- Email: [email protected]
Astaxanthin enhances pemetrexed-induced cytotoxicity by downregulation of thymidylate synthase expression in human lung cancer cells
Regulatory Toxicology and Pharmacology 81 (2016) 353e361
Contents lists available at ScienceDirect
Regulatory Toxicology and Pharmacology journal homepage: www.elsevier.com/locate/yrtph
Astaxanthin enhances pemetrexed-induced cytotoxicity by downregulation of thymidylate synthase expression in human lung cancer cells Kai-Sheng Liao a, b, 1, Chia-Li Wei c, 1, Jyh-Cheng Chen d, 1, Hao-Yu Zheng c, Wen-Ching Chen c, Chia-Hung Wu c, Tai-Jing Wang c, Yi-Shuan Peng c, Po-Yuan Chang c, Yun-Wei Lin c, * a
Department of Pathology, Ditmanson Medical Foundation Chia-Yi Christian Hospital, Chiayi, Taiwan School of Nursing, Chung Jen Junior College of Nursing, Health Science and Management, Chiayi, Taiwan c Department of Biochemical Science and Technology, National Chiayi University, Chiayi, Taiwan d Department of Food Science, National Chiayi University, Chiayi, Taiwan b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 1 August 2016 Received in revised form 21 September 2016 Accepted 27 September 2016 Available online 28 September 2016
Pemetrexed, a multitargeted antifolate agent, has demonstrated clinical activity in non-small cell lung cancer (NSCLC) cells. Increased expression of thymidylate synthase (TS) is thought to be associated with resistance to pemetrexed. Astaxanthin exhibits a wide range of beneficial effects including anti-cancer and anti-inflammatory properties. In this study, we showed that down-regulating of TS expression in two NSCLC cell lines, human lung adenocarcinoma H1650 and squamous cell carcinoma H1703 cells, with astaxanthin were associated with decreased MKK1/2-ERK1/2 activity. Enforced expression of constitutively active MKK1 (MKK1-CA) vector significantly rescued the decreased TS mRNA and protein levels in astaxanthin-treated NSCLC cells. Combined treatment with a MKK1/2 inhibitor (U0126 or PD98059) further decreased the TS expression in astaxanthin-exposed NSCLC cells. Knockdown of TS using small interfering RNA (siRNA) or inhibiting ERK1/2 activity enhanced the cytotoxicity and cell growth inhibition of astaxanthin. Combination of pemetrexed and astaxanthin resulted in synergistic enhancing cytotoxicity and cell growth inhibition in NSCLC cells, accompanied with reduced activation of phospho-MKK1/2, phopho-ERK1/2, and TS expression. Overexpression of MKK1/2-CA reversed the astaxanthin and pemetrexed-induced synergistic cytotoxicity. Our findings suggested that the downregulation of MKK1/2-ERK1/2-mediated TS expression by astaxanthin is an important regulator of enhancing the pemetrexed-induced cytotoxicity in NSCLC cells. © 2016 Published by Elsevier Inc.
Keywords: Astaxanthin Pemetrexed Thymidylate synthase ERK1/2 Non-small cell lung cancer
1. Introduction Lung cancer is one of the most lethal malignances in the world, and non-small cell lung cancer (NSCLC) accounts for more than 85% of all lung cancer cases (Ferlay et al., 2010; Pfister et al., 2004; Torre et al., 2015). Pemetrexed is a multi-targeted antifolate drug that inhibits enzymes including thymidylate synthase (TS), dihydrofolate reductase (DHFR) and glycinamide ribonucleotide
* Corresponding author. Department of Biochemical Science and Technology, National Chiayi University, 300 Syuefu Road, Chiayi, 600, Taiwan. E-mail address: [email protected] (Y.-W. Lin). 1 Kai-Sheng Liao, Chia-Li Wei, and Jyh-Cheng Chen contributed equally. http://dx.doi.org/10.1016/j.yrtph.2016.09.031 0273-2300/© 2016 Published by Elsevier Inc.
formyltransferase (GARFT) which are involved in the synthesis of pyrimidine and purine, thereby depleting nucleotide pools and blocking DNA synthesis (Joerger et al., 2010; Tonkinson et al., 1997). Pemetrexed has been approved in first-line, second-line, and maintenance therapy in the treatment of advanced NSCLC (Ciuleanu et al., 2009; Hanna, 2004). In NSCLC, overexpression of TS is associated with poor prognosis following lung resection (Huang et al., 2005; Shimokawa et al., 2011) and low TS mRNA level is associated with better response to neoadjuvant pemetrexed treatment (Bepler et al., 2008). Our previous study has shown that platinum-containing chemotherapeutic compound, cisplatin, increased TS protein expression in a MKK1/2-ERK1/2 dependent manner in NSCLC cell lines (Ko et al., 2011). Moreover, inhibition of heat shock protein 90 (HSP90) can sensitize colorectal cancer cells
354
K.-S. Liao et al. / Regulatory Toxicology and Pharmacology 81 (2016) 353e361
to the effects of chemotherapy through inhibition of ERK1/2 activation and downregulation of TS expression (Nagaraju et al., 2014). Astaxanthin, a ketocarotenoid (3,30 -dihydroxy-b,b0 -carotene4,40 -dione) red pigment ubiquitously found in microalgae, red yeast, and in marine animals such as shrimp, salmon, crayfish, and lobsters (Goto et al., 2001; Higuera-Ciapara et al., 2006). In vitro and in vivo studies have reported that astaxanthin possesses several pharmacological properties, including antioxidant, antiinflammatory, and antitumor effects (Lee et al., 2010; Marin et al., 2011; Nakao et al., 2010; Song et al., 2012). Moreover, astaxanthin induces apoptosis in U937 cells (Human leukemic monocyte lymphoma cell line) by downregulation of AKT activity (Lordan et al., 2008). Furthermore, astaxanthin treatment was shown to promote apoptosis in dimethylhydrazine induced rat colon carcinogenesis through modulating the expressions of ERK, NF-kB, and COX-2 (Nagendraprabhu and Sudhandiran, 2011). Recently, astaxanthin enhances mitomycin C-induced cytotoxic effects in human lung cancer cells lines via AKT inactivation (Ko et al., 2016). However, whether astaxanthin could regulate TS expression to enhance pemetrexed-induced cytotoxic effects in NSCLC has not been examined. In this study, we wanted to explore the molecular mechanism of astaxanthin in regulating TS expression to enhance the cytotoxic effect of pemetrexed in human lung cancer cells. Using H1650 and H1703 human lung cancer cell lines, we found that decreased TS expression by astaxanthin could enhance the sensitivity of pemetrexed. These results may provide a rationale to combine astaxanthin with pemetrexed for lung cancer treatment. 2. Materials and methods 2.1. Cell lines and chemicals Human lung carcinoma cells H1650 and H1703 were obtained from the American Type Culture Collection (Manassas, VA) and the cells were cultured at 37 C in a humidified atmosphere containing 5% CO2 in RPMI-1640 complete medium supplemented with sodium bicarbonate (2.2%, w/v), L-glutamine (0.03%, w/v), penicillin (100 units/ml), streptomycin (100 mg/ml), and fetal calf serum (10%). The cell lines were routinely tested to confirm that they were free of Mycoplasma. Astaxanthin (free form) was dissolved in dimethyl sulfoxide (DMSO) immediately before use. Pemetrexed was a gift from Eli Lilly Corporation (Indianapolis, IN, USA). Astaxanthin, Cycloheximide and actinomycin D were purchased from Sigma-Aldrich (St. Louis, MO, USA). N-acetyl-Leu-Leunorleucinal (ALLN), MG132, U0126, and PD98059 were purchased from Calbiochem-Novabiochem (San Diego, CA, USA). Actinomycin D, ALLN, MG132, U0126, and PD98059 were dissolved in dimethyl sulfoxide (DMSO). Cycloheximide was dissolved in Milli-Q-purified water (Millipore, Billerica, MA, USA). 2.2. Western blot analysis After cells were treated with pemetrexed (5, 10, 20 mM) and/or astaxanthin (2.5e20 mM) for 24 h, equal amounts (40 mg) of proteins from each set of experiments were subjected to Western blot analysis as previously described (Ko et al., 2009). Antibodies were stripped from polyvinylidene difluoride membranes using a solution containing 2% SDS, 62.5 mM Tris-HCl, pH 6.8, and 0.7% (w/w) b-mercaptoethanol at 50 C for 15 min before re-probing with another primary antibody. The specific phospho-MKK1/2 (Ser217/Ser221) and phospho-ERK1/2 (Thr202/Tyr204) antibodies were purchased from Cell Signaling (Beverly, MA, USA). Rabbit polyclonal antibodies against TS(TS-106) (sc-33679), ERK2(K-23) (sc-153), HA(F-7) (sc-7392), and Actin(I-19) (sc-1616) were
purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Relative protein blot intensities were determined using a computing densitometer equipped with the ImageQuant analysis program (Amersham Biosciences). 2.3. Plasmid and transfection Exponentially growing human lung cancer cells (106) were plated for 18 h, and then MKK1-CA (a constitutively active form of MKK1, DN3/S218E/S222D) and MKK2-CA (a constitutively active form of MKK2, DN4/S222E/S226D) were transfected into H1650 or H1703 cells using Lipofectamine (Invitrogen). The sense-strand sequences of siRNA duplexes were as follows: TS: 50 -GCACAUAUUUACCUGAAUC-30 , and scrambled (as a control): 50 -GCG CGC UUU GUA GGA TTC G-30 (Dharmacon Research, Lafayette, CO). Cells were transfected with siRNA duplexes (200 nM) using Lipofectamine 2000 (Invitrogen) for 24 h. 2.4. Quantitative real-time polymerase chain reaction (PCR) PCRs were performed using an ABI Prism 7900HT according to the manufacturer's instructions. Amplification of specific PCR products was performed using the SYBR Green PCR Master Mix (Applied Biosystems). For each sample, the data were normalized to the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The designed primers in this study were: TS forward primer, 50 - ACTGCAAAGAGTGATTGACACC -30 , TS reverse primer, 50 - CACTGTTCACCACATAGAACTGG -30 ; GAPDH forward primer, 50 - CATGAGAAGTATGACAACAGCCT -30 ; GAPDH reverse primer, 50 - AGTCCTTCCACGATACCAAAGT -30 . Analysis was performed using the comparative Ct value method. For each sample, the data were normalized to the housekeeping gene gapdh. 2.5. MTS assay In vitro 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenol)2-(4-sulfophenyl)-2H-tetrazolium (MTS) assay was performed. Cells were cultured at 5000 per well in 96-well tissue culture plates. To assess cell viability, drugs were added after plating. At the end of the culture period, 20 mL of MTS solution (CellTiter 96 Aqueous One Solution Cell Proliferation Assay; Promega, Madison, WI, USA) was added, the cells were incubated for a further 2 h, and the absorbance was measured at 490 nm using an ELISA plate reader (Biorad Technologies, Hercules, CA). 2.6. Combination index analysis Pemetrexed and astaxanthin were combined at a ratio of 1:1 or 1:2, and the effect of combined treatment on cell viability was examined by MTS assay. To calculate a combination index (CI), the computer software Calcusyn (Biosoft, Oxford, UK) can be used, taking the entire shape of the cell viability curve into account for calculating whether a combination is synergistic (CI < 0.9), additive (CI ¼ 0.9e1.1), or antagonistic (CI > 1.1) (Peters et al., 2000). The mean of CI values at a fraction affected (FA) of 0.90, 0.75, 0.50 were used to calculate between the three independent experiments. 2.7. Trypan blue dye exclusion assay Cells were treated with astaxanthin and/or pemetrexed for 24, 48, and 72 h. After treatment, the 500 cells were harvested, and the proportion of dead cells was determined by hemocytometer, counting the number of cells stained with trypan blue. Trypan blue dye can be excluded from living cells, but is able to penetrate dead cells. The dead cells were calculated as follow: trypan blue (þ) cells ratio (%) ¼(stained cell number/total cell number)100.
K.-S. Liao et al. / Regulatory Toxicology and Pharmacology 81 (2016) 353e361
2.8. Statistical analyses For each protocol, three or four independent experiments were performed. Results were expressed as the mean ± SEM. Statistical calculations were performed using SigmaPlot 2000 software (Systat Software, San Jose, CA). Differences in measured variables between the experimental and control groups were assessed by unpaired t-test. P < 0.05 was considered statistically significant. 3. Results 3.1. TS mRNA and protein levels were decreased after astaxanthin exposure To determine whether TS expression was associated with the effects of astaxanthin, we first assessed H1650 or H1703 cells treated with astaxanthin (20 mM) for 3e24 h or various concentrations of astaxanthin (2.5, 5, 10, 20 mM) for 24 h. Then, the realtime PCR and Western blot analysis was used for determination of the TS mRNA and protein level, respectively. In Fig. 1A and B, astaxanthin reduced TS mRNA and protein expression in a time and dose-dependent manner; this was accompanied with a decrease in phospho-MKK1/2 and phospho-ERK1/2 protein levels. Next, to determine whether MKK1/2-ERK1/2 inactivation was involved in down-regulation of TS by astaxanthin, these cell lines were transiently transfected with MKK1-CA plasmids, a constitutively active form of MKK1. Overexpression of MKK1-CA rescued TS mRNA and protein expression in H1650 and H1703 cells inhibited by astaxanthin (Fig. 1C and D). However, once these cells were pretreated with MKK1/2 inhibitors (U0126 or PD98059), the TS mRNA and protein levels in astaxanthin-exposed H1650 or H1703 cells would further decrease (Fig. 1E and F). As expected, the addition of U0126 or PD98059 decreased cellular phospho-ERK1/2 protein levels, and also further decreased phospho-ERK1/2 levels in astaxanthinexposed NSCLC cell lines (Fig. 1F). Therefore, we concluded that astaxanthin decreased TS expression through down-regulation of MKK1/2-ERK1/2 activity. Next, we hypothesized ERK1/2 inactivation to be involved in the down-regulation of TS protein level by the ubiquitin-26S proteasome-mediated proteolysis of TS. In Fig. 2A, the 26S proteasome inhibitors ALLN or MG132 were added for the final 6 h before harvesting in astaxanthin-treated H1650 and H1703 cells. The result showed that both of MG132 and ALLN restored the decreased TS protein levels induced by astaxanthin (Fig. 2A). In addition, we examined the levels of ubiquitin conjugates on TS. Enforced expression of the MKK1-CA vector decreased the levels of ubiquitin-conjugated TS in astaxanthin-treated NSCLC cell lines (Fig. 2B). These results revealed that ERK1/2 inactivation decreased TS protein level by ubiquitin-26S proteasome-mediated proteolysis of TS protein in astaxanthin-treated NSCLC cells. 3.2. Knockdown of TS increased astaxanthin-induced cytotoxicity and growth inhibition in NSCLC cells To investigate if astaxanthin had any cytotoxic activity against human NSCLC cells, cells were treated with various concentration of astaxanthin for 24 h. The cell viability was assessed by MTS assay. In Fig. 3A, astaxanthin induced a concentration-dependent reduction in cell viability. The IC50 values of 59.38 mM and 57.30 mM for astaxanthin were determined in H1650 cells and H1703 cells, respectively. We next examined the effect of siRNA-mediated TS knockdown on astaxanthin-induced cytotoxicity and cell growth inhibition in NSCLC cells. At 24 h post-transfection, Western blot analysis showed a further decrease in TS protein in astaxanthin-treated H1650 and H1703 cells (Fig. 3A). Furthermore,
355
suppression of TS protein expression by si-TS RNA resulted in increased sensitivity to astaxanthin compared to si-control transfected cells (Fig. 3B and C). We also conducted a cell growth inhibition assay to evaluate the synergistic effects of TS knockdown with astaxanthin treatment. In Fig. 3D, more inhibition of cell growth was induced by the combination of TS siRNA and astaxanthin than by astaxanthin alone in H1650 or H1703 cells (Fig. 3D). Therefore, down-regulation of TS expression could enhance astaxanthin-induced cytotoxicity and growth inhibition in NSCLC cells. 3.3. Blocking ERK1/2 activation enhanced astaxanthin-induced cytotoxicity and growth inhibition Next, the role of MKK1/2-ERK1/2 in the cytotoxic effect of astaxanthin was examined. In Fig. 3E, co-treatment with U0126 or PD98059 further decreased significantly cell viability in astaxanthin-exposed H1650 or H1703 cells, compared with astaxanthin treatment alone. U0126 or PD98059 could enhance growth inhibition after treatment with astaxanthin. Blocking ERK1/ 2 activity could more effectively inhibit cell growth than either drug alone after astaxanthin treatment (Fig. 3F). Taken together, inactivation of the MKK1/2-ERK1/2-TS signals could enhance astaxanthin-induced cytotoxicity and growth inhibition in NSCLC cells. 3.4. Combination treatment with astaxanthin enhanced the cytotoxic effect and growth inhibition of pemetrexed TS is the primary target of pemetrexed and its expression has been linked with response to antifolate treatment in various cancers including gastric, esophageal and colorectal cancers (Edler et al., 2000; Harpole et al., 2001; Yeh et al., 1998); therefore, we attempted to determine whether astaxanthin could enhance the cytotoxic effects of pemetrexed through down-regulating TS expression in NSCLC cells. Pemetrexed and astaxanthin were combined at a ratio of 1:1 or 1:2 and the effect of combined treatment on cell viability was examined by MTS assay (Fig. 4A). The CI values for astaxanthin and pemetrexed were <1, indicating the combined treatment had a synergistic effect (Fig. 4B). Combined treatment with astaxanthin and pemetrexed for 24 h resulted in a greater loss of cell viability in H1650 and H1703 cells than treatment with either pemetrexed or astaxanthin alone (Fig. 4A). In addition, H1650 and H1703 cells were exposed to astaxanthin and/ or pemetrexed, and cell proliferation was determined 1e3 days after exposure. Astaxanthin and pemetrexed co-treatment had a greater cell growth inhibition effect than either treatment alone (Fig. 4C). The results showed that combined astaxanthin and pemetrexed had a synergistic cytotoxic effect on human NSCLC cells. 3.5. Astaxanthin down-regulated TS protein and the mRNA level in pemetrexed-treated human lung cancer cells In order to assess the mechanism of the synergistic effects, we hypothesized that astaxanthin would affect TS expression in pemetrexed-treated NSCLC cells. To test this hypothesis, H1650 and H1703 cells were exposed to various concentrations of pemetrexed (5, 10, and 20 mM) and astaxanthin (20 mM) for 24 h. The results from real-time PCR analysis showed that astaxanthin decreased pemetrexed-induced TS mRNA levels in H1650 and H1703 cells (Fig. 4D). Moreover, astaxanthin suppressed the phospho-ERK1/2 and TS protein levels in pemetrexed-treated NSCLC cells (Fig. 4E).
356
K.-S. Liao et al. / Regulatory Toxicology and Pharmacology 81 (2016) 353e361
Fig. 1. Astaxanthin decreased TS expression in a dose and time-dependent manner. (A) Left panel, H1650 or H1703 cells (106) were cultured in complete medium for 18 h and then exposed to astaxanthin (20 mM) for 3, 6, 9, 12, or 24 h. After treated with astaxanthin (20 mM) for 24 h. Right panel, various concentrations of astaxanthin (2.5e20 mM) for 24 h in complete medium. The total RNA was isolated and subjected to real-time PCR for TS mRNA expression. The results (mean ± SEM) were from three independent experiments. (B) After treatment as above, the cell extracts were examined by Western blot for determination of TS, phospho-MKK1/2, phospho-ERK1/2, actin, MMK2, and ERK1/2 protein levels. Astaxanthin decreased TS expression via MKK1/2-ERK1/2 inactivation in NSCLC cells. (C and D) H1650 or H1703 cells (5 105) were transfected with MKK1-CA. After incubation for 24 h, the cells were treated with astaxanthin (10, 20 mM) for 24 h. The results (mean ± SEM) were from three independent experiments. a**p < 0.01 using Student's t-test for comparison between the cells transfected with pcDNA3 or MKK1-CA vector. b**p < 0.01 using Student's t-test for comparison between the cells treated with astaxanthin in pcDNA3 or MKK1-CA vector-transfected cells. (E and F) U0126 (5 mM) or PD98059 (5 mM) was added to H1650 or H1703 cells for 1 h before astaxanthin (5 mM) treatment for 24 h. The results (mean ± SEM) were from four independent experiments. c**p < 0.01 using Student's t-test for comparison between the cells treated with or without U0126/PD98059. d**p < 0.01 using Student's t-test for comparison between the cells treated with astaxanthineDMSO or a astaxanthineU0126/PD98059 combination. After treatment, the cell extracts were examined by real-time PCR (C, E) and Western blot (D, F) for determination of TS mRNA and protein levels, respectively.
K.-S. Liao et al. / Regulatory Toxicology and Pharmacology 81 (2016) 353e361
357
Fig. 2. Astaxanthin treatment triggers 26S proteasome-mediated proteolysis of TS. (A) Astaxanthin (20 mM) was added to H1650 or H1703 cells for 18 h, then the cells were cotreated with 26S proteasome inhibitor ALLN (10 mM) or MG132 (10 mM) for 6 h. Whole cell extracts were collected for Western blot analysis. (B) After pcDNA3 or MKK1-CA vector transfection, the cells were treated with astaxanthin (20 mM) for 18 h, and then MG132 (10 mM) for 6 h before whole cell extract collection. Equal amounts of proteins in each cell extract were subjected to immunoprecipitation (IP) using anti-ubiquitin antibody. The immunoprecipitates were analyzed by Western blotting using anti-TS antibody.
3.6. Down-regulation of TS expression by astaxanthin was through increased mRNA and protein instability in pemetrexed-exposed NSCLC cells Next, we examined the possible mechanisms for posttranscriptional regulation of TS transcripts under astaxanthin
and/or pemetrexed treatment. To evaluate the stability of TS mRNA in pemetrexed-exposed H1650 or H1703 cells, the cells were treated astaxanthin and/or pemetrexed for 8 h and actinomycin D were added to block de novo RNA synthesis and then measured the levels of existing TS mRNA using real-time PCR at 3, 6, and 9 h after treatment. After actinomycin D co-exposure, lower levels of TS
Fig. 3. Knockdown of TS expression by si-RNA transfection enhanced the cytotoxicity induced by astaxanthin. (A) H1650 or H1703 cells were treated with astaxanthin (10e80 mM) in complete medium for 24 h; cytotoxicity was determined by MTS assay. (B) H1650 or H1703 cells were transfected with siRNA duplexes (200 nM) specific to TS or scrambled (control) in complete medium for 24 h prior to treatment with astaxanthin (10 or 20 mM) in complete medium for 24 h; whole-cell extracts were collected for Western blot analysis using specific antibodies against TS and actin. (C and D) After the treatment as (B), cytotoxicity was determined by MTS assay and trypan blue exclusion assay. (E) After the cells were transfected with si-TS or si-scrambled RNA, the cells were treated with astaxanthin (10 or 20 mM) for 24, 48, and 72 h, after which living cells were determined by MTS assay. The results (mean ± SEM) were from three independent experiments. **p < 0.01 using Student's t-test for comparison between the cells treated with astaxanthin in si-TS RNA or si-scrambled RNA-transfected cells. Inhibition of ERK1/2 activation enhanced the cytotoxicity induced by astaxanthin. (F) Left panel, H1650 or H1703 cells were pretreated with U0126 (2.5 mM) for 1 h and then co-treated with various concentration of astaxanthin for 24 h. Right panel, cells were pretreated with PD98059 (2.5, 5, 10 mM) for 1 h and then co-treated with astaxanthin (20 mM) for 24 h. Cytotoxicity was determined by MTS assay. **p < 0.01 using Student's t-test for comparison between the cells pretreated with or without U0126/PD98059 in astaxanthin exposed cells. (G) Cells were treated with astaxanthin (10 mM) and/or U0126 (2.5 mM) or PD98059 (2.5 mM) for 1e3 days after which living cells were determined by trypan blue dye exclusion assay. **p < 0.01 using Student's t-test for comparison between cells treated with astaxanthin alone or with an astaxanthin and U0126/PD98059 combination.
358
K.-S. Liao et al. / Regulatory Toxicology and Pharmacology 81 (2016) 353e361
Fig. 4. Astaxanthin co-treatment with pemetrexed synergistically enhanced cytotoxicity. (A) Pemetrexed and astaxanthin were combined at a ratio of 1:1 (upper panel) or 1:2 (lower panel) and the MTS assay was used to analyze cell viability. (B) The mean CI values at a fraction affected (FA) of 0.50, 0.75, 0.90 for pemetrexed and astaxanthin combined treatment were averaged for each experiment and used to calculate the mean between experiments. Points and columns, mean values obtained from three independent experiments; bars, standard error (SE). (C) Cells were treated with astaxanthin (5 mM) and/or pemetrexed (10, 20 mM) for 1e3 days after which living cells were determined by MTS assay. **p < 0.01 using Student's t-test for comparison between cells treated with a drug alone or with a astaxanthin/pemetrexed combination. (D) Astaxanthin decreased TS protein and mRNA levels in pemetrexed-exposed NSCLC cells. H1650 or H1703 cells (106) were cultured in complete medium for 18 h and then were exposed to pemetrexed (5, 10, 20 mM) and astaxanthin (20 mM) for 24 h. After treatment, total RNA was isolated and subjected to real-time PCR for TS mRNA expression. The means ± standard deviation (SD) from four independent experiments. ** denotes p < 0.01, respectively, using Student's t-test for comparison between the cells treated with astaxanthin/pemetrexed alone or combined. (E) After treatment as the above, cell extracts were examined by Western blot for determination of TS, phospho-ERK1/2, actin, and ERK1/2 protein levels.
mRNA were observed with astaxanthin treatment than in untreated cells (Fig. 5A). Then, cycloheximide (an inhibitor of de novo protein synthesis) was added to astaxanthin treatment for 4, 8, and 12 h, and the remaining TS protein was analyzed by Western blot. In Fig. 5B, TS protein levels were progressively reduced with time in the presence of cycloheximide. However, astaxanthin treatment significantly enhanced TS degradation after cycloheximide treatment compared with untreated cells. Moreover, less TS protein remained after astaxanthin and pemetrexed co-treatment, compared with pemetrexed alone (Fig. 5B). Next, we examined whether astaxanthin-mediated ERK1/2 inactivation was involved in regulating TS mRNA and protein stability upon pemetrexed treatment. After H1650 or H1703 cells were transfected with MKK1-CA vectors, the TS mRNA and protein stability were examined as above. In Fig. 5C and D, it was of interest that enforced expression of the MKK1-CA vector significantly reduced astaxanthin and pemetrexed combination-induced TS mRNA and protein instability, compared with pcDNA3 control vector transfection. These results indicated that astaxanthin decreased TS mRNA and protein levels by augmentation of mRNA and protein instability through ERK1/2 inactivation in pemetrexed-treated NSCLC cells.
3.7. Transfection with MKK1/2-CA vectors enhanced the TS protein level as well as the cell survival suppressed by pemetrexed and astaxanthin We investigated whether astaxanthin and pemetrexed combination-mediated TS down-regulation was correlated with ERK1/2 inactivation in NSCLC cells. In Fig. 6A and B, enforced MKK1-CA vector expression could rescue the cellular ERK1/2
activation as well as TS mRNA and protein levels that were suppressed by astaxanthin and pemetrexed. In contrast, pretreatment with U0126 further decreased the phospho-ERK1/2 and TS mRNA and protein levels in astaxanthin and pemetrexed cotreated H1650 and H1703 cells (Fig. 6C and D). Enforced expression of the MKK1/2-CA vector could rescue H1650 and H1703 cell viability after being decreased by astaxanthin and pemetrexed (Fig. 6E and F); however, pretreatment of U0126 further decreased cell viability (Fig. 6G). In summary, as shown in Fig. 6H, the down-regulation of ERK1/2-mediated TS expression by astaxanthin enhanced the pemetrexed-induced cytotoxicity in NSCLC cells.
4. Discussion As an anti-folate drug, pemetrexed exerts its anti-cancer activity through inhibiting enzymes that are essential for synthesis of purine and pyrimidine, which are required for DNA/RNA synthesis and cell growth (Rollins and Lindley, 2005; Villela et al., 2006). Clinically, pemetrexed is approved by FDA for treatment of NSCLC and other malignant carcinoma (Argiris et al., 2013; Paz-Ares et al., 2003; Scagliotti et al., 2009). Pemetrexed inhibits multiple enzymes in the folate metabolic pathway, and TS is the main target (Shih et al., 1997). In NSCLC, high baseline TS gene expression levels conferred resistance to pemetrexed (Liu et al., 2013) and TS levels were correlated to pemetrexed efficacy in a variety of solid tumors (Gomez et al., 2006; Rose et al., 2002). In Chiu et al. study, when ERK1/2 phosphorylation is reduced by an inhibitor (U0126) or siRNA inhibition, the pemetrexed-resistant lung cancer sublines reduces their migration and invasion abilities (Chiu et al., 2016). Moreover, vinca alkaloids reduce the ERK1/2 activation and
K.-S. Liao et al. / Regulatory Toxicology and Pharmacology 81 (2016) 353e361
359
Fig. 5. Astaxanthin decreased TS mRNA and protein stability in pemetrexed-exposed NSCLC cells. (A) H1650 or H1703 cells were treated with astaxanthin (20 mM) and/or pemetrexed (10 mM) for 12 h in the presence or absence of actinomycin D (2 mg/mL) for 3, 6, or 9 h; total RNA was isolated and subjected to real-time PCR for TS mRNA expression. (B) The cells were exposed to astaxanthin (20 mM) and/or pemetrexed (10 mM) for 12 h followed by co-treatment with cycloheximide (CHX; 0.1 mg/mL) for 4, 8, or 12 h. Whole-cell extracts were collected for Western blot analysis. (C) H1650 or H1703 cells (5 105) were transfected with MKK1-CA. After incubation for 24 h, the cells were exposed to astaxanthin (20 mM) and pemetrexed (10 mM) or DMSO for 12 h in the presence or absence of actinomycin D (2 mg/mL) for 3, 6, or 9 h; total RNA was isolated and subjected to realtime PCR for TS mRNA expression. (D) After cells were transfected with MKK1-CA as above, the cells were exposed to astaxanthin (20 mM) and pemetrexed (10 mM) for 12 h followed by co-treatment with cycloheximide (CHX; 0.1 mg/mL) for 4, 8, or 12 h. Whole-cell extracts were collected for Western blot analysis.
360
K.-S. Liao et al. / Regulatory Toxicology and Pharmacology 81 (2016) 353e361
Fig. 6. Overexpression of MKK1-CA restored the suppressed TS protein expression and cell survival in astaxanthin and pemetrexed-exposed H1650 and H1703 cells. (A) MKK1-CA (5 mg) or pcDNA3 (5 mg) expression plasmids were transfected into cells using lipofectamine. After expression for 24 h, the cells were treated with astaxanthin and pemetrexed for an additional 24 h, and total RNA was isolated and subjected to real-time PCR for TS mRNA expression. The means ± standard deviation (SD) from four independent experiments. ** denotes p < 0.01, respectively, using Student's t-test to compare cells treated with astaxanthin and pemetrexed in MKK1-CA vs. pcDNA3-transfected cells. (B) After treatment as the above, whole-cell extracts were collected for Western blot analysis. (C) H1650 or H1703 cells were pretreated with U0126 (2.5 mM) for 1 h and then co-treated with astaxanthin (10 mM) and pemetrexed (10 mM) for 24 h. Total RNA was isolated and subjected to real-time PCR for TS mRNA expression. (D) After treatment as the above, the whole-cell extracts were collected for Western blot analysis. (E and F) After pcDNA3 control vector (5 mg), MKK1-CA (5 mg) or MKK2-CA (1, 3, 5 mg) expression plasmids transfection, cells were treated with astaxanthin (20 mM) and pemetrexed (5 mM) for 24 h. Cytotoxicity was determined by assessment with the MTS assay. **p < 0.01, *p < 0.05 by Student's t-test to compare cells treated with astaxanthin and pemetrexed in MKK1/2-CA vs. pcDNA3-transfected H1650 or H1703 cells. (G) H1650 or H1703 cells were pretreated with U0126 (5 mM) for 1 h and then co-treated with astaxanthin (5 mM) and pemetrexed (5 mM) for 24 h. Cytotoxicity was determined by the MTS assay. **p < 0.01 using Student's t-test for comparison between the cells pretreated with or without U0126 in astaxanthin and pemetrexed-exposed cells. (H) A signaling pathway that is regulated by astaxanthin in pemetrexed-exposed lung cancer cells is proposed.
overcome pemetrexed resistance in NSCLC (Chiu et al., 2016). Our study results showed that down-regulation of MKK1/2-ERK1/2mediated TS expression by astaxanthin could enhance the pemetrexedeinduced cell death and growth inhibition effect. Continently with previous study, pemetrexed induced an EGFRmediated activation of the phosphatidylinositol 3-kinase/AKT and ERK pathway, which was inhibited by EGFR-tyrosine kinase inhibitor gefitinib. Moreover, pemetrexed combined with gefitinib has a significantly synergistic effect on colorectal cancer cells (Zhang et al., 2013). In the Tong et al. study, pemetrexed activated MKK1/2-ERK1/2 signaling in HepG2 cells, which was required for autophagy induction. Pharmacological inhibition of MEK/ERK activation attenuated pemetrexed-induced autophagy, enhanced HepG2 cell death and apoptosis (Tong et al., 2015). In Nagaraju et al. study, heat shock protein 90 (HSP90) inhibition downregulates TS expression and ERK1/2 activation and sensitizes colorectal cancer cell lines to 5-FU (a nucleotide analogue)-based chemotherapy (Nagaraju et al., 2014). We found enhanced NSCLC cells sensitivity to pemetrexed in astaxanthin-treated cells as a result of MKK1/2-ERK1/2 mediated TS decrease. Moreover, PKCb inhibitor
enzastaurin significantly reduced pemetrexed-induced upregulation of TS expression, and enzastaurin-pemetrexed combination was synergistic and significantly increased apoptosis in SW1573 and A549 cells (Tekle et al., 2008). Astaxanthin is a red carotenoid pigment having powerful antioxidant activity and found in marine world of algae and aquatic animals (Lai et al., 2004). In the Chew et al. study, astaxanthin treatment inhibits the progression of mammary tumor in mice (Chew et al., 1999). Furthermore, Kurihara et al. reported that astaxanthin treatment inhibits the promotion of cancer metastasis in mice (Kurihara et al., 2002). Previous study demonstrate that astaxanthin inhibits the development of hamster buccal pouch (HBP) carcinogenesis carcinomas by inducing intrinsic apoptosis via coordinate inaction of both the ERK1/2 and AKT signals (Kavitha et al., 2013). Our study results showed that phospho-MKK1/2 and phospho-ERK1/2 were significantly decreased in H1650 and H1703 cells in a dose and time-dependent manner after astaxanthin treatment. Inactivation of ERK1/2 by MKK1/2 inhibitors augmented the astaxanthin-induced cytotoxicity in H1650 and H1703 cells. In contrast, enhancement of ERK1/2 activity could
K.-S. Liao et al. / Regulatory Toxicology and Pharmacology 81 (2016) 353e361
restore the cell viability decreased by astaxanthin. Therefore, astaxanthin induced cytotoxic effects in human lung cancer cells lines via MKK1/2-ERK1/2 inactivation. In addition, combined treatment with astaxanthin and pemetrexed could down-regulate the expressions of TS, and subsequently result in synergistic cytotoxic effects in NSCLC cells. This study provides new insight into the mechanism of astaxanthin in down-regulating the expression of TS to enhance the cytotoxic effect of pemetrexed in NSCLC cells. In summary, we extend the current knowledge by highlighting the role of TS in the pemetrexed chemotherapy sensitivity of lung cancer. In this study, combined treatment with astaxanthin significantly decreased the expression of TS, thereby enhancing the pemetrexed-induced cytotoxic effect on NSCLC cells. Taken together, these results may provide for the rational design of future drug regimens incorporating astaxanthin and pemetrexed for the treatment of NSCLC. Moreover, whether astaxanthin would relieve pemetrexed resistance in pemetrexed resistance human lung cancer sublines was under our next investigation. Although further study is required to evaluate the effect of astaxanthin, pemetrexed, and their combination in vivo, the concept of pemetrexed combined with astaxanthin seems to present a strategy for the treatment of NSCLC. Conflict of interest None declared. Acknowledgements This study was funded by grants from the Ministry of Science and Technology, Taiwan, Grant MOST 104-2314-B-415-002 and MOST 105-2314-B-002-112 (Y-W. Lin) and Ditmanson Medical Foundation Chia-Yi Christian Hospital Research Program R105-016. Transparency document Transparency document related to this article can be found online at http://dx.doi.org/10.1016/j.yrtph.2016.09.031. References Argiris, A., et al., 2013. Pemetrexed in head and neck cancer: a systematic review. Oral Oncol. 49, 492e501. Bepler, G., et al., 2008. Clinical efficacy and predictive molecular markers of neoadjuvant gemcitabine and pemetrexed in resectable non-small cell lung cancer. J. Thorac. Oncol. 3, 1112e1118. Chew, B.P., et al., 1999. A comparison of the anticancer activities of dietary betacarotene, canthaxanthin and astaxanthin in mice in vivo. Anticancer Res. 19, 1849e1853. Chiu, L.Y., et al., 2016. The ERK-ZEB1 pathway mediates epithelial-mesenchymal transition in pemetrexed resistant lung cancer cells with suppression by vinca alkaloids. Oncogene. http://dx.doi.org/10.1038/onc.2016.195. Ciuleanu, T., et al., 2009. Maintenance pemetrexed plus best supportive care versus placebo plus best supportive care for non-small-cell lung cancer: a randomised, double-blind, phase 3 study. Lancet 374, 1432e1440. Edler, D., et al., 2000. Immunohistochemically detected thymidylate synthase in colorectal cancer: an independent prognostic factor of survival. Clin. Cancer Res. 6, 488e492. Ferlay, J., et al., 2010. Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int. J. Cancer 127, 2893e2917. Gomez, H.L., et al., 2006. A phase II trial of pemetrexed in advanced breast cancer: clinical response and association with molecular target expression. Clin. Cancer Res. 12, 832e838. Goto, S., et al., 2001. Efficient radical trapping at the surface and inside the phospholipid membrane is responsible for highly potent antiperoxidative activity of the carotenoid astaxanthin. Biochim. Biophys. Acta 1512, 251e258. Hanna, N.H., 2004. Second-line chemotherapy for non-small-cell lung cancer: recent data with pemetrexed. Clin. Lung Cancer 5 (Suppl. 2), S75eS79. Harpole Jr., D.H., et al., 2001. The prognostic value of molecular marker analysis in patients treated with trimodality therapy for esophageal cancer. Clin. Cancer Res. 7, 562e569.
361
Higuera-Ciapara, I., et al., 2006. Astaxanthin: a review of its chemistry and applications. Crit. Rev. Food Sci. Nutr. 46, 185e196. Huang, C., et al., 2005. Clinical application of biological markers for treatments of resectable non-small-cell lung cancers. Br. J. Cancer 92, 1231e1239. Joerger, M., et al., 2010. The role of pemetrexed in advanced non small-cell lung cancer: special focus on pharmacology and mechanism of action. Curr. Drug Targets 11, 37e47. Kavitha, K., et al., 2013. Astaxanthin inhibits NF-kappaB and Wnt/beta-catenin signaling pathways via inactivation of Erk/MAPK and PI3K/Akt to induce intrinsic apoptosis in a hamster model of oral cancer. Biochim. Biophys. Acta 1830, 4433e4444. Ko, J.C., et al., 2016. Astaxanthin down-regulates Rad51 expression via inactivation of AKT kinase to enhance mitomycin C-induced cytotoxicity in human nonsmall cell lung cancer cells. Biochem. Pharmacol. 105, 91e100. Ko, J.C., et al., 2009. Roles of MKK1/2-ERK1/2 and phosphoinositide 3-kinase-AKT signaling pathways in erlotinib-induced Rad51 suppression and cytotoxicity in human non-small cell lung cancer cells. Mol. Cancer Res. 7, 1378e1389. Ko, J.C., et al., 2011. Up-regulation of extracellular signal-regulated kinase 1/2dependent thymidylate synthase and thymidine phosphorylase contributes to Cisplatin resistance in human non-small-cell lung cancer cells. J. Pharmacol. Exp. Ther. 338, 184e194. Kurihara, H., et al., 2002. Contribution of the antioxidative property of astaxanthin to its protective effect on the promotion of cancer metastasis in mice treated with restraint stress. Life Sci. 70, 2509e2520. Lai, J.P., et al., 2004. Separation and determination of astaxanthin from microalgal and yeast samples by molecularly imprinted microspheres. J. Chromatogr. B Anal. Technol. Biomed. Life Sci. 804, 25e30. Lee, D.H., et al., 2010. Neuroprotective effects of astaxanthin in oxygen-glucose deprivation in SH-SY5Y cells and global cerebral Ischemia in rat. J. Clin. Biochem. Nutr. 47, 121e129. Liu, Y., et al., 2013. Expression of thymidylate synthase predicts clinical outcomes of pemetrexed-containing chemotherapy for non-small-cell lung cancer: a systemic review and meta-analysis. Cancer Chemother. Pharmacol. 72, 1125e1132. Lordan, S., et al., 2008. Effects of apigenin, lycopene and astaxanthin on 7 betahydroxycholesterol-induced apoptosis and Akt phosphorylation in U937 cells. Br. J. Nutr. 100, 287e296. Marin, D.P., et al., 2011. ROS production in neutrophils from alloxan-induced diabetic rats treated in vivo with astaxanthin. Int. Immunopharmacol. 11, 103e109. Nagaraju, G.P., et al., 2014. HSP90 inhibition downregulates thymidylate synthase and sensitizes colorectal cancer cell lines to the effect of 5FU-based chemotherapy. Oncotarget 5, 9980e9991. Nagendraprabhu, P., Sudhandiran, G., 2011. Astaxanthin inhibits tumor invasion by decreasing extracellular matrix production and induces apoptosis in experimental rat colon carcinogenesis by modulating the expressions of ERK-2, NFkB and COX-2. Investig. New Drugs 29, 207e224. Nakao, R., et al., 2010. Effect of dietary astaxanthin at different stages of mammary tumor initiation in BALB/c mice. Anticancer Res. 30, 2171e2175. Paz-Ares, L., et al., 2003. Review of a promising new agentepemetrexed disodium. Cancer 97, 2056e2063. Peters, G.J., et al., 2000. Basis for effective combination cancer chemotherapy with antimetabolites. Pharmacol. Ther. 87, 227e253. Pfister, D.G., et al., 2004. American Society of Clinical Oncology treatment of unresectable non-small-cell lung cancer guideline: update 2003. J. Clin. Oncol. 22, 330e353. Rollins, K.D., Lindley, C., 2005. Pemetrexed: a multitargeted antifolate. Clin. Ther. 27, 1343e1382. Rose, M.G., et al., 2002. Thymidylate synthase: a critical target for cancer chemotherapy. Clin. Colorectal Cancer 1, 220e229. Scagliotti, G., et al., 2009. The differential efficacy of pemetrexed according to NSCLC histology: a review of two Phase III studies. Oncologist 14, 253e263. Shih, C., et al., 1997. LY231514, a pyrrolo[2,3-d]pyrimidine-based antifolate that inhibits multiple folate-requiring enzymes. Cancer Res. 57, 1116e1123. Shimokawa, H., et al., 2011. TS expression predicts postoperative recurrence in adenocarcinoma of the lung. Lung Cancer 72, 360e364. Song, X., et al., 2012. Changes in cell ultrastructure and inhibition of JAK1/STAT3 signaling pathway in CBRH-7919 cells with astaxanthin. Toxicol. Mech. Methods 22, 679e686. Tekle, C., et al., 2008. Molecular pathways involved in the synergistic interaction of the PKC beta inhibitor enzastaurin with the antifolate pemetrexed in non-small cell lung cancer cells. Br. J. Cancer 99, 750e759. Tong, Y., et al., 2015. Inhibition of MEK/ERK activation attenuates autophagy and potentiates pemetrexed-induced activity against HepG2 hepatocellular carcinoma cells. Biochem. Biophys. Res. Commun. 456, 86e91. Tonkinson, J.L., et al., 1997. Cell cycle effects of antifolate antimetabolites: implications for cytotoxicity and cytostasis. Cancer Chemother. Pharmacol. 39, 521e531. Torre, L.A., et al., 2015. Global cancer statistics, 2012. CA Cancer J. Clin. 65, 87e108. Villela, L.R., et al., 2006. Pemetrexed, a novel antifolate therapeutic alternative for cancer chemotherapy. Pharmacotherapy 26, 641e654. Yeh, K.H., et al., 1998. High expression of thymidylate synthase is associated with the drug resistance of gastric carcinoma to high dose 5-fluorouracil-based systemic chemotherapy. Cancer 82, 1626e1631. Zhang, G., et al., 2013. Effects of pemetrexed, gefitinib, and their combination on human colorectal cancer cells. Cancer Chemother. Pharmacol. 72, 767e775.
Contents lists available at ScienceDirect
Regulatory Toxicology and Pharmacology journal homepage: www.elsevier.com/locate/yrtph
Astaxanthin enhances pemetrexed-induced cytotoxicity by downregulation of thymidylate synthase expression in human lung cancer cells Kai-Sheng Liao a, b, 1, Chia-Li Wei c, 1, Jyh-Cheng Chen d, 1, Hao-Yu Zheng c, Wen-Ching Chen c, Chia-Hung Wu c, Tai-Jing Wang c, Yi-Shuan Peng c, Po-Yuan Chang c, Yun-Wei Lin c, * a
Department of Pathology, Ditmanson Medical Foundation Chia-Yi Christian Hospital, Chiayi, Taiwan School of Nursing, Chung Jen Junior College of Nursing, Health Science and Management, Chiayi, Taiwan c Department of Biochemical Science and Technology, National Chiayi University, Chiayi, Taiwan d Department of Food Science, National Chiayi University, Chiayi, Taiwan b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 1 August 2016 Received in revised form 21 September 2016 Accepted 27 September 2016 Available online 28 September 2016
Pemetrexed, a multitargeted antifolate agent, has demonstrated clinical activity in non-small cell lung cancer (NSCLC) cells. Increased expression of thymidylate synthase (TS) is thought to be associated with resistance to pemetrexed. Astaxanthin exhibits a wide range of beneficial effects including anti-cancer and anti-inflammatory properties. In this study, we showed that down-regulating of TS expression in two NSCLC cell lines, human lung adenocarcinoma H1650 and squamous cell carcinoma H1703 cells, with astaxanthin were associated with decreased MKK1/2-ERK1/2 activity. Enforced expression of constitutively active MKK1 (MKK1-CA) vector significantly rescued the decreased TS mRNA and protein levels in astaxanthin-treated NSCLC cells. Combined treatment with a MKK1/2 inhibitor (U0126 or PD98059) further decreased the TS expression in astaxanthin-exposed NSCLC cells. Knockdown of TS using small interfering RNA (siRNA) or inhibiting ERK1/2 activity enhanced the cytotoxicity and cell growth inhibition of astaxanthin. Combination of pemetrexed and astaxanthin resulted in synergistic enhancing cytotoxicity and cell growth inhibition in NSCLC cells, accompanied with reduced activation of phospho-MKK1/2, phopho-ERK1/2, and TS expression. Overexpression of MKK1/2-CA reversed the astaxanthin and pemetrexed-induced synergistic cytotoxicity. Our findings suggested that the downregulation of MKK1/2-ERK1/2-mediated TS expression by astaxanthin is an important regulator of enhancing the pemetrexed-induced cytotoxicity in NSCLC cells. © 2016 Published by Elsevier Inc.
Keywords: Astaxanthin Pemetrexed Thymidylate synthase ERK1/2 Non-small cell lung cancer
1. Introduction Lung cancer is one of the most lethal malignances in the world, and non-small cell lung cancer (NSCLC) accounts for more than 85% of all lung cancer cases (Ferlay et al., 2010; Pfister et al., 2004; Torre et al., 2015). Pemetrexed is a multi-targeted antifolate drug that inhibits enzymes including thymidylate synthase (TS), dihydrofolate reductase (DHFR) and glycinamide ribonucleotide
* Corresponding author. Department of Biochemical Science and Technology, National Chiayi University, 300 Syuefu Road, Chiayi, 600, Taiwan. E-mail address: [email protected] (Y.-W. Lin). 1 Kai-Sheng Liao, Chia-Li Wei, and Jyh-Cheng Chen contributed equally. http://dx.doi.org/10.1016/j.yrtph.2016.09.031 0273-2300/© 2016 Published by Elsevier Inc.
formyltransferase (GARFT) which are involved in the synthesis of pyrimidine and purine, thereby depleting nucleotide pools and blocking DNA synthesis (Joerger et al., 2010; Tonkinson et al., 1997). Pemetrexed has been approved in first-line, second-line, and maintenance therapy in the treatment of advanced NSCLC (Ciuleanu et al., 2009; Hanna, 2004). In NSCLC, overexpression of TS is associated with poor prognosis following lung resection (Huang et al., 2005; Shimokawa et al., 2011) and low TS mRNA level is associated with better response to neoadjuvant pemetrexed treatment (Bepler et al., 2008). Our previous study has shown that platinum-containing chemotherapeutic compound, cisplatin, increased TS protein expression in a MKK1/2-ERK1/2 dependent manner in NSCLC cell lines (Ko et al., 2011). Moreover, inhibition of heat shock protein 90 (HSP90) can sensitize colorectal cancer cells
354
K.-S. Liao et al. / Regulatory Toxicology and Pharmacology 81 (2016) 353e361
to the effects of chemotherapy through inhibition of ERK1/2 activation and downregulation of TS expression (Nagaraju et al., 2014). Astaxanthin, a ketocarotenoid (3,30 -dihydroxy-b,b0 -carotene4,40 -dione) red pigment ubiquitously found in microalgae, red yeast, and in marine animals such as shrimp, salmon, crayfish, and lobsters (Goto et al., 2001; Higuera-Ciapara et al., 2006). In vitro and in vivo studies have reported that astaxanthin possesses several pharmacological properties, including antioxidant, antiinflammatory, and antitumor effects (Lee et al., 2010; Marin et al., 2011; Nakao et al., 2010; Song et al., 2012). Moreover, astaxanthin induces apoptosis in U937 cells (Human leukemic monocyte lymphoma cell line) by downregulation of AKT activity (Lordan et al., 2008). Furthermore, astaxanthin treatment was shown to promote apoptosis in dimethylhydrazine induced rat colon carcinogenesis through modulating the expressions of ERK, NF-kB, and COX-2 (Nagendraprabhu and Sudhandiran, 2011). Recently, astaxanthin enhances mitomycin C-induced cytotoxic effects in human lung cancer cells lines via AKT inactivation (Ko et al., 2016). However, whether astaxanthin could regulate TS expression to enhance pemetrexed-induced cytotoxic effects in NSCLC has not been examined. In this study, we wanted to explore the molecular mechanism of astaxanthin in regulating TS expression to enhance the cytotoxic effect of pemetrexed in human lung cancer cells. Using H1650 and H1703 human lung cancer cell lines, we found that decreased TS expression by astaxanthin could enhance the sensitivity of pemetrexed. These results may provide a rationale to combine astaxanthin with pemetrexed for lung cancer treatment. 2. Materials and methods 2.1. Cell lines and chemicals Human lung carcinoma cells H1650 and H1703 were obtained from the American Type Culture Collection (Manassas, VA) and the cells were cultured at 37 C in a humidified atmosphere containing 5% CO2 in RPMI-1640 complete medium supplemented with sodium bicarbonate (2.2%, w/v), L-glutamine (0.03%, w/v), penicillin (100 units/ml), streptomycin (100 mg/ml), and fetal calf serum (10%). The cell lines were routinely tested to confirm that they were free of Mycoplasma. Astaxanthin (free form) was dissolved in dimethyl sulfoxide (DMSO) immediately before use. Pemetrexed was a gift from Eli Lilly Corporation (Indianapolis, IN, USA). Astaxanthin, Cycloheximide and actinomycin D were purchased from Sigma-Aldrich (St. Louis, MO, USA). N-acetyl-Leu-Leunorleucinal (ALLN), MG132, U0126, and PD98059 were purchased from Calbiochem-Novabiochem (San Diego, CA, USA). Actinomycin D, ALLN, MG132, U0126, and PD98059 were dissolved in dimethyl sulfoxide (DMSO). Cycloheximide was dissolved in Milli-Q-purified water (Millipore, Billerica, MA, USA). 2.2. Western blot analysis After cells were treated with pemetrexed (5, 10, 20 mM) and/or astaxanthin (2.5e20 mM) for 24 h, equal amounts (40 mg) of proteins from each set of experiments were subjected to Western blot analysis as previously described (Ko et al., 2009). Antibodies were stripped from polyvinylidene difluoride membranes using a solution containing 2% SDS, 62.5 mM Tris-HCl, pH 6.8, and 0.7% (w/w) b-mercaptoethanol at 50 C for 15 min before re-probing with another primary antibody. The specific phospho-MKK1/2 (Ser217/Ser221) and phospho-ERK1/2 (Thr202/Tyr204) antibodies were purchased from Cell Signaling (Beverly, MA, USA). Rabbit polyclonal antibodies against TS(TS-106) (sc-33679), ERK2(K-23) (sc-153), HA(F-7) (sc-7392), and Actin(I-19) (sc-1616) were
purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Relative protein blot intensities were determined using a computing densitometer equipped with the ImageQuant analysis program (Amersham Biosciences). 2.3. Plasmid and transfection Exponentially growing human lung cancer cells (106) were plated for 18 h, and then MKK1-CA (a constitutively active form of MKK1, DN3/S218E/S222D) and MKK2-CA (a constitutively active form of MKK2, DN4/S222E/S226D) were transfected into H1650 or H1703 cells using Lipofectamine (Invitrogen). The sense-strand sequences of siRNA duplexes were as follows: TS: 50 -GCACAUAUUUACCUGAAUC-30 , and scrambled (as a control): 50 -GCG CGC UUU GUA GGA TTC G-30 (Dharmacon Research, Lafayette, CO). Cells were transfected with siRNA duplexes (200 nM) using Lipofectamine 2000 (Invitrogen) for 24 h. 2.4. Quantitative real-time polymerase chain reaction (PCR) PCRs were performed using an ABI Prism 7900HT according to the manufacturer's instructions. Amplification of specific PCR products was performed using the SYBR Green PCR Master Mix (Applied Biosystems). For each sample, the data were normalized to the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The designed primers in this study were: TS forward primer, 50 - ACTGCAAAGAGTGATTGACACC -30 , TS reverse primer, 50 - CACTGTTCACCACATAGAACTGG -30 ; GAPDH forward primer, 50 - CATGAGAAGTATGACAACAGCCT -30 ; GAPDH reverse primer, 50 - AGTCCTTCCACGATACCAAAGT -30 . Analysis was performed using the comparative Ct value method. For each sample, the data were normalized to the housekeeping gene gapdh. 2.5. MTS assay In vitro 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenol)2-(4-sulfophenyl)-2H-tetrazolium (MTS) assay was performed. Cells were cultured at 5000 per well in 96-well tissue culture plates. To assess cell viability, drugs were added after plating. At the end of the culture period, 20 mL of MTS solution (CellTiter 96 Aqueous One Solution Cell Proliferation Assay; Promega, Madison, WI, USA) was added, the cells were incubated for a further 2 h, and the absorbance was measured at 490 nm using an ELISA plate reader (Biorad Technologies, Hercules, CA). 2.6. Combination index analysis Pemetrexed and astaxanthin were combined at a ratio of 1:1 or 1:2, and the effect of combined treatment on cell viability was examined by MTS assay. To calculate a combination index (CI), the computer software Calcusyn (Biosoft, Oxford, UK) can be used, taking the entire shape of the cell viability curve into account for calculating whether a combination is synergistic (CI < 0.9), additive (CI ¼ 0.9e1.1), or antagonistic (CI > 1.1) (Peters et al., 2000). The mean of CI values at a fraction affected (FA) of 0.90, 0.75, 0.50 were used to calculate between the three independent experiments. 2.7. Trypan blue dye exclusion assay Cells were treated with astaxanthin and/or pemetrexed for 24, 48, and 72 h. After treatment, the 500 cells were harvested, and the proportion of dead cells was determined by hemocytometer, counting the number of cells stained with trypan blue. Trypan blue dye can be excluded from living cells, but is able to penetrate dead cells. The dead cells were calculated as follow: trypan blue (þ) cells ratio (%) ¼(stained cell number/total cell number)100.
K.-S. Liao et al. / Regulatory Toxicology and Pharmacology 81 (2016) 353e361
2.8. Statistical analyses For each protocol, three or four independent experiments were performed. Results were expressed as the mean ± SEM. Statistical calculations were performed using SigmaPlot 2000 software (Systat Software, San Jose, CA). Differences in measured variables between the experimental and control groups were assessed by unpaired t-test. P < 0.05 was considered statistically significant. 3. Results 3.1. TS mRNA and protein levels were decreased after astaxanthin exposure To determine whether TS expression was associated with the effects of astaxanthin, we first assessed H1650 or H1703 cells treated with astaxanthin (20 mM) for 3e24 h or various concentrations of astaxanthin (2.5, 5, 10, 20 mM) for 24 h. Then, the realtime PCR and Western blot analysis was used for determination of the TS mRNA and protein level, respectively. In Fig. 1A and B, astaxanthin reduced TS mRNA and protein expression in a time and dose-dependent manner; this was accompanied with a decrease in phospho-MKK1/2 and phospho-ERK1/2 protein levels. Next, to determine whether MKK1/2-ERK1/2 inactivation was involved in down-regulation of TS by astaxanthin, these cell lines were transiently transfected with MKK1-CA plasmids, a constitutively active form of MKK1. Overexpression of MKK1-CA rescued TS mRNA and protein expression in H1650 and H1703 cells inhibited by astaxanthin (Fig. 1C and D). However, once these cells were pretreated with MKK1/2 inhibitors (U0126 or PD98059), the TS mRNA and protein levels in astaxanthin-exposed H1650 or H1703 cells would further decrease (Fig. 1E and F). As expected, the addition of U0126 or PD98059 decreased cellular phospho-ERK1/2 protein levels, and also further decreased phospho-ERK1/2 levels in astaxanthinexposed NSCLC cell lines (Fig. 1F). Therefore, we concluded that astaxanthin decreased TS expression through down-regulation of MKK1/2-ERK1/2 activity. Next, we hypothesized ERK1/2 inactivation to be involved in the down-regulation of TS protein level by the ubiquitin-26S proteasome-mediated proteolysis of TS. In Fig. 2A, the 26S proteasome inhibitors ALLN or MG132 were added for the final 6 h before harvesting in astaxanthin-treated H1650 and H1703 cells. The result showed that both of MG132 and ALLN restored the decreased TS protein levels induced by astaxanthin (Fig. 2A). In addition, we examined the levels of ubiquitin conjugates on TS. Enforced expression of the MKK1-CA vector decreased the levels of ubiquitin-conjugated TS in astaxanthin-treated NSCLC cell lines (Fig. 2B). These results revealed that ERK1/2 inactivation decreased TS protein level by ubiquitin-26S proteasome-mediated proteolysis of TS protein in astaxanthin-treated NSCLC cells. 3.2. Knockdown of TS increased astaxanthin-induced cytotoxicity and growth inhibition in NSCLC cells To investigate if astaxanthin had any cytotoxic activity against human NSCLC cells, cells were treated with various concentration of astaxanthin for 24 h. The cell viability was assessed by MTS assay. In Fig. 3A, astaxanthin induced a concentration-dependent reduction in cell viability. The IC50 values of 59.38 mM and 57.30 mM for astaxanthin were determined in H1650 cells and H1703 cells, respectively. We next examined the effect of siRNA-mediated TS knockdown on astaxanthin-induced cytotoxicity and cell growth inhibition in NSCLC cells. At 24 h post-transfection, Western blot analysis showed a further decrease in TS protein in astaxanthin-treated H1650 and H1703 cells (Fig. 3A). Furthermore,
355
suppression of TS protein expression by si-TS RNA resulted in increased sensitivity to astaxanthin compared to si-control transfected cells (Fig. 3B and C). We also conducted a cell growth inhibition assay to evaluate the synergistic effects of TS knockdown with astaxanthin treatment. In Fig. 3D, more inhibition of cell growth was induced by the combination of TS siRNA and astaxanthin than by astaxanthin alone in H1650 or H1703 cells (Fig. 3D). Therefore, down-regulation of TS expression could enhance astaxanthin-induced cytotoxicity and growth inhibition in NSCLC cells. 3.3. Blocking ERK1/2 activation enhanced astaxanthin-induced cytotoxicity and growth inhibition Next, the role of MKK1/2-ERK1/2 in the cytotoxic effect of astaxanthin was examined. In Fig. 3E, co-treatment with U0126 or PD98059 further decreased significantly cell viability in astaxanthin-exposed H1650 or H1703 cells, compared with astaxanthin treatment alone. U0126 or PD98059 could enhance growth inhibition after treatment with astaxanthin. Blocking ERK1/ 2 activity could more effectively inhibit cell growth than either drug alone after astaxanthin treatment (Fig. 3F). Taken together, inactivation of the MKK1/2-ERK1/2-TS signals could enhance astaxanthin-induced cytotoxicity and growth inhibition in NSCLC cells. 3.4. Combination treatment with astaxanthin enhanced the cytotoxic effect and growth inhibition of pemetrexed TS is the primary target of pemetrexed and its expression has been linked with response to antifolate treatment in various cancers including gastric, esophageal and colorectal cancers (Edler et al., 2000; Harpole et al., 2001; Yeh et al., 1998); therefore, we attempted to determine whether astaxanthin could enhance the cytotoxic effects of pemetrexed through down-regulating TS expression in NSCLC cells. Pemetrexed and astaxanthin were combined at a ratio of 1:1 or 1:2 and the effect of combined treatment on cell viability was examined by MTS assay (Fig. 4A). The CI values for astaxanthin and pemetrexed were <1, indicating the combined treatment had a synergistic effect (Fig. 4B). Combined treatment with astaxanthin and pemetrexed for 24 h resulted in a greater loss of cell viability in H1650 and H1703 cells than treatment with either pemetrexed or astaxanthin alone (Fig. 4A). In addition, H1650 and H1703 cells were exposed to astaxanthin and/ or pemetrexed, and cell proliferation was determined 1e3 days after exposure. Astaxanthin and pemetrexed co-treatment had a greater cell growth inhibition effect than either treatment alone (Fig. 4C). The results showed that combined astaxanthin and pemetrexed had a synergistic cytotoxic effect on human NSCLC cells. 3.5. Astaxanthin down-regulated TS protein and the mRNA level in pemetrexed-treated human lung cancer cells In order to assess the mechanism of the synergistic effects, we hypothesized that astaxanthin would affect TS expression in pemetrexed-treated NSCLC cells. To test this hypothesis, H1650 and H1703 cells were exposed to various concentrations of pemetrexed (5, 10, and 20 mM) and astaxanthin (20 mM) for 24 h. The results from real-time PCR analysis showed that astaxanthin decreased pemetrexed-induced TS mRNA levels in H1650 and H1703 cells (Fig. 4D). Moreover, astaxanthin suppressed the phospho-ERK1/2 and TS protein levels in pemetrexed-treated NSCLC cells (Fig. 4E).
356
K.-S. Liao et al. / Regulatory Toxicology and Pharmacology 81 (2016) 353e361
Fig. 1. Astaxanthin decreased TS expression in a dose and time-dependent manner. (A) Left panel, H1650 or H1703 cells (106) were cultured in complete medium for 18 h and then exposed to astaxanthin (20 mM) for 3, 6, 9, 12, or 24 h. After treated with astaxanthin (20 mM) for 24 h. Right panel, various concentrations of astaxanthin (2.5e20 mM) for 24 h in complete medium. The total RNA was isolated and subjected to real-time PCR for TS mRNA expression. The results (mean ± SEM) were from three independent experiments. (B) After treatment as above, the cell extracts were examined by Western blot for determination of TS, phospho-MKK1/2, phospho-ERK1/2, actin, MMK2, and ERK1/2 protein levels. Astaxanthin decreased TS expression via MKK1/2-ERK1/2 inactivation in NSCLC cells. (C and D) H1650 or H1703 cells (5 105) were transfected with MKK1-CA. After incubation for 24 h, the cells were treated with astaxanthin (10, 20 mM) for 24 h. The results (mean ± SEM) were from three independent experiments. a**p < 0.01 using Student's t-test for comparison between the cells transfected with pcDNA3 or MKK1-CA vector. b**p < 0.01 using Student's t-test for comparison between the cells treated with astaxanthin in pcDNA3 or MKK1-CA vector-transfected cells. (E and F) U0126 (5 mM) or PD98059 (5 mM) was added to H1650 or H1703 cells for 1 h before astaxanthin (5 mM) treatment for 24 h. The results (mean ± SEM) were from four independent experiments. c**p < 0.01 using Student's t-test for comparison between the cells treated with or without U0126/PD98059. d**p < 0.01 using Student's t-test for comparison between the cells treated with astaxanthineDMSO or a astaxanthineU0126/PD98059 combination. After treatment, the cell extracts were examined by real-time PCR (C, E) and Western blot (D, F) for determination of TS mRNA and protein levels, respectively.
K.-S. Liao et al. / Regulatory Toxicology and Pharmacology 81 (2016) 353e361
357
Fig. 2. Astaxanthin treatment triggers 26S proteasome-mediated proteolysis of TS. (A) Astaxanthin (20 mM) was added to H1650 or H1703 cells for 18 h, then the cells were cotreated with 26S proteasome inhibitor ALLN (10 mM) or MG132 (10 mM) for 6 h. Whole cell extracts were collected for Western blot analysis. (B) After pcDNA3 or MKK1-CA vector transfection, the cells were treated with astaxanthin (20 mM) for 18 h, and then MG132 (10 mM) for 6 h before whole cell extract collection. Equal amounts of proteins in each cell extract were subjected to immunoprecipitation (IP) using anti-ubiquitin antibody. The immunoprecipitates were analyzed by Western blotting using anti-TS antibody.
3.6. Down-regulation of TS expression by astaxanthin was through increased mRNA and protein instability in pemetrexed-exposed NSCLC cells Next, we examined the possible mechanisms for posttranscriptional regulation of TS transcripts under astaxanthin
and/or pemetrexed treatment. To evaluate the stability of TS mRNA in pemetrexed-exposed H1650 or H1703 cells, the cells were treated astaxanthin and/or pemetrexed for 8 h and actinomycin D were added to block de novo RNA synthesis and then measured the levels of existing TS mRNA using real-time PCR at 3, 6, and 9 h after treatment. After actinomycin D co-exposure, lower levels of TS
Fig. 3. Knockdown of TS expression by si-RNA transfection enhanced the cytotoxicity induced by astaxanthin. (A) H1650 or H1703 cells were treated with astaxanthin (10e80 mM) in complete medium for 24 h; cytotoxicity was determined by MTS assay. (B) H1650 or H1703 cells were transfected with siRNA duplexes (200 nM) specific to TS or scrambled (control) in complete medium for 24 h prior to treatment with astaxanthin (10 or 20 mM) in complete medium for 24 h; whole-cell extracts were collected for Western blot analysis using specific antibodies against TS and actin. (C and D) After the treatment as (B), cytotoxicity was determined by MTS assay and trypan blue exclusion assay. (E) After the cells were transfected with si-TS or si-scrambled RNA, the cells were treated with astaxanthin (10 or 20 mM) for 24, 48, and 72 h, after which living cells were determined by MTS assay. The results (mean ± SEM) were from three independent experiments. **p < 0.01 using Student's t-test for comparison between the cells treated with astaxanthin in si-TS RNA or si-scrambled RNA-transfected cells. Inhibition of ERK1/2 activation enhanced the cytotoxicity induced by astaxanthin. (F) Left panel, H1650 or H1703 cells were pretreated with U0126 (2.5 mM) for 1 h and then co-treated with various concentration of astaxanthin for 24 h. Right panel, cells were pretreated with PD98059 (2.5, 5, 10 mM) for 1 h and then co-treated with astaxanthin (20 mM) for 24 h. Cytotoxicity was determined by MTS assay. **p < 0.01 using Student's t-test for comparison between the cells pretreated with or without U0126/PD98059 in astaxanthin exposed cells. (G) Cells were treated with astaxanthin (10 mM) and/or U0126 (2.5 mM) or PD98059 (2.5 mM) for 1e3 days after which living cells were determined by trypan blue dye exclusion assay. **p < 0.01 using Student's t-test for comparison between cells treated with astaxanthin alone or with an astaxanthin and U0126/PD98059 combination.
358
K.-S. Liao et al. / Regulatory Toxicology and Pharmacology 81 (2016) 353e361
Fig. 4. Astaxanthin co-treatment with pemetrexed synergistically enhanced cytotoxicity. (A) Pemetrexed and astaxanthin were combined at a ratio of 1:1 (upper panel) or 1:2 (lower panel) and the MTS assay was used to analyze cell viability. (B) The mean CI values at a fraction affected (FA) of 0.50, 0.75, 0.90 for pemetrexed and astaxanthin combined treatment were averaged for each experiment and used to calculate the mean between experiments. Points and columns, mean values obtained from three independent experiments; bars, standard error (SE). (C) Cells were treated with astaxanthin (5 mM) and/or pemetrexed (10, 20 mM) for 1e3 days after which living cells were determined by MTS assay. **p < 0.01 using Student's t-test for comparison between cells treated with a drug alone or with a astaxanthin/pemetrexed combination. (D) Astaxanthin decreased TS protein and mRNA levels in pemetrexed-exposed NSCLC cells. H1650 or H1703 cells (106) were cultured in complete medium for 18 h and then were exposed to pemetrexed (5, 10, 20 mM) and astaxanthin (20 mM) for 24 h. After treatment, total RNA was isolated and subjected to real-time PCR for TS mRNA expression. The means ± standard deviation (SD) from four independent experiments. ** denotes p < 0.01, respectively, using Student's t-test for comparison between the cells treated with astaxanthin/pemetrexed alone or combined. (E) After treatment as the above, cell extracts were examined by Western blot for determination of TS, phospho-ERK1/2, actin, and ERK1/2 protein levels.
mRNA were observed with astaxanthin treatment than in untreated cells (Fig. 5A). Then, cycloheximide (an inhibitor of de novo protein synthesis) was added to astaxanthin treatment for 4, 8, and 12 h, and the remaining TS protein was analyzed by Western blot. In Fig. 5B, TS protein levels were progressively reduced with time in the presence of cycloheximide. However, astaxanthin treatment significantly enhanced TS degradation after cycloheximide treatment compared with untreated cells. Moreover, less TS protein remained after astaxanthin and pemetrexed co-treatment, compared with pemetrexed alone (Fig. 5B). Next, we examined whether astaxanthin-mediated ERK1/2 inactivation was involved in regulating TS mRNA and protein stability upon pemetrexed treatment. After H1650 or H1703 cells were transfected with MKK1-CA vectors, the TS mRNA and protein stability were examined as above. In Fig. 5C and D, it was of interest that enforced expression of the MKK1-CA vector significantly reduced astaxanthin and pemetrexed combination-induced TS mRNA and protein instability, compared with pcDNA3 control vector transfection. These results indicated that astaxanthin decreased TS mRNA and protein levels by augmentation of mRNA and protein instability through ERK1/2 inactivation in pemetrexed-treated NSCLC cells.
3.7. Transfection with MKK1/2-CA vectors enhanced the TS protein level as well as the cell survival suppressed by pemetrexed and astaxanthin We investigated whether astaxanthin and pemetrexed combination-mediated TS down-regulation was correlated with ERK1/2 inactivation in NSCLC cells. In Fig. 6A and B, enforced MKK1-CA vector expression could rescue the cellular ERK1/2
activation as well as TS mRNA and protein levels that were suppressed by astaxanthin and pemetrexed. In contrast, pretreatment with U0126 further decreased the phospho-ERK1/2 and TS mRNA and protein levels in astaxanthin and pemetrexed cotreated H1650 and H1703 cells (Fig. 6C and D). Enforced expression of the MKK1/2-CA vector could rescue H1650 and H1703 cell viability after being decreased by astaxanthin and pemetrexed (Fig. 6E and F); however, pretreatment of U0126 further decreased cell viability (Fig. 6G). In summary, as shown in Fig. 6H, the down-regulation of ERK1/2-mediated TS expression by astaxanthin enhanced the pemetrexed-induced cytotoxicity in NSCLC cells.
4. Discussion As an anti-folate drug, pemetrexed exerts its anti-cancer activity through inhibiting enzymes that are essential for synthesis of purine and pyrimidine, which are required for DNA/RNA synthesis and cell growth (Rollins and Lindley, 2005; Villela et al., 2006). Clinically, pemetrexed is approved by FDA for treatment of NSCLC and other malignant carcinoma (Argiris et al., 2013; Paz-Ares et al., 2003; Scagliotti et al., 2009). Pemetrexed inhibits multiple enzymes in the folate metabolic pathway, and TS is the main target (Shih et al., 1997). In NSCLC, high baseline TS gene expression levels conferred resistance to pemetrexed (Liu et al., 2013) and TS levels were correlated to pemetrexed efficacy in a variety of solid tumors (Gomez et al., 2006; Rose et al., 2002). In Chiu et al. study, when ERK1/2 phosphorylation is reduced by an inhibitor (U0126) or siRNA inhibition, the pemetrexed-resistant lung cancer sublines reduces their migration and invasion abilities (Chiu et al., 2016). Moreover, vinca alkaloids reduce the ERK1/2 activation and
K.-S. Liao et al. / Regulatory Toxicology and Pharmacology 81 (2016) 353e361
359
Fig. 5. Astaxanthin decreased TS mRNA and protein stability in pemetrexed-exposed NSCLC cells. (A) H1650 or H1703 cells were treated with astaxanthin (20 mM) and/or pemetrexed (10 mM) for 12 h in the presence or absence of actinomycin D (2 mg/mL) for 3, 6, or 9 h; total RNA was isolated and subjected to real-time PCR for TS mRNA expression. (B) The cells were exposed to astaxanthin (20 mM) and/or pemetrexed (10 mM) for 12 h followed by co-treatment with cycloheximide (CHX; 0.1 mg/mL) for 4, 8, or 12 h. Whole-cell extracts were collected for Western blot analysis. (C) H1650 or H1703 cells (5 105) were transfected with MKK1-CA. After incubation for 24 h, the cells were exposed to astaxanthin (20 mM) and pemetrexed (10 mM) or DMSO for 12 h in the presence or absence of actinomycin D (2 mg/mL) for 3, 6, or 9 h; total RNA was isolated and subjected to realtime PCR for TS mRNA expression. (D) After cells were transfected with MKK1-CA as above, the cells were exposed to astaxanthin (20 mM) and pemetrexed (10 mM) for 12 h followed by co-treatment with cycloheximide (CHX; 0.1 mg/mL) for 4, 8, or 12 h. Whole-cell extracts were collected for Western blot analysis.
360
K.-S. Liao et al. / Regulatory Toxicology and Pharmacology 81 (2016) 353e361
Fig. 6. Overexpression of MKK1-CA restored the suppressed TS protein expression and cell survival in astaxanthin and pemetrexed-exposed H1650 and H1703 cells. (A) MKK1-CA (5 mg) or pcDNA3 (5 mg) expression plasmids were transfected into cells using lipofectamine. After expression for 24 h, the cells were treated with astaxanthin and pemetrexed for an additional 24 h, and total RNA was isolated and subjected to real-time PCR for TS mRNA expression. The means ± standard deviation (SD) from four independent experiments. ** denotes p < 0.01, respectively, using Student's t-test to compare cells treated with astaxanthin and pemetrexed in MKK1-CA vs. pcDNA3-transfected cells. (B) After treatment as the above, whole-cell extracts were collected for Western blot analysis. (C) H1650 or H1703 cells were pretreated with U0126 (2.5 mM) for 1 h and then co-treated with astaxanthin (10 mM) and pemetrexed (10 mM) for 24 h. Total RNA was isolated and subjected to real-time PCR for TS mRNA expression. (D) After treatment as the above, the whole-cell extracts were collected for Western blot analysis. (E and F) After pcDNA3 control vector (5 mg), MKK1-CA (5 mg) or MKK2-CA (1, 3, 5 mg) expression plasmids transfection, cells were treated with astaxanthin (20 mM) and pemetrexed (5 mM) for 24 h. Cytotoxicity was determined by assessment with the MTS assay. **p < 0.01, *p < 0.05 by Student's t-test to compare cells treated with astaxanthin and pemetrexed in MKK1/2-CA vs. pcDNA3-transfected H1650 or H1703 cells. (G) H1650 or H1703 cells were pretreated with U0126 (5 mM) for 1 h and then co-treated with astaxanthin (5 mM) and pemetrexed (5 mM) for 24 h. Cytotoxicity was determined by the MTS assay. **p < 0.01 using Student's t-test for comparison between the cells pretreated with or without U0126 in astaxanthin and pemetrexed-exposed cells. (H) A signaling pathway that is regulated by astaxanthin in pemetrexed-exposed lung cancer cells is proposed.
overcome pemetrexed resistance in NSCLC (Chiu et al., 2016). Our study results showed that down-regulation of MKK1/2-ERK1/2mediated TS expression by astaxanthin could enhance the pemetrexedeinduced cell death and growth inhibition effect. Continently with previous study, pemetrexed induced an EGFRmediated activation of the phosphatidylinositol 3-kinase/AKT and ERK pathway, which was inhibited by EGFR-tyrosine kinase inhibitor gefitinib. Moreover, pemetrexed combined with gefitinib has a significantly synergistic effect on colorectal cancer cells (Zhang et al., 2013). In the Tong et al. study, pemetrexed activated MKK1/2-ERK1/2 signaling in HepG2 cells, which was required for autophagy induction. Pharmacological inhibition of MEK/ERK activation attenuated pemetrexed-induced autophagy, enhanced HepG2 cell death and apoptosis (Tong et al., 2015). In Nagaraju et al. study, heat shock protein 90 (HSP90) inhibition downregulates TS expression and ERK1/2 activation and sensitizes colorectal cancer cell lines to 5-FU (a nucleotide analogue)-based chemotherapy (Nagaraju et al., 2014). We found enhanced NSCLC cells sensitivity to pemetrexed in astaxanthin-treated cells as a result of MKK1/2-ERK1/2 mediated TS decrease. Moreover, PKCb inhibitor
enzastaurin significantly reduced pemetrexed-induced upregulation of TS expression, and enzastaurin-pemetrexed combination was synergistic and significantly increased apoptosis in SW1573 and A549 cells (Tekle et al., 2008). Astaxanthin is a red carotenoid pigment having powerful antioxidant activity and found in marine world of algae and aquatic animals (Lai et al., 2004). In the Chew et al. study, astaxanthin treatment inhibits the progression of mammary tumor in mice (Chew et al., 1999). Furthermore, Kurihara et al. reported that astaxanthin treatment inhibits the promotion of cancer metastasis in mice (Kurihara et al., 2002). Previous study demonstrate that astaxanthin inhibits the development of hamster buccal pouch (HBP) carcinogenesis carcinomas by inducing intrinsic apoptosis via coordinate inaction of both the ERK1/2 and AKT signals (Kavitha et al., 2013). Our study results showed that phospho-MKK1/2 and phospho-ERK1/2 were significantly decreased in H1650 and H1703 cells in a dose and time-dependent manner after astaxanthin treatment. Inactivation of ERK1/2 by MKK1/2 inhibitors augmented the astaxanthin-induced cytotoxicity in H1650 and H1703 cells. In contrast, enhancement of ERK1/2 activity could
K.-S. Liao et al. / Regulatory Toxicology and Pharmacology 81 (2016) 353e361
restore the cell viability decreased by astaxanthin. Therefore, astaxanthin induced cytotoxic effects in human lung cancer cells lines via MKK1/2-ERK1/2 inactivation. In addition, combined treatment with astaxanthin and pemetrexed could down-regulate the expressions of TS, and subsequently result in synergistic cytotoxic effects in NSCLC cells. This study provides new insight into the mechanism of astaxanthin in down-regulating the expression of TS to enhance the cytotoxic effect of pemetrexed in NSCLC cells. In summary, we extend the current knowledge by highlighting the role of TS in the pemetrexed chemotherapy sensitivity of lung cancer. In this study, combined treatment with astaxanthin significantly decreased the expression of TS, thereby enhancing the pemetrexed-induced cytotoxic effect on NSCLC cells. Taken together, these results may provide for the rational design of future drug regimens incorporating astaxanthin and pemetrexed for the treatment of NSCLC. Moreover, whether astaxanthin would relieve pemetrexed resistance in pemetrexed resistance human lung cancer sublines was under our next investigation. Although further study is required to evaluate the effect of astaxanthin, pemetrexed, and their combination in vivo, the concept of pemetrexed combined with astaxanthin seems to present a strategy for the treatment of NSCLC. Conflict of interest None declared. Acknowledgements This study was funded by grants from the Ministry of Science and Technology, Taiwan, Grant MOST 104-2314-B-415-002 and MOST 105-2314-B-002-112 (Y-W. Lin) and Ditmanson Medical Foundation Chia-Yi Christian Hospital Research Program R105-016. Transparency document Transparency document related to this article can be found online at http://dx.doi.org/10.1016/j.yrtph.2016.09.031. References Argiris, A., et al., 2013. Pemetrexed in head and neck cancer: a systematic review. Oral Oncol. 49, 492e501. Bepler, G., et al., 2008. Clinical efficacy and predictive molecular markers of neoadjuvant gemcitabine and pemetrexed in resectable non-small cell lung cancer. J. Thorac. Oncol. 3, 1112e1118. Chew, B.P., et al., 1999. A comparison of the anticancer activities of dietary betacarotene, canthaxanthin and astaxanthin in mice in vivo. Anticancer Res. 19, 1849e1853. Chiu, L.Y., et al., 2016. The ERK-ZEB1 pathway mediates epithelial-mesenchymal transition in pemetrexed resistant lung cancer cells with suppression by vinca alkaloids. Oncogene. http://dx.doi.org/10.1038/onc.2016.195. Ciuleanu, T., et al., 2009. Maintenance pemetrexed plus best supportive care versus placebo plus best supportive care for non-small-cell lung cancer: a randomised, double-blind, phase 3 study. Lancet 374, 1432e1440. Edler, D., et al., 2000. Immunohistochemically detected thymidylate synthase in colorectal cancer: an independent prognostic factor of survival. Clin. Cancer Res. 6, 488e492. Ferlay, J., et al., 2010. Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int. J. Cancer 127, 2893e2917. Gomez, H.L., et al., 2006. A phase II trial of pemetrexed in advanced breast cancer: clinical response and association with molecular target expression. Clin. Cancer Res. 12, 832e838. Goto, S., et al., 2001. Efficient radical trapping at the surface and inside the phospholipid membrane is responsible for highly potent antiperoxidative activity of the carotenoid astaxanthin. Biochim. Biophys. Acta 1512, 251e258. Hanna, N.H., 2004. Second-line chemotherapy for non-small-cell lung cancer: recent data with pemetrexed. Clin. Lung Cancer 5 (Suppl. 2), S75eS79. Harpole Jr., D.H., et al., 2001. The prognostic value of molecular marker analysis in patients treated with trimodality therapy for esophageal cancer. Clin. Cancer Res. 7, 562e569.
361
Higuera-Ciapara, I., et al., 2006. Astaxanthin: a review of its chemistry and applications. Crit. Rev. Food Sci. Nutr. 46, 185e196. Huang, C., et al., 2005. Clinical application of biological markers for treatments of resectable non-small-cell lung cancers. Br. J. Cancer 92, 1231e1239. Joerger, M., et al., 2010. The role of pemetrexed in advanced non small-cell lung cancer: special focus on pharmacology and mechanism of action. Curr. Drug Targets 11, 37e47. Kavitha, K., et al., 2013. Astaxanthin inhibits NF-kappaB and Wnt/beta-catenin signaling pathways via inactivation of Erk/MAPK and PI3K/Akt to induce intrinsic apoptosis in a hamster model of oral cancer. Biochim. Biophys. Acta 1830, 4433e4444. Ko, J.C., et al., 2016. Astaxanthin down-regulates Rad51 expression via inactivation of AKT kinase to enhance mitomycin C-induced cytotoxicity in human nonsmall cell lung cancer cells. Biochem. Pharmacol. 105, 91e100. Ko, J.C., et al., 2009. Roles of MKK1/2-ERK1/2 and phosphoinositide 3-kinase-AKT signaling pathways in erlotinib-induced Rad51 suppression and cytotoxicity in human non-small cell lung cancer cells. Mol. Cancer Res. 7, 1378e1389. Ko, J.C., et al., 2011. Up-regulation of extracellular signal-regulated kinase 1/2dependent thymidylate synthase and thymidine phosphorylase contributes to Cisplatin resistance in human non-small-cell lung cancer cells. J. Pharmacol. Exp. Ther. 338, 184e194. Kurihara, H., et al., 2002. Contribution of the antioxidative property of astaxanthin to its protective effect on the promotion of cancer metastasis in mice treated with restraint stress. Life Sci. 70, 2509e2520. Lai, J.P., et al., 2004. Separation and determination of astaxanthin from microalgal and yeast samples by molecularly imprinted microspheres. J. Chromatogr. B Anal. Technol. Biomed. Life Sci. 804, 25e30. Lee, D.H., et al., 2010. Neuroprotective effects of astaxanthin in oxygen-glucose deprivation in SH-SY5Y cells and global cerebral Ischemia in rat. J. Clin. Biochem. Nutr. 47, 121e129. Liu, Y., et al., 2013. Expression of thymidylate synthase predicts clinical outcomes of pemetrexed-containing chemotherapy for non-small-cell lung cancer: a systemic review and meta-analysis. Cancer Chemother. Pharmacol. 72, 1125e1132. Lordan, S., et al., 2008. Effects of apigenin, lycopene and astaxanthin on 7 betahydroxycholesterol-induced apoptosis and Akt phosphorylation in U937 cells. Br. J. Nutr. 100, 287e296. Marin, D.P., et al., 2011. ROS production in neutrophils from alloxan-induced diabetic rats treated in vivo with astaxanthin. Int. Immunopharmacol. 11, 103e109. Nagaraju, G.P., et al., 2014. HSP90 inhibition downregulates thymidylate synthase and sensitizes colorectal cancer cell lines to the effect of 5FU-based chemotherapy. Oncotarget 5, 9980e9991. Nagendraprabhu, P., Sudhandiran, G., 2011. Astaxanthin inhibits tumor invasion by decreasing extracellular matrix production and induces apoptosis in experimental rat colon carcinogenesis by modulating the expressions of ERK-2, NFkB and COX-2. Investig. New Drugs 29, 207e224. Nakao, R., et al., 2010. Effect of dietary astaxanthin at different stages of mammary tumor initiation in BALB/c mice. Anticancer Res. 30, 2171e2175. Paz-Ares, L., et al., 2003. Review of a promising new agentepemetrexed disodium. Cancer 97, 2056e2063. Peters, G.J., et al., 2000. Basis for effective combination cancer chemotherapy with antimetabolites. Pharmacol. Ther. 87, 227e253. Pfister, D.G., et al., 2004. American Society of Clinical Oncology treatment of unresectable non-small-cell lung cancer guideline: update 2003. J. Clin. Oncol. 22, 330e353. Rollins, K.D., Lindley, C., 2005. Pemetrexed: a multitargeted antifolate. Clin. Ther. 27, 1343e1382. Rose, M.G., et al., 2002. Thymidylate synthase: a critical target for cancer chemotherapy. Clin. Colorectal Cancer 1, 220e229. Scagliotti, G., et al., 2009. The differential efficacy of pemetrexed according to NSCLC histology: a review of two Phase III studies. Oncologist 14, 253e263. Shih, C., et al., 1997. LY231514, a pyrrolo[2,3-d]pyrimidine-based antifolate that inhibits multiple folate-requiring enzymes. Cancer Res. 57, 1116e1123. Shimokawa, H., et al., 2011. TS expression predicts postoperative recurrence in adenocarcinoma of the lung. Lung Cancer 72, 360e364. Song, X., et al., 2012. Changes in cell ultrastructure and inhibition of JAK1/STAT3 signaling pathway in CBRH-7919 cells with astaxanthin. Toxicol. Mech. Methods 22, 679e686. Tekle, C., et al., 2008. Molecular pathways involved in the synergistic interaction of the PKC beta inhibitor enzastaurin with the antifolate pemetrexed in non-small cell lung cancer cells. Br. J. Cancer 99, 750e759. Tong, Y., et al., 2015. Inhibition of MEK/ERK activation attenuates autophagy and potentiates pemetrexed-induced activity against HepG2 hepatocellular carcinoma cells. Biochem. Biophys. Res. Commun. 456, 86e91. Tonkinson, J.L., et al., 1997. Cell cycle effects of antifolate antimetabolites: implications for cytotoxicity and cytostasis. Cancer Chemother. Pharmacol. 39, 521e531. Torre, L.A., et al., 2015. Global cancer statistics, 2012. CA Cancer J. Clin. 65, 87e108. Villela, L.R., et al., 2006. Pemetrexed, a novel antifolate therapeutic alternative for cancer chemotherapy. Pharmacotherapy 26, 641e654. Yeh, K.H., et al., 1998. High expression of thymidylate synthase is associated with the drug resistance of gastric carcinoma to high dose 5-fluorouracil-based systemic chemotherapy. Cancer 82, 1626e1631. Zhang, G., et al., 2013. Effects of pemetrexed, gefitinib, and their combination on human colorectal cancer cells. Cancer Chemother. Pharmacol. 72, 767e775.