- Email: [email protected]
Association of variant alleles of MBL2 gene with vasoocclusive crisis in children with sickle cell anemia
Blood Cells, Molecules, and Diseases 44 (2010) 224–228
Contents lists available at ScienceDirect
Blood Cells, Molecules, and Diseases j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / y b c m d
Association of variant alleles of MBL2 gene with vasoocclusive crisis in children with sickle cell anemia T.F. Mendonça a,⁎, M.C.V.C. Oliveira b, L.R.S. Vasconcelos c, L.M.M.B. Pereira a,c, P. Moura a, M.A.C. Bezerra b, M.N.N. Santos b, A.S. Araújo b, M.S.M. Cavalcanti a a b c
Biological Science Institute and College of Medical Sciences, University of Pernambuco, Recife, Brazil Hematology and Hemotherapy Foundation of Pernambuco (HEMOPE), Recife, Brazil Liver Institute of Pernambuco (IFP-PE), Recife, Brazil
a r t i c l e
i n f o
Article history: Submitted 19 August 2009 Revised 26 November 2009 Available online 20 February 2010 (Communicated by P. Gallagher, M.D., 20 January 2010) Keywords: Sickle cell anemia Polymorphism MBL2 Real Time PCR Vasoocclusive crisis
a b s t r a c t Vasoocclusive crisis (VOC) is the major cause of morbidity and mortality in sickle cell anemia (SCA), which is caused by the occlusion of blood vessels, followed by ischemia or infarct, resulting in progressive damage to organs. However, this clinical manifestation is variable, indicating that this process could be influenced by modifier genes. The gene MBL2 which codes for mannose-binding lectin (MBL) has been associated with modifications in the progression of infectious and inflammatory vascular diseases. The aim of this study was to determine the frequency of the polymorphisms of exon 1 (alleles A/O) and promoter region − 221 (alleles Y/X) of MBL2 in children with SCA and to verify their association with VOC. The determination of the polymorphism of exon 1 and the promoter region of MBL2 was performed by SYBR GREEN® and Taqman® system, respectively. In the patients with SCA, the frequency of the genotype related to high production of MBL was 0.46 (YA/YA) and for intermediate/low production was 0.54 (YA/XA, XA/XA, YA/YO, XA/ YO, YO/YO). The frequency of the genotypes and haplotypes of MBL2 in patients with SCA did not differ from control individuals. The populations were in Hardy–Weinberg equilibrium. The patients were divided into two groups. The groups were separated by the frequency of VOC, which was defined by the total of VOC episodes divided by the age of the children at the end of this study. Since, we choose a cut point in FVOC b 1 (n = 48) (which we considered of mild presentation of disease) and FVOC ≥ 1 (n = 39) (higher severity). In children with SCA, the frequency of the genotypes of MBL2 of intermediate/low expression for MBL was associated with FVOC ≥ 1 (p = 0.0188 OR = 3.15 CI = 1.19–8.50). The results suggest that MBL2 polymorphism at promoter and first exon of MBL2 associated with low serum levels and structural alterations of MBL could modify the phenotype of the child with SCA related to VOC. © 2010 Elsevier Inc. All rights reserved.
Introduction Sickle cell anemia (SCA) is a genetic disease caused by a mutation in the β chain of hemoglobin, characterized by chronic inflammatory manifestations. The mutant hemoglobin (HbS) polymerizes at low oxygen tension, causing the deformation of the erythrocytes, making them rigid which leads to obstruction of blood flow and tissue damage [1]. Vasoocclusive crisis (VOC) is a complex event involving erythrocytes deformation, enhancement of leukocyte adhesion, inflammation, endothelial injury and activation of the coagulation and
⁎ Corresponding author. R. Arnóbio Marques, 310, Núcleo de Pós-graduação Ruy Marques, 50100-130 – Santo Amaro, Recife, Brazil. Fax: +55 81 3183 3510. E-mail addresses: [email protected] (T.F. Mendonça), [email protected] (M.C.V.C. Oliveira), [email protected] (L.R.S. Vasconcelos), [email protected] (L.M.M.B. Pereira), [email protected] (P. Moura), [email protected] (M.A.C. Bezerra), [email protected] (M.N.N. Santos), [email protected] (A.S. Araújo), [email protected] (M.S.M. Cavalcanti). 1079-9796/$ – see front matter © 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.bcmd.2010.02.004
complement pathways, been the major cause of morbidity and mortality in SCA [2]. The consumption of components of the complement system (CS) through the alternative route [3] and the alteration of the opsonization activity in the serum of patients with SCA during VOC [4] appear to be related to the clearance of sickled erythrocytes [5]. Therefore, the excess consumption of CS components can lead to a decreased capacity of CS to combat infectious agents, thereby overloading the phagocytosis system in the clearance of erythrocytes, compromising the antimicrobicidal activity of the macrophages [6]. Another mechanism of activation of the CS is initiated by mannosebinding lectin (MBL), a protein of innate immunity coded by the MBL2 gene [7]. MBL recognizes carbohydrate patterns in a variety of pathogens, activating serine-proteases associated with MBL called MASPs, which cleave the C3 and C4 components of the CS [8,9]. In exon 1 of the MBL2 gene, there are three point mutations collectively called “O” and the wild-type allele called “A” [10]. The promoter regions −221 (alleles Y/X) and −550 (alleles H/L) of MBL2
T.F. Mendonça et al. / Blood Cells, Molecules, and Diseases 44 (2010) 224–228
contain regulatory elements that influence the transcription of the protein, associated with different serum concentrations of MBL, in which, the variant allele X has an important negative effect on serum levels of MBL [11–13]. Consequently, the Y/X polymorphism, in the promoter region, has been considered an important genetic regulator of serum MBL levels [14,15]. Studies have shown a positive association between low serum levels of MBL and polymorphism of MBL2 with increased risk for infections [16–18]. Also, the deficiency of MBL has been associated with the risk of autoimmune disease, atherosclerosis [19–21] and arterial thrombosis [19,22]. However, deficiency of this protein appears to confer protection against certain intracellular pathogens [23,24]. MBL is recognized by colectin receptors expressed on various cell types such as monocytes, macrophages, B lymphocytes, platelets, endothelial cells and fibroblasts [25–27]. Fraser et al. (2006) [27] demonstrated that activated macrophages recognize MBL bound to apoptotic cells, which leads to the production of interleukine-10 (IL-10), which could modulates the inflammatory response. Additionally, human endothelial cells, when submitted to oxidative stress, can be targets for the activation of the CS via MBL [28]. Neonato et al. (1999) [29], studying 242 children with sickle cell disease (SS and SC), observed that mutations in MBL2, related to the expression of low levels of MBL, conferred a protective role against severe infections (osteomyelitis, meningitis, and septicemia) (p = 0.01). These results indicate that the variant alleles related to low production of MBL, do not lead exclusively to a biological disadvantage. However, in many studies, the low expression of MBL has been associated with susceptibility to infection [16–18]. Oliveira et al. (2009) [30] determined the frequency of polymorphism of exon 1 of MBL2 in 422 Brazilian patients with SCA. Of these patients, 87 children who participated in the National Neonatal Screening Program for SCA of the HEMOPE Foundation, were selected for analysis of the association of the structural polymorphism with VOC, demonstrating a statistically significant association between variants of MBL2 (AO/OO) and VOC. Therefore, the study of the frequency of MBL2 polymorphism in children with SCA is important, since this protein acts in the innate immune system and in play a role in the modulation of inflammation. Thus, the aim of this work was to continue the study of Oliveira et al. (2009) [30], investigating not only the polymorphism of exon 1 but also the polymorphism of the promoter region −221 of MBL2, due to its great influence on the serum concentrations of MBL, as well as to determine the association of these polymorphisms with VOC.
225
population for a clinical association study with VOC. The clinical data were collected from the records in the medical files of the HEMOPE Foundation. The period of observation for collection of VOC consisted from birth until the end of this study. The control group consisted of 232 blood donor volunteers without SCA, who were recruited from the Blood Bank. In the control group the age ranged from 18 to 55 years (mean 34 ± 8.3) and 58% were male. The clinical events considered VOC were: painful crisis, dactylitis and acute thoracic syndrome. For the association analysis of MBL2 polymorphism and VOC, the patients were divided into two groups. The groups were separated by the frequency of VOC, which was defined by the total of VOC episodes divided by the age of the children at the end of this study. Since, we choose a cut point in FVOC b1 (n = 48) (which we considered of mild presentation of disease) and FVOC ≥1 (n = 39) (higher severity). Extraction of genomic DNA and genotyping of gene MBL2 DNA was extracted from peripheral blood samples by the phenol– chloroform technique, according to Isola et al. (1994) [31]. Real Time PCR was used to determine the polymorphism of the promoter region and exon 1 of the MBL2 gene, using the Rotor Gene 6000TM apparatus (Corbett Research Mortlake, Sydney, Australia). The fluorophore SYBR GREEN® was utilized in the assay for exon 1 polymorphism (A/O), in accordance with Hladnik et al. [32]. The primers used in the genotyping of exon 1 were: forward 5′AGGCATCAACGGCTTCCCA 3′ and reverse 5′ CAGAACAGCCCAACACGTACCT 3′ [32]. The promoter region −221 (X/Y) polymorphism were detected using the Taqman® SNP (Single Nucleotide Polymorphism) (Applied Biosystems, CA, USA). Primer and probe sequences were taken from the NCBI website (http://snp500cancer.nci.nih.gov). Analysis of haplotypes and genotypes For the study of the association, the haplotypes of MBL2 were divided into two groups: those related to high expression of MBL (YA) (n = 116) and those related to intermediate/low expression (XA, YO) (n = 58). The genotypes were divided related to high (YA/YA) (n = 40) and intermediate/low (YA/XA, XA/XA, YA/YO, XA/YO, YO/ YO) (n = 47) serum MBL levels. This division of the haplotypes and genotypes was used according to Garred et al. (2003) [15]. Statistical analysis
Materials and methods Ethical considerations This project was approved by the Research Ethics Committee of the HEMOPE Foundation , Recife, Pernambuco (registration No. 044/06) and written informed consent was obtained from patients and control subjects.
The allele frequencies were calculated by ARLEQUIM software version 3.1 (Geneva University, Geneva, Switzerland) [33] and the differences of frequencies analyzed by Fisher's exact probability test using 2 × 2 and 3 × 2 contingency tables. The statistical analyses were performed using EPinfo version 3.5.1 (CDC, Atlanta, USA), with the level of significance at p b 0.05. Results
Patients Eighty-seven children with SCA were studied; they were homozygote for hemoglobin S, aged 1 to 6 years with a mean of 3.46 ± 1.49 years, where 48.3% were males. The samples of the patients were obtained from the DNA bank of the Hematology Hospital of the HEMOPE Foundation, where the patients were enrolled in the Brazilian National Neonatal Screening Program for SCA and followed-up regularly in HEMOPE, in Pernambuco State, Brazil. In the protocol of this program, the patients are vaccinated against pneumococci (Pneumo 7 — Wyeth Pharmaceuticals Inc. USA) and meningococci (Meningitec — Wyeth Pharmaceuticals, UK), and are also given prophylactic penicillin (dose of 4000 U/kg/day) up to 5 years of age, producing a more homogeneous
The clinical information of the patients with is observed in Table 1. It could be observed that the traits are practically evenly distributed in both groups of patients. Therefore, our analysis can be considered with a reasonable certainty. The groups of patients with SCA and control were in Hardy– Weinberg equilibrium. In the patients with SCA, the frequency of the alleles Y and X of the promoter region (−221) was 0.84 and 0.16, respectively; and the frequency of the alleles A and O of the first exon was 0.83 and 0.17, respectively. In the control population, the frequencies found were: 0.84 (Y), 0.16 (X), 0.79 (A) and 0.21 (O). The allelic frequencies of Y/X and A/O did not differ significantly (p = 0.9738 and p = 0.3571, respectively) between the two populations.
226
T.F. Mendonça et al. / Blood Cells, Molecules, and Diseases 44 (2010) 224–228
Table 1 Characteristics of the patients with sickle cell anemia. Characteristics
All patients (n = 87)
b 1 FVOC (n = 48)
≥ 1 FVOC (n = 39)
Age mean (±SD) Sex (M/F) Haplotype HBB*S (with CAR/Without CAR) HbF median (min–max) 3.7 Kb Deletion α (heterozygote/normal)
3.47 (± 1.49) 42/45 80/07
3.52 (± 1.42) 23/25 44/04
3.41 (± 1.58) 19/20 36/03
21.15 (0.8–35.2) 16/71
19.5 (8.7–35.2) 11/37
21.3 (0.8–26.8) 05/34
Table 3 Association of polymorphism of the − 221 promoter region and exon 1 of the MBL2 gene with vasoocclusive crisis (VOC) in patients with sickle cell anemia treated in Hemope Foundation — Recife/Brazil. Profile of MBL2 genotypes
FVOC ≥1
b1
High Intermediate/low
12 27
28 20
TOTAL
p
40 47
p = 0.0188 OR = 3.15 CI = 1.19–8.50
FVOC = Frequency of VOC, which was defined by the total of VOC episodes divided by the age of the children at the end of this study.
FVOC = Frequency of VOC, which was defined by the total of VOC episodes divided by the age of the children at the end of this study; HbF = Hemoglobina F.
The distribution of the frequency of the variant genotypes of the promoter region − 221 (YX/XX) and of exon 1 (AO/OO) of MBL2 in patients with SCA compared to the control group also did not show a significant difference (p = 0.9699 and p = 0.4533, respectively). In the patients, the frequency of haplotypes related to high (YA) (n = 116), intermediate (XA) (n = 28) and low (YO) (n = 30) expression of MBL were 0.67, 0.16 and 0.17, respectively, and the frequency of the genotypes related to high (YA/YA) (n = 40), intermediate (YA/XA, XA/XA, YA/YO) (n = 38) and low (XA/YO, YO/YO) (n = 9) expression of MBL were 0.46, 0.44 and 0.10, respectively (Table 2). The association of the genotypes of high and intermediate/low expression of MBL with the patients with SCA and the control group also was not significant (p = 0.5874). A positive association was found between the MBL2 genotypes related to intermediate/low expression of MBL and patients with SCA with FVOC ≥1 (p = 0.0188) (Table 3). Discussion The MBL2 gene shows a large allelic variety in accordance with each ethnic group [34]. In the studied population, the frequency of the MBL2 polymorphism was similar to that found by Boldt et al. (2006) [35] who studied a Brazilian population (n = 107) with a high degree of miscegenation. SNPs constitute common variations in the human genome, which can be associated with the clinical stage of diseases and even influence therapy to some degree. In SCA, small genetic differences are known to be directly associated with the phenotype of the disease [36,37]. Important features which may have an impact on the VOC episode, such as age, HBB*S haplotype, HbF and alpha-thalassemia [38] listed in the Table 1 showed no differences when the groups with b1 FVOC and ≥1 FVOC were compared. Therefore, those characteristics seem not be influencing the frequency of VOC. In a previous study from our group, 422 Brazilian patients with SCA were analyzed, and no difference was found in the frequency Table 2 Frequency of haplotypes and genotypes of the −221 promoter region and exon 1 of the MBL2 gene and their phenotypes in patients with sickle cell anemia treated in Hemope Foundation — Recife/Brazil. Haplotype
Sickle cell anemia (n = 174)
Controls (n = 464)
MBL expression
YA XA YO
0.67 (116/174) 0.16 (28/174) 0.17 (30/174)
0.63 (295/464) 0.17 (77/464) 0.20 (92/464)
High Intermediate Low
Genotype
Sickle cell anemia (n = 87)
Controls (n = 232)
MBL expression
YA/YA YA/XA XA/XA YA/YO XA/YO YO/YO
0.46 0.20 0.02 0.22 0.08 0.02
0.42 0.17 0.04 0.26 0.08 0.03
High Intermediate Intermediate Intermediate Low Low
(40/87) (17/87) (2/87) (19/87) (7/87) (2/87)
*According Garred et al. [15].
(97/232) (41/232) (9/232) (60/232) (18/232) (7/232)
distribution of MBL2 exon 1 polymorphism, when compared to the control group [30]. The present study analyzed 87 children with SCA, and also did not find any difference in the frequency of this polymorphism compared to the control group. The genotypes related to intermediate/low expression of MBL showed similar frequency (0.54) (Table 2) to the frequency found by Neonato et al. (1999) [29], which was 0.50. Even though that those authors had included in their analysis the promoter region −550 for patients with SCA group. This study demonstrated a statistically significant association between genotypes of MBL2 considering the combined alleles from promoter and exon 1 regions, related to intermediate/low expression of MBL, and higher frequency of VOC in children with SCA (p = 0.0188) (Table 3). This finding is in accordance with the results obtained by Oliveira et al. (2009) [30] who studied the frequency of the structural variants of MBL2 in the same population and found a significant association between the patients with SCA who had the variants AO/ OO with VOC (p = 0.039; OR = 3.01; CI = 1.05–9.11). These authors demonstrated this positive association even without analyzing the polymorphism of the promoter region − 221 of MBL2 which significantly influences the production of this protein. Another difference between the previous study and the present one is in regard to the categorization of the clinical event, because Oliveira et al. (2009) [30] divided the groups on the basis of the absence or presence of at least one event of VOC independent of the age of the patient. Conversely, the present study utilized as criteria for separate the groups, the frequency of VOC (FVOC) with regard to the age of the patient, which varied from 1 to 6 years, providing an analysis more suitable for the association between the frequency of MBL2 polymorphisms and SCA patients with VOC. Previous studies investigating MBL2 polymorphism in patients with SCA observed no association of the MBL2 variants with susceptibility to infections [29,30,39]. The relatively recent disclosure of MBL as a regulatory molecule of inflammation has been explored [22,27,40,41]. Genotypes related to low concentrations of MBL could lead to an increase in the inflammation of vessels, which may contribute to the development of the atherosclerosis process [20]. Since MBL has been considered a modifying factor of disease, we intended to address its association with VOC in patients with SCA, because this clinical manifestation is related to inflammatory processes. Chlamydia pneumonia infection can lead to the development, progression and severity of coronary artery disease in patients with variant alleles of MBL2 [42]. It is likely that patients with variant alleles of MBL2 do not develop an efficient immune response against atherogenic agents of the vascular endothelium, which are responsible for the constant inflammatory response [22,42,43]. It was demonstrated that MBL participates in the phagocytosis of promoter agents of inflammation, such as C. pneumoniae, diminishing local inflammation [22,43]. Acute thoracic syndrome, a type of VOC manifestation, is often associated with infection by Chlamydia [44]. Thus, MBL could play an important modulator role in this clinical event, and its deficiency could be related to risk of development, progression and severity of VOC in patients with SCA as well.
T.F. Mendonça et al. / Blood Cells, Molecules, and Diseases 44 (2010) 224–228
MBL exerted an important contribution to antimicrobicidal activity and regulation of inflammation through the activation of CS by lectin pathway. It has been suggested that the high consumption of components of the CS [3] and the alteration of the opsonization activity in the serum of SCA patients [4] can exhaust antimicrobicidal defenses and the capacity to remove sickled erythrocytes. Thus, patients with a deficiency of MBL would show additional deficiency on the phagocytosis system, which could lead to the accumulation of erythrocytes on vessel walls, and reduced capacity for combating infectious agents. In this perspective the adhering erythrocyte and endothelium infection may be contributing to the VOC episode. Although in the specialized literature there are no studies demonstrating the interaction of MBL with sickled erythrocytes, we believe that this lectin has a great potential to bind to these erythrocytes, since it has been demonstrated that erythrocytes infected by Plasmodium falciparum are recognized by MBL [45]. In this context, one could suppose that sickled erythrocytes would be removed from inflammatory sites, reducing the inflammation and, consequently, VOC. Therefore, individuals with variant genotypes, related to MBL deficiency, would be more predisposed to the development of VOC and longer duration of this event. However, experimental models should be developed to study the modifier role of MBL in the development of VOC. Conclusion This study demonstrated that there is an association between higher frequency of genotypes of intermediate/low production of MBL and higher frequency of VOC in patients with SCA. Our results suggest that the determination of the polymorphism of MBL2 gene may contribute as prognostic factor for development of VOC. However, as this study was based on genetic polymorphism, other studies involving clinical or experimental models aimed at evaluating the activity of MBL should be carried out. Another important aspect would be to elucidate the interaction of this lectin with sickled erythrocytes and its capacity to modulate inflammation in patients with SCA. Acknowledgments We acknowledge the HEMOPE Foundation for making available the DNA bank of the Hemoglobin Disease Laboratory and to the National Council for Scientific and Technological Development (CNPq) grant 484008/2007-2. References [1] O.S. Platt, Sickle cell anemia as an inflammatory disease, J. Clin. Invest. 106 (2000) 337–338. [2] C. Johnson, M.J. Telen, Adhesion molecules and hydroxyurea in the pathophysiology of sickle cell disease, Haematologica 93 (2008) 481–485. [3] W.A. Wilson, E.J. Thomas, J.P.G. Sissons, Complement activation in asymptomatic patients with sickle cell anaemia, Clin. Exp. Immunol. 36 (1979) 130–139. [4] J.A. Winkelstein, R.H. Drachman, Deficiency of pneumococcal serum opsonizing activity in sickle-cell disease, N. Engl. J. Med. 279 (1968) 459–466. [5] P. Arese, F. Turrini, F. Bussolino, et al., Recognition signals for phagocytic removal of favic malaria-infected and sickled erythrocytes, Adv. Exp. Med. Biol. 307 (1991) 317–327. [6] R.H. Wang, G. Phillips, M.E. Medof, C. Mold, Activation of the alternative complement pathway by exposure of phosphatidylethanolamine and phosphatidylserine on erythrocytes from sickle cell disease patients, J. Clin. Invest. 92 (1993) 1326–1335. [7] M.W. Turner, L. Dinan, S. Heatley, et al., Restricted polymorphism of the mannosebinding lectin gene of indigenous Australians, Hum. Mol. Genet. 9 (2000) 1481–1486. [8] D.L. Worthley, P.G. Bardy, C.G. Mullighan, Mannose-binding lectin: biology and clinical implication, Intern. Med. J. 35 (2005) 548–555. [9] K. Takahashi, W.E. Ip, I.C. Michelow, R.A. Ezekowitz, The mannose-binding lectin: a prototypic pattern recognition molecule, Curr. Opin. Immunol. 18 (2006) 16–23.
227
[10] M.W. Turner, R.M. Hamvas, Mannose-binding lectin: structure, function, genetics and disease associations, Rev. Immunogenet. 2 (2000) 305–322. [11] R.M. Minchinton, M.M. Dean, T.R. Clark, S. Heatley, C.G. Mullighan, Analysis of the relationship between mannose-binding lectin (MBL) genotype, MBL levels and function in an Australian blood donor population, Scand. J. Immunol. 56 (2002) 630–641. [12] M.W. Turner, The role of mannose-binding lectin in health and disease, Mol. Immunol. 40 (2003) 423–429. [13] A. Mangano, C. Rocco, S. Marino, et al., Detrimental effects of mannose-binding lectin (MBL2) promoter genotype XA/XA on HIV-1 vertical transmission and Aids progression, J. Infect. Dis. 198 (2008) 694–700. [14] H.O. Madsen, P. Garred, S. Thiel, et al., Interplay between promoter and structural gene variants control basal serum level of mannan-binding protein, J. Immunol. 155 (1995) 3013–3020. [15] P. Garred, F. Larsen, H.O. Madsen, C. Koch, Mannose-binding lectin deficiency revisited, Mol. Immunol. 40 (2003) 73–84. [16] M.W. Turner, Mannose-binding lectin (MBL) in health and disease, Immunobiology 199 (1998) 327–339. [17] A.C. Gordon, U. Waheed, T.K. Hansen, et al., Mannose-binding lectin polymorphisms in severe sepsis: relationship to levels, incidence, and outcome, Shock 25 (2006) 88–93. [18] A. Koch, M. Melbye, P. Sørensen, et al., Acute respiratory tract infections and mannose-binding lectin insufficiency during early childhood, JAMA 285 (2001) 1316–1321. [19] A. Tsutsumi, R. Takahashi, T. Sumida, Mannose-binding lectin: genetics and autoimmune disease, Autoimmun. Rev. 4 (2005) 364–372. [20] L.G. Best, M. Davidson, K.E. North, et al., Prospective analysis of mannose-binding lectin genotypes and coronary artery disease in American Indians: the Strong Heart Study, Circulation 109 (2004) 471–475. [21] H.O. Madsen, V. Videm, A. Svejgaard, J.L. Svennevig, P. Garred, Association of mannose-binding-lectin deficiency with severe atherosclerosis [letter], Lancet 352 (1998) 959–960. [22] T. Øhlenschlæger, P. Garred, H.O. Madsen, H.O.S. Jacobsen, Mannose-binding lectin variant alleles and the risk of arterial thrombosis in systemic lupus erythematosus, N. Engl. J. Med. 351 (2004) 260–267. [23] L.N. Dornelles, L. Pereira-Ferrari, I. Messias-Reason, Mannan-binding lectin plasma levels in leprosy: deficiency confers protection against the lepromatous but not the tuberculoid forms, Clin. Exp. Immunol. 145 (2006) 463–468. [24] I.K. Santos, C.H. Costa, H. Krieger, et al., Mannan-binding lectin enhances susceptibility to visceral leishmaniasis, Infect. Immun. 69 (2001) 5212–5215. [25] I. Ghiran, S.F. Barbashov, L.B. Klickstein, et al., Complement receptor 1/CD35 is a receptor for mannan-binding lectin, J. Exp. Med. 192 (2000) 1797–1808. [26] R. Malhotra, S. Thiel, K.B.M. Reid, R.B. Sim, Human leukocyte MBL in Sepsis 205 C1q receptor binds other soluble proteins with collagen domains, J. Exp. Med. 172 (1990) 955–959. [27] D.A. Fraser, S.S. Bohlson, N. Jasinskiene, et al., C1q and MBL, components of the innate immune system, influence monocyte cytokine expression, J. Leukoc. Biol. 80 (2006) 107–116. [28] C.D. Collard, M.C. Montalto, W.R. Reenstra, J.A. Buras, G.L. Stahl, Endothelial oxidative stress activates the lectin complement pathway role of cytokeratin 1, Am. J. Pathol. 159 (2001) 1045–1054. [29] M.G. Neonato, C.Y. Lu, M. Guilloud-bataille, et al., Genetic polymorphism of the mannose-binding protein gene in children with sickle cell disease: identification of the three new variant alleles and relationship to infections, Eur. J. Hum. Genet. 7 (1999) 679–686. [30] M.C.V.C. Oliveira, T.F. Mendonça, L.R.S. Vasconcelos, et al., Association of the MBL2 gene exon 1 polymorphism and vasoocclusive crisis in patients with sickle cell anemia, Acta Haematol. 121 (2009) 212–215. [31] J. Isola, S. Devries, L. Chu, S. Chazvini, F. Waldman, Analysis of changes in DNA sequence copy number by comparative genomic hybridization in archival paraffin-embedded tumor samples, Am. J. Pathol. 145 (1994) 1301–1308. [32] U. Hladnik, L. Braida, M. Boniotto, et al., Single-tube genotyping of MBL-2 polymorphisms using melting temperature analysis, Clin. Exp. Med. 2 (2002) 105–108. [33] S. Schneider, D. Roessli, L. Excoffier, Arlequin: a software for population genetic data analysis [Computer Program], Genetics and Biometry Laboratory, University of Geneva, Geneva, 2000. [34] P. Garred, F. Larsen, J. Seyfarth, R. Fujita, H.O. Madsen, Mannose-binding lectin and its genetic variants, Genes Immun. 7 (2006) 85–94. [35] A.B. Boldt, L. Culpi, L.T. Tsuneto, et al., Diversity of the MBL2 gene in various brazilian populations and the case of selection at the mannose-binding lectin locus, Hum. Immunol. 67 (2006) 722–734. [36] L. Kruglyak, D.A. Nickerson, Variation is the spice of life, Nat. Genet. 27 (2001) 234–236. [37] The International SNP Map Working Group, A map of human genome sequence variation containing 1.42 million single nucleotide polymorphisms, Nature 409 (2001) 928–933. [38] A. Adekile, F. Kutlar, K. Mckie, et al., A influence of uridine diphosphate glucoronosyl transferase 1A promoter polymorphisms, β′-globin gene haplotype, co-inherited α-thalassemi trait and HbF on steady-state serum bilirubin levels in sickle cell anemia, Eur. J. Haematol. 75 (2005) 150–155. [39] O.P. Dossou-Yovo, I. Zaccaria, M. Benkerrou, et al., Effects of RANTES and MBL2 gene polymorphisms in sickle cell disease clinical outcomes: association of the g.In1.1T N C RANTES variant with protection against infections, Am. J. Hematol. 84 (2009) 378–380. [40] J. Calvo-Alén, G.S. Alarcón, M.B. Tew, et al., Systemic lupus erythematosus in a multiethnic us cohort XXXIV. Deficient mannose-binding lectin exon 1
228
T.F. Mendonça et al. / Blood Cells, Molecules, and Diseases 44 (2010) 224–228
polymorphisms are associated with cerebrovascular but not with other arterial thrombotic events, Arthritis Rheum. 54 (2006) 1940–1956. [41] M.C. Walsh, T. Bourcier, K. Takahashi, Mannose-binding lectin is a regulator of inflammation that accompanies myocardial ischemia and reperfusion injury, J Immunol. 175 (2005) 541–546. [42] S. Rugonfalvi-Kiss, V. Endrész, H.O. Madsen, S. Jacobsen, Association of chlamydia pneumoniae with coronary artery disease and its progression is dependent on the modifying effect of mannose-binding lectin, Circulation 106 (2002) 1071–1076.
[43] S. Saevarsdottir, O.O. Oskarsson, T. Aspelund, et al., Mannan-binding lectin as an adjunct to risk assessment for myocardial infarction in individuals with enhanced risk, J. Exp. Med. 201 (2005) 117–125. [44] E.P. Vichinsky, L.D. Neumayr, A.N. Earles, et al., Causes and outcomes of the acute chest syndrome in sickle cell disease, N. Engl. J. Med. 342 (2000) 1855–1865. [45] P. Garred, M.A. Nielson, J.A.L. Kurtzhals, et al., Mannose-binding lectin is a disease modifier in clinical malaria and may function as opsonin for plasmodium falciparum-infected erythrocytes, Infect. Immun. 71 (2003) 5245–5253.
Contents lists available at ScienceDirect
Blood Cells, Molecules, and Diseases j o u r n a l h o m e p a g e : w w w. e l s e v i e r. c o m / l o c a t e / y b c m d
Association of variant alleles of MBL2 gene with vasoocclusive crisis in children with sickle cell anemia T.F. Mendonça a,⁎, M.C.V.C. Oliveira b, L.R.S. Vasconcelos c, L.M.M.B. Pereira a,c, P. Moura a, M.A.C. Bezerra b, M.N.N. Santos b, A.S. Araújo b, M.S.M. Cavalcanti a a b c
Biological Science Institute and College of Medical Sciences, University of Pernambuco, Recife, Brazil Hematology and Hemotherapy Foundation of Pernambuco (HEMOPE), Recife, Brazil Liver Institute of Pernambuco (IFP-PE), Recife, Brazil
a r t i c l e
i n f o
Article history: Submitted 19 August 2009 Revised 26 November 2009 Available online 20 February 2010 (Communicated by P. Gallagher, M.D., 20 January 2010) Keywords: Sickle cell anemia Polymorphism MBL2 Real Time PCR Vasoocclusive crisis
a b s t r a c t Vasoocclusive crisis (VOC) is the major cause of morbidity and mortality in sickle cell anemia (SCA), which is caused by the occlusion of blood vessels, followed by ischemia or infarct, resulting in progressive damage to organs. However, this clinical manifestation is variable, indicating that this process could be influenced by modifier genes. The gene MBL2 which codes for mannose-binding lectin (MBL) has been associated with modifications in the progression of infectious and inflammatory vascular diseases. The aim of this study was to determine the frequency of the polymorphisms of exon 1 (alleles A/O) and promoter region − 221 (alleles Y/X) of MBL2 in children with SCA and to verify their association with VOC. The determination of the polymorphism of exon 1 and the promoter region of MBL2 was performed by SYBR GREEN® and Taqman® system, respectively. In the patients with SCA, the frequency of the genotype related to high production of MBL was 0.46 (YA/YA) and for intermediate/low production was 0.54 (YA/XA, XA/XA, YA/YO, XA/ YO, YO/YO). The frequency of the genotypes and haplotypes of MBL2 in patients with SCA did not differ from control individuals. The populations were in Hardy–Weinberg equilibrium. The patients were divided into two groups. The groups were separated by the frequency of VOC, which was defined by the total of VOC episodes divided by the age of the children at the end of this study. Since, we choose a cut point in FVOC b 1 (n = 48) (which we considered of mild presentation of disease) and FVOC ≥ 1 (n = 39) (higher severity). In children with SCA, the frequency of the genotypes of MBL2 of intermediate/low expression for MBL was associated with FVOC ≥ 1 (p = 0.0188 OR = 3.15 CI = 1.19–8.50). The results suggest that MBL2 polymorphism at promoter and first exon of MBL2 associated with low serum levels and structural alterations of MBL could modify the phenotype of the child with SCA related to VOC. © 2010 Elsevier Inc. All rights reserved.
Introduction Sickle cell anemia (SCA) is a genetic disease caused by a mutation in the β chain of hemoglobin, characterized by chronic inflammatory manifestations. The mutant hemoglobin (HbS) polymerizes at low oxygen tension, causing the deformation of the erythrocytes, making them rigid which leads to obstruction of blood flow and tissue damage [1]. Vasoocclusive crisis (VOC) is a complex event involving erythrocytes deformation, enhancement of leukocyte adhesion, inflammation, endothelial injury and activation of the coagulation and
⁎ Corresponding author. R. Arnóbio Marques, 310, Núcleo de Pós-graduação Ruy Marques, 50100-130 – Santo Amaro, Recife, Brazil. Fax: +55 81 3183 3510. E-mail addresses: [email protected] (T.F. Mendonça), [email protected] (M.C.V.C. Oliveira), [email protected] (L.R.S. Vasconcelos), [email protected] (L.M.M.B. Pereira), [email protected] (P. Moura), [email protected] (M.A.C. Bezerra), [email protected] (M.N.N. Santos), [email protected] (A.S. Araújo), [email protected] (M.S.M. Cavalcanti). 1079-9796/$ – see front matter © 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.bcmd.2010.02.004
complement pathways, been the major cause of morbidity and mortality in SCA [2]. The consumption of components of the complement system (CS) through the alternative route [3] and the alteration of the opsonization activity in the serum of patients with SCA during VOC [4] appear to be related to the clearance of sickled erythrocytes [5]. Therefore, the excess consumption of CS components can lead to a decreased capacity of CS to combat infectious agents, thereby overloading the phagocytosis system in the clearance of erythrocytes, compromising the antimicrobicidal activity of the macrophages [6]. Another mechanism of activation of the CS is initiated by mannosebinding lectin (MBL), a protein of innate immunity coded by the MBL2 gene [7]. MBL recognizes carbohydrate patterns in a variety of pathogens, activating serine-proteases associated with MBL called MASPs, which cleave the C3 and C4 components of the CS [8,9]. In exon 1 of the MBL2 gene, there are three point mutations collectively called “O” and the wild-type allele called “A” [10]. The promoter regions −221 (alleles Y/X) and −550 (alleles H/L) of MBL2
T.F. Mendonça et al. / Blood Cells, Molecules, and Diseases 44 (2010) 224–228
contain regulatory elements that influence the transcription of the protein, associated with different serum concentrations of MBL, in which, the variant allele X has an important negative effect on serum levels of MBL [11–13]. Consequently, the Y/X polymorphism, in the promoter region, has been considered an important genetic regulator of serum MBL levels [14,15]. Studies have shown a positive association between low serum levels of MBL and polymorphism of MBL2 with increased risk for infections [16–18]. Also, the deficiency of MBL has been associated with the risk of autoimmune disease, atherosclerosis [19–21] and arterial thrombosis [19,22]. However, deficiency of this protein appears to confer protection against certain intracellular pathogens [23,24]. MBL is recognized by colectin receptors expressed on various cell types such as monocytes, macrophages, B lymphocytes, platelets, endothelial cells and fibroblasts [25–27]. Fraser et al. (2006) [27] demonstrated that activated macrophages recognize MBL bound to apoptotic cells, which leads to the production of interleukine-10 (IL-10), which could modulates the inflammatory response. Additionally, human endothelial cells, when submitted to oxidative stress, can be targets for the activation of the CS via MBL [28]. Neonato et al. (1999) [29], studying 242 children with sickle cell disease (SS and SC), observed that mutations in MBL2, related to the expression of low levels of MBL, conferred a protective role against severe infections (osteomyelitis, meningitis, and septicemia) (p = 0.01). These results indicate that the variant alleles related to low production of MBL, do not lead exclusively to a biological disadvantage. However, in many studies, the low expression of MBL has been associated with susceptibility to infection [16–18]. Oliveira et al. (2009) [30] determined the frequency of polymorphism of exon 1 of MBL2 in 422 Brazilian patients with SCA. Of these patients, 87 children who participated in the National Neonatal Screening Program for SCA of the HEMOPE Foundation, were selected for analysis of the association of the structural polymorphism with VOC, demonstrating a statistically significant association between variants of MBL2 (AO/OO) and VOC. Therefore, the study of the frequency of MBL2 polymorphism in children with SCA is important, since this protein acts in the innate immune system and in play a role in the modulation of inflammation. Thus, the aim of this work was to continue the study of Oliveira et al. (2009) [30], investigating not only the polymorphism of exon 1 but also the polymorphism of the promoter region −221 of MBL2, due to its great influence on the serum concentrations of MBL, as well as to determine the association of these polymorphisms with VOC.
225
population for a clinical association study with VOC. The clinical data were collected from the records in the medical files of the HEMOPE Foundation. The period of observation for collection of VOC consisted from birth until the end of this study. The control group consisted of 232 blood donor volunteers without SCA, who were recruited from the Blood Bank. In the control group the age ranged from 18 to 55 years (mean 34 ± 8.3) and 58% were male. The clinical events considered VOC were: painful crisis, dactylitis and acute thoracic syndrome. For the association analysis of MBL2 polymorphism and VOC, the patients were divided into two groups. The groups were separated by the frequency of VOC, which was defined by the total of VOC episodes divided by the age of the children at the end of this study. Since, we choose a cut point in FVOC b1 (n = 48) (which we considered of mild presentation of disease) and FVOC ≥1 (n = 39) (higher severity). Extraction of genomic DNA and genotyping of gene MBL2 DNA was extracted from peripheral blood samples by the phenol– chloroform technique, according to Isola et al. (1994) [31]. Real Time PCR was used to determine the polymorphism of the promoter region and exon 1 of the MBL2 gene, using the Rotor Gene 6000TM apparatus (Corbett Research Mortlake, Sydney, Australia). The fluorophore SYBR GREEN® was utilized in the assay for exon 1 polymorphism (A/O), in accordance with Hladnik et al. [32]. The primers used in the genotyping of exon 1 were: forward 5′AGGCATCAACGGCTTCCCA 3′ and reverse 5′ CAGAACAGCCCAACACGTACCT 3′ [32]. The promoter region −221 (X/Y) polymorphism were detected using the Taqman® SNP (Single Nucleotide Polymorphism) (Applied Biosystems, CA, USA). Primer and probe sequences were taken from the NCBI website (http://snp500cancer.nci.nih.gov). Analysis of haplotypes and genotypes For the study of the association, the haplotypes of MBL2 were divided into two groups: those related to high expression of MBL (YA) (n = 116) and those related to intermediate/low expression (XA, YO) (n = 58). The genotypes were divided related to high (YA/YA) (n = 40) and intermediate/low (YA/XA, XA/XA, YA/YO, XA/YO, YO/ YO) (n = 47) serum MBL levels. This division of the haplotypes and genotypes was used according to Garred et al. (2003) [15]. Statistical analysis
Materials and methods Ethical considerations This project was approved by the Research Ethics Committee of the HEMOPE Foundation , Recife, Pernambuco (registration No. 044/06) and written informed consent was obtained from patients and control subjects.
The allele frequencies were calculated by ARLEQUIM software version 3.1 (Geneva University, Geneva, Switzerland) [33] and the differences of frequencies analyzed by Fisher's exact probability test using 2 × 2 and 3 × 2 contingency tables. The statistical analyses were performed using EPinfo version 3.5.1 (CDC, Atlanta, USA), with the level of significance at p b 0.05. Results
Patients Eighty-seven children with SCA were studied; they were homozygote for hemoglobin S, aged 1 to 6 years with a mean of 3.46 ± 1.49 years, where 48.3% were males. The samples of the patients were obtained from the DNA bank of the Hematology Hospital of the HEMOPE Foundation, where the patients were enrolled in the Brazilian National Neonatal Screening Program for SCA and followed-up regularly in HEMOPE, in Pernambuco State, Brazil. In the protocol of this program, the patients are vaccinated against pneumococci (Pneumo 7 — Wyeth Pharmaceuticals Inc. USA) and meningococci (Meningitec — Wyeth Pharmaceuticals, UK), and are also given prophylactic penicillin (dose of 4000 U/kg/day) up to 5 years of age, producing a more homogeneous
The clinical information of the patients with is observed in Table 1. It could be observed that the traits are practically evenly distributed in both groups of patients. Therefore, our analysis can be considered with a reasonable certainty. The groups of patients with SCA and control were in Hardy– Weinberg equilibrium. In the patients with SCA, the frequency of the alleles Y and X of the promoter region (−221) was 0.84 and 0.16, respectively; and the frequency of the alleles A and O of the first exon was 0.83 and 0.17, respectively. In the control population, the frequencies found were: 0.84 (Y), 0.16 (X), 0.79 (A) and 0.21 (O). The allelic frequencies of Y/X and A/O did not differ significantly (p = 0.9738 and p = 0.3571, respectively) between the two populations.
226
T.F. Mendonça et al. / Blood Cells, Molecules, and Diseases 44 (2010) 224–228
Table 1 Characteristics of the patients with sickle cell anemia. Characteristics
All patients (n = 87)
b 1 FVOC (n = 48)
≥ 1 FVOC (n = 39)
Age mean (±SD) Sex (M/F) Haplotype HBB*S (with CAR/Without CAR) HbF median (min–max) 3.7 Kb Deletion α (heterozygote/normal)
3.47 (± 1.49) 42/45 80/07
3.52 (± 1.42) 23/25 44/04
3.41 (± 1.58) 19/20 36/03
21.15 (0.8–35.2) 16/71
19.5 (8.7–35.2) 11/37
21.3 (0.8–26.8) 05/34
Table 3 Association of polymorphism of the − 221 promoter region and exon 1 of the MBL2 gene with vasoocclusive crisis (VOC) in patients with sickle cell anemia treated in Hemope Foundation — Recife/Brazil. Profile of MBL2 genotypes
FVOC ≥1
b1
High Intermediate/low
12 27
28 20
TOTAL
p
40 47
p = 0.0188 OR = 3.15 CI = 1.19–8.50
FVOC = Frequency of VOC, which was defined by the total of VOC episodes divided by the age of the children at the end of this study.
FVOC = Frequency of VOC, which was defined by the total of VOC episodes divided by the age of the children at the end of this study; HbF = Hemoglobina F.
The distribution of the frequency of the variant genotypes of the promoter region − 221 (YX/XX) and of exon 1 (AO/OO) of MBL2 in patients with SCA compared to the control group also did not show a significant difference (p = 0.9699 and p = 0.4533, respectively). In the patients, the frequency of haplotypes related to high (YA) (n = 116), intermediate (XA) (n = 28) and low (YO) (n = 30) expression of MBL were 0.67, 0.16 and 0.17, respectively, and the frequency of the genotypes related to high (YA/YA) (n = 40), intermediate (YA/XA, XA/XA, YA/YO) (n = 38) and low (XA/YO, YO/YO) (n = 9) expression of MBL were 0.46, 0.44 and 0.10, respectively (Table 2). The association of the genotypes of high and intermediate/low expression of MBL with the patients with SCA and the control group also was not significant (p = 0.5874). A positive association was found between the MBL2 genotypes related to intermediate/low expression of MBL and patients with SCA with FVOC ≥1 (p = 0.0188) (Table 3). Discussion The MBL2 gene shows a large allelic variety in accordance with each ethnic group [34]. In the studied population, the frequency of the MBL2 polymorphism was similar to that found by Boldt et al. (2006) [35] who studied a Brazilian population (n = 107) with a high degree of miscegenation. SNPs constitute common variations in the human genome, which can be associated with the clinical stage of diseases and even influence therapy to some degree. In SCA, small genetic differences are known to be directly associated with the phenotype of the disease [36,37]. Important features which may have an impact on the VOC episode, such as age, HBB*S haplotype, HbF and alpha-thalassemia [38] listed in the Table 1 showed no differences when the groups with b1 FVOC and ≥1 FVOC were compared. Therefore, those characteristics seem not be influencing the frequency of VOC. In a previous study from our group, 422 Brazilian patients with SCA were analyzed, and no difference was found in the frequency Table 2 Frequency of haplotypes and genotypes of the −221 promoter region and exon 1 of the MBL2 gene and their phenotypes in patients with sickle cell anemia treated in Hemope Foundation — Recife/Brazil. Haplotype
Sickle cell anemia (n = 174)
Controls (n = 464)
MBL expression
YA XA YO
0.67 (116/174) 0.16 (28/174) 0.17 (30/174)
0.63 (295/464) 0.17 (77/464) 0.20 (92/464)
High Intermediate Low
Genotype
Sickle cell anemia (n = 87)
Controls (n = 232)
MBL expression
YA/YA YA/XA XA/XA YA/YO XA/YO YO/YO
0.46 0.20 0.02 0.22 0.08 0.02
0.42 0.17 0.04 0.26 0.08 0.03
High Intermediate Intermediate Intermediate Low Low
(40/87) (17/87) (2/87) (19/87) (7/87) (2/87)
*According Garred et al. [15].
(97/232) (41/232) (9/232) (60/232) (18/232) (7/232)
distribution of MBL2 exon 1 polymorphism, when compared to the control group [30]. The present study analyzed 87 children with SCA, and also did not find any difference in the frequency of this polymorphism compared to the control group. The genotypes related to intermediate/low expression of MBL showed similar frequency (0.54) (Table 2) to the frequency found by Neonato et al. (1999) [29], which was 0.50. Even though that those authors had included in their analysis the promoter region −550 for patients with SCA group. This study demonstrated a statistically significant association between genotypes of MBL2 considering the combined alleles from promoter and exon 1 regions, related to intermediate/low expression of MBL, and higher frequency of VOC in children with SCA (p = 0.0188) (Table 3). This finding is in accordance with the results obtained by Oliveira et al. (2009) [30] who studied the frequency of the structural variants of MBL2 in the same population and found a significant association between the patients with SCA who had the variants AO/ OO with VOC (p = 0.039; OR = 3.01; CI = 1.05–9.11). These authors demonstrated this positive association even without analyzing the polymorphism of the promoter region − 221 of MBL2 which significantly influences the production of this protein. Another difference between the previous study and the present one is in regard to the categorization of the clinical event, because Oliveira et al. (2009) [30] divided the groups on the basis of the absence or presence of at least one event of VOC independent of the age of the patient. Conversely, the present study utilized as criteria for separate the groups, the frequency of VOC (FVOC) with regard to the age of the patient, which varied from 1 to 6 years, providing an analysis more suitable for the association between the frequency of MBL2 polymorphisms and SCA patients with VOC. Previous studies investigating MBL2 polymorphism in patients with SCA observed no association of the MBL2 variants with susceptibility to infections [29,30,39]. The relatively recent disclosure of MBL as a regulatory molecule of inflammation has been explored [22,27,40,41]. Genotypes related to low concentrations of MBL could lead to an increase in the inflammation of vessels, which may contribute to the development of the atherosclerosis process [20]. Since MBL has been considered a modifying factor of disease, we intended to address its association with VOC in patients with SCA, because this clinical manifestation is related to inflammatory processes. Chlamydia pneumonia infection can lead to the development, progression and severity of coronary artery disease in patients with variant alleles of MBL2 [42]. It is likely that patients with variant alleles of MBL2 do not develop an efficient immune response against atherogenic agents of the vascular endothelium, which are responsible for the constant inflammatory response [22,42,43]. It was demonstrated that MBL participates in the phagocytosis of promoter agents of inflammation, such as C. pneumoniae, diminishing local inflammation [22,43]. Acute thoracic syndrome, a type of VOC manifestation, is often associated with infection by Chlamydia [44]. Thus, MBL could play an important modulator role in this clinical event, and its deficiency could be related to risk of development, progression and severity of VOC in patients with SCA as well.
T.F. Mendonça et al. / Blood Cells, Molecules, and Diseases 44 (2010) 224–228
MBL exerted an important contribution to antimicrobicidal activity and regulation of inflammation through the activation of CS by lectin pathway. It has been suggested that the high consumption of components of the CS [3] and the alteration of the opsonization activity in the serum of SCA patients [4] can exhaust antimicrobicidal defenses and the capacity to remove sickled erythrocytes. Thus, patients with a deficiency of MBL would show additional deficiency on the phagocytosis system, which could lead to the accumulation of erythrocytes on vessel walls, and reduced capacity for combating infectious agents. In this perspective the adhering erythrocyte and endothelium infection may be contributing to the VOC episode. Although in the specialized literature there are no studies demonstrating the interaction of MBL with sickled erythrocytes, we believe that this lectin has a great potential to bind to these erythrocytes, since it has been demonstrated that erythrocytes infected by Plasmodium falciparum are recognized by MBL [45]. In this context, one could suppose that sickled erythrocytes would be removed from inflammatory sites, reducing the inflammation and, consequently, VOC. Therefore, individuals with variant genotypes, related to MBL deficiency, would be more predisposed to the development of VOC and longer duration of this event. However, experimental models should be developed to study the modifier role of MBL in the development of VOC. Conclusion This study demonstrated that there is an association between higher frequency of genotypes of intermediate/low production of MBL and higher frequency of VOC in patients with SCA. Our results suggest that the determination of the polymorphism of MBL2 gene may contribute as prognostic factor for development of VOC. However, as this study was based on genetic polymorphism, other studies involving clinical or experimental models aimed at evaluating the activity of MBL should be carried out. Another important aspect would be to elucidate the interaction of this lectin with sickled erythrocytes and its capacity to modulate inflammation in patients with SCA. Acknowledgments We acknowledge the HEMOPE Foundation for making available the DNA bank of the Hemoglobin Disease Laboratory and to the National Council for Scientific and Technological Development (CNPq) grant 484008/2007-2. References [1] O.S. Platt, Sickle cell anemia as an inflammatory disease, J. Clin. Invest. 106 (2000) 337–338. [2] C. Johnson, M.J. Telen, Adhesion molecules and hydroxyurea in the pathophysiology of sickle cell disease, Haematologica 93 (2008) 481–485. [3] W.A. Wilson, E.J. Thomas, J.P.G. Sissons, Complement activation in asymptomatic patients with sickle cell anaemia, Clin. Exp. Immunol. 36 (1979) 130–139. [4] J.A. Winkelstein, R.H. Drachman, Deficiency of pneumococcal serum opsonizing activity in sickle-cell disease, N. Engl. J. Med. 279 (1968) 459–466. [5] P. Arese, F. Turrini, F. Bussolino, et al., Recognition signals for phagocytic removal of favic malaria-infected and sickled erythrocytes, Adv. Exp. Med. Biol. 307 (1991) 317–327. [6] R.H. Wang, G. Phillips, M.E. Medof, C. Mold, Activation of the alternative complement pathway by exposure of phosphatidylethanolamine and phosphatidylserine on erythrocytes from sickle cell disease patients, J. Clin. Invest. 92 (1993) 1326–1335. [7] M.W. Turner, L. Dinan, S. Heatley, et al., Restricted polymorphism of the mannosebinding lectin gene of indigenous Australians, Hum. Mol. Genet. 9 (2000) 1481–1486. [8] D.L. Worthley, P.G. Bardy, C.G. Mullighan, Mannose-binding lectin: biology and clinical implication, Intern. Med. J. 35 (2005) 548–555. [9] K. Takahashi, W.E. Ip, I.C. Michelow, R.A. Ezekowitz, The mannose-binding lectin: a prototypic pattern recognition molecule, Curr. Opin. Immunol. 18 (2006) 16–23.
227
[10] M.W. Turner, R.M. Hamvas, Mannose-binding lectin: structure, function, genetics and disease associations, Rev. Immunogenet. 2 (2000) 305–322. [11] R.M. Minchinton, M.M. Dean, T.R. Clark, S. Heatley, C.G. Mullighan, Analysis of the relationship between mannose-binding lectin (MBL) genotype, MBL levels and function in an Australian blood donor population, Scand. J. Immunol. 56 (2002) 630–641. [12] M.W. Turner, The role of mannose-binding lectin in health and disease, Mol. Immunol. 40 (2003) 423–429. [13] A. Mangano, C. Rocco, S. Marino, et al., Detrimental effects of mannose-binding lectin (MBL2) promoter genotype XA/XA on HIV-1 vertical transmission and Aids progression, J. Infect. Dis. 198 (2008) 694–700. [14] H.O. Madsen, P. Garred, S. Thiel, et al., Interplay between promoter and structural gene variants control basal serum level of mannan-binding protein, J. Immunol. 155 (1995) 3013–3020. [15] P. Garred, F. Larsen, H.O. Madsen, C. Koch, Mannose-binding lectin deficiency revisited, Mol. Immunol. 40 (2003) 73–84. [16] M.W. Turner, Mannose-binding lectin (MBL) in health and disease, Immunobiology 199 (1998) 327–339. [17] A.C. Gordon, U. Waheed, T.K. Hansen, et al., Mannose-binding lectin polymorphisms in severe sepsis: relationship to levels, incidence, and outcome, Shock 25 (2006) 88–93. [18] A. Koch, M. Melbye, P. Sørensen, et al., Acute respiratory tract infections and mannose-binding lectin insufficiency during early childhood, JAMA 285 (2001) 1316–1321. [19] A. Tsutsumi, R. Takahashi, T. Sumida, Mannose-binding lectin: genetics and autoimmune disease, Autoimmun. Rev. 4 (2005) 364–372. [20] L.G. Best, M. Davidson, K.E. North, et al., Prospective analysis of mannose-binding lectin genotypes and coronary artery disease in American Indians: the Strong Heart Study, Circulation 109 (2004) 471–475. [21] H.O. Madsen, V. Videm, A. Svejgaard, J.L. Svennevig, P. Garred, Association of mannose-binding-lectin deficiency with severe atherosclerosis [letter], Lancet 352 (1998) 959–960. [22] T. Øhlenschlæger, P. Garred, H.O. Madsen, H.O.S. Jacobsen, Mannose-binding lectin variant alleles and the risk of arterial thrombosis in systemic lupus erythematosus, N. Engl. J. Med. 351 (2004) 260–267. [23] L.N. Dornelles, L. Pereira-Ferrari, I. Messias-Reason, Mannan-binding lectin plasma levels in leprosy: deficiency confers protection against the lepromatous but not the tuberculoid forms, Clin. Exp. Immunol. 145 (2006) 463–468. [24] I.K. Santos, C.H. Costa, H. Krieger, et al., Mannan-binding lectin enhances susceptibility to visceral leishmaniasis, Infect. Immun. 69 (2001) 5212–5215. [25] I. Ghiran, S.F. Barbashov, L.B. Klickstein, et al., Complement receptor 1/CD35 is a receptor for mannan-binding lectin, J. Exp. Med. 192 (2000) 1797–1808. [26] R. Malhotra, S. Thiel, K.B.M. Reid, R.B. Sim, Human leukocyte MBL in Sepsis 205 C1q receptor binds other soluble proteins with collagen domains, J. Exp. Med. 172 (1990) 955–959. [27] D.A. Fraser, S.S. Bohlson, N. Jasinskiene, et al., C1q and MBL, components of the innate immune system, influence monocyte cytokine expression, J. Leukoc. Biol. 80 (2006) 107–116. [28] C.D. Collard, M.C. Montalto, W.R. Reenstra, J.A. Buras, G.L. Stahl, Endothelial oxidative stress activates the lectin complement pathway role of cytokeratin 1, Am. J. Pathol. 159 (2001) 1045–1054. [29] M.G. Neonato, C.Y. Lu, M. Guilloud-bataille, et al., Genetic polymorphism of the mannose-binding protein gene in children with sickle cell disease: identification of the three new variant alleles and relationship to infections, Eur. J. Hum. Genet. 7 (1999) 679–686. [30] M.C.V.C. Oliveira, T.F. Mendonça, L.R.S. Vasconcelos, et al., Association of the MBL2 gene exon 1 polymorphism and vasoocclusive crisis in patients with sickle cell anemia, Acta Haematol. 121 (2009) 212–215. [31] J. Isola, S. Devries, L. Chu, S. Chazvini, F. Waldman, Analysis of changes in DNA sequence copy number by comparative genomic hybridization in archival paraffin-embedded tumor samples, Am. J. Pathol. 145 (1994) 1301–1308. [32] U. Hladnik, L. Braida, M. Boniotto, et al., Single-tube genotyping of MBL-2 polymorphisms using melting temperature analysis, Clin. Exp. Med. 2 (2002) 105–108. [33] S. Schneider, D. Roessli, L. Excoffier, Arlequin: a software for population genetic data analysis [Computer Program], Genetics and Biometry Laboratory, University of Geneva, Geneva, 2000. [34] P. Garred, F. Larsen, J. Seyfarth, R. Fujita, H.O. Madsen, Mannose-binding lectin and its genetic variants, Genes Immun. 7 (2006) 85–94. [35] A.B. Boldt, L. Culpi, L.T. Tsuneto, et al., Diversity of the MBL2 gene in various brazilian populations and the case of selection at the mannose-binding lectin locus, Hum. Immunol. 67 (2006) 722–734. [36] L. Kruglyak, D.A. Nickerson, Variation is the spice of life, Nat. Genet. 27 (2001) 234–236. [37] The International SNP Map Working Group, A map of human genome sequence variation containing 1.42 million single nucleotide polymorphisms, Nature 409 (2001) 928–933. [38] A. Adekile, F. Kutlar, K. Mckie, et al., A influence of uridine diphosphate glucoronosyl transferase 1A promoter polymorphisms, β′-globin gene haplotype, co-inherited α-thalassemi trait and HbF on steady-state serum bilirubin levels in sickle cell anemia, Eur. J. Haematol. 75 (2005) 150–155. [39] O.P. Dossou-Yovo, I. Zaccaria, M. Benkerrou, et al., Effects of RANTES and MBL2 gene polymorphisms in sickle cell disease clinical outcomes: association of the g.In1.1T N C RANTES variant with protection against infections, Am. J. Hematol. 84 (2009) 378–380. [40] J. Calvo-Alén, G.S. Alarcón, M.B. Tew, et al., Systemic lupus erythematosus in a multiethnic us cohort XXXIV. Deficient mannose-binding lectin exon 1
228
T.F. Mendonça et al. / Blood Cells, Molecules, and Diseases 44 (2010) 224–228
polymorphisms are associated with cerebrovascular but not with other arterial thrombotic events, Arthritis Rheum. 54 (2006) 1940–1956. [41] M.C. Walsh, T. Bourcier, K. Takahashi, Mannose-binding lectin is a regulator of inflammation that accompanies myocardial ischemia and reperfusion injury, J Immunol. 175 (2005) 541–546. [42] S. Rugonfalvi-Kiss, V. Endrész, H.O. Madsen, S. Jacobsen, Association of chlamydia pneumoniae with coronary artery disease and its progression is dependent on the modifying effect of mannose-binding lectin, Circulation 106 (2002) 1071–1076.
[43] S. Saevarsdottir, O.O. Oskarsson, T. Aspelund, et al., Mannan-binding lectin as an adjunct to risk assessment for myocardial infarction in individuals with enhanced risk, J. Exp. Med. 201 (2005) 117–125. [44] E.P. Vichinsky, L.D. Neumayr, A.N. Earles, et al., Causes and outcomes of the acute chest syndrome in sickle cell disease, N. Engl. J. Med. 342 (2000) 1855–1865. [45] P. Garred, M.A. Nielson, J.A.L. Kurtzhals, et al., Mannose-binding lectin is a disease modifier in clinical malaria and may function as opsonin for plasmodium falciparum-infected erythrocytes, Infect. Immun. 71 (2003) 5245–5253.