Astrocyte-derived CCL2 participates in surgery-induced cognitive dysfunction and neuroinflammation via evoking microglia activation

Behavioural Brain Research 332 (2017) 145–153

Contents lists available at ScienceDirect

Behavioural Brain Research journal homepage: www.elsevier.com/locate/bbr

Astrocyte-derived CCL2 participates in surgery-induced cognitive dysfunction and neuroinflammation via evoking microglia activation

MARK

⁎

Jiawen Xu1, Hongquan Dong1, Qingqing Qian, Xiang Zhang, Yiwei Wang, Wenjie Jin , ⁎ Yanning Qian Department of Anesthesiology, The First Affiliated Hospital of Nanjing Medical University, Nanjing 210002, PR China

A R T I C L E I N F O

A B S T R A C T

Keywords: Postoperative cognitive dysfunction Neuroinflammation CCL2 CCR2 Astrocytes Microglia

Neuroinflammation induced by peripheral trauma plays a key role in the development of postoperative cognitive dysfunction (POCD). Substantial evidence points to reactive glia as a pivotal factor during the inflammation process. However, little is known about the functional interactions between astrocytes and microglia. Recent evidence suggests the involvement of the CCL2-CCR2 pathway in CNS inflammation-related diseases. Our previous studies have suggested that astrocyte-derived CCL2 can induce microglial activation in vitro. Within this context, we sought to determine if the CCL2/CCR2 axis is involved in the crosstalk between astrocytes and microglia, contributing to increased neuroinflammation. Here, we show that tibial fracture surgery promoted CCL2 upregulation in activated astrocytes, increased CCR2 expression in activated microglia, and induced deficits in learning and memory. Site-directed pre-injection of RS504393, a CCR2 antagonist, inhibited this effect by reducing microglial activation, M1 polarization, inflammatory cytokines, and neuronal injury and death and improving cognitive function. Taken together, these data implicate CCL2-CCR2 signaling in astrocyte-mediated microglial activation in central nervous system (CNS) inflammation and suggest that interference with CCL2 signaling could constitute another potential therapeutic target for POCD.

1. Introduction Postoperative cognitive dysfunction (POCD) refers to an objectively measured decrease in cognition after surgery, a common postoperative complication associated with significant morbidity and even mortality, especially among elderly patients [1]. Although the etiology of POCD has remained elusive, highly compelling evidence has demonstrated that neuroinflammation, characterized by persistent activation of innate immune responses, is a prominent contributor to the development of POCD [2]. Current research points to reactive glia as the key players in neuroinflammatory responses. Microglia, first described as brain-resident phagocytes of the central nervous system (CNS), has a pivotal role in immune surveillance [3]. When subjected to abnormal stimulation, microglia cells execute inflammatory feedback via polarizing from M2 to M1 activation states. Astrocytes, another important glial cell type, have been considered as inert scaffold or housekeeping cells for many years. However, it has become clear that this cell population actively

modulates the immune response in the CNS and responds to pathological changes with hypertrophy and hyperplasia [4]. Once activated, these glial cells can secrete large amounts of cytokines, chemokines, reactive oxygen species, and pro-inflammatory mediators, affecting the cellular state of surrounding cells such as neurons and other glial cells, which initiates a vicious cycle and finally leads to an exaggerated and uncontrolled inflammatory response [5]. Our previous studies have confirmed that both astrocytes and microglia are activated in the hippocampi of rats exhibiting cognitive impairment one day following surgery [6,7]. However, the functional aspects of astrocyte-microglia interactions remain poorly understood. Chemokines (chemotactic cytokines) are small secreted proteins that attract and activate immune and non-immune cells in vitro and in vivo. Accumulating evidence has highlighted a crucial role for chemokines and their receptors in the CNS [8]. Chemokine CeC motif ligand 2 (CCL2), also known as monocyte chemoattractant protein 1 (MCP-1), is a member of the CC subtype chemokine family and signals through its cognate receptor chemokine receptor type 2 (CCR2) [9].

Abbreviations: POCD, postoperative cognitive dysfunction; CNS, central nervous system; CCL2, chemokine C-C motif ligand 2; MCP-1, monocyte chemoattractant protein 1; CCR2, chemokine receptor type 2; EAE, experimental autoimmune encephalomyelitis; ICV, intracerebroventricular injection; GFAP, glial fibrillary acidic protein; GAPDH, glyceraldehyde 3phosphate dehydrogenase; AD, Alzheimer’s disease; TBI, traumatic brain injury; BMeCs, brain microvascular endothelial cells; BBB, blood-brain barrier ⁎ Corresponding author at: Department of Anesthesiology, The First Affiliated Hospital of Nanjing Medical University, 300 Guangzhou Road, Nanjing, Jiangsu, 210029, PR China. E-mail addresses: [email protected] (W. Jin), [email protected] (Y. Qian). 1 Both authors contributed equally to this work. http://dx.doi.org/10.1016/j.bbr.2017.05.066 Received 13 March 2017; Received in revised form 15 May 2017; Accepted 30 May 2017 Available online 03 June 2017 0166-4328/ © 2017 Elsevier B.V. All rights reserved.

Behavioural Brain Research 332 (2017) 145–153

J. Xu et al.

The expression of CCL2 is elevated in various diseases characterized by acute and chronic inflammation. In particular, it has been documented that selective pharmacological interference with CCL2 signaling causes a potent suppression of the inflammatory response [10,11]. Given that astrocytes are recognized as the main source of CCL2 and the expression of CCR2 is observed in microglia [12], the CCL2-CCR2 pathway is likely to be involved in CNS pathologies via interactions between astrocytes and microglia. Indeed, Sheehan and colleagues revealed that microglial activation/migration induced by excitotoxic injury is attenuated in CCL2−/− mice [13]. Consistent with the result above, Kim et al. demonstrated that CCL2 deletion from astrocytes resulted in the reduced activation of microglia during experimental autoimmune encephalomyelitis (EAE). Based on these findings, we hypothesized that CCL2-CCR2 signaling may participate in astrocyte-mediated microglial activation, which promotes neuroinflammation and thereby impacts cognitive dysfunction. In the present study, we used a tibial fracture surgical model in adult rats to investigate the role of CCL2-CCR2 signaling on the occurrence of POCD and further clarify astrocyte-microglial interactions involved in the inflamed CNS.

RS504393 (RS504393 group); (C) tibial fracture surgery following i.c.v. injection of vehicle (Sur group); and (D) tibial fracture surgery following i.c.v. injection of RS504393 (RS504393 + Sur group). Rats in the RS504393 group and RS504393 + Sur group received 2 μl of 5 μg/ μl RS504393 i.c.v. 30 min before surgery, while the others received an equivalent volume of vehicle (saline containing 10% DMSO). Animals were sacrificed after behavior tests on postoperative day 1. The open tibial fracture surgery was conducted as previously described [6,14,15]. In brief, rats were anesthetized with isoflurane (2.1% inspired concentration in 0.4 FiO2), and analgesia (0.1 mg/kg buprenorphine) was given subcutaneously. Under aseptic conditions, the left hind limb of operated animals was shaved and disinfected with povidone iodine. Following a middle incision performed on the left hind paw, a 20-G pin was inserted into the intramedullary canal. The periosteum was stripped, and osteotomy was performed. Finally, the skin was sutured with 8/0 Prolene sutures after wound irrigation. During the surgery process, temperature was monitored and maintained at 37 ± 0.5 °C with a heating pad.

2. Materials and methods

2.4.1. Contextual fear conditioning Contextual fear conditioning was performed to assess hippocampaldependent learning and memory in rodents as previously described [16,17]. Rats were trained to associate an environment (context) with a conditional stimulus (tone) and an unconditional stimulus (foot shock). The contextual memory of the learned fear was assessed 1 day after surgery. Freezing behavior, which is defined as the absence of all movement except for respiration, was automatically recorded for 300 s by video tracking software (Xeye Fcs, Beijing MacroAmbition S & T Development Co., Ltd., Beijing, China). A decrease in the percentage of time spent freezing reflects memory impairment. The evaluation was conducted by investigators blinded to the treatments and groups.

2.4. Behavioral tests

2.1. Animals Adult Sprague-Dawley rats (male, 200–250 g) were purchased from Jinling Hospital of Nanjing University and used in this study (n = 48). All rats were housed in groups of five per cage and maintained on a 12:12 h light/dark cycle under conditions of 23 ± 1 °C with access to food and water ad libitum. This study was conducted with the approval of the Nanjing Medical University Animal Care and Use Committee. Study design is summarized in Fig. 1. 2.2. Intracerebroventricular cannula implantation

2.4.2. Y maze The Y maze test was used as another assessment of short-term spatial working memory in rodents. According to a protocol we used previously [6,14,18], nine correct responses in 10 consecutive foot stimulations was defined as the learning criterion. The total number of stimulations to reach the criterion during training was recorded as learning ability. All rats reached the learning criterion in the present study. The assessments were performed in a blinded fashion.

For the intracerebroventricular (i.c.v.) administration of drugs, cannula implantation was conducted in the rats as previously described [6,14]. Briefly, the rats were placed in the stereotaxic apparatus (Stoelting Instruments, USA) after anesthesia. A 21-gauge stainless steel guide cannula was implanted into the right lateral ventricle using the following coordinates: 0.8 mm posterior, 1.5 mm right lateral, and 3.7 mm ventral to the bregma, and the skull was fixed by stainless steel screws with dental cement. The animals were allowed to recover for one week before use. Animals with broken guide cannulas were eliminated from the study. At the time of drug administration, using a 29-gauge injection cannula attached to a microsyringe pump, reagents were injected into the right lateral ventricle. The needle was held in this position for 5 min after injection and then retrieved slowly from the brain.

2.5. Immunofluorescence After the behavioral tests, the animals were deeply anesthetized with isoflurane and perfused transcardially with 0.9% saline followed by 4% paraformaldehyde (0.1 M phosphate buffer, pH 7.4). Brains were harvested and maintained in 4% paraformaldehyde overnight. Brains were cut into 10 μm thick sections, and free floating sections were pretreated with 3% H2O2 for 10 min. Sections were incubated with primary antibodies at 4 °C overnight and incubated with secondary antibody for 2 h. Primary antibodies used in this study were as follows: anti-CCL2 antibody (1:200, Millipore), anti-glial fibrillary acidic

2.3. Surgery and drug administration All rats were randomly assigned to four groups (n = 12) as follows: (A) i.c.v. injection of vehicle (Con group); (B) i.c.v. injection of

Fig. 1. Study design. Experiment: All rats received i.c.v. cannula implantation 7 days before their experimental use. One day after contextual fear conditioning training, all animals were divided into four groups and received RS504393 or vehicle, where applicable. A subset of rats received tibial fracture surgery. Behavior tests (contextual assessment and Y maze test) were conducted for all rats 1 day after surgery. Brains were collected after behavior tests; Drug treatment: among the four groups, the RS504393 group and the RS504393 + Sur group received RS504393 i.c.v. 30 min before surgery, while the others received an equivalent volume of saline containing 10% DMSO.

146

Behavioural Brain Research 332 (2017) 145–153

J. Xu et al.

protein (GFAP) antibody (1:300, CST), anti-CCR2 antibody (1:50, Santa Cruz), and anti-Iba1 antibody (1:200, Wako). The hippocampus was analyzed and imaged by laser confocal microscopy (Carl Zeiss LSM710, Germany). Quantification was performed using the Leica LCS software by placing a rectangular region of interest (ROI) across the full image and within the ROI, for every image, mean fluorescence intensity (MFI) was measured and the values were plotted.

bands on the membranes were detected with an ECL kit (Thermo Fisher Scientific, Rockford, IL, USA). The relative density of the protein bands was obtained by densitometry using Image Lab software (Bio-Rad, Richmond, CA, USA) and quantified using NIH ImageJ software (Bethesda, MD, USA)

2.6. Immunohistochemistry

Total RNA from the hippocampus was extracted with Trizol reagent (Invitrogen, USA) and reverse transcription was performed with the Transcription First Strand cDNA Synthesis Kit (Roche, Switzerland) according to the manufacturer’s instructions using 1 μg of total RNA for each sample. Real-time PCR amplification was performed using an ABI7500 Real-time PCR Detection System (Foster City, CA) with SYBR Green master mix (Applied Biosystems, USA) at a final volume of 10 μl containing 1 μl of cDNA template from each sample. Primers were as follows: TNF-α forward, AGTGCGGGACCCATCAGGCA; TNF-α reverse, GCAGTGTTGGGG GCACGGTT; IL-1β forward, ACTATGGCAAC TGTCCCTGAAC; IL-1β reverse, GTGCTTGGGTCCTCATCCTG; CD86 forward, GACACCCACGGGATCAATTA; CD86 reverse, AGGTTTCGGGTATCCTTGCT; IL-10 forward, CACTGCTATG TTGCCTGCTC; IL-10 reverse, AACCCAAGTAACCCTTAAAGTCC; Arginase1 forward, CTGCATATCTGCCAAGGACA; Arginase1 reverse, CCAGCAGGTAGCTGAAGGTC; CD206 forward, TGTGAGCAAC CACTGGGTTA; CD206 reverse, GTGCATGTTTGGTTTGCATC; GAPDH forward, GGGTGTGAACCACGAGAAAT; GAPDH reverse, CCACAGTCTTCTGAGTGGCA. Samples were subjected to 40 cycles of amplification at 95 °C for 5 s and 60 °C for 30 s, after holding at 95 °C for 30s. Relative expression was calculated using the 2-(Ctexperimentalsample−Ctinternalcontrolsample(GAPDH)) method.

2.9. Real-time PCR

Immunohistochemical staining was conducted as previously described [14]. Briefly, after deparaffinization and dehydration, tissue sections were incubated with anti-caspase-3 antibody (1:100, CST) or anti-Tau antibody (1:500, abcam) at 4 °C overnight. Following PBS wash, sections were incubated with secondary antibody for 2 h. Immunostaining was visualized by adding 3, 3-diaminobenzidine (DAB) to the sections. Sections were then counterstained with hematoxylin. For quantification, 15 photographs from the CA1 area of three hippocampus sections from each animal were captured using Leika 2500 (Leica Microsystems, Wetzlar, Germany) at ×200 magnification. The number of positive cells per photograph (0.74-mm2 frame) was obtained by using NIH Image J software (Bethesda, MD, USA), averaged, and converted to cells per square millimeter. Positive cell counting was performed in a blinded fashion by an experimenter that was unaware of the sample identity. 2.7. ELISA The levels of pro-inflammatory factors tumor necrosis factor (TNF)α and interleukin (IL)-1β in rat hippocampus tissue extracts were detected by using ELISA kits (R & D systems, USA), according to the manufacturer’s instructions. Briefly, 50 μl assay diluent were added to each well. This was followed by adding 50 μl of standard, control, or sample to each well. Then plates were incubated at room temperature for 2 h. After five washes with wash buffer, 100 μl of conjugate were added for 2 h. Following five washes with wash buffer, 100 μl of substrate solution were added to each well and incubated at room temperature until color develops. Colorimetric reactions were stopped by adding 100 μl of stop solution. ELISA data acquisition was performed using VersaMax Tunable MicroPlate Reader (Molecular Devices, Sunnyvale, CA) at 450 nm.

2.10. Statistical analysis All values are expressed as the mean ± S.E.M. Statistical analysis was carried out with GraphPad Prism 5 software (version 5.01, GraphPad Software, San Diego, CA). Data were analyzed with one-way ANOVA followed by Newman-Keuls post hoc testing where appropriate. Statistical significance was accepted at P < 0.05. 3. Results 3.1. A CCR2 antagonist alleviated cognitive decline induced by surgery

2.8. Western blot analysis To determine whether CCL2-CCR2 signaling was responsible for surgery-induced cognitive impairment, rats were injected with the CCR2 antagonist RS504393 30 min prior to tibial fracture surgery. One day after the surgery, we conducted contextual assessment and the Y maze test to observe the cognitive function of the rats. As shown in Fig. 2A and B, intracerebroventricular injection of RS504393 alone did not alter freezing time or number of learning trials. However, tibial fracture surgery significantly impaired spatial working memory as indicated by decreased freezing time (p < 0.01) and increased number of learning trials (p < 0.01) on postoperative day 1. Interestingly, pretreatment with RS504393 greatly improved cognitive function on day 1 (freezing time: p < 0.01, number of learning trials: p < 0.01, Fig. 2A and B). This phenomenon may reflect the involvement of CCL2CCR2 signaling in surgery-induced cognitive decline.

For Western blot analyses, hippocampal tissues were homogenized in RIPA lysis buffer (Biyuntian, Shanghai, China), which contained 50 mM Tris (pH 7.4), 150 mM NaCl, 1% Triton X-100, 1% sodium deoxycholate, 0.1% sodium dodecyl sulfate (SDS), sodium orthovanadate, sodium fluoride, EDTA, leupeptin, etc. The homogenates were centrifuged at 12,000g for 20 min (4 °C), and the supernatants were harvested as cytosolic fractions for immunoblotting. The protein content was determined by a BCA protein assay kit (Biouniquer Technology Co., Ltd., China). Proteins (50 μg) were denatured with sodium dodecyl sulfate (SDS) sample buffer and separated by 10% SDS–polyacrylamide gel electrophoresis (PAGE). This was followed by transferring proteins onto PVDF membranes (Millipore, Bedford, MA). The membranes were blocked with 5% milk dissolved in TBST (pH 7.4, 10 mM Tris-HCl, 150 mM NaCl, and 0.1% Tween 20) at room temperature for 2 h. Bands were incubated with primary antibody overnight at 4 °C. The following primary antibodies were used: anti-CCL2 antibody (1:500, Millipore), anti-glial fibrillary acidic protein (GFAP) antibody (1:1000, CST), antiIba1 antibody (1:1000, abcam), anti-PSD95 antibody (1:1000, abcam), and anti-Tau antibody (1:5000, abcam). An antibody against GAPDH (1:1000) was also included as an internal loading control. Following TBST washing, bands were incubated with the corresponding secondary antibody (1:5000) for 1 h at the room temperature, then the protein

3.2. Surgery induced upregulated CCL2 expression in activated astrocytes in the hippocampus To further evaluate the contribution of CCL2-CCR2 signaling to the occurrence of POCD, we performed immunofluorescence staining of brain sections from experimental and corresponding control rats using an anti-CCL2 antibody. The CCL2 immunoreactive area in the hippocampal CA1 region significantly increased in 1-day surgery-exposed 147

Behavioural Brain Research 332 (2017) 145–153

J. Xu et al.

Fig. 2. Amelioration of surgery-induced cognitive decline by a CCR2 antagonist. (A) Contextual fear response, as measured by freezing behavior, was determined in the rats. (B) The Y maze test was performed after contextual assessment in the rats. The data are presented as the mean ± S.E.M. (n = 12). **p < 0.01 versus the control group. ## p < 0.01 versus the surgery group.

Fig. 3. Surgery induced upregulated CCL2 expression in activated astrocytes in the hippocampus (A) Immunofluorescence of astrocytic marker GFAP and CCL2 in the hippocampus. Dual labeling (yellow) showed GFAP (green) co-localized with CCL2 (red), demonstrating the close relationship between GFAP and CCL2. The blue staining represents DAPI. Scale bar = 50 μm. (B)Graph showing the mean fluorescence intensity (MFI) for GFAP and CCL2 (n = 4). (C) The expression levels of GFAP and CCL2 were detected via Western blotting using specific antibodies. Each blot is representative of three experiments. (D) Levels of GFAP and CCL2 were quantified and normalized to GAPDH levels. Each value was then expressed relative to the control, which was set to 1 (n = 3). The data are presented as the mean ± S.E.M. **p < 0.01 versus the control group. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

3.3. Surgery induced increased CCR2 expression in activated microglia in hippocampus, and a CCR2 antagonist reversed this effect

rats compared to the control group (Fig. 3A and B). Moreover, as astrocytes are recognized as the main source of CCL2 in the CNS [19], anti-GFAP antibody was used to concurrently evaluate the activation level of astrocytes. Immunofluorescence double staining indicated that nearly all cells showing increased GFAP staining in the hippocampus after surgery coexpressed CCL2 (Fig. 3A). The elevated expression of both GFAP and CCL2 induced by surgery was further validated by Western blotting (GFAP, Sur group versus Con group: p < 0.01; CCL2, Sur group versus Con group: p < 0.01) (Fig. 3C and D).

Given the dramatic increase of astrocyte CCL2 expression in response to tibial fracture surgery, we next examined the expression of downstream signaling partners of CCL2. Similarly, CCR2 expression in the hippocampus was greatly enhanced at 1 day after surgery (Fig. 4A and B). In addition, immunofluorescence localization of CCR2 was found predominantly in Iba-1 positive microglia. These were activated microglia, exhibiting amoeboid shapes with enlarged cell bodies. Notably, the pre-operative administration of a CCR2 antagonist inhibited 148

Behavioural Brain Research 332 (2017) 145–153

J. Xu et al.

Fig. 4. Effects of the pre-operative administration of CCR2 antagonist on microgliosis after tibial surgery (A) Immunofluorescence of microglial marker Iba1 and CCR2 in the hippocampus. Dual labeling (yellow) showed that Iba1 (red) co-localized with CCR2 (green), demonstrating the close relationship between Iba1 and CCR2. The bue staining represents DAPI. Scale bar = 50 μm. (B) Graph showing the mean fluorescence intensity (MFI) for Iba-1(n = 4). (C and D) Levels of Iba1 detected by Western blotting, quantified and normalized to GAPDH levels. Values are expressed relative to the control, which was set to 1(n = 3). The data are presented as the mean ± S.E.M. *p < 0.05, **p < 0.01 versus the control group. # p < 0.05, ##p < 0.01 versus the surgery group. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

again be prevented by pretreatment with a CCR2 antagonist (Fig. 5A–C). In contrast, surgery had no effect on the expression of M2 markers (Arginase1 and CD206). However, the expression of IL-10 (an M2 marker) was increased, and pretreatment with CCR2 antagonist decreased IL-10 expression (Fig. 5D–F). Our results indicated that CCR2 antagonist could suppress the M1 polarization of microglia in the hippocampus induced by surgery.

the expression of Iba1 protein in microglia. These immunofluorescence findings were confirmed by Western blot (Fig. 4C and D). One day following surgery, hippocampal levels of Iba1 protein sharply increased in the Sur group compared to controls. This effect was partly abolished by treatment with RS504393 30 min prior to surgery. 3.4. A CCR2 antagonist inhibited surgery-associated increases in M1 markers in microglia

3.5. A CCR2 antagonist inhibited surgery-induced hippocampal TNF-α and IL-1β expression

To observe the effects of pretreatment with a CCR2 antagonist on surgery-induced phenotype changes of microglia in the hippocampus, the phenotypic markers of microglia in the hippocampus at 1 day were assessed by qRT-PCR. Surgery led to the increased expression of M1 markers (TNF-α，IL-1β and CD86). Furthermore, the effect could once

To further investigate the impact of the CCR2 antagonist on neuroinflammation caused by surgery in the hippocampus, the levels of pro-inflammatory factors TNF-α and IL-1β were detected by ELISA. At 149

Behavioural Brain Research 332 (2017) 145–153

J. Xu et al.

Fig. 5. A CCR2 antagonist inhibited surgery-associated increases of M1 markers in microglia. The expression of M1 markers (TNF-α (A), IL-1β (B), and CD86 (C)) and M2 markers (IL-10 (D), Arginase1 (E), and CD206 (F)) were examined by quantitative RT-PCR. The data are presented as the mean ± S.E.M. (n = 6). *p < 0.05, **p < 0.01 versus the control group. ## p < 0.01 versus the surgery group. Fig. 6. A CCR2 antagonist inhibited surgery-induced hippocampal TNF-α and IL-1β expression induced by surgery. TNF-α (A) and IL-1β (B) protein expression levels in the hippocampus were determined by ELISA. The data are presented as the mean ± S.E.M. (n = 6). **p < 0.01 versus the control group. ## p < 0.01 versus the surgery group.

3.6. A CCR2 antagonist inhibited surgery-induced hippocampal neuronal injury and apoptosis

one day post-surgery, the levels of TNF-α and IL-1β in the hippocampus substantially increased by up to approximately 216 and 305% of the control values, respectively (TNF-α: p < 0.01; IL-1β: p < 0.01) (Fig. 6A and B). Pre-treatment with CCR2 antagonist for 30 min effectively attenuated the increased production of both cytokines (TNF-α: p < 0.01; IL-1β: p < 0.01). Thus, CCR2 antagonist was able to inhibit the pro-inflammatory effects of tibial fracture surgery in the hippocampus via reducing the production of pro-inflammatory factors.

To ascertain whether neurons are involved in the downstream signaling cascades of CCL2-CCR2 pathway, we tested for neuronal apoptosis with caspase-3 immunostaining. In postoperative rats, there was a striking increase in caspase-3 expression which was diminished by pretreatment with the CCR2 antagonist (Fig. 7A and C). To further examine neuronal injury, we explored the expression of Tau in the hippocampus. Coincident with the change in caspase-3 expression, the RS504393-treated rats showed a lower expression of Tau than did the

150

Behavioural Brain Research 332 (2017) 145–153

J. Xu et al.

Fig. 7. A CCR2 antagonist inhibited surgery-induced neuronal injury and apoptosis in hippocampus. Immunostaining was used to detect caspase-3 (A) and Tau (B) in area CA1 of the hippocampus. Scale bar = 50 μm. (C) and (D) Quantification of caspase-3 and Tau-positive area in the CA1 region of the hippocampus (n = 4). (E) The expression of PSD95 and Tau was detected by Western blotting using specific antibodies in the hippocampus of rats. Each blot is representative of three experiments. (F) Levels of PSD95 and Tau were quantified and normalized to GAPDH levels. Each value was then expressed relative to the control, which was set to 1 (n = 3). The data are presented as the mean ± S.E.M. **p < 0.01 versus the control group. ##p < 0.01 versus the surgery group.

4. Discussion

postoperative rats given no pretreatment, which was confirmed by both immunohistochemistry and Western blotting analysis (Fig. 7B, D, E and F). Additionally, the expression of the synaptic marker PSD95 was evaluated in the present study. As shown in Fig. 7E and F, CCR2 antagonist increased the expression of PSD95 on postoperative day 1. Taken together, we conclude that inhibition of CCR2 effectively protected against neuronal injury.

Emerging evidence demonstrates that CCL2/CCR2 signaling plays a key role in acute and chronic brain damage associated with neuroinflammation in disease states including stroke, acute brain injury, infectious disease, multiple sclerosis, and EAE [20]. In recent years, POCD-associated neuroinflammation has attracted considerable attention [21]. However, little is known about the role of CCL2/CCR2 signaling in the pathogenesis of POCD. In this study, we demonstrated the 151

Behavioural Brain Research 332 (2017) 145–153

J. Xu et al.

Together, our results established that astrocyte-derived CCL2 is a mechanism by which glial cell communication may arise. To further ascertain the inflammatory reactions taking place downstream of their activation, the production of inflammatory cytokines and neuronal function were evaluated. Many studies have demonstrated the elevated CNS expression of pro-inflammatory cytokines (IL-1, TNF) in the initiation, progression, and advancement of a multifaceted inflammatory cascade, and neuroinflammation can eventually result in neuronal death [42,43]. We revealed in this study that CCR2 antagonist administration abolished the increases in surgery-induced TNF-α and IL-1β production in the hippocampus. Tau protein, as a biomarker of nonspecific neural damage, is increasingly recognized as an important hallmark of AD [44,45]. Our experimental studies showed that surgery could induce a marked increase in the production of hippocampal tau protein. Additionally, increased apoptosis and a reduction in synaptic proteins were observed in the hippocampus on postoperative day 1. Interestingly, these changes were prevented once again by CCR2 antagonist. Since we observed higher expression of CCR2 in microglia, it is tempting to speculate that the CCR2 antagonist may exert its protective effects against neuronal injury by mediating microglial pro-inflammatory feedback. Some studies have demonstrated that the predominant expression of CCR2 on neurons, not microglia, played a key role in the pathogenesis of neuropathic pain, suggesting a direct effect of CCL2 on these neurons [46,47]. Indeed, the CNS expression profile of CCR2 is heavily debated and varies in different models of disease. Hence, we still cannot exclude the possibility that astrocyte-derived CCL2 can result in neuronal dysfunction independent of microglial activation.

pro-inflammatory properties of the CCL2-CCR2 pathway in a rat model of POCD after tibial fracture surgery, and a CCR2 antagonist was able to suppress neuroinflammation and ameliorate cognitive impairment via the inhibition of microglial activation. Patients may experience cognitive impairment following illness or trauma. Accumulating evidence supports a role for CCL2/CCR2 in cognitive decline [22–24]. CCL2 was associated with poor cognitive status in obese mice, which was accompanied by BBB breakdown and macrophage infiltration [22]. High levels of CCL2 were also observed in microglia-related mature senile plaques in brains from patients diagnosed with Alzheimer’s disease (AD), a disease characterized by cognitive impairment in the elderly [25]. In the current study, we observed postsurgical impairment of performance in the contextual assessment and the Y maze test, which are both thought to depend on hippocampal function. However, this spatial working memory was improved in the presence of the CCL2 receptor antagonist RS504393, as indicated by increases in freezing time and decreases in number of learning trials. Hence, we suggest that CCL2 signaling may participate in the cognitive dysfunction after tibial surgery. The role of chemokines in regulating several physiological and pathological processes has only become clear in the last few years. The chemokine CCL2 has been implicated in the pathogenesis of several different disease processes, including obesity, atherosclerosis, autoimmune disease, and a number of different neurological disorders [26]. In particular, recent evidence shows its vital role in the nervous system. CCL2 upregulation has been identified in traumatic brain injury (TBI) [27], cerebral infarcts and ischemia [28], and AD [29], as well as rodent models of these diseases [28,30]. In the present study, we found that rats subjected to surgery experienced a larger induction of CCL2 in the hippocampus than the controls. Although it has been reported that CCL2 is expressed by most cell types, including astrocytes, microglia, neurons, and brain microvascular endothelial cells (BMeCs) [31], accumulating evidence over recent years suggests that astrocytes are a primary source of CCL2 [32–35]. As expected, immunofluorescence double staining showed that nearly all increased CCL2 expression was found in GFAP-stained astrocytes in the hippocampus after surgery. These astrocytes also had large somata with many thick processes. Astrocytes have gained increasing attention over recent decades as key regulators of neuroinflammation. Thanks to astrocytes being part of the blood-brain barrier (BBB), they are among the first to encounter proinflammatory signals produced in the peripheral immune compartment, even before the breakdown of the BBB [4,36].Over-activation of astrocytes in animal models mimicking POCD has been observed in our previous research [7,37], and the present findings may further define the specific contribution of astrocytes to POCD. Microglia, described as brain-resident phagocytes, plays active roles in response to inflammatory stimulation. Microgliosis, which is defined as an increased number of microglia, has been demonstrated to occur during the early stages of the neuroinflammatory process. Activated microglia cells also show M1 polarization, a state in which they can produce inflammatory cytokines [38,39]. In addition to releasing proinflammatory mediators, microglia cells also respond to pro-inflammatory signals released from other cells. In this context, CCL2 may be a key contributor to the immune response. The expression of CCR2 (the primary receptor for CCL2) in microglia has been detected both in vivo and in vitro [40,41]. A study by Zhang Ji et al. demonstrated that intrathecal injection of CCL2 caused the activation of microglia in wildtype mice but not in CCR2-deficient mice [12]. Our previous study also indicated that CCL2 from astrocytes led to microglial activation in vitro [41]. Similarly, in the present study, immunofluorescence staining verified that CCR2 was mainly expressed in microglia. Moreover, the increased numbers of microglia and microglial M1 polarization induced by surgery could be partially reversed by pretreatment with CCR2 antagonist. These results suggest that the CCL2-CCR2 pathway is an important form of astrocyte-microglial signaling in our rat model of POCD.

5. Conclusions In summary, our findings suggest that upregulated CCL2 expression induced by surgery in activated astrocytes promotes microglial activation and M1 polarization, followed by increases in pro-inflammatory cytokines and neuronal injury in the hippocampus. Its pro-inflammatory effect contributed to the occurrence and development of neuroinflammation and cognitive impairment, which could be inhibited by a CCR2 antagonist. Thus, targeting the CCL2–CCR2 signaling pathway may provide a novel therapeutic approach for the treatment of POCD. Competing interest The authors declare that they have no competing interests Acknowledgements This project was sponsored by the National Natural Science Foundation of China (No. 81400889; 81671387), a Project Funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD). References [1] M. Berger, J.W. Nadler, J. Browndyke, N. Terrando, V. Ponnusamy, H.J. Cohen, H.E. Whitson, J.P. Mathew, Postoperative cognitive dysfunction, Anesthesiol. Clin. 33 (2015) 517–550. [2] A.E. van Harten, T.W.L. Scheeren, A.R. Absalom, A review of postoperative cognitive dysfunction and neuroinflammation associated with cardiac surgery and anaesthesia, Anaesthesia 67 (2012) 280–293. [3] M. Sochocka, B.S. Diniz, J. Leszek, Inflammatory response in the CNS: friend or foe? Mol. Neurobiol. (2016), http://dx.doi.org/10.1007/s12035-016-0297-1. [4] V. Rothhammer, F.J. Quintana, Control of autoimmune CNS inflammation by astrocytes, Semin. Immunopathol. 37 (2015) 625–638. [5] A. Waisman, R.S. Liblau, B. Becher, Innate and adaptive immune responses in the CNS, Lancet Neurol. 14 (2015) 945–955. [6] X. Zhang, H. Dong, N. Li, S. Zhang, J. Sun, S. Zhang, Y. Qian, Activated brain mast cells contribute to postoperative cognitive dysfunction by evoking microglia activation and neuronal apoptosis, J. Neuroinflamm. 13 (2016).

152

Behavioural Brain Research 332 (2017) 145–153

J. Xu et al. [7] X. Zhang, H. Yao, Q. Qian, N. Li, W. Jin, Y. Qian, Cerebral mast cells participate in postoperative cognitive dysfunction by promoting astrocyte activation, Cell Physiol. Biochem. 40 (2016) 104–116. [8] A. Réaux-Le Goazigo, J. Van Steenwinckel, W. Rostène, S. Mélik Parsadaniantz, Current status of chemokines in the adult CNS, Prog. Neurobiol. 104 (2013) 67–92. [9] S. Bose, J. Cho, Role of chemokine CCL2 and its receptor CCR2 in neurodegenerative diseases, Arch. Pharm. Res. (2013) 1039–1050. [10] F. Yuan, N. Yosef, R.C. Lakshmana, A. Huang, S.C. Chiang, H.R. Tithi, E.E. Ubogu, CCR2 gene deletion and pharmacologic blockade ameliorate a severe murine experimental autoimmune neuritis model of Guillain-Barre syndrome, PLoS One 9 (2014) e90463. [11] C. Cerri, S. Genovesi, M. Allegra, F. Pistillo, U. Puntener, A. Guglielmotti, V.H. Perry, Y. Bozzi, M. Caleo, The chemokine CCL2 mediates the seizure-enhancing effects of systemic inflammation, J. Neurosci. 36 (2016) 3777–3788. [12] J. Zhang, X.Q. Shi, S. Echeverry, J.S. Mogil, Y. De Koninck, S. Rivest, Expression of CCR2 in both resident and bone marrow-derived microglia plays a critical role in neuropathic pain, J. Neurosci. 27 (2007) 12396–12406. [13] J.J. Sheehan, C. Zhou, I. Gravanis, A.D. Rogove, Y.P. Wu, D.F. Bogenhagen, S.E. Tsirka, Proteolytic activation of monocyte chemoattractant protein-1 by plasmin underlies excitotoxic neurodegeneration in mice, J. Neurosci. 27 (2007) 1738–1745. [14] S. Zhang, H. Dong, X. Zhang, N. Li, J. Sun, Y. Qian, Cerebral mast cells contribute to postoperative cognitive dysfunction by promoting blood brain barrier disruption, Behav. Brain Res. 298 (2016) 158–166. [15] S. Lu, C. Yu, Y. Liu, H. Dong, X. Zhang, S. Zhang, L. Hu, F. Zhang, Y. Qian, B. Gui, S100A8 contributes to postoperative cognitive dysfunction in mice undergoing tibial fracture surgery by activating the TLR4/MyD88 pathway, Brain Behav. Immun. 44 (2015) 221–234. [16] T.Y.J.K. Niccolò Terrando, M.F.D.M. Monaco, Stimulation of the alpha 7 nicotinic acetylcholine receptor protects against neuroinflammation after tibia fracture and endotoxemia in mice, Mol. Med. 21 (2014) 667–675. [17] X. Feng, V. Degos, L.G. Koch, S.L. Britton, Y. Zhu, S. Vacas, N. Terrando, J. Nelson, X. Su, M. Maze, Surgery results in exaggerated and persistent cognitive decline in a rat model of the Metabolic Syndrome, Anesthesiology 118 (2013) 1098–1105. [18] J. Sun, S. Zhang, X. Zhang, X. Zhang, H. Dong, Y. Qian, IL-17A is implicated in lipopolysaccharide-induced neuroinflammation and cognitive impairment in aged rats via microglial activation, J. Neuroinflamm. 12 (2015) 165. [19] L. Mayo, S.A. Trauger, M. Blain, M. Nadeau, B. Patel, J.I. Alvarez, I.D. Mascanfroni, A. Yeste, P. Kivisäkk, K. Kallas, B. Ellezam, R. Bakshi, A. Prat, J.P. Antel, H.L. Weiner, F.J. Quintana, Regulation of astrocyte activation by glycolipids drives chronic CNS inflammation, Nat. Med. 20 (2014) 1147–1156. [20] J. Dawson, W. Miltz, A.K. Mir, C. Wiessner, Targeting monocyte chemoattractant protein-1 signalling in disease, Expert Opin. Ther. Targets 7 (2003) 35–48. [21] I.B. Hovens, R.G. Schoemaker, E.A. van der Zee, A.R. Absalom, E. Heineman, B.L. van Leeuwen, Postoperative cognitive dysfunction: involvement of neuroinflammation and neuronal functioning, Brain Behav. Immun. 38 (2014) 202–210. [22] A.M. Stranahan, S. Hao, A. Dey, X. Yu, B. Baban, Blood-brain barrier breakdown promotes macrophage infiltration and cognitive impairment in leptin receptor-deficient mice, J. Cereb. Blood Flow Metab. 36 (2016) 2108–2121. [23] R.K. Gherardi, J. Aouizerate, J. Cadusseau, S. Yara, F.J. Authier, Aluminum adjuvants of vaccines injected into the muscle: normal fate, pathology and associated disease, Morphologie 100 (2016) 85–94. [24] R.K. Sodhi, N. Singh, Liver X receptors: emerging therapeutic targets for Alzheimer’s disease, Pharmacol. Res. 72 (2013) 45–51. [25] K. Ishizuka, T. Kimura, R. Igata-yi, S. Katsuragi, J. Takamatsu, T. Miyakawa, Identification of monocyte chemoattractant protein-1 in senile plaques and reactive microglia of Alzheimer’s disease, Psychiatry Clin. Neurosci. 51 (1997) 135–138. [26] T. O'Connor, L. Borsig, M. Heikenwalder, CCL2-CCR2 signaling in disease pathogenesis, Endocr. Metab. Immune Disord. Drug Targets 15 (2015) 105–118. [27] L. Ho, W. Zhao, K. Dams-O'Connor, C.Y. Tang, W. Gordon, E.R. Peskind, S. Yemul, V. Haroutunian, G.M. Pasinetti, Elevated plasma MCP-1 concentration following traumatic brain injury as a potential predisposition factor associated with an increased risk for subsequent development of Alzheimer's disease, J. Alzheimers Dis. 31 (2012) 301–313. [28] N.G. Gourmala, M. Buttini, S. Limonta, A. Sauter, H.W.G.M. Boddeke, Differential and time-dependent expression of monocyte chemoattractant protein-1 mRNA by

[29]

[30]

[31] [32]

[33]

[34]

[35]

[36] [37]

[38]

[39]

[40]

[41]

[42]

[43] [44]

[45]

[46]

[47]

153

astrocytes and macrophages in rat brain: effects of ischemia and peripheral lipopolysaccharide administration, J. Neuroimmunol. 74 (1997) 35–44. A. Sokolova, M.D. Hill, F. Rahimi, L.A. Warden, G.M. Halliday, C.E. Shepherd, Monocyte chemoattractant protein-1 plays a dominant role in the chronic inflammation observed in Alzheimer's disease, Brain Pathol. 19 (2009) 392–398. R. Sandhir, V. Puri, R.M. Klein, N.E.J. Berman, Differential expression of cytokines and chemokines during secondary neuron death following brain injury in old and young mice, Neurosci. Lett. 369 (2004) 28–32. Y. Yao, S.E. Tsirka, Monocyte chemoattractant protein-1 and the blood-brain barrier, Cell Mol. Life Sci. 71 (2014) 683–697. Z. Zhang, Y. Dong, Y. Lu, S. Cao, Z. Zhao, Y. Gao, Chemokine CCL2 and its receptor CCR2 in the medullary dorsal horn are involved in trigeminal neuropathic pain, J. Neuroinflammation 9 (2012) 136. K. Kawabata, I. Nishimura, T. Fujiwara, S. Terauchi, T. Minami, S. Ito, E. OkudaAshitaka, Intrathecal administration of low-dose nociceptin/orphanin FQ induces allodynia via c-Jun N-terminal kinase and monocyte chemoattractant protein-1, Eur. J. Neurosci. 43 (2016) 1499–1508. M. Moreno, P. Bannerman, J. Ma, F. Guo, L. Miers, A.M. Soulika, D. Pleasure, Conditional Ablation of Astroglial CCL2 suppresses CNS accumulation of M1 macrophages and preserves axons in mice with MOG peptide EAE, J. Neurosci. 34 (2014) 8175–8185. J. Menetski, S. Mistry, M. Lu, J.S. Mudgett, R.M. Ransohoff, J.A. DeMartino, D.E. MacIntyre, C. Abbadie, Mice overexpressing chemokine ligand 2 (CCL2) in astrocytes display enhanced nociceptive responses, Neuroscience 149 (2007) 706–714. E. Colombo, C. Farina, Astrocytes key regulators of neuroinflammation, Trends Immunol. 37 (2016) 608–620. W. Jin, S. Feng, Z. Feng, S. Lu, T. Qi, Y. Qian, Minocycline improves postoperative cognitive impairment in aged mice by inhibiting astrocytic activation, Neuroreport 25 (2014) 1–6. V. Chhor, T. Le Charpentier, S. Lebon, M. Oré, I.L. Celador, J. Josserand, V. Degos, E. Jacotot, H. Hagberg, K. Sävman, C. Mallard, P. Gressens, B. Fleiss, Characterization of phenotype markers and neuronotoxic potential of polarised primary microglia in vitro, Brain Behav. Immun. 32 (2013) 70–85. S.M. Lloyd-Burton, E.M. York, M.A. Anwar, A.J. Vincent, A.J. Roskams, SPARC regulates microgliosis and functional recovery following cortical ischemia, J. Neurosci. 33 (2013) 4468–4481. M.A. Thacker, A.K. Clark, T. Bishop, J. Grist, P.K. Yip, L.D.F. Moon, S.W.N. Thompson, F. Marchand, S.B. McMahon, CCL2 is a key mediator of microglia activation in neuropathic pain states, Eur. J. Pain 13 (2009) 263–272. M. He, H. Dong, Y. Huang, S. Lu, S. Zhang, Y. Qian, W. Jin, Astrocyte-derived CCL2 is associated with M1 activation and recruitment of cultured microglial cells, Cell Physiol. Biochem. 38 (2016) 859–870. Q. Alam, M.Z. Alam, G. Mushtaq, G.A. Damanhouri, M. Rasool, M.A. Kamal, A. Haque, Inflammatory process in Alzheimer's and Parkinson’s diseases: central role of cytokines, Curr. Pharm. Des. 22 (2016) 541–548. C.A. Dinarello, The IL-1 family and inflammatory diseases, Clin. Exp. Rheumatol. 20 (2002) S1–13. R.C. Ng, O. Cheng, M. Jian, J.S. Kwan, P.W. Ho, K.K. Cheng, P.K.K. Yeung, L.L. Zhou, R.L. Hoo, S.K. Chung, A. Xu, K.S. Lam, K.H. Chan, Chronic adiponectin deficiency leads to Alzheimer’s disease-like cognitive impairments and pathologies through AMPK inactivation and cerebral insulin resistance in aged mice, Mol. Neurodegener. 11 (2016) 71. M. Schjønning Nielsen, A.H. Simonsen, V. Siersma, S.G. Hasselbalch, P. Høgh, Are CSF biomarkers useful as prognostic indicators in diagnostically unresolved cognitively impaired patients in a normal clinical setting, Dement. Geriatr. Cogn. Dis. Extra 6 (2016) 465–476. Y.J. Gao, L. Zhang, O.A. Samad, M.R. Suter, K. Yasuhiko, Z.Z. Xu, J.Y. Park, A.L. Lind, Q. Ma, R.R. Ji, JNK-induced MCP-1 production in spinal cord astrocytes contributes to central sensitization and neuropathic pain, J. Neurosci. 29 (2009) 4096–4108. J. Van Steenwinckel, A. Reaux-Le Goazigo, B. Pommier, A. Mauborgne, M.A. Dansereau, P. Kitabgi, P. Sarret, M. Pohl, S. Melik Parsadaniantz, CCL2 released from neuronal synaptic vesicles in the spinal cord is a major mediator of local inflammation and pain after peripheral nerve injury, J. Neurosci. 31 (2011) 5865–5875.