 polymorphism on body fat accumulation. Diabetes 2008;57:95–101. [26] Mangge H, Renner W, Almer G, Weghuber D, Moller R, Horejsi R. Rs9939609 variant of the fat mass and obesity-associated gene and trunk obesity in adolescents. Journal of Obesity 2011;2011:186368. [27] Kilpelainen TO, Qi L, Brage S, et al. Physical activity attenuates the influence of FTO variants on obesity risk: a meta-analysis of 218,166 adults and 19,268 children. PLoS Medicine 2011;8(11):e1001116. [28] Fogelholm M, Kukkonen-Harjula K. Does physical activity prevent weight gain – a systematic review. Obesity Reviews 2000;1:95–111. [29] Franz MJ, VanWormer JJ, Crain AL, et al. Weight-loss outcomes: a systematic review and meta-analysis of weight-loss clinical trials with a minimum 1-year follow-up. Journal of the American Dietetic Association 2007;107: 1755–67. [30] Meirhaeghe A, Helbecque N, Cottel D, Amouyel P. Beta2-adrenoceptor gene polymorphism, body weight, and physical activity. Lancet 1999;353:896.
Contents lists available at ScienceDirect
Maturitas journal homepage: www.elsevier.com/locate/maturitas
Association of the FTO and ADRB2 genes with body composition and fat distribution in obese women Anne Rauhio a,∗ , Kirsti Uusi-Rasi b , Seppo T. Nikkari a,c , Pekka Kannus b,d,e , Harri Sievänen b , Tarja Kunnas c a
Fimlab Laboratories Ltd, Tampere, Finland The UKK Institute for Health Promotion Research, Tampere, Finland c Department of Medical Biochemistry, Medical School, University of Tampere, Tampere, Finland d Medical School, University Hospital of Tampere, Tampere, Finland e Division of Orthopaedics and Traumatology, Department of Trauma, Musculoskeletal Surgery and Rehabilitation, Tampere University Hospital, Tampere, Finland b
a r t i c l e
i n f o
Article history: Received 28 March 2013 Received in revised form 26 June 2013 Accepted 7 July 2013
Keywords: Obesity Genetic variants Weight reduction Weight maintenance DXA
a b s t r a c t Objective: The aim of this study was to investigate whether the polymorphisms of the fat mass and obesity-associated gene (FTO, rs9939609:T > A) and the 2-adrenergic receptor gene (ADRB2, rs1042714:Gln > Glu) are associated with weight loss in dieting obese premenopausal women and the association of these SNPs with body weight, body composition and distribution of fat mass. Methods: 75 obese (BMI > 30) premenopausal women participated in the intervention including a 3month weight reduction period and a subsequent 9-month weight maintenance period. Weight and height were measured and BMI calculated. Body composition and fat mass distribution were assessed by dual energy X-ray absorptiometry. Results: At baseline, the AA homozygotes of the FTO gene were 10.1 kg heavier (p = 0.031), they had higher BMI (p = 0.038), and greater waist and greater hip circumference (p = 0.08 and p = 0.067, respectively) compared to the TT homozygotes. Gln/Gln carriers of the ADRB2 gene had smaller gynoid fat-% compared with both the Gln/Glu and Glu/Glu carriers (p = 0.050 and p = 0.009, respectively). The Gln homozygotes had also smaller total body fat-% and higher total body lean mass-% than that of the Glu homozygotes (p = 0.018 and p = 0.019, respectively). Conclusion: FTO genotype was associated with body weight in general, whereas ADRB2 genotype was associated with fat distribution. However, all women in the study group lost weight similarly independently of their genotypes. Neither the FTO nor ADRB2 genotype had statistically significant effect on weight reduction or weight maintenance. © 2013 Elsevier Ireland Ltd. All rights reserved.
1. Introduction Obesity is one of the major health risks by contributing to the development of many diseases such as cardiovascular diseases, cancer, type 2 diabetes and hypertension [1]. In addition to the environmental and behavioural factors, genetic heredity accounts for obesity and recent research on various candidate
Abbreviations: FTO, fat mass and obesity-associated gene; ADRB2, 2-adrenergic receptor gene; A, adenine; T, thymine; Gln, glutamine; Glu, glutamic acid; BMI, body mass index; SNP, single nucleotide polymorphism; VLED, very-low-energy diet; DXA, dual-energy X-ray absorptiometry; GLM, general linear model. ∗ Corresponding author at: Fimlab Laboratories Ltd, PO Box 66, FIN-33101 Tampere, Finland. Tel.: +358 3311 75576; fax: +358 3311 75554. E-mail address: anne.rauhio@uta.fi (A. Rauhio). 0378-5122/$ – see front matter © 2013 Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.maturitas.2013.07.004
genes and genetic mechanisms has been lively [2,3]. However, the genetics of obesity seems very complicated and findings have been inconsistent suggesting polygenic basis for obesity [4]. Genome-wide association studies (GWAS) have suggested that FTO gene (fat mass and obesity-associated gene) is the most significant candidate gene contributing to obesity. In 2007, Frayling et al. showed a strong association between a SNP in the first intron of FTO (rs9939609:T > A) and body mass index (BMI) [5]. Participants homozygous with the risk allele A were approximately 3 kg heavier than those who were homozygous for the non-risk allele T. Since then many studies have confirmed this association [6–10]. In addition, the association of the FTO polymorphism with other obesity traits such as waist and hip circumference has been shown to be strong, but a few studies have shown lack of these associations [11–13].
166
A. Rauhio et al. / Maturitas 76 (2013) 165–171
The association with FTO-genotype and BMI appears in childhood and adolescence, while association with birth weight has not been found [6,8,10]. During adulthood the FTO-associated effect on BMI, or rather on body weight (since changes in BMI during adulthood are due to changes in body mass), remains more or less constant and may even reduce at older age [6,10] but findings are inconsistent [7]. In addition to the cross-sectional and retrospective studies, the effect of the FTO polymorphism on body weight and its changes has been investigated in a few dietary and exercise interventions [9,14]. In general, FTO genotype was not associated with weight loss, but in a 3-year Mediterranean-stylediet-intervention A-allele carriers showed the lowest gain in body weight [9]. Another gene polymorphism that has been shown to be associated with obesity is Gln27Glu polymorphism (rs1042714:Gln > Glu) in the 2-adrenergic receptor gene (ADRB2) [15–17]. As with FTO gene polymorphism, the results have remained contradictory [18,19]. Recently Ruiz et al. demonstrated that women carrying the Glu allele had greater reduction in total body weight, and lean and fat mass, than non-Glu allele carriers [20]. The aim of this study was to investigate whether the polymorphisms of the FTO and the ADRB2 are associated with weight loss in dieting obese premenopausal women and the association of these SNPs with body weight, body composition and distribution of fat mass. Since recent studies have suggested that the AA genotype of the FTO gene variant is a significant risk factor for obesity compared with the TT genotype [5], we focused our study results especially to these homozygous groups.
2. Methods 2.1. Subjects and methods Seventy-five clinically healthy obese (BMI > 30) sedentary premenopausal women with the age range from 25 to 45 years were recruited in the study. A detailed description of the design and data collection of the study is described elsewhere [21]. The total duration of the study was 12 months including an intensive 3-month weight reduction period with very-low-energy diet (VLED, Cambridgekuren, Solna, Sweden), and a subsequent 9-month weight maintenance period. All physical assessments were done at baseline and 3 and 12 months from the beginning. The study protocol was approved by the Ethics Committee of The Pirkanmaa Hospital District, and each participant gave her written informed consent prior to the intervention.
2.2. Anthropometry and body composition Body height was measured to the nearest 0.1 cm and body weight to the nearest 0.1 kg with a high-precision scale with the participants wearing only underwear. Waist circumference was measured midway between the lowest rib and the iliac crest, and hip circumference at the tip of the greater trochanter. Body composition (fat mass and lean mass and their proportions in %) was assessed with dual-energy X-ray absorptiometry (DXA, Lunar Prodigy Advance, GE Lunar, Madison, WI). Besides the total body assessment, android (abdominal region) and gynoid (hip region) fat-% was evaluated according to the manufacturer’s protocol. In our laboratory, the in vivo precision (coefficient of variation, CV %) based on repeated scans of 27 subjects with repositioning is 1.3% for the fat mass, 0.8% for the lean mass, 1.3% for the total body fat-%, 1.6% for the android fat-%, and 2.2% for the gynoid fat-% [21].
2.3. Physical activity Over the entire 12-month study period the participants kept an exercise diary for type, intensity and duration of leisure physical activity lasting for at least 10 min per session including commuting. The intensity was self-rated with a scale from 1 to 4, where 1 = light, no enhanced breathing or sweating; 2 = moderate, enhanced breathing and some sweating; 3 = strenuous, enhanced breathing and sweating; 4 = exhausting. The mean duration of the physical activity was calculated for each quarter of the year. 2.4. DNA extraction and genotyping Genomic DNA was extracted from blood samples using a commercial kit (Qiagen Inc., Valencia, CA, USA). FTO (rs9939609:T > A) was genotyped using TagMan genotyping assay (ID C 30090620 10, Applied Biosystems, Foster City, CA, USA) using probes (VIC/FAM GGTTCCTTGCGACTGCTGTGAATTT[A/T]GTGATGCACTTGGATAGTCTCTGTT). Genotyping was carried out according to manufacturers’ instructions. For ADRB2 (rs1042714:Gln > Glu) genotyping, the following primers were used in polymerase chain reaction: forward 5 GAA TGA GGC TTC CAG GCG TC 3 /reverse 5 GGC CCA TGA CCA GAT CAG CA3 . The amplification product was digested with SatI (Fermentas Inc., USA) and the fragments were separated using 1.5% agarose gel. 2.5. Statistical analyses Means and standard deviations or standard errors were used as descriptive statistics. Total body weight, height, BMI, total body fat mass, lean mass, total body fat-%, lean mass-%, gynoid and android fat-% and waist and hip circumferences were compared using analysis of variance (ANOVA) at the baseline. Post hoc comparisons between the homozygote groups were done using least significant difference (LSD) test for multiple comparisons. The repeated measures analysis (GLM, General linear model) at baseline, after the 3-month weight loss and 9-month weight maintenance periods was used to assess mean differences in body composition. A p-value less than 0.05 was considered significant. 3. Results 3.1. General The main characteristics of the participants broken down by the FTO and ADRB2 genotypes are given in Table 1. The number of women in the FTO genotype groups was 23 (31%) for TT, 36 (48%) for AT and 16 (21%) for AA, and for the ADRB2 genotype groups 22 (29%) for Gln/Gln, 37 (49%) for Gln/Glu and 16 (21%) for Glu/Glu. Of the 75 women who started the intervention, 65 completed the weight loss period and 62 completed the whole one-year study. On the whole group the mean (SD) weight loss during the 3-month dieting period was 9.8 (4.3) kg, the individual changes ranging from an 18.8 kg loss to a 1.9 kg gain. The mean declines in fat mass and lean mass were 8.0 (3.2) kg and 1.4 (2.3) kg, respectively. Waist and hip circumferences declined 7.6 (4.8) cm and 6.3 (3.4) cm, respectively. Based on exercise diaries the women with the FTO genotype AA and the ADRB genotype Glu/Glu, the heaviest genotypes, tended to have less physical activity including commuting and leisure activity throughout the study period (Table 2), although the difference was not statistically significant. By contrast, physically most active were those with homozygote FTO genotype TT and those with heterozygote ADRB2 genotype Gln/Glu. However, the mean intensity
A. Rauhio et al. / Maturitas 76 (2013) 165–171
167
Table 1 Baseline characteristics of the study population by the FTO (rs9939609:T > A) and ADRB2 (rs1042714:Gln > Glu) genotype groups.
Age (years) Weight (kg) Height (cm) BMI (kg/m2 ) Waist (cm) Hip (cm) Total body fat (%) Total body fat (kg) Lean mass (%) Lean mass (kg) Gynoid fat (%) Anroid fat (%)
Age (years) Weight (kg) Height (cm) BMI (kg/m2 ) Waist (cm) Hip (cm) Total body fat (%) Total body fat (kg) Lean mass (%) Lean mass (kg) Gynoid fat (%) Anroid fat (%) a b
TT (n = 23) Mean (sd)
AT (n = 36) Mean (sd)
AA (n = 16) Mean (sd)
Pa
39.2 (6.2) 88.2 (12.9) 164.6 (6.1) 32.5 (4.0) 104.4 (13.4) 114.8 (8.5) 46.5 (4.1) 39.8 (8.8) 51.7 (3.8) 45.1 (5.0) 50.5 (3.9) 52.1 (5.7)
39.3 (5.4) 94.7 (14.6) 166.3 (6.8) 34.2 (4.3) 108.2 (10.4) 119.2 (9.8) 47.8 (4.6) 43.7 (9.2) 50.5 (4.4) 47.2 (7.0) 51.9 (6.6) 53.7 (4.6)
40.9 (6.0) 98.3 (14.3) 166.3 (5.5) 35.6 (5.2) 111.5 (14.2) 120.4 (9.7) 48.7 (4.4) 46.4 (10.8) 49.8 (4.1) 48.1 (4.5) 52.6 (4.0) 54.5 (5.6)
0.38 0.031 0.39 0.038 0.080 0.067 0.14 0.034 0.15 0.12 0.17 0.16
Gln/Gln (n = 22)
Gln/Glu (n = 37)
Glu/Glu (n = 16)
Pb
39.8 (6.5) 91.4 (10.6) 166.1 (5.5) 33.2 (4.0) 108.5 (10.8) 116.0 (7.5) 46.0 (3.8) 40.6 (7.0) 52.3 (3.5) 47.4 (4.9) 49.3 (4.1) 52.5 (5.5)
37.7 (5.8) 93.8 (17.5) 166.3 (7.1) 33.8 (4.9) 107.4 (13.6) 118.1 (10.9) 47.8 (4.7) 43.5 (11.3) 50.5 (4.5) 46.6 (7.1) 51.6 (4.4) 53.3 (5.0)
39.1 (4.6) 95.6 (10.8) 164.2 (5.3) 35.5 (4.1) 107.2 (11.8) 121.1 (8.4) 49.4 (3.9) 45.6 (7.9) 49.1 (3.7) 46.3 (4.6) 53.1 (4.2) 55.0 (5.0)
0.88 0.39 0.36 0.19 0.74 0.11 0.018 0.12 0.019 0.59 0.009 0.14
AA vs. TT. Gln/Gln vs. Glu/Glu.
of the physical activity was only from light to moderate and part of women reported no exercise at all. 3.2. FTO gene When comparing the genotypes AA and TT of the FTO gene, the AA homozygotes were heavier the mean difference in BMI being 3.1 kg/m2 (p = 0.038), in body weight 10.1 kg (p = 0.031), and in total body fat mass 6.6 kg (p = 0.034) (Table 1). They also tended to have greater waist and hip circumferences the mean differences being 7.1 cm (p = 0.08) and 5.7 cm (p = 0.067), respectively. The FTO genotype did not seem to affect weight reduction or weight maintenance. Repeated measures analysis (GLM) showed that all women lost and gained weight similarly during the 3month weight reduction period and 9-month weight maintenance period. The mean difference in BMI between the TT and AA genotypes remained the same as well as unadjusted body weight after weight loss (p = 0.046) and weight maintenance (p = 0.082) (Fig. 1).
The waist and hip circumferences also declined similarly mean difference at the end of weight maintenance being significant between the two homozygote groups (p = 0.026 and p = 0.021, respectively) (Fig. 1). 3.3. ADRB2 gene At baseline, the Gln homozygotes had lower gynoid fat-% compared with the Gln/Glu and Glu/Glu carriers, mean differences being 2.3%-units (p = 0.050) and 3.8%-units (p = 0.009), respectively. The Gln homozygotes had also lower total body fat-% and higher lean mass-% than the Glu homozygotes, mean difference being 3.4%-units (p = 0.018) and 3.2%-units (p = 0.019), respectively. The Glu homozygote had slightly, although not significantly, wider hip circumference, but similar waist circumference compared to two other genotypes (Table 1). The ADRB2 genotype had no effect on weight changes. Mean between-group differences were maintained at all time points of
Table 2 Commuting and leisure physical activity by quarters of the study year for the three FTO (rs9939609:T > A) and ADRB2 (rs1042714:Gln > Glu) genotype groups. Physical activity (min/week)
TT (n = 23) Mean (sd)
AT (n = 36) Mean (sd)
AA (n = 16) Mean (sd)
1st quarter, 1–3 months 2nd quarter, 4–6 months 3rd quarter, 7–9 months 4th quarter, 10–12 months
165 (184) 140 (155) 107 (139) 105 (174)a
143 (113) 108 (140) 79 (104) 99 (145)b
130 (200) 94 (229) 33 (56) 40 (98)
Gln/Gln (n = 22) 1st quarter, 1–3 months 2nd quarter, 4–6 months 3rd quarter, 7–9 months 4th quarter, 10–12 months a b c d
n = 22. n = 35. n = 36. n = 15.
150 (211) 97 (207) 78 (114) 87 (154)
Gln/Glu (n = 37) 164 (136) 130 (152) 85 (118) 93 (154)c
Glu/Glu (n = 16) 105 (105) 104 (136) 61 (88) 79 (125)d
168
A. Rauhio et al. / Maturitas 76 (2013) 165–171
Fig. 1. BMI, weight, waist and hip circumferences (mean, SE) for FTO (rs9939609:T > A) genotypes during the one-year study intervention. Total body fat mass followed the same patterns (data not shown). A p-value less than 0.05 was considered significant.
the 3-month weight reduction and 9-month weight maintenance (Fig. 2). The gynoid fat-% and total body fat-% remained significantly different between the genotypes (p = 0.028 and p = 0.092, respectively). At 3-month time point Gln homozygotes had 2.7%units (p = 0.036) and 4.1%-units (p = 0.011) lower gynoid fat-% than Gln/Glu carriers and Glu/Glu carriers, respectively. After the subsequent 9-month weight maintenance period, gynoid fat-% of the Gln homozygotes was 3.8%-units (p = 0.026) lower than that of Glu-homozygotes. The mean difference in total body fat-% also remained at the same level throughout the study being 4.0%-units (p = 0.032) and 3.4%-units (p = 0.086) lower among Gln homozygotes than among Glu homozygotes at 3 and 12-month time points, respectively (Fig. 2). 4. Discussion Our results confirm the association between the FTO polymorphism and greater body weight presented by several other research groups [5,8–10]. The ADRB2 subgroups showed no difference in total body weight or BMI. However, the homozygote ADRB2
genotype Glu/Glu was associated with the highest total body fat-% and gynoid fat-% and the lowest lean mass-% values. They also had somewhat greater hip circumference but similar waist circumference, which suggests that much of the fat tissue was distributed around the hip. We also found that neither the FTO nor the ADRB2 genotype were associated with weight loss or weight maintenance. On the contrary, the mean differences that existed between the genotypes at baseline remained similar throughout the 3 month weight reduction and 9 month weight maintenance periods. Frayling et al. were the firsts to demonstrate that the AA genotype of the FTO gene is a significant risk factor for obesity, homozygotes with a risk allele A being approximately 3 kg heavier than the homozygotes for the non-risk allele T [5]. Several studies have shown that Glu-allele of the ADRB2 gene is also associated with obesity and elevated BMI [15–17]. In men, this association seems evident [22,23], whereas in women the association with BMI seems not to be so [22–24]. Our findings are in line with these results. In our study all participants were obese (BMI at least 30), and even among them the FTO homozygotes AA were about 10 kg (11%) heavier than the corresponding TT homozygotes,
A. Rauhio et al. / Maturitas 76 (2013) 165–171
169
Fig. 2. BMI, total body fat-%, gynoid fat-% and android fat-% (mean, SE) for ADRB2 (rs1042714:Gln > Glu) genotypes during the one-year study intervention. Total body lean mass-% followed the same patterns (data not shown). A p-value less than 0.05 was considered significant.
while ADRB2 Glu-allele carriers were not significantly heavier than ADRB2 Gln/Gln homozygotes. Earlier studies have demonstrated associations between FTO genotypes and waist and hip circumferences [6,25,26]. Interestingly, in the present study the FTO homozygote genotype AA had somewhat greater waist and hip circumferences than the homozygote TT, but no difference in the DXA-measured android and gynoid fat-%. On the other hand, ADRB2 genotypes had between-group differences in fat distribution, the Glu/Glu homozygotes having greater gynoid fat-%, about 5 cm wider hip circumference, but similar waist circumference than Gln/Gln. Previous research has provided evidence that ADRB2 gene has an effect on fat distribution at the abdominal region [17,24]. In the present study Glu-allele was positively associated with gynoid fat-%, but not with android fat-%, the latter representing abdominal fat deposition. To our best knowledge, ADRB2 polymorphisms’ associations with gynoidal fat distribution have not been reported previously. Although genetic heredity accounts for obesity, the question is complicated and the findings remain inconsistent presuming that obesity has a polygenic basis [2,4]. Although all 75 participants were obese there were 16 individuals representing the heaviest AA and Glu/Glu genotypes, and both genotypes were present only in three women. At the population level in general, only few people have
the most harmful combination and therefore, environmental and behavioural factors should be primarily taken into account when treating and preventing obesity [8,27]. Low physical activity is a known risk factor for obesity [28], and interestingly in our study both heaviest FTO and ADRB2 genotypes (AA and Glu/Glu) tended to be the least active. However, it is not possible to know, if they were heavier due to less physical activity, or they were less active due to greater body mass. There is very little evidence about long-term benefits of exercise on weight loss. In their systematic review, Franz et al. showed that exercise alone did not result in successful weight loss [29]. However, high physical activity may be associated with improved maintenance of body weight [28]. The Gln/Gln genotype has been suggested to benefit from physical activity to reduce weight [30]. However, in our study the ADRB2 polymorphism was not associated with the weight reduction. On the other hand, we did not have any exercise intervention. Although the participants were advised to increase physical activity in their daily life to help to maintain the weight loss results, this counselling did not seem to work, since physical activity rather declined than increased during the study period. It is also possible that there are genderrelated differences, in Meirhaeghe’s study the participants were men [22].
170
A. Rauhio et al. / Maturitas 76 (2013) 165–171
Few studies have investigated the relationship between the FTO or ADRB2 polymorphisms and weight changes during dietary interventions [9,14,20]. Ruiz et al. found that women carrying the ADRB2 Glu allele had greater weight reduction in a 12-week low energy diet-intervention [20]. They suggest a greater weight-loss resistance and higher decrease in resting metabolic rate among Gln homozygotes after diet therapy. We did not find any association between the ADRB2 genotype and weight loss, thus our results are not in line with these findings in spite of similarities between the study groups all participants being premenopausal obese women. Razquin et al., in turn, suggest that the FTO homozygotes AA may benefit the Mediterranean-style-diet [9] indicating that the quality and composition of the diet is more important than the quantity. In the present study, all participants lost weight with VLED products, and therefore it is not possible to speculate about the dietary effect on weight reduction between the genotypes. Unfortunately, we did not have specific dietary data during the weight maintenance period when all genotype groups gained weight similarly during that period. A limitation of this study is the small number of participants. However, the frequency of the FTO minor allele A among them was 0.45, which is similar that is given in the HapMap population frequencies for the rs9939609 A allele in the Europeans [5]. The frequency of ADRB2 minor allele Glu was 0.46 in the present study, which is higher than global frequency of 0.30 given in scientific publications [19]. On the other hand, our Glu frequency has also been found in one Swedish population of obese women [16]. Thus, the allele frequencies may depend on ethnic background of the studied population. Another limitation is that the study participants represented a convenience sample of obese premenopausal women, and the results cannot thus be generalized. Therefore, it is important that further studies assess associations between FTO and ADRB2 gene polymorphisms and obesity traits also among women and men in different ages and in larger sample sizes. The strength of this study is the longitudinal study design; the weight loss intervention and long follow-up period. Further, the body composition measurements were completed by the DXA measured body composition traits; total body fat and lean mass and fat-%, and their distribution. Very few studies have applied DXA or quantitative computed tomography (QCT) in assessing body composition. Most previous studies have used conventional waist and hip circumferences to describe and interpret body composition and fat distribution traits. Furthermore, the circumferences can only roughly describe fat distribution, whereas android and gynoid fat% are more specific traits to describe fat accumulation within the body. In conclusion, among clinically healthy obese (BMI > 30) premenopausal Finnish women the FTO (rs9939609:T > A) and ADRB2 (rs1042714:Gln > Glu) polymorphisms were associated with obesity. FTO genotype was associated with body weight in general, whereas ADRB2 genotype associated with fat distribution. However, all women in the study group lost weight similarly independently of their genotypes. Neither FTO nor ADRB2 polymorphism were associated with weight reduction or weight gain during the follow-up period.
Contributors AR developed the design and conduct of the study. AR, KUR and TK were involved in elaborating specific research questions. SN, PK and HS also contributed to methodological decisions such as study sample and choice of outcome measures. AR, TK and SN provided the methodological support for biochemical laboratory assays. AR and KUR are responsible for data collection management and SN, TK and AR for statistical data analyses. AR drafted the manuscript.
All authors commented on the draft and read and approved the final version of the paper. Competing interests The authors declare that they have no competing interests. Ethical approval The study protocol was approved by the Ethics Committee of The Pirkanmaa Hospital District, and each participant gave her written informed consent prior to the intervention. Funding This study was financially supported by the Competetive Research Funding of the Tampere University Hospital (Grant 9L140) and the Juho Vainio Foundation, Helsinki, Finland. We also wish to thank National Doctoral Programme of Musculoskeletal Disorders and Biomaterials, Finland. References [1] Haslam DW, James WP. Obesity. Lancet 2005;366:1197–209. [2] Day FR, Loos RJ. Developments in obesity genetics in the era of genomewide association studies. Journal of Nutrigenetics and Nutrigenomics 2011;4:222–38. [3] Fawcett KA, Barroso I. The genetics of obesity: FTO leads the way. Trends in Genetics 2010;26:266–74. [4] Leibel RL. Energy in, energy out, and the effects of obesity-related genes. New England Journal of Medicine 2008;359:2603–4. [5] Frayling TM, Timpson NJ, Weedon MN, et al. A common variant in the FTO gene is associated with body mass index and predisposes to childhood and adult obesity. Science 2007;316:889–94. [6] Qi L, Kang K, Zhang C, et al. Fat mass- and obesity-associated (FTO) gene variant is associated with obesity: longitudinal analyses in two cohort studies and functional test. Diabetes 2008;57:3145–51. [7] Mei H, Chen W, Srinivasan SR, et al. FTO influences on longitudinal BMI over childhood and adulthood and modulation on relationship between birth weight and longitudinal BMI. Human Genetics 2010;128:589–96. [8] Kaakinen M, Laara E, Pouta A, et al. Life-course analysis of a fat mass and obesityassociated (FTO) gene variant and body mass index in the Northern Finland Birth Cohort 1966 using structural equation modeling. American Journal of Epidemiology 2010;172:653–65. [9] Razquin C, Martinez JA, Martinez-Gonzalez MA, Bes-Rastrollo M, FernandezCrehuet J, Marti A. A 3-year intervention with a Mediterranean diet modified the association between the rs9939609 gene variant in FTO and body weight changes. International Journal of Obesity 2010;34:266–72. [10] Hertel JK, Johansson S, Sonestedt E, et al. FTO, type 2 diabetes, and weight gain throughout adult life: a meta-analysis of 41,504 subjects from the Scandinavian HUNT, MDC, and MPP studies. Diabetes 2011;60:1637–44. [11] Wahlen K, Sjolin E, Hoffstedt J. The common rs9939609 gene variant of the fat mass- and obesity-associated gene FTO is related to fat cell lipolysis. Journal of Lipid Research 2008;49:607–11. [12] Speakman JR, Rance KA, Johnstone AM. Polymorphisms of the FTO gene are associated with variation in energy intake, but not energy expenditure. Obesity (Silver Spring) 2008;16:1961–5. [13] Jacobsson JA, Riserus U, Axelsson T, Lannfelt L, Schioth HB, Fredriksson R. The common FTO variant rs9939609 is not associated with BMI in a longitudinal study on a cohort of Swedish men born 1920–1924. BMC Medical Genetics 2009;10:131. [14] Muller TD, Hinney A, Scherag A, et al. ‘Fat mass and obesity associated’ gene (FTO): no significant association of variant rs9939609 with weight loss in a lifestyle intervention and lipid metabolism markers in German obese children and adolescents. BMC Medical Genetics 2008;9:85. [15] Large V, Hellstrom L, Reynisdottir S, et al. Human beta-2 adrenoceptor gene polymorphisms are highly frequent in obesity and associate with altered adipocyte beta-2 adrenoceptor function. Journal of Clinical Investigation 1997;100:3005–13. [16] Hellstrom L, Large V, Reynisdottir S, Wahrenberg H, Arner P. The different effects of a Gln27Glu beta 2-adrenoceptor gene polymorphism on obesity in males and in females. Journal of Internal Medicine 1999;245: 253–9. [17] Lange LA, Norris JM, Langefeld CD, et al. Association of adipose tissue deposition and beta-2 adrenergic receptor variants: the IRAS family study. International Journal of Obesity 2005;29:449–57. [18] Gjesing AP, Andersen G, Burgdorf KS, et al. Studies of the associations between functional beta2-adrenergic receptor variants and obesity,
A. Rauhio et al. / Maturitas 76 (2013) 165–171
[19]
[20]
[21]
[22]
[23]
hypertension and type 2 diabetes in 7808 white subjects. Diabetologia 2007;50: 563–8. Jalba MS, Rhoads GG, Demissie K. Association of codon 16 and codon 27 beta 2-adrenergic receptor gene polymorphisms with obesity: a meta-analysis. Obesity (Silver Spring) 2008;16:2096–106. Ruiz JR, Larrarte E, Margareto J, Ares R, Labayen I. Role of beta-adrenergic receptor polymorphisms on body weight and body composition response to energy restriction in obese women: preliminary results. Obesity (Silver Spring) 2011;19:212–5. Uusi-Rasi K, Rauhio A, Kannus P, et al. Three-month weight reduction does not compromise bone strength in obese premenopausal women. Bone 2010;46:1286–93. Meirhaeghe A, Helbecque N, Cottel D, Amouyel P. Impact of polymorphisms of the human beta2-adrenoceptor gene on obesity in a French population. International Journal of Obesity and Related Metabolic Disorders 2000;24:382–7. Gonzalez Sanchez JL, Proenza AM, Martinez Larrad MT, et al. The glutamine 27 glutamic acid polymorphism of the beta2-adrenoceptor gene is associated with abdominal obesity and greater risk of impaired glucose tolerance in men but not in women: a population-based study in Spain. Clinical Endocrinology (Oxford) 2003;59:476–81.
171
[24] Kunnas T, Lahtio R, Kortelainen ML, Kalela A, Nikkari ST. Gln27Glu variant of Beta2-adrenoceptor gene affects male type fat accumulation in women. Lipids in Health and Disease 2009;8:43. [25] Andreasen CH, Stender-Petersen KL, Mogensen MS, et al. Low physical activity accentuates the effect of the FTO rs9939609 polymorphism on body fat accumulation. Diabetes 2008;57:95–101. [26] Mangge H, Renner W, Almer G, Weghuber D, Moller R, Horejsi R. Rs9939609 variant of the fat mass and obesity-associated gene and trunk obesity in adolescents. Journal of Obesity 2011;2011:186368. [27] Kilpelainen TO, Qi L, Brage S, et al. Physical activity attenuates the influence of FTO variants on obesity risk: a meta-analysis of 218,166 adults and 19,268 children. PLoS Medicine 2011;8(11):e1001116. [28] Fogelholm M, Kukkonen-Harjula K. Does physical activity prevent weight gain – a systematic review. Obesity Reviews 2000;1:95–111. [29] Franz MJ, VanWormer JJ, Crain AL, et al. Weight-loss outcomes: a systematic review and meta-analysis of weight-loss clinical trials with a minimum 1-year follow-up. Journal of the American Dietetic Association 2007;107: 1755–67. [30] Meirhaeghe A, Helbecque N, Cottel D, Amouyel P. Beta2-adrenoceptor gene polymorphism, body weight, and physical activity. Lancet 1999;353:896.