Associations of Vitamin D Receptor Single Nucleotide Polymorphisms with Susceptibility to Systemic Sclerosis

Archives of Medical Research 50 (2019) 368e376

PRELIMINARY REPORT

Associations of Vitamin D Receptor Single Nucleotide Polymorphisms with Susceptibility to Systemic Sclerosis Juan Li,a,1 Shan-Yu Chen,b,1 Hong-Hui Liu,a Xiao-Dong Yin,a Long-Ting Cao,a Jian-Hua Xu,b Xiao-Mei Li,c Dong-Qing Ye,a and Jing Wanga b

a Department of Epidemiology and Biostatistics, School of Public Health, Anhui Medical University, Hefei, China Department of Rheumatology and Immunology, First Affiliated Hospital of Anhui Medical University, Hefei, China c Department of Rheumatology and Immunology, Anhui Provincial Hospital, Hefei, China

Received for publication May 24, 2019; accepted September 30, 2019 (ARCMED_2019_456).

Background. This study aims to evaluate whether the Vitamin D receptor (VDR) gene polymorphisms were associated with systemic sclerosis (SSc) in a Chinese Han population. Methods. Using a hospital-based case-control study including 100 SSc patients and 100 healthy controls. Single nucleotide polymorphisms (SNPs) in the VDR region were genotyped by the improved multiplex ligase detection reaction (i MLDR) method. Haplotypes were also constructed after linkage disequilibrium (LD) analysis. Results. Eight SNPs (rs731236 (TaqI), rs2228570 (FokI), rs7975232 (ApaI), rs1544410 (BsmI), rs11574010 (Cdx2), rs739837 (BglI), rs757343 (Tru9I) and rs11168267) were included. There were significant differences between SSc patients and healthy individuals in ApaI and BglI genotype (both adjusted p 5 0.008). Through the genotyping, significantly association of SSc were found for: dominant model of ApaI and BglI (both OR (95% CI) 5 1.80 (1.03,3.16), p 5 0.040). Furthermore, the elevation of erythrocyte sedimentation rate (ESR) had a higher percentage of BglI GT genotype frequency ( p 5 0.034) and dominant model of ApaI ( p 5 0.016) in SSc. There was high linkage disequilibrium was detected in BglI and ApaI polymorphisms (r2 5 1.0, D’ 5 1.0), Tru9I and rs11168267 (r2 5 0.926, D’ 5 0.969), respectively. No significant difference were found in these four haplotypes (all p O0.05). The correlation between VD levels and VDR gene polymorphisms was not statistically significant. Conclusions. Our preliminary study indicates the ApaI and BglI genotype may possibly have a role in the pathogenesis of SSc patients. Dominant model of ApaI and BglI GT genotype frequency may be associated with the increased risk of ESR. Ó 2019 IMSS. Published by Elsevier Inc. Key Words: Systemic sclerosis, Vitamin D receptor, VDR, Polymorphism.

Introduction Systemic sclerosis (SSc, scleroderma) is a severe autoimmune disease that is characterized by vascular abnormalities, immunological alterations and fibrosis of the skin

1

These authors contributed equally to this work. Address reprint requests to: Jing Wang, MD, Department of Epidemiology and Biostatistics, School of Public Health, Anhui Medical University, Meishan Road 81, Hefei, Anhui, 230032, PR China; Phone: (þ86) (551) 65161175; FAX: (þ86) (551) 65161033; E-mail: jwang2006@126. com

and internal organs (1). Based on the extent of skin involvement, SSc is classified into limited cutaneous (lcSSc) and diffuse cutaneous (dcSSc) scleroderma. The overall incidence rates of SSc range globally from 8 to 56 new cases/million/year, which is observed predominantly in females. Although the pathogenesis of SSc is not yet fully clarified, genetic and environmental factors are implicated in disease susceptibility (2,3). Vitamin D (VD) is a necessary micronutrient for human beings, and plays an important role in the bone health and calcium homeostasis (4). VD deficiency impairs immune responses and self-tolerance by compromising the functions

0188-4409/$ - see front matter. Copyright Ó 2019 IMSS. Published by Elsevier Inc. https://doi.org/10.1016/j.arcmed.2019.09.006

Vitamin D Receptor Gene Polymorphisms with Susceptibility to Systemic Sclerosis

of these cells including natural killer cells, T or B lymphocytes. Accumulating evidence indicates that VD deficiency could contribute to the risk of autoimmune diseases such as SSc (5). Actually, VD has several immunomodulatory effects mediating them through binding to its specific receptor, vitamin D receptor (VDR), existing in most cell types of the immune system, mainly antigen-presenting cells and T cells, which belongs to the superfamily of transacting transcriptional regulatory factors (6). Notably, VDR activation plays a central role in modulating the immunological response. Specific variants of the VDR gene are associated with alterations in VD function and metabolism (7,8). These results suggest VDR gene may be related to autoimmunity diseases susceptibility including SSc. In humans, the VDR gene is located on chromosome 12q13.11., extends over 100 kb and includes eight protein-coding exons, six untranslated exons, eight introns and two promoter regions, with numerous single nucleotide polymorphisms (SNPs) (9,10). Associations between VDR polymorphisms and susceptibility to autoimmunity diseases have been conducted in different settings and ethnic backgrounds, while the results obtained so far are conflicting (11e15). On the contrary, a meta-analysis was conducted on the associations between the VDR gene polymorphism and rheumatoid arthritis (RA) or SLE, which found that the BsmI polymorphism was significant risk factors for SLE and the FokI polymorphism may confer susceptibility to RA in Europeans (13). Notably, there is still a scarcity of data regarding the association of VDR SNPs with SSc patients. To our knowledge, there was only one study explored that the association between VDR gene polymorphisms and SSc in the Egyptian population, but the samples sizes was small (30 cases and 60 controls) and only two common VDR polymorphisms (ApaI and TaqI) were analyzed (16). Unfortunately, the possible relationship between SSc and VDR SNPs in Chinese Han population still remains uncertain. Thus, in the current study, to clarify whether the VDR gene polymorphisms could influence SSc susceptibility as well as its clinical or laboratory characteristics in a Chinese Han population. We finally selected eight VDR SNPs (rs731236 (TaqI), rs2228570 (FokI), rs7975232 (ApaI), rs1544410 (BsmI), rs11574010 (Cdx2), rs739837 (BglI), rs757343 (Tru9I) and rs11168267). It is helpful to further understand the mechanism of how VD acts on SSc and to identify of new therapeutic targets.

Materials and Methods Patients and Controls This is a hospital-based case-control study included 100 SSc patients and 100 healthy control subjects. Both SSc and control populations were of Han Chinese. All SSc patients were recruited from the department of Rheumatology

369

at the First Affiliation Hospital of Anhui Medical University and Anhui Provincial Hospital between January 2015 and February 2017. The diagnosis of SSc was performed according to the criteria defined by the 1980 revision of the American College of Rheumatology and diagnosed by the clinicians of the Department of Rheumatism and Immunology (17). In the same period, a group of ethnically and geographically matched healthy subjects were selected as normal controls, which were from the health examination center of the second affiliated hospital of Anhui Medical University. We used the presence of clinical manifestations and/ or family history of autoimmunity or chronic inflammatory as exclusion criteria for the control group. This study conformed to the Declaration of Helsinki, and the design of the work was reviewed and approved by the Ethics Committee of Anhui Medical University. All subjects agreed to participate in this study and signed informed consents. Collection of Information Prior to the start of the study, all staff involved in the study were given uniform training and guidance, and a standard survey process was used for data collection. Each participant was interviewed using a standardized questionnaire that included information on demographic data (age, gender), clinical and laboratory markers data were also collected from hospital records or by questionnaire and reviewed by experienced physicians. These main clinical manifestations included limitation of mouth opening, dyspnea, Raynaud’s phenomenon (RP), joints and organs involvement. In terms of clinical symptoms, limitation of mouth opening was defined as the space between upper incisor and lower incisor cannot accommodate the horizontally erected index finger, middle finger and ring finger. Dyspnea was defined as a subjects experience of breathing discomfort. RP was defined as history of sudden onset of cold fingers (or toes) in association with sharply demarcated colour changes of skin pallor (white attack) and/or cyanotic skin (blue attack), followed by erythema upon warming and reperfusion (18). Joins involvement were defined as swelling and/or tenderness of joints (18). Organs involvement were defined as progressive fibrosis and/or dysfunction of the skin, lungs and other internal organs. Additionally, laboratory data collected included erythrocyte sedimentation rate (ESR), autoantibody results including antinuclear antibody (ANA), anti-Sjgren syndrome A antibody (anti-SSA), and antitopoisomerase I antibody (anti-Scl-70). We defined elevation of ESR as female O20 mm/h and male O15 mm/h, respectively. SNP Selection The VDR gene is located on chromosome 12 at q11eq13. Our study referred to HapMap database of Han Chinese in

370

Li et al./ Archives of Medical Research 50 (2019) 368e376

Beijing, China (http://hapmap.ncbi.nlm.nih.gov) and NCBI database (http://www.ncbi.nlm.nih.gov/ncbisearch) with information about VDR loci and related published literature which previously explored for VDR SNPs associated with SSc and/or other autoimmune diseases. Finally, eight SNPs FokI (rs2228570), BsmI (rs1544410), ApaI (rs7975232), TaqI (rs731236), Cdx2 (rs11574010), BglI (rs739837), Tru9I (rs757343) and rs11168267 were identified in present study. DNA Extraction and Genotyping Collection and treatment of blood samples: Peripheral blood samples (5 mL) of SSc patients and healthy controls were collected using tubes for blood specimen collection with Ethylene Diamine Tetraacetic Acid (EDTA). Then immediately in the 4 C refrigerator to spare. VDR genotyping: Genomic DNA was extracted from EDTA-treated whole blood by using the DNA Blood Mini Kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions and were stored at 80 C before the detection of genotyping. The genotypes of VDR SNPs were analyzed by polymerase chain reaction (PCR) method. The PCR primers are listed in Table 1. Reaction condition was as follows: initial denaturation for 95 C for 2 min followed by 11cycle of denaturation at 94 C for 30 s, annealing at 65 C for 40 s and extension at 72 C for 1.5 min and 24 cycle of denaturation at 94 C for 30 s, annealing at 59 C for 30 s and extension at 72 C for 1.5 min. Final extension was performed at 72 C for 2 min. Eight SNPs were detected by using the improved multiplex ligase detection reaction (i MLDR) method (Shanghai Genesky Bio-Tech Co, Ltd.; www.geneskies.com). Raw data were analyzed by GeneMapper 4.1 (Applied Biosystems, USA).

Statistical Analysis Statistical analyses were performed with the SPSS version 23.0 (IBM Corp, Armonk, NY, USA). Categorical variables are expressed as n (%). Continuous data were given as mean  standard deviation (SD) or median (interquartile range, IQR), according to the normality of the data. Genotype distributions and allele frequencies were compared between SSc patients and healthy controls using the c2 test or Fisher’s exact test. Hardy-Weinberg equilibrium (HWE) tests were evaluated using the SHEsis software (http:// analysis.bio-x.cn/myAnalysis.php) in control groups by Fisher’s exact test. Binary logistic regression was performed to evaluate the association between the polymorphisms and SSc risk, adjusting for sex and age when necessary. Association of polymorphic genotypes or alleles with SSc was evaluated by odds ratios (ORs) were calculated with 95% confidence intervals (CI). The Haplotype analysis was also done using the SHEsis software. Correlation between VD levels and VDR SNPs in SSc patients using Spearman rank correlation. A p value !0.05 was considered significant and all statistical tests were twosided.

Results Characteristics of Study Sample In the current study, for SSc group, mean age and percentage of males was 48.96  12.28 and 8.0%, respectively. Healthy control group included 13 males and 87 females with mean age 50.53  10.45 years. There is no statistically significant difference between these two groups in terms of age ( p 5 0.331) or sex ( p 5 0.249). All SSc patients

Table 1. SNP information and oligonucleotide sequences used for VDR gene genotyping

SNPs

SNP Property

Allele

Chromosome position

PCR product length (bp)

FokI (rs2228570)

Nonsynon _exon3

A/G

48272895

181

BsmI (rs1544410)

Intron9

T/C

48239835

317

ApaI (rs7975232)

Intron9

A/C

48238837

224

TaqI (rs731236)

Synon_exon10

G/A

48238757

224

Cdx2 (rs11574010)

5’_ flanking

C/T

48298902

350

BglI (rs739837)

3’_UTR

G/T

48238221

293

Tru9I (rs757343)

Intron9

C/T

48239675

317

rs11168267

Intron4

G/A

48251542

286

PCR primer (5’/30 ) F: TGCAGCCTTCACAGGTCATAGC R: GGCACTGACTCTGGCTCTGACC F: TTGGACCTCATCACCGACATCA R: TTCGTAGGGGGGATTCTGAGGA F: GCGGATGTACGTCTGCAGTGTG R: TGGTATCACCGGTCAGCAGTCA F: GCGGATGTACGTCTGCAGTGTG R: TGGTATCACCGGTCAGCAGTCA F: CTTCGCCCCGCCCACAGGTC R: GTGCCTTGCCCTATGGACGAC F: AGACCCCACTAGGCGCTGGAC R: CCCAGCCCATTCTCTCTCCTGT F: TTGGACCTCATCACCGACATCA R: TTCGTAGGGGGGATTCTGAGGA F: CGGAGTAGGTGGGGTCGTAGGT R: GAGGGAGCCCCGAGTGTTAAAG

Vitamin D Receptor Gene Polymorphisms with Susceptibility to Systemic Sclerosis

included in this study were diagnosed as diffuse cutaneous SSc. Clinical features of the patients included limitation of mouth opening (65.0%), dyspnea (41.0%), RP (63.0%), joints involvement (42.0%) and organs involvement (63.0%); The results of laboratory manifestations indicated that the percentage of elevated ESR, positive anti-Scl70 antibody, positive anti-SSA antibody, and positive ANA in SSc patients were 41.0, 25.0, 20.0 and 72.0%, respectively (Table 2). Minor Allele Frequencies and HWE Test Of the 200 individuals, 199 DNA samples of them (99 SSc patients and 100 controls) were successfully genotyped (99.50%). The minor allele frequencies (MAF) of the eight SNPs (FokI, BsmI, ApaI, TaqI, Cdx2, BglI, Tru9I and rs11168267) were 0.46, 0.04, 0.26, 0.05, 0.00, 0.26, 0.21 and 0.21 in the healthy controls, respectively, which were similar to the values of CHB (Chinese Beijing) population in HapMap (Ref mRNA: NM_000376.2; MAF 5 0.40, 0.05, 0.26, 0.05, 0.00, 0.26, 0.20, and 0.17, respectively). The HWE p value in control group all were O0.05. VDR Polymorphisms with SSc The VDR alleles and genotype frequencies have been compared between SSc patients and healthy controls. There were statistically significant differences in the genotype frequencies at ApaI (rs7975232) and BglI genotype between SSc patients and healthy controls (both adjusted p 5 0.008) (Table 3). Logistic regression analysis showed that SSc risk was significantly higher in carriers of the A allele of ApaI (rs7975232) polymorphisms (OR [95% CI] 5 1.80 [1.03,3.16], p 5 0.040) than those with CC (CA þ AA vs. CC). Similarly, the dominant model for BglI (rs739837) polymorphism were more frequent in patients than controls (OR [95% CI] 5 1.80 [1.03,3.16], p 5 0.040) (Table 4). However, we did not find any significant association of the other six SNPs with SSc risk.

371

Linkage Disequilibrium and Haplotype Analysis LD analysis was performed among the eight polymorphisms; As shown in Figure 1, there was high LD between the chosen SNPs rs739837 and rs7975232 (r2 5 1.0, D’ 5 1.0), rs757343 and rs11168267 (r2 5 0.926, D’ 5 0.969), respectively. Although D’ between other groups (rs731236 and rs739837 or rs7975232) were 1.0, the LD among these groups tend to have a poor r2; this was due to one SNP being much rarer than the other. Moreover, haplotype analysis was conducted through the distribution of haplotypes in SSc and healthy controls. The results showed that these four haplotypes frequencies were not significantly different between SSc patients and healthy controls (all p O0.05). Haplotypes with an estimated frequency less than 0.03 were not listed (Table 5). Furthermore, for SNPs rs739837 and rs7975232, haplotype analysis according to stratification of different clinical parameters was performed. No statistical significance was found between the two VDR gene polymorphisms (Supplementary Table 1). VDR Polymorphisms with Clinical or Laboratory Data in SSc Patients Among SSc patients, the elevation of ESR was significantly association with distribution of BglI (rs739837) genotype frequency ( p 5 0.034) (Supplementary Table 2). Significant relationship was identified between dominant model of ApaI and the elevation of ESR ( p 5 0.016) (Supplementary Table 3). Additionally, we failed to observe any significant association of eight VDR SNPs with other clinical manifestations of SSc, including limitation of mouth opening, dyspnea, joint involvement, RP, organ involvement, ESR, anti-SSA antibody, anti Scl-70 antibody and ANA (all p O0.05) (data not shown). Correlation Between VD Levels and VDR SNPs in SSc Vitamin D levels measured by previous groups were used (19). For 57 SSc patients, Spearman rank correlation

Table 2. Characteristics of SSc patients and healthy controls Characteristics

SSc (n [ 100)

Age (year), mean  SD Sex, male (%) Clinical/Laboratories characteristics (%) Limitation of mouth opening RP Joints involvement Organs involvement Dyspnea Elevated ESR Positive anti-Scl70 antibody Positive anti-SSA antibody Positive ANA

48.9612.28 8.0 65.0 63.0 42.0 63.0 41.0 41.0 25.0 20.0 72.0

Controls (n [ 100)

t/c2

50.53  10.45 13.0

0.974 1.330

-

a

p

0.331 0.249 -

372

Li et al./ Archives of Medical Research 50 (2019) 368e376

Table 3. The allele and genotype frequencies of VDR gene polymorphisms in SSc patients and HC SNP FokI (rs2228570)

GG GA AA BsmI (rs1544410) CC CT TT ApaI (rs7975232) CC CA AA TaqI (rs731236) GG GA AA Cdx2 (rs11574010) CC CT TT BglI (rs739837) TT GT GG Tru9I (rs757343) CC CT TT rs11168267 AA AG GG

21 51 27 89 10 0 44 53 2 0 11 88 98 1 0 2 53 44 56 41 2 4 37 58

(21.2) (51.5) (27.3) (89.9) (10.1) (0.0) (44.4) (53.5) (2.0) (0.0) (11.1) (88.9) (99.0) (1.0) (0.00) (2.0) (53.5) (44.4) (56.6) (41.4) (2.0) (4.0) (37.4) (58.6)

17 59 24 93 7 0 59 33 8 0 9 91 100 0 0 8 33 59 67 27 6 7 26 67

(17.0) (59.0) (24.0) (93.0) (7.0) (0.0) (59.0) (33.0) (8.0) (0.0) (9.0) (91.0) (100) (0.0) (0.00) (8.0) (33.0) (59.0) (67.0) (27.0) (6.0) (7.0) (26.0) (67.0)

p

c2

Genotype SSc (n %) HC (n %)

pb

1.17 0.556 0.596

Allele SSc (n %) HC (n %)

c2

p

OR (95 % CI) HWE cp

G A

93 (47.0) 93 (46.5) 0.01 0.925 1.02 (0.69,1.51) 105 (53.0) 107 (53.5)

0.063

C T

188 (94.9) 193 (96.5) 0.59 0.444 0.68 (0.25,1.83) 10 (5.0) 7 (3.5)

0.717

10.43 0.005 0.008a C A

141 (71.2) 151 (75.5) 0.94 0.333 0.80 (0.51,1.25) 57 (28.8) 49 (24.5)

0.280

-

-

-

A G

187 (94.4) 191 (95.5) 0.23 0.630 0.80 (0.32,1.98) 11 (5.6) 9 (4.5)

0.638

-

-

-

C T

197 (99.5) 200 (100) 1 (0.5) 0 (0.0)

1.000

-

-

-

10.43 0.005 0.008a G T

-

-

-

141 (71.2) 151 (75.5) 0.94 0.333 0.80 (0.51,1.25) 57 (28.8) 49 (24.5)

0.280

5.86 0.053 0.055

C T

153 (77.3) 161 (80.5) 0.62 0.430 0.82 (0.51,1.33) 45 (22.7) 39 (19.5)

0.162

3.38 0.184 0.174

G A

153 (77.3) 160 (80.0) 0.44 0.507 0.85 (0.53,1.37) 45 (22.7) 40 (20.0)

0.061

VDR, vitamin D receptor; SNP, single nucleotide polymorphism; SSc, systemic sclerosis; HC, healthy control; HWE, Hardy-Weinberg equilibrium test, performed in control group, and p !0.05 means statistically significant. a After adjusted for sex and age, p value still is significant. b p values were obtained by binary logistic regression analysis adjusted for age and sex. c p value of Fisher’s exact test for HWE.

analysis was performed on VDR SNPs and serum VD levels in the same blood samples. No difference was found to be statistically significant (all p O0.05) (Supplementary Table 4).

Discussion This is a hospital-based case-control study to establish an association between VDR (FokI, TaqI, BsmI, ApaI, Cdx2, BglI, Tru9I and rs11168267) SNPs and SSc susceptibility. In the current study, only ApaI and BglI polymorphism genotype were significantly associated with the risk of SSc. It’s worth noting that the frequencies of mutant genotypes were low. The result was inconsistent with the previous study by Kamal A, et al. (16), who demonstrated that no significant differences versus the controls regarding the distribution of ApaI genotype frequency in SSc patients. The different study population, subtypes of SSc and different sample size may be the main reason for conflicting conclusion. Also, the dominant model of ApaI (rs7975232) and BglI (rs739837) have also showed the ApaI and BglI polymorphisms were associated with SSc. Actually, VD has an important role in the control of inflammatory responses with a switch from the Th1 to the

Th2 cytokine profile, enhancing the Th17 pathway via transcriptional modulation of interleukin-17A (IL-17A), as well as induction of regulatory T cells (20,21). Importantly, Th2 cytokine -mediated mechanism could be the native promoting factor responsible for transforming growth factor-b (TGF-b) activity and profibrotic effects (22). Recently, Kotyla et al. noticed that FGF23/a-Klotho (two of VD major regulators) index was significantly reduced in SSc patients and its log10 significantly correlated with disease activity score (23). Furthermore, increasing evidence demonstrated that VDR plays an important role in fibrosis. Zerr et al. reported that impaired VDR signalling with reduced expression of VDR and decreased levels of its ligand may contribute to hyperactive TGF-b signalling and aberrant fibroblast activation in SSc (24). This suggests that VDR gene may be involved in SSc susceptibility. On the other hand, a number of SNPs have been reported in the VDR gene; mainly four include ApaI (rs7975232), TaqI (rs731236) and (rs1544410) and FokI (rs2228570). TaqI, BsmI and ApaI SNPs located near the 3’ untranslated region (UTR) identified by their restriction endonuclease sites (25). FokI polymorphisms located at the first of the two potential translation initiation sites in exon 2, which have been frequently reported to be associated with nonspecific inflammation and seems to influence both VDR protein

Vitamin D Receptor Gene Polymorphisms with Susceptibility to Systemic Sclerosis

373

Table 4. Genotype modeling of significant vitamin D receptor polymorphisms SNPs FokI (rs2228570)

Models

Genotype

SSc (%)

Dominant

GAþAA GG AA GGþGA CTþTT CC TT CTþTT CAþAA CC AA CCþCA GAþGG AA GG GAþAA CTþTT CC TT CTþCC GTþTT GG TT GTþGG CTþTT CC TT CTþCC AGþAA GG AA GGþAG

78 21 27 72 10 89 0 99 55 44 2 97 11 88 0 99 1 98 0 99 55 44 2 97 43 56 2 97 41 58 4 95

Recessive BsmI (rs1544410)

Dominant Recessive

ApaI (rs7975232)

Dominant Recessive

TaqI (rs731236)

Dominant Recessive

Cdx2 (rs11574010)

Dominant Recessive

BglI (rs739837)

Dominant Recessive

Tru9I (rs757343)

Dominant Recessive

rs11168267

Dominant Recessive

(72.7) (27.3) (21.2) (78.8) (10.1) (89.9) (0) (100) (55.6) (44.4) (2.0) (98.0) (11.1) (88.9) (0) (100) (1.0) (99.0) (0) (100) (55.6) (44.4) (2.0) (98.0) (43.4) (56.6) (2.0) (98.0) (41.4) (58.6) (4.0) (96.0)

HC (%) 83 17 24 76 7 93 0 100 41 59 8 92 9 91 0 100 0 100 0 100 41 59 8 92 33 67 6 94 33 67 7 93

(76.0) (24.0) (17.0) (83.0) (7.0) (93.0) (0) (100) (41.0) (59.0) (8.0) (92.0) (9.0) (91.0) (0) (100) (0) (100) (0) (100) (41.0) (59.0) (8.0) (92.0) (33.0) (67.0) (6.0) (94.0) (33.0) (67.0) (7.0) (93.0)

c2

p

OR (95 % CI)

0.57

0.450

0.76 (0.37,1.55)

0.28

0.597

1.19 (0.63,2.25)

0.61

0.434

1.49 (0.54,4.09)

-

-

-

4.22

0.040a

1.80 (1.03,3.16)

2.58

0.108

0.24 (0.05,1.15)

0.25

0.62

1.26 (0.50,3.20)

-

-

-

-

-

-

-

-

-

4.22

0.040a

1.80 (1.03,3.16)

2.58

0.108

0.24 (0.05,1.15)

2.30

0.130

1.56 (0.88,2.77)

1.14

0.285

0.32 (0.06,1.64)

1.51

0.219

1.44 (0.81,2.56)

0.83

0.361

0.56 (0.16,1.98)

SNP, single nucleotide polymorphism, HC, healthy control. a p !0.05.

structure and transcriptional activity (26). Furthermore, SSc is categorized as chronic inflammatory diseases, besides being autoimmune diseases (27). However, our results revealed no association between SSc and the VDR FokI genotypes or allele polymorphisms. Additionally, we also analyzed the relationship between BglI (rs739837), Cdx2 (rs11574010), Tru9I (rs757343) and rs11168267 in the VDR gene and SSc susceptibility. However, all three SNPs except BglI (rs739837) were not associated with SSc susceptibility. Additionally, in SSc patients, the correlation between VD levels and VDR gene polymorphisms was not statistically significant. Currently, the role of VDR polymorphism in the pathogenesis of SSc has not been fully elucidated. At the molecular level, we speculate that ApaI and BglI do not directly affect VDR protein structure, but differences in stability and/or translation efficiency of the RNA have been reported (28,29). Additionally, VDR (ApaI, BglI) polymorphisms may be in LD with other SNPs in the VDR gene or in other closely related genes such as HLADRB1 that play a central role in the pathogenesis of SSc (30,31). Furthermore, in immune-mediated disease, there

is chronic T cell activation, and in this scenario, VD and VDR are critical for inhibiting T cell proliferation and cytokine production. Variations in VDR protein contributes to uncontrolled immune responses via regulation of the Thelper (Th)1/Th2 cytokine imbalance (32). Accordingly, further prospective studies are needed to confirm these associations of VDR SNPs with autoimmune diseases, including SSc. We further analyzed the association of VDR gene polymorphisms with the clinical manifestations of SSc. Several studies reported VD has an antifibrotic effect on fibroblasts, consequently inhibiting synthesis and deposition of extracellular matrix and VDR may be a negative regulator of TGF-b/Smad signalling which plays an important role in tissue fibrosis (24,33). Thus, it’s a reasonable assumption that VDR gene polymorphisms may have an effect on the characteristic of SSc. Our results indicated that the elevation of ESR was correlated with BglI (rs739837) genotype frequency and dominant model of ApaI (rs7975232). However, we failed to found that the studied SNPs were significant associations with other clinical or laboratory

374

Li et al./ Archives of Medical Research 50 (2019) 368e376

Figure 1. Linkage disequilibrium (LD) plot showing the linkage disequilibrium among vitamin D receptor (VDR) gene polymorphisms, whereas in (a) D0 values and (b) r2 values. The SNP BglI (rs739837) was in high LD with the SNP ApaI (rs7975232) (r2 5 1.0, D’ 5 1.0). The SNP Tru9I (rs757343) was in high LD with the SNP rs11168267 (r2 5 0.926, D’ 5 0.969).

characteristics such as RP, dyspnea, and ANA. Previously, Kamal A, et al. (16) have demonstrated that the VDR (ApaI, TaqI) polymorphisms were not significantly associated with any of the clinical or laboratory features of SSc. These results may indicted that the VDR certain polymorphism may affect the clinical course of SSc rather than be considered as a susceptibility gene. The multiple phenotypes, such as SSc, were a result of many gene polymorphism and geneegene interactions; hence, it was necessary to investigate the impact of geneegene interactions on SSc risk. In this study, we also analyzed the VDR gene haplotype and SSc risk. Because D0 is easily influenced by the distribution of SNP, while r2 is a much more stable parameter. In order to avoid false positive results, we specified both D’ and r2 to take the correct decision. We found there were high LD between the chosen SNPs BglI (rs739837) and ApaI (rs7975232), Tru9I

(rs757343) and rs11168267, respectively. But no significant difference were found in these four haplotypes, indicating that the haplotypes of VDR gene were not associated with the risk of SSc. The present study has several limitations. Firstly, the sample size in our study was relatively small as they were recruited from two hospitals in the same area and the flow of scleroderma cases was low during the period of the study. Thus, future study with large populations should be conducted to confirm the association. Secondly, the interaction analyses between VDR gene and environment were not performed; we may do such research in the future until we collect enough data of SSc patients. Thirdly, due to the limited data we could obtained from the questionnaire, we have not performed further analysis to investigate the association between VDR SNPs and other clinical/laboratory findings (such as HLA-

Table 5. Results of haplotype analyses of eight VDR SNPs in SSc and HC Frequency n (%) a

Haplotypes

SSc

AC AC GC GC

15.51 80.79 26.47 58.19

A AC T TA CACGCG A ACT TA CACGCG

HC (0.08) (0.41) (0.13) (0.29)

21.46 81.76 17.54 68.24

(0.11) (0.41) (0.09) (0.34)

SNP, single nucleotide polymorphism; SSc, systemic sclerosis; HC, healthy control. a The order of SNPs in haplotypes: FokI, BsmI, ApaI, TaqI, Cdx2, BglI, Tru9I, rs11168267. b p value of Fisher’s exact test.

p

b

0.372 0.788 0.112 0.424

OR (95% CI) 0.73 1.06 1.68 0.84

(0.37|1.46) (0.70|1.60) (0.88|3.18) (0.55|1.29)

Vitamin D Receptor Gene Polymorphisms with Susceptibility to Systemic Sclerosis

DRB1*51 status, progression index (PI), treatment) in SSc patients. Therefore, further studies are still needed to clarity the relationship between VDR SNPs and other features for SSc patients.

Conclusions In summary, our preliminary study concluded that ApaI and BglI genotype may possibly have a role in the pathogenesis of SSc patients. Additionally, dominant model of ApaI and BglI GT genotype frequency may be associated with the increased risk of ESR. Acknowledgments This work were partly supported by grants from the Anhui provincial major project of quality engineering teaching research in 2016 (code:2016jyxm0378), Key Project of the Education Department of Anhui Province Natural Science Research (code: KJ2017A164), Project of visiting study overseas of the excellent youth backbone in the universities of education department of Anhui province in 2017 (code:gxfx2017008), Data Science Center of school of Public Health of Anhui Medical University and Anhui provincial laboratory of population health & major disease screening and diagnosis.

Conflict of interest The authors declare no conflicts of interest. Supplementary Data Supplementary data related to this article can be found at https://doi.org/10.1016/j.arcmed.2019.09.006. References 1. Cutolo M, Soldano S, Smith V. Pathophysiology of systemic sclerosis: current understanding and new insights. Expert Rev Clin Immunol 2019;15:753e764. 2. Legendre P, Mouthon L. Systemic sclerosis. Rev Prat 2017;67: 775e783. 3. Ingegnoli F, Ughi N, Mihai C. Update on the epidemiology, risk factors, and disease outcomes of systemic sclerosis. Best Pract Res Clin Rheumatol 2018;32:223e240. 4. Vatakencherry RMJ, Saraswathy L. Association between vitamin D and hypertension in people coming for health check up to a tertiary care centre in South India. J Family Med Prim Care 2019;8: 2061e2067. 5. Murdaca G, Tonacci A, Negrini S, et al. Emerging role of vitamin D in autoimmune diseases: an update on evidence and therapeutic implications. Autoimmun Rev 2019;18:102350. 6. Girgis CM. Vitamin D and skeletal muscle: emerging roles in development, anabolism and repair. Calcif Tissue Int, 2019. 7. Bouksila M, Kaabachi W, Mrad M, et al. FGF 23, PTH and vitamin D status in end stage renal disease patients affected by VDR FokI and BsmI variants. Clin Biochem 2018;54:42e50.

375

8. Mukhtar M, Sheikh N, Suqaina SK, et al. Vitamin D receptor gene polymorphism: an important predictor of arthritis development. Biomed Res Int 2019;2019:8326246. 9. Zilahi E, Chen JQ, Papp G, et al. Lack of association of vitamin D receptor gene polymorphisms/haplotypes in Sj€ogren’s syndrome. Clin Rheumatol 2015;34:247e253. 10. Davis CD. Vitamin D and cancer: current dilemmas and future research needs. Am J Clin Nutr 2008;88:565Se569S. 11. Fouad H, Yahia S, Elsaid A, et al. Oxidative stress and vitamin D receptor BsmI gene polymorphism in Egyptian children with systemic lupus erythematosus: a single center study. Lupus 2019;28: 771e777. 12. Mostowska A, Lianeri M, Wudarski M, et al. Vitamin D receptor gene BsmI, FokI, ApaI and TaqI polymorphisms and the risk of systemic lupus erythematosus. Mol Biol Rep 2013;40: 803e810. 13. Ghaly MS, Badra DI, Dessouki O, et al. Vitamin D receptor Fok1 & Bsm 1 gene polymorphisms in systemic lupus erythematosus and osteoarthritis: autoimmune inflammatory versus degenerative model. Egypt J Immunol 2017;24:151e164. 14. Tizaoui K, Hamzaoui K. Association between VDR polymorphisms and rheumatoid arthritis disease: systematic review and updated meta-analysis of case-control studies. Immunobiology 2015;220: 807e816. 15. Song GG, Bae SC, Lee YH. Vitamin D receptor FokI, BsmI, and TaqI polymorphisms and susceptibility to rheumatoid arthritis: a meta-analysis. Z Rheumatol 2016;75:322e329. 16. Kamal A, Gamal SM, Elgengehy FT, et al. Association of VDR ApaI and TaqI gene polymorphisms with the risk of scleroderma and Behc¸et’s disease. Immunol Invest 2016;45:531e542. 17. Masi AT. Preliminary criteria for the classification of systemic sclerosis (scleroderma). Arthritis Rheum 1980;23:581e590. 18. Huang J, Li M, Tian Z, et al. Clinical and laboratory characteristics of systemic sclerosis patients with pulmonary arterial hypertension in China. Clin Exp Rheumatol 2014;32(6 Suppl 86). S115-121. 19. Zhang L, Duan Y, Zhang TP, et al. Association between the serum level of vitamin D and systemic sclerosis in a Chinese population: a case control study. Int J Rheum Dis 2017;20: 1002e1008. 20. Peelen E, Knippenberg S, Muris AH, et al. Effects of vitamin D on the peripheral adaptive immune system: a review. Autoimmun Rev 2011; 10:733e743. 21. Joshi S, Pantalena LC, Liu XK, et al. 1,25- dihydroxyvitamin D (3) ameliorates Th17 autoimmunity via transcriptional modulation of interleukin-17A. Mol Cell Biol 2011;31:3653e3669. 22. Usategui A, Criado G, Del Rey MJ, et al. Topical vitamin D analogue calcipotriol reduces skin fibrosis in experimental scleroderma. Arch Dermatol Res 2014;306:757e761. 23. Kotyla PJ, Kruszec-Zytniewska A, Owczarek AJ, et al. Fibroblast growth factor 23 to alpha-klotho index correlates with systemic sclerosis activity: a proposal for novel disease activity marker. J Clin Med 2018;7(12). 24. Zerr P, Vollath S, Palumbo-Zerr K, et al. Vitamin D receptor regulates TGF-b signalling in systemic sclerosis. Ann Rheum Dis 2015;74:e20. 25. Uitterlinden AG, Fang Y, van Meurs JB, et al. Vitamin D receptor gene polymorphisms in relation to Vitamin D related disease states. J Steroid Biochem Mol Biol 2004;89e90: 187e193. 26. van Etten E, Verlinden L, Giulietti A, et al. The vitamin D receptor gene FokI polymorphism: functional impact on the immune system. Eur J Immunol 2007;37:395e405. 27. Zimmermann AF, Pizzichini MM. Update on the etiopathogenesis of systemic sclerosis. Rev Bras Reumatol 2013;53:516e524.

376

Li et al./ Archives of Medical Research 50 (2019) 368e376

28. Jia J, Ding H, Yang K, et al. Vitamin D receptor genetic polymorphism is significantly associated with risk of type 2 diabetes mellitus in Chinese Han population. Arch Med Res 2015;46:572e579. 29. Zhang P, Li Q, Qi J, et al. Association between vitamin D receptor gene polymorphism and ankylosing spondylitis in Han Chinese. Int J Rheum Dis 2017;20:1510e1516. 30. Yamout B, Karaky NM, Mahfouz RAR, et al. Vitamin D receptor biochemical and genetic profiling and HLA-class II genotyping among Lebanese with multiple sclerosiseA pilot study. J Neuroimmunol 2016;293:59e64.

31. Abouzid M, Karazniewicz-Lada M, Glowka F. Genetic determinants of vitamin D-related disorders; focus on vitamin D receptor. Curr Drug Metab 2018;19:1042e1052. 32. Karray EF, Ben Dhifallah I, Ben Abdelghani K, et al. Associations of vitamin D receptor gene polymorphisms FokI and BsmI with susceptibility to rheumatoid arthritis and Behc¸et’s disease in Tunisians. Joint Bone Spine 2012;79:144e148. 33. Yang CY, Leung PS, Adamopoulos IE, et al. The implication of vitamin D and autoimmunity: a comprehensive review. Clin Rev Allergy Immunol 2013;45:217e226.