- Email: [email protected]
Association of TP53 codon 72 and CDH1 genetic polymorphisms with colorectal cancer risk in Bangladeshi population
Cancer Epidemiology 49 (2017) 46–52
Contents lists available at ScienceDirect
Cancer Epidemiology The International Journal of Cancer Epidemiology, Detection, and Prevention journal homepage: www.cancerepidemiology.net
Association of TP53 codon 72 and CDH1 genetic polymorphisms with colorectal cancer risk in Bangladeshi population Sanzana Fareen Rivua,1, Mohd Nazmul Hasan Apua,1, Samia Shabnaza , Noor Ahmed Nahida , Md. Reazul Islama , Mir Md. Abdullah Al-Mamuna , Zabun Naharb , Sikder Nahidul Islam Rabbic, Maizbha Uddin Ahmeda , Mohammad Safiqul Islamd,* , Abul Hasnata a
Department of Clinical Pharmacy and Pharmacology, Faculty of Pharmacy, University of Dhaka, Dhaka 1000, Bangladesh Department of Pharmacy, University of Asia Pacific, Dhaka, Bangladesh c Pharmacogenetics Lab, Labaid Limited, Dhaka, Bangladesh d Department of Pharmacy, Noakhali Science and Technology University, Sonapur, Noakhali 3814, Bangladesh b
A R T I C L E I N F O
Article history: Received 28 January 2017 Received in revised form 6 April 2017 Accepted 16 May 2017 Available online xxx Keywords: Colorectal cancer Genetic polymorphisms TP53 codon 72 CDH1 Bangladeshi population
A B S T R A C T
Till now no pharmacogenetic study of TP53 codon 72 (Arg72Pro) and CDH1 rs16260 (-160C
1. Introduction Colorectal cancer is ascribed as a malignant tumor arising from the inner wall of the large intestine [1]. It is because of the abnormal growth of cells that have the capability to invade to other parts of the body [2]. Signs and symptoms may include a change in bowel movements, blood in the stool, weight loss, and feeling tired all the time [3]. In case of men colorectal cancer is the third most common cancer (746,000 cases, 10.0% of the total) and the second
* Corresponding author. E-mail address: research_safi[email protected] (M.S. Islam). These authors contributed equally.
1
http://dx.doi.org/10.1016/j.canep.2017.05.005 1877-7821/© 2017 Elsevier Ltd. All rights reserved.
in women (614,000 cases, 9.2% of the total) worldwide [4,5]. Mortality is lower (694,000 deaths, 8.5% of the total) with more deaths (52%) in the less developed regions of the world, indicating a poorer survival in these regions [4,5]. Epidemiological studies have ascertained that colorectal cancer is associated with familial and hereditary factors, age as well as environmental and lifestyle-related risk factors for example obesity, physical inactivity, alcohol consumption and smoking [6–9]. A recent study on twins has reported that 35% of all colorectal cancer can be acquired from inherited genetic susceptibility [10,11]. Sporadic colorectal cancer is usually seen in 70% to 75% of cases [12]. The risk factor of the disease is delineated from the interrelation between the breast cancer risk and SNPs of various genes [13].
S.F. Rivu et al. / Cancer Epidemiology 49 (2017) 46–52
TP53 gene which is known as the guardian of the genome, is accountable for induction of cell cycle arrest and apoptosis. The cell cycle arrest in the G1, G2 and S phases is induced by p53and this induction provides an additional time for the repairing of genomic damage before entering the different stages of DNA synthesis and mitosis [14,15]. p53 also induces apoptosis to eliminate damaged cells [16]. The R72 variant is known to be an inducer of apoptosis rather than the P72 variant [17,18]. Therefore, the absence of arginine would induce cancer. Six studies have reported the association of colorectal cancer (CRC) risk with Pro72 allele [19–24]. The transmembrane glycoprotein E-cadherin, encoded by a tumor suppressor gene CDH1 [25], is crucial for epithelial cell intercellular adhesion, cell polarity, cell signaling, tissue morphology, and maintenance of cellular differentiation [26]. Loss of Ecadherin function or expression results in reduced intercellular adhesion, increasing cellular motility. As a consequence of these events, carcinoma cells may find a free-pass to diffuse through the basement membrane and invade surrounding tissues [26]. Recently, a C/A single nucleotide polymorphism has been identified in the promoter region of the E-cadherin gene that is located160 base pairs upstream of the transcriptional start site [27]. It has been shown that the A allele has the reduced transcriptional efficiency (about 10–68%) compared with the wild type C allele [27–29]. It was also observed that the C allele showed much higher binding affinity to transcriptional factor than the mutant allele, suggesting that the 160C/A variant may alter transcriptional activity of the E-cadherin gene and be responsible for reduced E-cadherin expression. So the common polymorphism of the CDH1 promoter, at nucleotide-160 relative to the transcription start (CDH1-160 C >A; rs16260), has been described to affect CDH1 expression [30] and hence may directly influence susceptibility to cancer. In different ethnic groups it has been recognized as a risk factor for lung, breast, prostate, colorectal, gastric and endometrial cancers [31–33]. Moreover, a recently conducted casecontrol study on Bangladeshi population revealed a high risk association between TP53 Arg72Pro and CDH1 rs16260 polymorphisms and breast cancer development [26]. Since TP53 Arg72pro and CDH1 rs16260 polymorphisms has been proven to be a risk factor of colorectal cancer in different ethnicities [20–24,31–33] and also for breast cancer development in Bangladeshi population [26], there might have a correlation between TP53 Arg72Pro and CDH1rs16260 polymorphisms with colorectal cancer risk in Bangladeshi population. Furthermore, no study has been conducted regarding this possible correlation in Bangladeshi population. We, therefore, expect to find out that probable association of TP53 Arg72Pro and CDH1 rs16260 genetic polymorphisms with colorectal cancer risk in Bangladeshi population for the very first time.
47
2. Materials and methods 2.1. Study population Total 288 colorectal cancer patients were recruited during the period of February 2015 to November 2015. All patients were histologically diagnosed with colorectal cancer who reported in National Institute of Cancer research and Hospital (NICHR), Ahasania Mission Cancer Hospital, Dhaka Medical College Hospital (DMCH), Bangabandhu Sheikh Mujib Medical University (BSMMU). Another 295 healthy volunteers were included in this case-control study matched by age and sex with the patients. All the information was collected by trained nurses in presence of physicians through a detailed questionnaire. All patients and/or legal guardians signed a written consent and ethical committee of the respective hospitals approved all the ethical issues regarding the study. The study was conducted according to the description of Helsinki and its following revisions [34] and the genotyping analysis was performed in the laboratory of pharmacogenetics and pharmacokinetics of the Department of Clinical Pharmacy and Pharmacology, Faculty of Pharmacy, University of Dhaka, Bangladesh. 2.2. Genotyping Genomic DNA was isolated from the blood samples collected from all patients according to our published method [35]. Amplification of genomic DNA was performed using the predesigned forward and reverse primers [26]. PCR-restriction fragment length polymorphism (RFLP) method was used to genotype both the TP53 Arg72Pro and CDH1 rs16260 allele. PCR products of 309 bp and 217 bp were obtained for TP53 Arg72Pro and CDH1rs16260 SNPs respectively. Conditions for PCR amplifications are presented in Table 1. Digestion of 309 bp PCR product of TP53 Arg72Pro was done with BstUI (NEB, USA) by incubating at 60 C for 4 h which generated two fragments of 175 bp & 134 bp in case of Arg allele while for Pro allele it generated only one fragment of 309 bp. Restriction enzyme HincII (NEB, USA) (37 C overnight) cleaved the A allele of CDH1 rs16260 giving two fragments of 129 bp & 88 bp but did not cleaved the C allele (only one fragment of 217 bp). These DNA fragments were stained with ethidium bromide and visualized on 2% agarose gel electrophoresis (Figs. 1 and 2). More than 25% of samples were randomly re-evaluated for confirmation. 2.3. Statistical analysis Statistical analyses were performed using SPSS software package, version 17.0 (SPSS, Inc., Chicago, IL). Deviation of genotype frequencies in the control group from patient group under Hardy–
Table 1 Primers, PCR conditions, restriction enzymes (RE), and expected DNA fragments on digestion to determine the genotype. Allele
Primer Sequence
PCR Conditions
RE
DNA fragments
Codon 72
FP 50 -TTCACCCATCTACAGTCC-30 RP 50 -CTCAGGGCAACTGACCGT-30
94 C 30 s 54 C 30 s 72 C 30 s
BstUI
NH 175,134 HE 309, 175, 134 MH 309
CDH1
FP 50 - GTGTAAAAGCCCTTTCTGATCCC -30 RP 50 - CACCTGCCGGCCACAGCCAATCA -30
94 C 40 s 56 C 30 s 72 C 50 s
HincII
NH 217 HE 217, 129, 88 MH 129, 88
FP = Forward Primer; RP = Reverse Primer; RE = Restriction Enzyme; NH = Normal Homozygote; HE = Heterozygote; MH = Mutant Homozygote.
48
S.F. Rivu et al. / Cancer Epidemiology 49 (2017) 46–52
The Male/Female ratio for patient group is 1.5 and that for control group is 1.2. The most prevalent primary tumor site is colon (63.2%) and the majority of the patients had stage II disease (37.2%) (Table 2). In case of CDH1 rs16260 polymorphism, parameters like female patients (OR = 1.83, 95% CI = 1.13–2.92, p < 0.05), stage III disease patients (OR = 2.03, 95% CI = 1.12–2.66, p < 0.05) were found to have a statistically significant risk association with colorectal cancer (Table 3). No other parameter was found to be significantly associated with TP53 rs1042522 and CDH1 rs16260 polymorphisms. 3.2. TP53 rs1042522 polymorphism
Fig. 1. Restriction Endonuclease (BstUI) digestion fragment of p53 with codon 72 polymorphism (2% agarose gel). Lane M: 50 bp molecular marker; Lane 1–9: Restriction digestion products; Lane 5 shows the wild (Arg/Arg) form(175 and 134 bp); Lanes 1, 2, 4, 6, 8 and 9 show the heterozygous (Arg/Pro) form(309, 175 and 134 bp); Lanes 3 and 7 show the mutant (Pro/Pro) form(309 bp).
Fig. 1 shows the DNA fragment patterns of BstUI digestion of the PCR product carried out to identify the variations at codon 72. Two bands (175 bp & 134 bp) in lane 5 demonstrated Arg/Arg homozygous genotype, three bands (309 bp, 175 bp & 134 bp) in lanes 1, 2, 4, 6, 8 and 9 demonstrated Arg/Pro heterozygous genotype and one band (309 bp) in lanes 3 and 7 indicated the presence of Pro/Pro mutant homozygous genotypes. The genotype frequencies in cases and controls are presented in Table 4. The percent distribution of Arg/Arg homozygous genotype was statistically lower in patients than in controls (30.9% vs. 53.9%). Patients carrying Arg/Pro heterozygous genotype was found to have 2.58-fold elevated risk of colorectal cancer compared to Arg/ Arg genotype carriers (adjusted OR = 2.58, 95% CI = 1.77–3.77, p < 0.05). The Pro/Pro genotype was statistically found to be responsible for colorectal cancer (adjusted OR = 2.92, 95% CI = 1.78– 4.78, p < 0.05) and shows 2.92 times greater risk of developing colorectal cancer. Similarly, the combination of Arg/Pro & Pro/Pro genotype also increased the colorectal cancer risk significantly (adjusted OR = 2.70, 95% CI = 1.90–3.82, p < 0.05). 3.3. CDH1 rs16260 polymorphism Digestion by HincII illustrated the mutation of CHD1 rs16260 (Fig. 2). Complete digestion of 217 bp fragment into 129 bp and 88 bp fragments demonstrated that both alleles were A/A mutant homozygous (lane 5). Lanes 1, 2, 4, 8 and 9 showed incomplete digestion that indicated the presence of C/A heterozygous form. Both alleles were C/C in lanes 3, 6 and 7. The frequency of C/C genotype was found higher for both patient and control and considered to be the reference. Number of patients carrying C/A heterozygous genotype is higher than that of in control group (36.5% vs 24.1%) and comprises a high risk factor of
Fig. 2. Restriction Endonuclease (HincII) digestion fragment of CDH1 rs16260 (2% agarose gel). Lane M: 50 bpmolecularmarker; Lane 1–9: Restriction digestion products; Lanes 3, 6 and 7 show the wild (C/C) form (217 bp); Lanes 1, 2, 4, 8 and 9 show the heterozygous (C/A) form (217, 129 and 88 bp); Lane 5 shows the mutant (A/A) form (129 and 88 bp).
Weinberg equilibrium (HWE) was measured by chi-square test (x2). A multivariate logistic regression analysis was performed to assess the odd ratios (OR) and 95% confidence interval adjusted to age and sex. In all of the analyses, p < 0.05 was considered as statistical significant. 3. Results 3.1. Characteristics of study population The study included 172 males (59.7%) and 116 females (40.3%) colorectal cancer patients with a mean age of 54 years (range 23–68) and the control group comprised of 163 males (55.3%) and 132 females (44.7%) with a mean age of 51.5 years (range 31–71).
Table 2 Demographic characteristics of the patients and controls. Variables
Cases n = 288 (%)
Controls n = 295 (%)
Age (years) <45 45–60 >60
33 (11.46) 182 (63.19) 73 (25.35)
95 (32.20) 170 (57.63) 30 (10.17)
Sex Male Female
172 (59.72) 116 (40.28)
163 (55.25) 132 (44.75)
Primary tumor location Colon Rectum
182 (63.19) 106 (36.81)
Tumor Stage I II III IV
54 (18.75) 107 (37.15) 99 (34.38) 28 (9.72)
S.F. Rivu et al. / Cancer Epidemiology 49 (2017) 46–52
49
Table 3 Correlation of TP53 Arg72Pro and CDH1 rs16260 polymorphisms with clinicopathological characteristics of the patients. Characteristics
TP53 Carrier (n = 199)
TP53 Noncarrier (n = 89)
OR (95% CI)
pvalue
CDH1 Carrier (n = 126)
CDH1 Noncarrier (n = 162)
OR (95% CI)
p-value
53
15
>0.05
28
40
92
55
>0.05
59
88
>60
54
19
>0.05
39
34
45–60 + >60
146
74
–
98
122
0.87 (0.50– 1.51) 0.83 (0.55– 1.27) 1.43 (0.84– 2.43) Ref
>0.05
45–60
1.79 (0.95– 3.39) 0.85 (0.55– 1.31) 1.44 (0.80– 2.61) Ref
Sex Male Female
125 74
47 42
Ref 0.66 (0.40– 1.10)
– >0.05
65 61
107 55
Ref 1.83 (1.13– 2.92)
– <0.05
Tumor Location Colon Rectum
125 74
57 32
Ref 1.05 (0.63– 1.77)
– >0.05
75 51
107 55
Ref 1.32 (0.82– 2.14)
– >0.05
Tumor Stage I II
36 74
18 33
– >0.05
28 44
26 63
71
28
>0.05
44
55
IV
18
10
>0.05
10
18
Ref 1.77 (0.98– 3.17) 2.03 (1.12– 3.66) 1.41 (0.58– 3.42)
– >0.05
III
Ref 1.12 (0.56– 2.26) 1.27 (0.62– 2.59) 0.90 (0.35– 2.35)
Age <45
>0.05 >0.05 –
<0.05 >0.05
Table 4 Genotype frequencies of TP53 Arg72Pro and CDH1 rs16260 gene polymorphisms in cases and controls. Genotype
Cases n = 288 (%)
Control n = 295 (%)
Adjusted Odd ratio (95% CI)
p- value
TP53 Arg72Pro Arg/Arg Arg/Pro Pro/Pro Arg/Pro + Pro/Pro
89 (30.90) 138 (47.92) 61 (21.18) 199 (69.10)
159 (53.90) 98 (33.22) 38 (12.88) 136 (46.10)
Ref 2.58 (1.77–3.77) 2.92 (1.78–4.78) 2.70 (1.90–3.82)
– <0.05 <0.05 <0.05
CDH1 rs16260 C/C C/A A/A C/A + A/A
162 (56.25) 105 (36.46) 21 (7.29) 126 (43.75)
215 (72.88) 71 (24.07) 9(3.05) 80 (27.12)
Ref 1.94 (1.34–2.81) 2.63 (1.15–6.01) 2.02 (1.42–2.87)
– <0.05 <0.05 <0.05
1.94 to develop colorectal cancer in comparison with the C/C homozygote. The C/A heterozygote is found to be significantly increased the risk of developing colorectal cancer (adjusted OR = 1.94, 95% CI = 1.34–2.81, p < 0.05). The A/A mutant has the highest risk factor compared to C/C reference with an OR of 2.63 and has been found statistically significant (adjusted OR = 2.63; 95% CI = 1.15–6.01, p < 0.05). The combined C/A and A/A genotype is also significantly associated with colorectal cancer (adjusted OR = 2.02; 95% CI = 1.42–2.87, p < 0.05) (Table 3). 4. Discussion Mutations of TP53 gene are responsible for almost half of all colorectal cancer [36]. SNPs are the most common form of genetic variation. Till now more than 200 SNPs have been identified for TP53 [37]. But the most presumptively functional one, TP53 Arg72Pro, has been known for its importance in growth suppression and apoptotic functions [38]. Studies revealed that the homozygote Arg72 allele has 15-fold higher apoptosis inducing activity than does the Pro72 allele [39]. This high apoptosis inducing capability is because of its mitochondrial location which makes it possible for p53 to have a direct interaction with pro-
apoptotic BAK protein [40]. Therefore, the R72 allele has been considered as an allele of low penetrability for colorectal cancer susceptibility [21–24]. Consequently, the less apoptotic allele Pro72 represents an increased capability to proliferate cancer cell and thus leads to colorectal tumors [39]. In addition, the prevalence of Pro allele is very common in Bangladeshi population. Mostaid et al. [41] and Shabnaz et al. [26] reported that the frequencies of Pro allele were 31.5% and 35.2% in control and 55.7% and 35% in patient groups, respectively. Therefore, TP53 Arg72Pro polymorphism could be a critical biomarker in modifying the risk of colorectal cancer for Bangladeshi population. Several case–control studies have examined the association between the p53 codon 72 polymorphism and the risk of colorectal cancer in different ethnic groups within consistent findings (Table 5). For example, in a Chinese study of 345 colorectal cancer patients and 670 healthy controls, Zhu et al. [42] showed that patients carrying the Pro/Pro genotype (24.6% in patient vs 15.7% in control) had high risk of developing colorectal cancer. Gemignani et al. [24] analyzed 374 cases of colorectal cancer patient and 322 controls and showed a positive association between Arg/Pro + Pro/ Pro genotypes and colorectal cancer (42.9% in patient vs 36.1% in control with OR = 1.34). In contrary, three independent studies
50
S.F. Rivu et al. / Cancer Epidemiology 49 (2017) 46–52
Table 5 Comparison of previous association studies between TP53 codon 72 SNP and CRC with the present study. Author
No of cases
Arg/Arg%
Arg/Pro%
Pro/Pro%
Association Status
Population
Engin et al. [57] Koushik et al. [46] Kruger et al. [58] Mojtahedi et al. [59] Aizat et al. [60] Cao et al. [21] Doosti et al. [61] Gemignani et al. [24] Sameer et al. [20] Singamsetty et al. [62] Zhu et al. [42] Tan et al. [63] Present study
96 442 126 132 202 156 145 352 86 103 345 467 288
52.1 51.6 62.7 34.8 35 34.6 33.8 57.1 11.6 15.5 24.1 66.8 53.9
42.7 42.1 32.5 47.8 44 43 53.8 37.8 43 46.6 51.3 28.1 33.2
5.2 6.3 4.8 17.4 21 22.4 12.4 5.1 45.4 37.9 24.6 5.1 12.9
No association No association No association No association Pro72 associated with "CRC risk Pro72 associated with "CRC risk Arg/Pro associated with "CRC risk Pro72 associated with "CRC risk Pro72 associated with "CRC risk Pro72 associated with "CRC risk Pro72 associated with "CRC risk Pro72 associated with #CRC risk Arg/Pro & Pro/Pro associated with "CRC risk
Turkey USA Germany Iran Malaysia Korea Iran Spain North India South India China Germany Bangladesh
Table 6 Comparison of previous association studies between CDH1 rs16260 SNP and CRC with the present study. Author
No of cases
C/C%
C/A%
A/A%
Association Status
Population
Porter et al. [51] Shin et al. [52] Tan et al. [53] Cattaneo et al. [32] Pittman et al. [64] Present study
290 260 498 106 5679 288
55.5 71.9 51.6 49.1 54.1 56.2
41.4 25.4 42 41.5 38.9 36.5
3.1 2.7 6.4 9.4 7 7.3
No association No association No association "Association with CRC risk "Association with CRC risk C/A & C/A + A/A associated with "CRC risk
England South Korea German Italy UK Bangladesh
conducted among Caucasian population with small number of samples revealed an increased risk of developing colorectal cancer in relationship with Arg/Arg genotype [43–45], while a large sample based study in United States found no association between the p53 codon 72 polymorphism and the risk of colorectal cancer [46]. In case of our study we found that individual carrying Arg/Pro heterozygous and Pro/Pro mutant homozygous alleles possess 2.58 and 2.92-fold increased risk of developing colorectal cancer compared to control group, respectively and both of these findings are counted as statistically significant. In addition, Arg/Pro + Pro/ Pro genotype together also increased the risk of colorectal cancer development (adjusted OR = 2.70). These results corroborate with the findings of Gemignani et al. [24] and Zhu et al. [42]. The percent distribution of Arg/Arg homozygosity in CRC patients compared to control group (30.9% in patient vs 53.9% in control) is also in support with these findings [24,42] which indicates that loss of Arg/Arg homozygosity might have a role in CRC development, but it is needed to be proven with more elaborate investigation. E-cadherin, commonly known as CDH1, is one of the principal mediators of cell signaling, intercellular adhesion and cellular differentiation. The genetic variation in the CDH1 gene changes in the cellular polarity and cell-to-cell adhesion that is finally responsible for tumor progression and metastasis [47–49]. Several studies have been conducted to investigate the association between CDH1 polymorphism and colorectal cancer predisposition with contradictory results. It is possible that due to the selection criteria for patients and controls and frequency differences between different ethnic groups the association between the risk genotype and CRC showed this disparity (Table 6). In the present study, we reported a significant association between the CDH1 polymorphism and colorectal cancer risk in Bangladeshi population for the first time. Frequencies of C/A and A/ A genotype were found to be 36.5% and 7.3% respectively. Cattaneo et al. [32] suggested the similar findings with an OR of 1.66 for C/A heterozygotes and A/A mutant homozygotes versus C/C common homozygotes (95% CI = 1.00–2.74) in a case-control study
comprising of 246 controls and 106 CRC patients. Our study also revealed that A/A genotype increased risk of colorectal cancer by 2.63-fold in comparison with C/C genotype. The percent frequency of A/A genotype was higher in colorectal cancer patients than unaffected controls (7.3% vs. 3.1%) (p < 0.05) which is in tune with Chu et al. [50] (14% in patient vs 4% in control) depicting a significant increase in risk among CDH1 160A allele carriers. Along with this, the combination of C/A + A/A genotype having an adjusted odds ratio of 2.02 also comprised a significant risk association with colorectal cancer in Bangladeshi population (p < 0.05). Other studies like Porter et al. [51], Shin et al. [52], Tan et al. [53], de Lima et al. [54], Wang et al. [55] and Zhong-zheng et al. [56] failed to correlate between CDH1 160C>A gene polymorphism and CRC susceptibility and disagreed with our results. As per our results, the -160A may be considered as a disease risk-conferring allele in causing colorectal cancer in Bangladeshi population. However, our study has a small sample size resulting in low power to detect genotype-disease associations and geneenvironment interactions; therefore, further study with large sample size is required. Functional consequences of these SNPs are also needed to be investigated further in order to get more conclusive result. 5. Conclusion In summary, our case-control study data suggesting that a significant association exists between Arg/Pro heterozygosity and Pro/Pro mutant homozygosity at codon 72 of TP53 and colorectal cancer predisposition. Our results also depict that A allele and combined genotype of C/A and A/A of CDH1 represent an elevated risk of colorectal cancer development in Bangladeshi population. Therefore, TP53 and CDH1 genetic polymorphism and colorectal cancer risk is an important research area that needs much more attention. Studies with larger samples may reveal more statistically significant data and unravel vital genetic events that actually lead to the development of colorectal cancer.
S.F. Rivu et al. / Cancer Epidemiology 49 (2017) 46–52
Conflicts of interest None. Authorship contribution SFR, MNHA: designed and conducted the study; analyzed and interpreted data; prepared the manuscript; SS, NAN: conceptualized the study and helped in drafting the manuscript; MRI, MMAA, ZN, SNIR, MUA, AH, MSI: analyzed and interpreted data; edited and critically reviewed manuscript. All authors read and approved the final manuscript. Acknowledgement The authors are thankful to the many patients, volunteers, nurses, physicians and scientists of National Institute of Cancer research and Hospital (NICHR), Ahasania Mission Cancer Hospital, Dhaka Medical College Hospital (DMCH), Bangabandhu Sheikh Mujib Medical University (BSMMU). The authors are also thankful to the Department of Clinical Pharmacy and Pharmacology, Faculty of Pharmacy, University of Dhaka, Bangladesh to give the opportunity to carry out the whole research work. References [1] http://www.medicinenet.com/colon_cancer/article.htm. Accessed 29 March 2017. [2] Defining Cancer. National Cancer Institute. https://www.cancer.gov/aboutcancer/understanding/what-is-cancer. Accessed 29 March 2017 [3] General Information about Colon Cancer NCI. 2014-05-12. https://www. cancer.gov/types/colorectal/patient/colon-treatment-pdq. Accessed 29 March 2017. [4] J. Ferlay, I. Soerjomataram, M. Ervik, R. Dikshit, S. Eser, C. Mathers, M. Rebelo, D. M. Parkin, D. Forman, F. Bray, GLOBOCAN 2012 v1. 0, Cancer Incidence and Mortality Worldwide: IARC Cancer Base No. 11 [Internet], International Agency for Research on Cancer, Lyon, France, 2013 (Available from: http://globocan. iarc.fr. Accessed 29 March 2016). [5] F. Bray, J.S. Ren, E. Masuyer, J. Ferlay, Global estimates of cancer prevalence for 27 sites in the adult population in 2008, Int. J. Cancer 132 (5) (2013) 1133–1145. [6] F.A. Haggar, R.P. Boushey, Colorectal cancer epidemiology: incidence, mortality, survival, and risk factors, Clin. Colon Rectal Surg. 22 (4) (2009) 191–197. [7] L.A.G. Ries, D. Melbert, M. Krapcho, D.G. Stinchcomb, N. Howlader, M.J. Horner, A. Mariotto, B.A. Miller, E.J. Feuer, S.F. Altekruse, D.R. Lewis, L. Clegg, M.P. Eisner, M. Reichman, B.K. Edwards, SEER Cancer Statistics Review, 1975–2005, National Cancer Institute, Bethesda, MD, 2008 (http://seer.cancer.gov/csr/ 1975_2005/, based on November 2007 SEER data submission posted to the SEER web site). [8] A.L. Zisman, A. Nickolov, R.E. Brand, A. Gorchow, H.K. Roy, Associations between the age at diagnosis and location of colorectal cancer and the use of alcohol and tobacco: implications for screening, Arch. Intern. Med. 166 (6) (2006) 629–634. [9] W.H. Tsong, W.P. Koh, J.M. Yuan, R. Wang, C.L. Sun, M.C. Yu, Cigarettes and alcohol in relation to colorectal cancer: the Singapore Chinese Health Study, Br. J. Cancer 96 (5) (2007) 821–827. [10] P. Lichtenstein, N.V. Holm, P.K. Verkasalo, A. Iliadou, J. Kaprio, M. Koskenvuo, E. Pukkala, A. Skytthe, K. Hemminki, Environmental and heritable factors in the causation of cancer—analyses of cohorts of twins from Sweden, Denmark, and Finland, N. Engl. J. Med. 343 (2) (2000) 78–85. [11] K. Hemminki, B. Chen, Familial risk for colorectal cancers are mainly due to heritable causes, Cancer Epidemiol. Biomarkers Prev. 13 (7) (2004) 1253–1256. [12] F. Amersi, M. Agustin, C.Y. Ko, Colorectal cancer: epidemiology, risk factors, and health services, Clin. Colon Rectal Surg. 18 (3) (2005) 133–140. [13] A. Rudolph, J. Chang-Claude, M.K. Schmidt, Gene-environment interaction and risk of breast cancer, Br. J. Cancer 114 (2) (2016) 125–133. [14] M.L. Agarwal, A. Agarwal, W.R. Taylor, G.R. Stark, p53 controls both the G2/M and the G1 cell cycle checkpoints and mediates reversible growth arrest in human fibroblasts, Proc. Natl. Acad. Sci. U. S. A. 92 (18) (1995) 8493–8497. [15] J. Zhou, J. Ahn, S.H. Wilson, C. Prives, A role for p53 in base excision repair, EMBO J. 20 (4) (2001) 914–923. [16] L.J. Hofseth, S.P. Hussain, C.C. Harris, p53: 25 years after its discovery, Trends Pharmacol. Sci. 25 (4) (2004) 177–181. [17] D. Pim, L. Banks, p53 polymorphic variants at codon 72 exert different effects on cell cycle progression, Int. J. Cancer 108 (2) (2004) 196–199. [18] C. Whibley, P.D. Pharoah, M. Hollstein, p53 polymorphisms: cancer implications, Nat. Rev. Cancer 9 (2) (2009) 95–107.
51
[19] H.R. Song, S.S. Kweon, H.N. Kim, J.M. Piao, W.J. Yun, J.S. Choi, J.E. Hwang, J.Y. Yoon, H.R. Kim, Y.K. Park, S.H. Kim, Y.D. Choi, M.H. Shin, p53 codon 72 polymorphism in patients with gastric and colorectal cancer in a Korean population, Gastric Cancer 14 (3) (2011) 242–248. [20] A.S. Sameer, Z.A. Shah, N. Syeed, M.Z. Banday, S.M. Bashir, B.A. Bhat, M.A. Siddiqi, TP53 Pro47Ser and Arg72Pro polymorphisms and colorectal cancer predisposition in an ethnic Kashmiri population, Genet. Mol. Res. 9 (2) (2010) 651–660. [21] Z. Cao, J.H. Song, Y.K. Park, E.J. Maeng, S.W. Nam, J.Y. Lee, W.S. Park, The p53 codon 72 polymorphism and susceptibility to colorectal cancer in Korean patients, Neoplasma 56 (2) (2009) 114–118. [22] J.E. Goodman, L.E. Mechanic, B.T. Luke, S. Ambs, S. Chanock, C.C. Harris, Exploring SNP-SNP interactions and colon cancer risk using polymorphism interaction analysis, Int. J. Cancer 118 (7) (2006) 1790–1797. [23] C. Perfumo, L. Bonelli, P. Menichini, A. Inga, V. Gismondi, E. Ciferri, P. Percivale, G. Bianchi Scarra, S. Nasti, G. Fronza, L. Varesco, Increased risk of colorectal adenomas in Italian subjects carrying the p53 PIN3 A2-Pro72 haplotype, Digestion 74 (3–4) (2006) 228–235. [24] F. Gemignani, V. Moreno, S. Landi, N. Moullan, A. Chabrier, S. GutierrezEnriquez, J. Hall, E. Guino, M.A. Peinado, G. Capella, F. Canzian, A TP53 polymorphism is associated with increased risk of colorectal cancer and with reduced levels of TP53 mRNA, Oncogene 23 (10) (2004) 1954–1956. [25] D.G. Huntsman, C. Caldas, Assignment of the E-cadherin gene (CDH1) to chromosome 16q22.1 by radiation hybrid mapping, Cytogenet. Cell Genet. 83 (1–2) (1998) 82–83. [26] S. Shabnaz, M.U. Ahmed, M.S. Islam, M.R. Islam, M.M. Al-Mamun, M.S. Islam, A. Hasnat, Breast cancer risk in relation to TP53 codon 72 and CDH1 gene polymorphisms in the Bangladeshi women, Tumour Biol. 37 (6) (2016) 7229–7237. [27] L.C. Li, R.M. Chui, M. Sasaki, K. Nakajima, G. Perinchery, H.C. Au, D. Nojima, P. Carroll, R. Dahiya, A single nucleotide polymorphism in the E-cadherin gene promoter alters transcriptional activities, Cancer Res. 60 (4) (2000) 873–876. [28] H. Lei, S. Sjoberg-Margolin, S. Salahshor, B. Werelius, E. Jandakova, K. Hemminki, A. Lindblom, I. Vorechovsky, CDH1 mutations are present in both ductal and lobular breast cancer, but promoter allelic variants show no detectable breast cancer risk, Int. J. Cancer 98 (2) (2002) 199–204. [29] A. Nakamura, T. Shimazaki, K. Kaneko, M. Shibata, T. Matsumura, M. Nagai, R. Makino, K. Mitamura, Characterization of DNA polymorphisms in the Ecadherin gene (CDH1) promoter region, Mutat. Res. 502 (1–2) (2002) 19–24. [30] G.Y. Wang, C.Q. Lu, R.M. Zhang, X.H. Hu, Z.W. Luo, The E-cadherin gene polymorphism 160C->A and cancer risk: a HuGE review and meta-analysis of 26 case-control studies, Am. J. Epidemiol. 167 (1) (2008) 7–14. [31] F.M. Richards, S.A. McKee, M.H. Rajpar, T.R. Cole, D.G. Evans, J.A. Jankowski, C. McKeown, D.S. Sanders, E.R. Maher, Germline E-cadherin gene (CDH1) mutations predispose to familial gastric cancer and colorectal cancer, Hum. Mol. Genet. 8 (4) (1999) 607–610. [32] F. Cattaneo, T. Venesio, S. Molatore, A. Russo, R. Fiocca, M. Frattini, A.I. Scovassi, L. Ottini, L. Bertario, G.N. Ranzani, Functional analysis and case-control study of -160C/A polymorphism in the E-cadherin gene promoter: association with cancer risk, Anticancer Res. 26 (6b) (2006) 4627–4632. [33] L.X. Qiu, R.T. Li, J.B. Zhang, W.Z. Zhong, J.L. Bai, B.R. Liu, M.H. Zheng, X.P. Qian, The E-cadherin (CDH1)-160C/A polymorphism and prostate cancer risk: a meta-analysis, Eur. J. Hum. Genet. 17 (2) (2009) 244–249. [34] World Medical Association Declaration of Helsinki, Ethical principles for medical research involving human subjects, Adopted by 64th WMA General Assembly, Fortaleza, Brazil, October 2013, 2008. [35] M.S. Bin Sayeed, M.N. Hasan Apu, M.T. Munir, M.U. Ahmed, M.S. Islam, M.M. Haq, C.H. Ahsan, M.A. Rashid, J.G. Shin, A. Hasnat, Prevalence of CYP2C19 alleles, pharmacokinetic and pharmacodynamic variation of clopidogrel and prasugrel in Bangladeshi population, Clin. Exp. Pharmacol. Physiol. 42 (5) (2015) 451–457. [36] C.C. Harris, M. Hollstein, Clinical implications of the p53 tumor-suppressor gene, N. Engl. J. Med. 329 (18) (1993) 1318–1327. [37] http://www-p53.iarc.fr, Accessed 29 March 2017. [38] T. Soussi, G. Lozano, p53 mutation heterogeneity in cancer, Biochem. Biophys. Res. Commun. 331 (3) (2005) 834–842. [39] P. Dumont, J.I. Leu, A.C. Della Pietra 3rd, D.L. George, M. Murphy, The codon 72 polymorphic variants of p53 have markedly different apoptotic potential, Nat. Genet. 33 (3) (2003) 357–365. [40] J.I. Leu, P. Dumont, M. Hafey, M.E. Murphy, D.L. George, Mitochondrial p53 activates Bak and causes disruption of a Bak-Mcl1 complex, Nat. Cell Biol. 6 (5) (2004) 443–450. [41] M.S. Mostaid, M.U. Ahmed, M.S. Islam, M.S. Bin Sayeed, A. Hasnat, Lung cancer risk in relation to TP53 codon 47 and codon 72 polymorphism in Bangladeshi population, Tumour Biol. 35 (10) (2014) 10309–10317. [42] Z.Z. Zhu, A.Z. Wang, H.R. Jia, X.X. Jin, X.L. He, L.F. Hou, G. Zhu, Association of the TP53 codon 72 polymorphism with colorectal cancer in a Chinese population, Jpn. J. Clin. Oncol. 37 (5) (2007) 385–390. [43] L.O. Perez, M.C. Abba, F.N. Dulout, C.D. Golijow, Evaluation of p53 codon 72 polymorphism in adenocarcinomas of the colon and rectum in La Plata, Argentina, World J. Gastroenterol. 12 (9) (2006) 1426–1429. [44] A. Dakouras, N. Nikiteas, E. Papadakis, M. Perakis, D. Valis, G. Rallis, N. Tzanakis, G. Peros, C. Tsigkris, C. Kittas, P. Karakitsos, P53Arg72 homozygosity and its increased incidence in left-sided sporadic colorectal adenocarcinomas, in a Greek-Caucasian population, Anticancer Res. 28 (2a) (2008) 1039–1043.
52
S.F. Rivu et al. / Cancer Epidemiology 49 (2017) 46–52
[45] E. Mammano, C. Belluco, M. Bonafe, F. Olivieri, E. Mugianesi, C. Barbi, M. Mishto, M. Cosci, C. Franceschi, M. Lise, D. Nitti, Association of p53 polymorphisms and colorectal cancer: modulation of risk and progression, Eur. J. Surg. Oncol. 35 (4) (2009) 415–419. [46] A. Koushik, G.J. Tranah, J. Ma, M.J. Stampfer, H.D. Sesso, C.S. Fuchs, E.L. Giovannucci, D.J. Hunter, p53 Arg72Pro polymorphism and risk of colorectal adenoma and cancer, Int. J. Cancer 119 (8) (2006) 1863–1868. [47] A. Jeanes, C.J. Gottardi, A.S. Yap, Cadherins and cancer: how does cadherin dysfunction promote tumor progression? Oncogene 27 (55) (2008) 6920–6929. [48] S. Baranwal, S.K. Alahari, Molecular mechanisms controlling E-cadherin expression in breast cancer, Biochem. Biophys. Res. Commun. 384 (1) (2009) 6–11. [49] A. Beeghly-Fadiel, W. Lu, Y.T. Gao, J. Long, S.L. Deming, Q. Cai, Y. Zheng, X.O. Shu, W. Zheng, E-cadherin polymorphisms and breast cancer susceptibility: a report from the Shanghai Breast Cancer Study, Breast Cancer Res. Treat. 121 (2) (2010) 445–452. [50] C.M. Chu, C.J. Chen, D.C. Chan, H.S. Wu, Y.C. Liu, C.Y. Shen, T.M. Chang, J.C. Yu, H. J. Harn, C.P. Yu, M.H. Yang, CDH1 polymorphisms and haplotypes in sporadic diffuse and intestinal gastric cancer: a case-control study based on direct sequencing analysis, World J. Surg. Oncol. 12 (2014) 80, doi:http://dx.doi.org/ 10.1186/1477-7819-12-80. [51] T.R. Porter, F.M. Richards, R.S. Houlston, D.G. Evans, J.A. Jankowski, F. Macdonald, G. Norbury, S.J. Payne, S.A. Fisher, I. Tomlinson, E.R. Maher, Contribution of cyclin d1 (CCND1) and E-cadherin (CDH1) polymorphisms to familial and sporadic colorectal cancer, Oncogene 21 (12) (2002) 1928–1933. [52] Y. Shin, I.J. Kim, H.C. Kang, J.H. Park, H.W. Park, S.G. Jang, M.R. Lee, S.Y. Jeong, H.J. Chang, J.L. Ku, J.G. Park, A functional polymorphism (-347 G—>GA) in the Ecadherin gene is associated with colorectal cancer, Carcinogenesis 25 (11) (2004) 2173–2176. [53] X.L. Tan, A. Nieters, S. Kropp, M. Hoffmeister, H. Brenner, J. Chang-Claude, The association of cyclin D1 G870A and E-cadherin C-160A polymorphisms with the risk of colorectal cancer in a case control study and meta-analysis, Int. J. Cancer 122 (11) (2008) 2573–2580. [54] J.M. de Lima, L.G. de Souza, I.D. da Silva, N.M. Forones, E-cadherin and metalloproteinase-1 and -7 polymorphisms in colorectal cancer, Int. J. Biol. Markers 24 (2) (2009) 99–106.
[55] Q. Wang, C. Gao, W. Dai, X. Zou, X. Yang, Association of-160a/c single nucleotide polymorphism in e-cadherin gene promoter region with colorectal cancer in china, Prog. Mod. Biomed. 10 (24) (2010) 4621–4625. [56] Z. Zhong-zheng, C. Wen-ming, W. Ai-zhong, I. Hang-ruo, J. Xia-xiang, H. Xianglie, Z. Guan-shan, Association of CDH1 polymorphism with tumorigenesis and progression of colorectal cancer and hepatocellular carcinoma, Chin. J. Clin. Exp. Pathol. 24 (5) (2008) 533–536. [57] A.B. Engin, B. Karahalil, A.E. Karakaya, A. Engin, Association between XRCC1 ARG399GLN and P53 ARG72PRO polymorphisms and the risk of gastric and colorectal cancer in Turkish population, Arh. Hig. Rada Toksikol. 62 (3) (2011) 207–214. [58] S. Kruger, A. Bier, C. Engel, E. Mangold, C. Pagenstecher, M. von Knebel Doeberitz, E. Holinski-Feder, G. Moeslein, K. Schulmann, J. Plaschke, J. Ruschoff, H.K. Schackert, The p53 codon 72 variation is associated with the age of onset of hereditary non-polyposis colorectal cancer (HNPCC), J. Med. Genet. 42 (10) (2005) 769–773. [59] Z. Mojtahedi, M.R. Haghshenas, S.V. Hosseini, M.J. Fattahi, A. Ghaderi, p 53 codon 72 polymorphism in stomach and colorectal adenocarcinomas in Iranian patients, Indian J. Cancer 47 (1) (2010) 31–34. [60] A.A. Aizat, S.N. Shahpudin, M.A. Mustapha, Z. Zakaria, A.S. Sidek, M.R. Abu Hassan, R. Ankathil, Association of Arg72Pro of P53 polymorphism with colorectal cancer susceptibility risk in Malaysian population, Asian Pac. J. Cancer Prev. 12 (11) (2011) 2909–2913. [61] A. Doosti, M. Zamani, P.G. Dehkordi, S. Taheri, M. Banitalebi, M. Mahmoudzadeh, Association of the p53 codon 72 polymorphism with colorectal cancer in South West of Iran, Sci. Res. Essays 6 (15) (2011) 3148–3152. [62] G.K. Singamsetty, S. Malempati, S. Bhogadhi, R. Kondreddy, S. Govatati, N.K. Tangudu, S. Govatati, A.K. kuraganti, M. Bhanoori, K. Kassetty, TP53 alterations and colorectal cancer predisposition in south Indian population: a casecontrol study, Tumour Biol. 35 (3) (2014) 2303–2311. [63] X.L. Tan, A. Nieters, M. Hoffmeister, L. Beckmann, H. Brenner, J. Chang-Claude, Genetic polymorphisms in TP53, nonsteroidal anti-inflammatory drugs and the risk of colorectal cancer: evidence for gene-environment interaction? Pharmacogenet. Genomics 17 (8) (2007) 639–645. [64] A.M. Pittman, P. Twiss, P. Broderick, S. Lubbe, I. Chandler, S. Penegar, R.S. Houlston, The CDH1-160C>A polymorphism is a risk factor for colorectal cancer, Int. J. Cancer 125 (7) (2009) 1622–1625.
Contents lists available at ScienceDirect
Cancer Epidemiology The International Journal of Cancer Epidemiology, Detection, and Prevention journal homepage: www.cancerepidemiology.net
Association of TP53 codon 72 and CDH1 genetic polymorphisms with colorectal cancer risk in Bangladeshi population Sanzana Fareen Rivua,1, Mohd Nazmul Hasan Apua,1, Samia Shabnaza , Noor Ahmed Nahida , Md. Reazul Islama , Mir Md. Abdullah Al-Mamuna , Zabun Naharb , Sikder Nahidul Islam Rabbic, Maizbha Uddin Ahmeda , Mohammad Safiqul Islamd,* , Abul Hasnata a
Department of Clinical Pharmacy and Pharmacology, Faculty of Pharmacy, University of Dhaka, Dhaka 1000, Bangladesh Department of Pharmacy, University of Asia Pacific, Dhaka, Bangladesh c Pharmacogenetics Lab, Labaid Limited, Dhaka, Bangladesh d Department of Pharmacy, Noakhali Science and Technology University, Sonapur, Noakhali 3814, Bangladesh b
A R T I C L E I N F O
Article history: Received 28 January 2017 Received in revised form 6 April 2017 Accepted 16 May 2017 Available online xxx Keywords: Colorectal cancer Genetic polymorphisms TP53 codon 72 CDH1 Bangladeshi population
A B S T R A C T
Till now no pharmacogenetic study of TP53 codon 72 (Arg72Pro) and CDH1 rs16260 (-160C
1. Introduction Colorectal cancer is ascribed as a malignant tumor arising from the inner wall of the large intestine [1]. It is because of the abnormal growth of cells that have the capability to invade to other parts of the body [2]. Signs and symptoms may include a change in bowel movements, blood in the stool, weight loss, and feeling tired all the time [3]. In case of men colorectal cancer is the third most common cancer (746,000 cases, 10.0% of the total) and the second
* Corresponding author. E-mail address: research_safi[email protected] (M.S. Islam). These authors contributed equally.
1
http://dx.doi.org/10.1016/j.canep.2017.05.005 1877-7821/© 2017 Elsevier Ltd. All rights reserved.
in women (614,000 cases, 9.2% of the total) worldwide [4,5]. Mortality is lower (694,000 deaths, 8.5% of the total) with more deaths (52%) in the less developed regions of the world, indicating a poorer survival in these regions [4,5]. Epidemiological studies have ascertained that colorectal cancer is associated with familial and hereditary factors, age as well as environmental and lifestyle-related risk factors for example obesity, physical inactivity, alcohol consumption and smoking [6–9]. A recent study on twins has reported that 35% of all colorectal cancer can be acquired from inherited genetic susceptibility [10,11]. Sporadic colorectal cancer is usually seen in 70% to 75% of cases [12]. The risk factor of the disease is delineated from the interrelation between the breast cancer risk and SNPs of various genes [13].
S.F. Rivu et al. / Cancer Epidemiology 49 (2017) 46–52
TP53 gene which is known as the guardian of the genome, is accountable for induction of cell cycle arrest and apoptosis. The cell cycle arrest in the G1, G2 and S phases is induced by p53and this induction provides an additional time for the repairing of genomic damage before entering the different stages of DNA synthesis and mitosis [14,15]. p53 also induces apoptosis to eliminate damaged cells [16]. The R72 variant is known to be an inducer of apoptosis rather than the P72 variant [17,18]. Therefore, the absence of arginine would induce cancer. Six studies have reported the association of colorectal cancer (CRC) risk with Pro72 allele [19–24]. The transmembrane glycoprotein E-cadherin, encoded by a tumor suppressor gene CDH1 [25], is crucial for epithelial cell intercellular adhesion, cell polarity, cell signaling, tissue morphology, and maintenance of cellular differentiation [26]. Loss of Ecadherin function or expression results in reduced intercellular adhesion, increasing cellular motility. As a consequence of these events, carcinoma cells may find a free-pass to diffuse through the basement membrane and invade surrounding tissues [26]. Recently, a C/A single nucleotide polymorphism has been identified in the promoter region of the E-cadherin gene that is located160 base pairs upstream of the transcriptional start site [27]. It has been shown that the A allele has the reduced transcriptional efficiency (about 10–68%) compared with the wild type C allele [27–29]. It was also observed that the C allele showed much higher binding affinity to transcriptional factor than the mutant allele, suggesting that the 160C/A variant may alter transcriptional activity of the E-cadherin gene and be responsible for reduced E-cadherin expression. So the common polymorphism of the CDH1 promoter, at nucleotide-160 relative to the transcription start (CDH1-160 C >A; rs16260), has been described to affect CDH1 expression [30] and hence may directly influence susceptibility to cancer. In different ethnic groups it has been recognized as a risk factor for lung, breast, prostate, colorectal, gastric and endometrial cancers [31–33]. Moreover, a recently conducted casecontrol study on Bangladeshi population revealed a high risk association between TP53 Arg72Pro and CDH1 rs16260 polymorphisms and breast cancer development [26]. Since TP53 Arg72pro and CDH1 rs16260 polymorphisms has been proven to be a risk factor of colorectal cancer in different ethnicities [20–24,31–33] and also for breast cancer development in Bangladeshi population [26], there might have a correlation between TP53 Arg72Pro and CDH1rs16260 polymorphisms with colorectal cancer risk in Bangladeshi population. Furthermore, no study has been conducted regarding this possible correlation in Bangladeshi population. We, therefore, expect to find out that probable association of TP53 Arg72Pro and CDH1 rs16260 genetic polymorphisms with colorectal cancer risk in Bangladeshi population for the very first time.
47
2. Materials and methods 2.1. Study population Total 288 colorectal cancer patients were recruited during the period of February 2015 to November 2015. All patients were histologically diagnosed with colorectal cancer who reported in National Institute of Cancer research and Hospital (NICHR), Ahasania Mission Cancer Hospital, Dhaka Medical College Hospital (DMCH), Bangabandhu Sheikh Mujib Medical University (BSMMU). Another 295 healthy volunteers were included in this case-control study matched by age and sex with the patients. All the information was collected by trained nurses in presence of physicians through a detailed questionnaire. All patients and/or legal guardians signed a written consent and ethical committee of the respective hospitals approved all the ethical issues regarding the study. The study was conducted according to the description of Helsinki and its following revisions [34] and the genotyping analysis was performed in the laboratory of pharmacogenetics and pharmacokinetics of the Department of Clinical Pharmacy and Pharmacology, Faculty of Pharmacy, University of Dhaka, Bangladesh. 2.2. Genotyping Genomic DNA was isolated from the blood samples collected from all patients according to our published method [35]. Amplification of genomic DNA was performed using the predesigned forward and reverse primers [26]. PCR-restriction fragment length polymorphism (RFLP) method was used to genotype both the TP53 Arg72Pro and CDH1 rs16260 allele. PCR products of 309 bp and 217 bp were obtained for TP53 Arg72Pro and CDH1rs16260 SNPs respectively. Conditions for PCR amplifications are presented in Table 1. Digestion of 309 bp PCR product of TP53 Arg72Pro was done with BstUI (NEB, USA) by incubating at 60 C for 4 h which generated two fragments of 175 bp & 134 bp in case of Arg allele while for Pro allele it generated only one fragment of 309 bp. Restriction enzyme HincII (NEB, USA) (37 C overnight) cleaved the A allele of CDH1 rs16260 giving two fragments of 129 bp & 88 bp but did not cleaved the C allele (only one fragment of 217 bp). These DNA fragments were stained with ethidium bromide and visualized on 2% agarose gel electrophoresis (Figs. 1 and 2). More than 25% of samples were randomly re-evaluated for confirmation. 2.3. Statistical analysis Statistical analyses were performed using SPSS software package, version 17.0 (SPSS, Inc., Chicago, IL). Deviation of genotype frequencies in the control group from patient group under Hardy–
Table 1 Primers, PCR conditions, restriction enzymes (RE), and expected DNA fragments on digestion to determine the genotype. Allele
Primer Sequence
PCR Conditions
RE
DNA fragments
Codon 72
FP 50 -TTCACCCATCTACAGTCC-30 RP 50 -CTCAGGGCAACTGACCGT-30
94 C 30 s 54 C 30 s 72 C 30 s
BstUI
NH 175,134 HE 309, 175, 134 MH 309
CDH1
FP 50 - GTGTAAAAGCCCTTTCTGATCCC -30 RP 50 - CACCTGCCGGCCACAGCCAATCA -30
94 C 40 s 56 C 30 s 72 C 50 s
HincII
NH 217 HE 217, 129, 88 MH 129, 88
FP = Forward Primer; RP = Reverse Primer; RE = Restriction Enzyme; NH = Normal Homozygote; HE = Heterozygote; MH = Mutant Homozygote.
48
S.F. Rivu et al. / Cancer Epidemiology 49 (2017) 46–52
The Male/Female ratio for patient group is 1.5 and that for control group is 1.2. The most prevalent primary tumor site is colon (63.2%) and the majority of the patients had stage II disease (37.2%) (Table 2). In case of CDH1 rs16260 polymorphism, parameters like female patients (OR = 1.83, 95% CI = 1.13–2.92, p < 0.05), stage III disease patients (OR = 2.03, 95% CI = 1.12–2.66, p < 0.05) were found to have a statistically significant risk association with colorectal cancer (Table 3). No other parameter was found to be significantly associated with TP53 rs1042522 and CDH1 rs16260 polymorphisms. 3.2. TP53 rs1042522 polymorphism
Fig. 1. Restriction Endonuclease (BstUI) digestion fragment of p53 with codon 72 polymorphism (2% agarose gel). Lane M: 50 bp molecular marker; Lane 1–9: Restriction digestion products; Lane 5 shows the wild (Arg/Arg) form(175 and 134 bp); Lanes 1, 2, 4, 6, 8 and 9 show the heterozygous (Arg/Pro) form(309, 175 and 134 bp); Lanes 3 and 7 show the mutant (Pro/Pro) form(309 bp).
Fig. 1 shows the DNA fragment patterns of BstUI digestion of the PCR product carried out to identify the variations at codon 72. Two bands (175 bp & 134 bp) in lane 5 demonstrated Arg/Arg homozygous genotype, three bands (309 bp, 175 bp & 134 bp) in lanes 1, 2, 4, 6, 8 and 9 demonstrated Arg/Pro heterozygous genotype and one band (309 bp) in lanes 3 and 7 indicated the presence of Pro/Pro mutant homozygous genotypes. The genotype frequencies in cases and controls are presented in Table 4. The percent distribution of Arg/Arg homozygous genotype was statistically lower in patients than in controls (30.9% vs. 53.9%). Patients carrying Arg/Pro heterozygous genotype was found to have 2.58-fold elevated risk of colorectal cancer compared to Arg/ Arg genotype carriers (adjusted OR = 2.58, 95% CI = 1.77–3.77, p < 0.05). The Pro/Pro genotype was statistically found to be responsible for colorectal cancer (adjusted OR = 2.92, 95% CI = 1.78– 4.78, p < 0.05) and shows 2.92 times greater risk of developing colorectal cancer. Similarly, the combination of Arg/Pro & Pro/Pro genotype also increased the colorectal cancer risk significantly (adjusted OR = 2.70, 95% CI = 1.90–3.82, p < 0.05). 3.3. CDH1 rs16260 polymorphism Digestion by HincII illustrated the mutation of CHD1 rs16260 (Fig. 2). Complete digestion of 217 bp fragment into 129 bp and 88 bp fragments demonstrated that both alleles were A/A mutant homozygous (lane 5). Lanes 1, 2, 4, 8 and 9 showed incomplete digestion that indicated the presence of C/A heterozygous form. Both alleles were C/C in lanes 3, 6 and 7. The frequency of C/C genotype was found higher for both patient and control and considered to be the reference. Number of patients carrying C/A heterozygous genotype is higher than that of in control group (36.5% vs 24.1%) and comprises a high risk factor of
Fig. 2. Restriction Endonuclease (HincII) digestion fragment of CDH1 rs16260 (2% agarose gel). Lane M: 50 bpmolecularmarker; Lane 1–9: Restriction digestion products; Lanes 3, 6 and 7 show the wild (C/C) form (217 bp); Lanes 1, 2, 4, 8 and 9 show the heterozygous (C/A) form (217, 129 and 88 bp); Lane 5 shows the mutant (A/A) form (129 and 88 bp).
Weinberg equilibrium (HWE) was measured by chi-square test (x2). A multivariate logistic regression analysis was performed to assess the odd ratios (OR) and 95% confidence interval adjusted to age and sex. In all of the analyses, p < 0.05 was considered as statistical significant. 3. Results 3.1. Characteristics of study population The study included 172 males (59.7%) and 116 females (40.3%) colorectal cancer patients with a mean age of 54 years (range 23–68) and the control group comprised of 163 males (55.3%) and 132 females (44.7%) with a mean age of 51.5 years (range 31–71).
Table 2 Demographic characteristics of the patients and controls. Variables
Cases n = 288 (%)
Controls n = 295 (%)
Age (years) <45 45–60 >60
33 (11.46) 182 (63.19) 73 (25.35)
95 (32.20) 170 (57.63) 30 (10.17)
Sex Male Female
172 (59.72) 116 (40.28)
163 (55.25) 132 (44.75)
Primary tumor location Colon Rectum
182 (63.19) 106 (36.81)
Tumor Stage I II III IV
54 (18.75) 107 (37.15) 99 (34.38) 28 (9.72)
S.F. Rivu et al. / Cancer Epidemiology 49 (2017) 46–52
49
Table 3 Correlation of TP53 Arg72Pro and CDH1 rs16260 polymorphisms with clinicopathological characteristics of the patients. Characteristics
TP53 Carrier (n = 199)
TP53 Noncarrier (n = 89)
OR (95% CI)
pvalue
CDH1 Carrier (n = 126)
CDH1 Noncarrier (n = 162)
OR (95% CI)
p-value
53
15
>0.05
28
40
92
55
>0.05
59
88
>60
54
19
>0.05
39
34
45–60 + >60
146
74
–
98
122
0.87 (0.50– 1.51) 0.83 (0.55– 1.27) 1.43 (0.84– 2.43) Ref
>0.05
45–60
1.79 (0.95– 3.39) 0.85 (0.55– 1.31) 1.44 (0.80– 2.61) Ref
Sex Male Female
125 74
47 42
Ref 0.66 (0.40– 1.10)
– >0.05
65 61
107 55
Ref 1.83 (1.13– 2.92)
– <0.05
Tumor Location Colon Rectum
125 74
57 32
Ref 1.05 (0.63– 1.77)
– >0.05
75 51
107 55
Ref 1.32 (0.82– 2.14)
– >0.05
Tumor Stage I II
36 74
18 33
– >0.05
28 44
26 63
71
28
>0.05
44
55
IV
18
10
>0.05
10
18
Ref 1.77 (0.98– 3.17) 2.03 (1.12– 3.66) 1.41 (0.58– 3.42)
– >0.05
III
Ref 1.12 (0.56– 2.26) 1.27 (0.62– 2.59) 0.90 (0.35– 2.35)
Age <45
>0.05 >0.05 –
<0.05 >0.05
Table 4 Genotype frequencies of TP53 Arg72Pro and CDH1 rs16260 gene polymorphisms in cases and controls. Genotype
Cases n = 288 (%)
Control n = 295 (%)
Adjusted Odd ratio (95% CI)
p- value
TP53 Arg72Pro Arg/Arg Arg/Pro Pro/Pro Arg/Pro + Pro/Pro
89 (30.90) 138 (47.92) 61 (21.18) 199 (69.10)
159 (53.90) 98 (33.22) 38 (12.88) 136 (46.10)
Ref 2.58 (1.77–3.77) 2.92 (1.78–4.78) 2.70 (1.90–3.82)
– <0.05 <0.05 <0.05
CDH1 rs16260 C/C C/A A/A C/A + A/A
162 (56.25) 105 (36.46) 21 (7.29) 126 (43.75)
215 (72.88) 71 (24.07) 9(3.05) 80 (27.12)
Ref 1.94 (1.34–2.81) 2.63 (1.15–6.01) 2.02 (1.42–2.87)
– <0.05 <0.05 <0.05
1.94 to develop colorectal cancer in comparison with the C/C homozygote. The C/A heterozygote is found to be significantly increased the risk of developing colorectal cancer (adjusted OR = 1.94, 95% CI = 1.34–2.81, p < 0.05). The A/A mutant has the highest risk factor compared to C/C reference with an OR of 2.63 and has been found statistically significant (adjusted OR = 2.63; 95% CI = 1.15–6.01, p < 0.05). The combined C/A and A/A genotype is also significantly associated with colorectal cancer (adjusted OR = 2.02; 95% CI = 1.42–2.87, p < 0.05) (Table 3). 4. Discussion Mutations of TP53 gene are responsible for almost half of all colorectal cancer [36]. SNPs are the most common form of genetic variation. Till now more than 200 SNPs have been identified for TP53 [37]. But the most presumptively functional one, TP53 Arg72Pro, has been known for its importance in growth suppression and apoptotic functions [38]. Studies revealed that the homozygote Arg72 allele has 15-fold higher apoptosis inducing activity than does the Pro72 allele [39]. This high apoptosis inducing capability is because of its mitochondrial location which makes it possible for p53 to have a direct interaction with pro-
apoptotic BAK protein [40]. Therefore, the R72 allele has been considered as an allele of low penetrability for colorectal cancer susceptibility [21–24]. Consequently, the less apoptotic allele Pro72 represents an increased capability to proliferate cancer cell and thus leads to colorectal tumors [39]. In addition, the prevalence of Pro allele is very common in Bangladeshi population. Mostaid et al. [41] and Shabnaz et al. [26] reported that the frequencies of Pro allele were 31.5% and 35.2% in control and 55.7% and 35% in patient groups, respectively. Therefore, TP53 Arg72Pro polymorphism could be a critical biomarker in modifying the risk of colorectal cancer for Bangladeshi population. Several case–control studies have examined the association between the p53 codon 72 polymorphism and the risk of colorectal cancer in different ethnic groups within consistent findings (Table 5). For example, in a Chinese study of 345 colorectal cancer patients and 670 healthy controls, Zhu et al. [42] showed that patients carrying the Pro/Pro genotype (24.6% in patient vs 15.7% in control) had high risk of developing colorectal cancer. Gemignani et al. [24] analyzed 374 cases of colorectal cancer patient and 322 controls and showed a positive association between Arg/Pro + Pro/ Pro genotypes and colorectal cancer (42.9% in patient vs 36.1% in control with OR = 1.34). In contrary, three independent studies
50
S.F. Rivu et al. / Cancer Epidemiology 49 (2017) 46–52
Table 5 Comparison of previous association studies between TP53 codon 72 SNP and CRC with the present study. Author
No of cases
Arg/Arg%
Arg/Pro%
Pro/Pro%
Association Status
Population
Engin et al. [57] Koushik et al. [46] Kruger et al. [58] Mojtahedi et al. [59] Aizat et al. [60] Cao et al. [21] Doosti et al. [61] Gemignani et al. [24] Sameer et al. [20] Singamsetty et al. [62] Zhu et al. [42] Tan et al. [63] Present study
96 442 126 132 202 156 145 352 86 103 345 467 288
52.1 51.6 62.7 34.8 35 34.6 33.8 57.1 11.6 15.5 24.1 66.8 53.9
42.7 42.1 32.5 47.8 44 43 53.8 37.8 43 46.6 51.3 28.1 33.2
5.2 6.3 4.8 17.4 21 22.4 12.4 5.1 45.4 37.9 24.6 5.1 12.9
No association No association No association No association Pro72 associated with "CRC risk Pro72 associated with "CRC risk Arg/Pro associated with "CRC risk Pro72 associated with "CRC risk Pro72 associated with "CRC risk Pro72 associated with "CRC risk Pro72 associated with "CRC risk Pro72 associated with #CRC risk Arg/Pro & Pro/Pro associated with "CRC risk
Turkey USA Germany Iran Malaysia Korea Iran Spain North India South India China Germany Bangladesh
Table 6 Comparison of previous association studies between CDH1 rs16260 SNP and CRC with the present study. Author
No of cases
C/C%
C/A%
A/A%
Association Status
Population
Porter et al. [51] Shin et al. [52] Tan et al. [53] Cattaneo et al. [32] Pittman et al. [64] Present study
290 260 498 106 5679 288
55.5 71.9 51.6 49.1 54.1 56.2
41.4 25.4 42 41.5 38.9 36.5
3.1 2.7 6.4 9.4 7 7.3
No association No association No association "Association with CRC risk "Association with CRC risk C/A & C/A + A/A associated with "CRC risk
England South Korea German Italy UK Bangladesh
conducted among Caucasian population with small number of samples revealed an increased risk of developing colorectal cancer in relationship with Arg/Arg genotype [43–45], while a large sample based study in United States found no association between the p53 codon 72 polymorphism and the risk of colorectal cancer [46]. In case of our study we found that individual carrying Arg/Pro heterozygous and Pro/Pro mutant homozygous alleles possess 2.58 and 2.92-fold increased risk of developing colorectal cancer compared to control group, respectively and both of these findings are counted as statistically significant. In addition, Arg/Pro + Pro/ Pro genotype together also increased the risk of colorectal cancer development (adjusted OR = 2.70). These results corroborate with the findings of Gemignani et al. [24] and Zhu et al. [42]. The percent distribution of Arg/Arg homozygosity in CRC patients compared to control group (30.9% in patient vs 53.9% in control) is also in support with these findings [24,42] which indicates that loss of Arg/Arg homozygosity might have a role in CRC development, but it is needed to be proven with more elaborate investigation. E-cadherin, commonly known as CDH1, is one of the principal mediators of cell signaling, intercellular adhesion and cellular differentiation. The genetic variation in the CDH1 gene changes in the cellular polarity and cell-to-cell adhesion that is finally responsible for tumor progression and metastasis [47–49]. Several studies have been conducted to investigate the association between CDH1 polymorphism and colorectal cancer predisposition with contradictory results. It is possible that due to the selection criteria for patients and controls and frequency differences between different ethnic groups the association between the risk genotype and CRC showed this disparity (Table 6). In the present study, we reported a significant association between the CDH1 polymorphism and colorectal cancer risk in Bangladeshi population for the first time. Frequencies of C/A and A/ A genotype were found to be 36.5% and 7.3% respectively. Cattaneo et al. [32] suggested the similar findings with an OR of 1.66 for C/A heterozygotes and A/A mutant homozygotes versus C/C common homozygotes (95% CI = 1.00–2.74) in a case-control study
comprising of 246 controls and 106 CRC patients. Our study also revealed that A/A genotype increased risk of colorectal cancer by 2.63-fold in comparison with C/C genotype. The percent frequency of A/A genotype was higher in colorectal cancer patients than unaffected controls (7.3% vs. 3.1%) (p < 0.05) which is in tune with Chu et al. [50] (14% in patient vs 4% in control) depicting a significant increase in risk among CDH1 160A allele carriers. Along with this, the combination of C/A + A/A genotype having an adjusted odds ratio of 2.02 also comprised a significant risk association with colorectal cancer in Bangladeshi population (p < 0.05). Other studies like Porter et al. [51], Shin et al. [52], Tan et al. [53], de Lima et al. [54], Wang et al. [55] and Zhong-zheng et al. [56] failed to correlate between CDH1 160C>A gene polymorphism and CRC susceptibility and disagreed with our results. As per our results, the -160A may be considered as a disease risk-conferring allele in causing colorectal cancer in Bangladeshi population. However, our study has a small sample size resulting in low power to detect genotype-disease associations and geneenvironment interactions; therefore, further study with large sample size is required. Functional consequences of these SNPs are also needed to be investigated further in order to get more conclusive result. 5. Conclusion In summary, our case-control study data suggesting that a significant association exists between Arg/Pro heterozygosity and Pro/Pro mutant homozygosity at codon 72 of TP53 and colorectal cancer predisposition. Our results also depict that A allele and combined genotype of C/A and A/A of CDH1 represent an elevated risk of colorectal cancer development in Bangladeshi population. Therefore, TP53 and CDH1 genetic polymorphism and colorectal cancer risk is an important research area that needs much more attention. Studies with larger samples may reveal more statistically significant data and unravel vital genetic events that actually lead to the development of colorectal cancer.
S.F. Rivu et al. / Cancer Epidemiology 49 (2017) 46–52
Conflicts of interest None. Authorship contribution SFR, MNHA: designed and conducted the study; analyzed and interpreted data; prepared the manuscript; SS, NAN: conceptualized the study and helped in drafting the manuscript; MRI, MMAA, ZN, SNIR, MUA, AH, MSI: analyzed and interpreted data; edited and critically reviewed manuscript. All authors read and approved the final manuscript. Acknowledgement The authors are thankful to the many patients, volunteers, nurses, physicians and scientists of National Institute of Cancer research and Hospital (NICHR), Ahasania Mission Cancer Hospital, Dhaka Medical College Hospital (DMCH), Bangabandhu Sheikh Mujib Medical University (BSMMU). The authors are also thankful to the Department of Clinical Pharmacy and Pharmacology, Faculty of Pharmacy, University of Dhaka, Bangladesh to give the opportunity to carry out the whole research work. References [1] http://www.medicinenet.com/colon_cancer/article.htm. Accessed 29 March 2017. [2] Defining Cancer. National Cancer Institute. https://www.cancer.gov/aboutcancer/understanding/what-is-cancer. Accessed 29 March 2017 [3] General Information about Colon Cancer NCI. 2014-05-12. https://www. cancer.gov/types/colorectal/patient/colon-treatment-pdq. Accessed 29 March 2017. [4] J. Ferlay, I. Soerjomataram, M. Ervik, R. Dikshit, S. Eser, C. Mathers, M. Rebelo, D. M. Parkin, D. Forman, F. Bray, GLOBOCAN 2012 v1. 0, Cancer Incidence and Mortality Worldwide: IARC Cancer Base No. 11 [Internet], International Agency for Research on Cancer, Lyon, France, 2013 (Available from: http://globocan. iarc.fr. Accessed 29 March 2016). [5] F. Bray, J.S. Ren, E. Masuyer, J. Ferlay, Global estimates of cancer prevalence for 27 sites in the adult population in 2008, Int. J. Cancer 132 (5) (2013) 1133–1145. [6] F.A. Haggar, R.P. Boushey, Colorectal cancer epidemiology: incidence, mortality, survival, and risk factors, Clin. Colon Rectal Surg. 22 (4) (2009) 191–197. [7] L.A.G. Ries, D. Melbert, M. Krapcho, D.G. Stinchcomb, N. Howlader, M.J. Horner, A. Mariotto, B.A. Miller, E.J. Feuer, S.F. Altekruse, D.R. Lewis, L. Clegg, M.P. Eisner, M. Reichman, B.K. Edwards, SEER Cancer Statistics Review, 1975–2005, National Cancer Institute, Bethesda, MD, 2008 (http://seer.cancer.gov/csr/ 1975_2005/, based on November 2007 SEER data submission posted to the SEER web site). [8] A.L. Zisman, A. Nickolov, R.E. Brand, A. Gorchow, H.K. Roy, Associations between the age at diagnosis and location of colorectal cancer and the use of alcohol and tobacco: implications for screening, Arch. Intern. Med. 166 (6) (2006) 629–634. [9] W.H. Tsong, W.P. Koh, J.M. Yuan, R. Wang, C.L. Sun, M.C. Yu, Cigarettes and alcohol in relation to colorectal cancer: the Singapore Chinese Health Study, Br. J. Cancer 96 (5) (2007) 821–827. [10] P. Lichtenstein, N.V. Holm, P.K. Verkasalo, A. Iliadou, J. Kaprio, M. Koskenvuo, E. Pukkala, A. Skytthe, K. Hemminki, Environmental and heritable factors in the causation of cancer—analyses of cohorts of twins from Sweden, Denmark, and Finland, N. Engl. J. Med. 343 (2) (2000) 78–85. [11] K. Hemminki, B. Chen, Familial risk for colorectal cancers are mainly due to heritable causes, Cancer Epidemiol. Biomarkers Prev. 13 (7) (2004) 1253–1256. [12] F. Amersi, M. Agustin, C.Y. Ko, Colorectal cancer: epidemiology, risk factors, and health services, Clin. Colon Rectal Surg. 18 (3) (2005) 133–140. [13] A. Rudolph, J. Chang-Claude, M.K. Schmidt, Gene-environment interaction and risk of breast cancer, Br. J. Cancer 114 (2) (2016) 125–133. [14] M.L. Agarwal, A. Agarwal, W.R. Taylor, G.R. Stark, p53 controls both the G2/M and the G1 cell cycle checkpoints and mediates reversible growth arrest in human fibroblasts, Proc. Natl. Acad. Sci. U. S. A. 92 (18) (1995) 8493–8497. [15] J. Zhou, J. Ahn, S.H. Wilson, C. Prives, A role for p53 in base excision repair, EMBO J. 20 (4) (2001) 914–923. [16] L.J. Hofseth, S.P. Hussain, C.C. Harris, p53: 25 years after its discovery, Trends Pharmacol. Sci. 25 (4) (2004) 177–181. [17] D. Pim, L. Banks, p53 polymorphic variants at codon 72 exert different effects on cell cycle progression, Int. J. Cancer 108 (2) (2004) 196–199. [18] C. Whibley, P.D. Pharoah, M. Hollstein, p53 polymorphisms: cancer implications, Nat. Rev. Cancer 9 (2) (2009) 95–107.
51
[19] H.R. Song, S.S. Kweon, H.N. Kim, J.M. Piao, W.J. Yun, J.S. Choi, J.E. Hwang, J.Y. Yoon, H.R. Kim, Y.K. Park, S.H. Kim, Y.D. Choi, M.H. Shin, p53 codon 72 polymorphism in patients with gastric and colorectal cancer in a Korean population, Gastric Cancer 14 (3) (2011) 242–248. [20] A.S. Sameer, Z.A. Shah, N. Syeed, M.Z. Banday, S.M. Bashir, B.A. Bhat, M.A. Siddiqi, TP53 Pro47Ser and Arg72Pro polymorphisms and colorectal cancer predisposition in an ethnic Kashmiri population, Genet. Mol. Res. 9 (2) (2010) 651–660. [21] Z. Cao, J.H. Song, Y.K. Park, E.J. Maeng, S.W. Nam, J.Y. Lee, W.S. Park, The p53 codon 72 polymorphism and susceptibility to colorectal cancer in Korean patients, Neoplasma 56 (2) (2009) 114–118. [22] J.E. Goodman, L.E. Mechanic, B.T. Luke, S. Ambs, S. Chanock, C.C. Harris, Exploring SNP-SNP interactions and colon cancer risk using polymorphism interaction analysis, Int. J. Cancer 118 (7) (2006) 1790–1797. [23] C. Perfumo, L. Bonelli, P. Menichini, A. Inga, V. Gismondi, E. Ciferri, P. Percivale, G. Bianchi Scarra, S. Nasti, G. Fronza, L. Varesco, Increased risk of colorectal adenomas in Italian subjects carrying the p53 PIN3 A2-Pro72 haplotype, Digestion 74 (3–4) (2006) 228–235. [24] F. Gemignani, V. Moreno, S. Landi, N. Moullan, A. Chabrier, S. GutierrezEnriquez, J. Hall, E. Guino, M.A. Peinado, G. Capella, F. Canzian, A TP53 polymorphism is associated with increased risk of colorectal cancer and with reduced levels of TP53 mRNA, Oncogene 23 (10) (2004) 1954–1956. [25] D.G. Huntsman, C. Caldas, Assignment of the E-cadherin gene (CDH1) to chromosome 16q22.1 by radiation hybrid mapping, Cytogenet. Cell Genet. 83 (1–2) (1998) 82–83. [26] S. Shabnaz, M.U. Ahmed, M.S. Islam, M.R. Islam, M.M. Al-Mamun, M.S. Islam, A. Hasnat, Breast cancer risk in relation to TP53 codon 72 and CDH1 gene polymorphisms in the Bangladeshi women, Tumour Biol. 37 (6) (2016) 7229–7237. [27] L.C. Li, R.M. Chui, M. Sasaki, K. Nakajima, G. Perinchery, H.C. Au, D. Nojima, P. Carroll, R. Dahiya, A single nucleotide polymorphism in the E-cadherin gene promoter alters transcriptional activities, Cancer Res. 60 (4) (2000) 873–876. [28] H. Lei, S. Sjoberg-Margolin, S. Salahshor, B. Werelius, E. Jandakova, K. Hemminki, A. Lindblom, I. Vorechovsky, CDH1 mutations are present in both ductal and lobular breast cancer, but promoter allelic variants show no detectable breast cancer risk, Int. J. Cancer 98 (2) (2002) 199–204. [29] A. Nakamura, T. Shimazaki, K. Kaneko, M. Shibata, T. Matsumura, M. Nagai, R. Makino, K. Mitamura, Characterization of DNA polymorphisms in the Ecadherin gene (CDH1) promoter region, Mutat. Res. 502 (1–2) (2002) 19–24. [30] G.Y. Wang, C.Q. Lu, R.M. Zhang, X.H. Hu, Z.W. Luo, The E-cadherin gene polymorphism 160C->A and cancer risk: a HuGE review and meta-analysis of 26 case-control studies, Am. J. Epidemiol. 167 (1) (2008) 7–14. [31] F.M. Richards, S.A. McKee, M.H. Rajpar, T.R. Cole, D.G. Evans, J.A. Jankowski, C. McKeown, D.S. Sanders, E.R. Maher, Germline E-cadherin gene (CDH1) mutations predispose to familial gastric cancer and colorectal cancer, Hum. Mol. Genet. 8 (4) (1999) 607–610. [32] F. Cattaneo, T. Venesio, S. Molatore, A. Russo, R. Fiocca, M. Frattini, A.I. Scovassi, L. Ottini, L. Bertario, G.N. Ranzani, Functional analysis and case-control study of -160C/A polymorphism in the E-cadherin gene promoter: association with cancer risk, Anticancer Res. 26 (6b) (2006) 4627–4632. [33] L.X. Qiu, R.T. Li, J.B. Zhang, W.Z. Zhong, J.L. Bai, B.R. Liu, M.H. Zheng, X.P. Qian, The E-cadherin (CDH1)-160C/A polymorphism and prostate cancer risk: a meta-analysis, Eur. J. Hum. Genet. 17 (2) (2009) 244–249. [34] World Medical Association Declaration of Helsinki, Ethical principles for medical research involving human subjects, Adopted by 64th WMA General Assembly, Fortaleza, Brazil, October 2013, 2008. [35] M.S. Bin Sayeed, M.N. Hasan Apu, M.T. Munir, M.U. Ahmed, M.S. Islam, M.M. Haq, C.H. Ahsan, M.A. Rashid, J.G. Shin, A. Hasnat, Prevalence of CYP2C19 alleles, pharmacokinetic and pharmacodynamic variation of clopidogrel and prasugrel in Bangladeshi population, Clin. Exp. Pharmacol. Physiol. 42 (5) (2015) 451–457. [36] C.C. Harris, M. Hollstein, Clinical implications of the p53 tumor-suppressor gene, N. Engl. J. Med. 329 (18) (1993) 1318–1327. [37] http://www-p53.iarc.fr, Accessed 29 March 2017. [38] T. Soussi, G. Lozano, p53 mutation heterogeneity in cancer, Biochem. Biophys. Res. Commun. 331 (3) (2005) 834–842. [39] P. Dumont, J.I. Leu, A.C. Della Pietra 3rd, D.L. George, M. Murphy, The codon 72 polymorphic variants of p53 have markedly different apoptotic potential, Nat. Genet. 33 (3) (2003) 357–365. [40] J.I. Leu, P. Dumont, M. Hafey, M.E. Murphy, D.L. George, Mitochondrial p53 activates Bak and causes disruption of a Bak-Mcl1 complex, Nat. Cell Biol. 6 (5) (2004) 443–450. [41] M.S. Mostaid, M.U. Ahmed, M.S. Islam, M.S. Bin Sayeed, A. Hasnat, Lung cancer risk in relation to TP53 codon 47 and codon 72 polymorphism in Bangladeshi population, Tumour Biol. 35 (10) (2014) 10309–10317. [42] Z.Z. Zhu, A.Z. Wang, H.R. Jia, X.X. Jin, X.L. He, L.F. Hou, G. Zhu, Association of the TP53 codon 72 polymorphism with colorectal cancer in a Chinese population, Jpn. J. Clin. Oncol. 37 (5) (2007) 385–390. [43] L.O. Perez, M.C. Abba, F.N. Dulout, C.D. Golijow, Evaluation of p53 codon 72 polymorphism in adenocarcinomas of the colon and rectum in La Plata, Argentina, World J. Gastroenterol. 12 (9) (2006) 1426–1429. [44] A. Dakouras, N. Nikiteas, E. Papadakis, M. Perakis, D. Valis, G. Rallis, N. Tzanakis, G. Peros, C. Tsigkris, C. Kittas, P. Karakitsos, P53Arg72 homozygosity and its increased incidence in left-sided sporadic colorectal adenocarcinomas, in a Greek-Caucasian population, Anticancer Res. 28 (2a) (2008) 1039–1043.
52
S.F. Rivu et al. / Cancer Epidemiology 49 (2017) 46–52
[45] E. Mammano, C. Belluco, M. Bonafe, F. Olivieri, E. Mugianesi, C. Barbi, M. Mishto, M. Cosci, C. Franceschi, M. Lise, D. Nitti, Association of p53 polymorphisms and colorectal cancer: modulation of risk and progression, Eur. J. Surg. Oncol. 35 (4) (2009) 415–419. [46] A. Koushik, G.J. Tranah, J. Ma, M.J. Stampfer, H.D. Sesso, C.S. Fuchs, E.L. Giovannucci, D.J. Hunter, p53 Arg72Pro polymorphism and risk of colorectal adenoma and cancer, Int. J. Cancer 119 (8) (2006) 1863–1868. [47] A. Jeanes, C.J. Gottardi, A.S. Yap, Cadherins and cancer: how does cadherin dysfunction promote tumor progression? Oncogene 27 (55) (2008) 6920–6929. [48] S. Baranwal, S.K. Alahari, Molecular mechanisms controlling E-cadherin expression in breast cancer, Biochem. Biophys. Res. Commun. 384 (1) (2009) 6–11. [49] A. Beeghly-Fadiel, W. Lu, Y.T. Gao, J. Long, S.L. Deming, Q. Cai, Y. Zheng, X.O. Shu, W. Zheng, E-cadherin polymorphisms and breast cancer susceptibility: a report from the Shanghai Breast Cancer Study, Breast Cancer Res. Treat. 121 (2) (2010) 445–452. [50] C.M. Chu, C.J. Chen, D.C. Chan, H.S. Wu, Y.C. Liu, C.Y. Shen, T.M. Chang, J.C. Yu, H. J. Harn, C.P. Yu, M.H. Yang, CDH1 polymorphisms and haplotypes in sporadic diffuse and intestinal gastric cancer: a case-control study based on direct sequencing analysis, World J. Surg. Oncol. 12 (2014) 80, doi:http://dx.doi.org/ 10.1186/1477-7819-12-80. [51] T.R. Porter, F.M. Richards, R.S. Houlston, D.G. Evans, J.A. Jankowski, F. Macdonald, G. Norbury, S.J. Payne, S.A. Fisher, I. Tomlinson, E.R. Maher, Contribution of cyclin d1 (CCND1) and E-cadherin (CDH1) polymorphisms to familial and sporadic colorectal cancer, Oncogene 21 (12) (2002) 1928–1933. [52] Y. Shin, I.J. Kim, H.C. Kang, J.H. Park, H.W. Park, S.G. Jang, M.R. Lee, S.Y. Jeong, H.J. Chang, J.L. Ku, J.G. Park, A functional polymorphism (-347 G—>GA) in the Ecadherin gene is associated with colorectal cancer, Carcinogenesis 25 (11) (2004) 2173–2176. [53] X.L. Tan, A. Nieters, S. Kropp, M. Hoffmeister, H. Brenner, J. Chang-Claude, The association of cyclin D1 G870A and E-cadherin C-160A polymorphisms with the risk of colorectal cancer in a case control study and meta-analysis, Int. J. Cancer 122 (11) (2008) 2573–2580. [54] J.M. de Lima, L.G. de Souza, I.D. da Silva, N.M. Forones, E-cadherin and metalloproteinase-1 and -7 polymorphisms in colorectal cancer, Int. J. Biol. Markers 24 (2) (2009) 99–106.
[55] Q. Wang, C. Gao, W. Dai, X. Zou, X. Yang, Association of-160a/c single nucleotide polymorphism in e-cadherin gene promoter region with colorectal cancer in china, Prog. Mod. Biomed. 10 (24) (2010) 4621–4625. [56] Z. Zhong-zheng, C. Wen-ming, W. Ai-zhong, I. Hang-ruo, J. Xia-xiang, H. Xianglie, Z. Guan-shan, Association of CDH1 polymorphism with tumorigenesis and progression of colorectal cancer and hepatocellular carcinoma, Chin. J. Clin. Exp. Pathol. 24 (5) (2008) 533–536. [57] A.B. Engin, B. Karahalil, A.E. Karakaya, A. Engin, Association between XRCC1 ARG399GLN and P53 ARG72PRO polymorphisms and the risk of gastric and colorectal cancer in Turkish population, Arh. Hig. Rada Toksikol. 62 (3) (2011) 207–214. [58] S. Kruger, A. Bier, C. Engel, E. Mangold, C. Pagenstecher, M. von Knebel Doeberitz, E. Holinski-Feder, G. Moeslein, K. Schulmann, J. Plaschke, J. Ruschoff, H.K. Schackert, The p53 codon 72 variation is associated with the age of onset of hereditary non-polyposis colorectal cancer (HNPCC), J. Med. Genet. 42 (10) (2005) 769–773. [59] Z. Mojtahedi, M.R. Haghshenas, S.V. Hosseini, M.J. Fattahi, A. Ghaderi, p 53 codon 72 polymorphism in stomach and colorectal adenocarcinomas in Iranian patients, Indian J. Cancer 47 (1) (2010) 31–34. [60] A.A. Aizat, S.N. Shahpudin, M.A. Mustapha, Z. Zakaria, A.S. Sidek, M.R. Abu Hassan, R. Ankathil, Association of Arg72Pro of P53 polymorphism with colorectal cancer susceptibility risk in Malaysian population, Asian Pac. J. Cancer Prev. 12 (11) (2011) 2909–2913. [61] A. Doosti, M. Zamani, P.G. Dehkordi, S. Taheri, M. Banitalebi, M. Mahmoudzadeh, Association of the p53 codon 72 polymorphism with colorectal cancer in South West of Iran, Sci. Res. Essays 6 (15) (2011) 3148–3152. [62] G.K. Singamsetty, S. Malempati, S. Bhogadhi, R. Kondreddy, S. Govatati, N.K. Tangudu, S. Govatati, A.K. kuraganti, M. Bhanoori, K. Kassetty, TP53 alterations and colorectal cancer predisposition in south Indian population: a casecontrol study, Tumour Biol. 35 (3) (2014) 2303–2311. [63] X.L. Tan, A. Nieters, M. Hoffmeister, L. Beckmann, H. Brenner, J. Chang-Claude, Genetic polymorphisms in TP53, nonsteroidal anti-inflammatory drugs and the risk of colorectal cancer: evidence for gene-environment interaction? Pharmacogenet. Genomics 17 (8) (2007) 639–645. [64] A.M. Pittman, P. Twiss, P. Broderick, S. Lubbe, I. Chandler, S. Penegar, R.S. Houlston, The CDH1-160C>A polymorphism is a risk factor for colorectal cancer, Int. J. Cancer 125 (7) (2009) 1622–1625.