Atlantic cod (Gadus morhua) CC chemokines: Diversity and expression analysis

Developmental and Comparative Immunology 34 (2010) 904–913

Contents lists available at ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci

Atlantic cod (Gadus morhua) CC chemokines: Diversity and expression analysis Tudor Borza a,∗ , Cynthia Stone a , Matthew L. Rise b , Sharen Bowman a , Stewart C. Johnson c,∗∗ a

Genome Atlantic, NRC Institute for Marine Biosciences, 1411 Oxford Street, Halifax, NS, B3H 3Z1, Canada Ocean Sciences Centre, Memorial University of Newfoundland, St. John’s, NL, Canada c Pacific Biological Station, Fisheries and Oceans Canada, 3190 Hammond Bay Road, Nanaimo, BC,V9T 6N7, Canada b

a r t i c l e

i n f o

Article history: Received 2 March 2010 Received in revised form 27 March 2010 Accepted 30 March 2010 Available online 14 April 2010 Keywords: Atlantic cod (Gadus morhua) CC chemokines QPCR EST abundance Phylogeny

a b s t r a c t Chemokines are a large, diverse group of small cytokines that can be classified into several families, including the CC chemokines that are characterized by two adjacent cysteines near their amino terminus. CC chemokines play a pivotal role in host defense mechanisms by inducing leukocyte chemotaxis under physiological and inflammatory conditions. Analysis of CC chemokines from teleost fishes indicates that the number of CC chemokine genes and their tissue expression patterns vary largely in this group of vertebrates. Here we describe 32 distinct CC chemokine sequences from Atlantic cod (Gadus morhua) identified by analysis of approximately 206,000 ESTs. Phylogenetic analysis of Atlantic cod CC chemokines placed these sequences in seven clusters, most likely resulting from species-specific gene duplications, and two unique sequences; 12 of these CC chemokines, including at least one member of each cluster, were analyzed by QPCR using four immune-related tissues (head kidney, liver, spleen and blood) obtained from unstimulated, polyriboinosinic polyribocytidylic acid (pIC)-stimulated and formalin-killed atypical Aeromonas salmonicida-stimulated individuals. EST abundance and QPCR analysis indicate that the expression of closely related CC chemokines GmSCYA101 and GmSCYA102, GmSCYA108 and GmSCYA109 or GmSCYA122 and GmSCYA124 can be highly tissue-specific despite substantial sequence identity. Stimulation with the viral mimic pIC or formalin-killed atypical A. salmonicida resulted in increased expression of most of the CC chemokines, indicating that they can be regarded as either inducible (inflammatory) or dual-function rather than constitutive (homeostatic). Tissue specificity, and the level of induction, varied broadly; for example, GmSCYA123 was at least 4-fold up-regulated by both inducers in all tissues analyzed, whereas pIC increased the expression of GmSCYA124 in liver over 1500 times. © 2010 Elsevier Ltd. All rights reserved.

1. Introduction Chemokines represent a superfamily of chemotactic cytokines that regulate cell trafficking of various types of leukocytes playing fundamental roles in the functioning of the immune system, as well as in homeostasis and development (Rossi and Zlotnik, 2000; Zlotnik and Yoshie, 2000; Laing and Secombes, 2004a). Chemokines can be classified in four families that are present in all vertebrates, based on the number and spacing of conserved cysteine residues: CXC (␣), CC (␤), C (␥) and CX3C (␦) (Rossi and Zlotnik, 2000; Laing and Secombes, 2004a; Murphy et al., 2000). Recently, a new subfamily of chemokines, CX, was described in zebrafish (Danio rerio) (Nomiyama et al., 2008). Analyses of the genomic organization of chemokine genes in mammals suggest that chemokines can be divided into two groups (Laing and

∗ Corresponding author. Tel.: +1 902 425 8831; fax: +1 902 421 2733. ∗∗ Corresponding author. Tel.: +1 250 756 7077; fax: +1 250 756 7053. E-mail addresses: [email protected] (T. Borza), [email protected] (S.C. Johnson). 0145-305X/$ – see front matter © 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.dci.2010.03.011

Secombes, 2004a; Nomiyama et al., 2008; Nomiyama et al., 2003; Bao et al., 2006). The vast majority of chemokine genes tend to form large clusters at specific chromosome locations (the majorcluster chemokines). The remaining chemokines are either located separately in unique chromosomal locations, or form mini-clusters. This pattern of genome localization correlates with their mode of expression and their functions; inflammatory and dual-function chemokines tend to be located in large clusters while homeostatic chemokines are distributed among several chromosomes. Inflammatory (inducible) chemokines are usually expressed by leukocytes or other immune-related cells upon activation and play a role in regulating the migration of leukocytes, while homeostatic (constitutive) chemokines are expressed in the absence of inflammatory stimuli, and are involved in the relocation of various immune-related types of cells such as lymphocytes. Some chemokines possess both properties and are called dual-function chemokines (Laing and Secombes, 2004a; Murphy et al., 2000; Nomiyama et al., 2003, 2008; Bao et al., 2006; Peatman et al., 2005; Colobran et al., 2007a; Cuesta et al., 2010). CC chemokines (or ␤-chemokines), represent the largest family of chemokines and are characterized by two adjacent cys-

T. Borza et al. / Developmental and Comparative Immunology 34 (2010) 904–913

teines situated near the amino terminus. Two other conserved cysteine residues are positioned in the central part of the protein, which consists of a three-stranded antiparallel ␤-sheet. The N-terminal loop is anchored to the rest of the protein by Cys1–Cys3 and Cys2–Cys4 disulfide bonds while the C-terminal ␣-helix is packed against the ␤-sheet; the N-terminal loop is indispensable for biological activity and participates in the formation of dimers or higher oligomers (Barinka et al., 2008). CC chemokines play key roles in host defense mechanisms by regulating cell trafficking of various types of leukocytes under physiological (homeostatic) and inflammatory (pathological) conditions (Nomiyama et al., 2008; Colobran et al., 2007a; Peatman and Liu, 2007). Mammalian and chicken CC chemokines are well characterized, with 24 genes identified in humans (Rossi and Zlotnik, 2000; Zlotnik and Yoshie, 2000; Nomiyama et al., 2001, 2003). Early analysis of CC chemokines from teleost fishes such as zebrafish, channel catfish (Ictalurus punctatus), rainbow trout (Oncorhynchus mykiss) and Atlantic salmon (Salmo salar) suggested that most teleosts have around 30 distinct CC chemokine genes and provided insight on the functional diversity of these proteins. Many of these studies, reporting novel CC chemokines in fishes, have relied on expressed sequence tag (EST) data (Laing and Secombes, 2004a; Bao et al., 2006; Peatman et al., 2005; Peatman and Liu, 2007; He et al., 2004; Laing and Secombes, 2004b). Phylogenetic analyses indicate that some of the teleost sequences cluster with, or within, the major clades described in mammals, but these affinities have little statistical support (Laing and Secombes, 2004a; Nomiyama et al., 2008; Peatman and Liu, 2007; Laing and Secombes, 2004b; Peatman et al., 2006). Extensive genomic data, generated recently for a number of teleost fishes such as zebrafish, torafugu (Takifugu rubripes) and spotted green pufferfish (Tetraodon nigroviridis) has facilitated important advances in the understanding of the genome architecture of chemokine genes, as well as their evolution and function (Nomiyama et al., 2008). The emerging picture is that the number of CC chemokines in teleost fishes varies considerably, with zebrafish having as many as 81 different genes (Nomiyama et al., 2008), a number substantially higher than seen in mammals. In sharp contrast, the search of CC chemokines in the compact genomes of torafugu and spotted green pufferfish revealed, in both taxa, the presence of 11 genes encoding this family of chemokines (Nomiyama et al., 2008) suggesting that, in fishes, the number of CC chemokines might be related to genome size. These differences in the number of CC chemokines present in various fish species raise several questions, such as how many CC chemokines are needed to ensure the functioning of the immune system in fishes, why the level of species-specific gene duplication differs greatly among taxa, and how fast duplicated genes acquire functional- and tissuespecificity. Atlantic cod (Gadus morhua) represents one of the most valuable commercial resources for fisheries in the northern Atlantic, and its immune system exhibits some peculiar traits such as ineffectiveness in producing specific antibodies upon immunization (Pilström et al., 2005). In an effort to provide more genomic data related to this fish, the Atlantic Cod Genomics and Broodstock Development Project (CGP) recently produced approximately 160,000 ESTs (Bowman et al., in press) from over 40 cDNA libraries representing large numbers of individuals and a variety of tissues (e.g., liver, spleen, blood, ovary, gills) and developmental stages (e.g., embryonic, larval, juvenile and adult). Using data produced by CGP and other data present in GenBank, we identified by bioinformatics analysis CC chemokines expressed in Atlantic cod, and analyzed by quantitative reverse-transcriptionpolymerase chain reaction (QPCR) the expression of a subset of them in 4 immune-related tissues, i.e., head kidney, liver, spleen and blood.

905

2. Material and methods 2.1. Identification of Atlantic cod CC chemokine transcripts in databases and bioinformatic analyses The identification of CC chemokine transcripts expressed in Atlantic cod was carried out by analyzing EST data produced by the CGP (see CodGene database: http://www.codgene.ca) (Bowman et al., in press) and EST data deposited in GenBank by the CGP and other groups (e.g., see: http://www.codgen.olsvik.info). Identification of CC chemokine transcripts in CodGene included Keywords: searches of data automatically annotated by AutoFact (Koski et al., 2005); while GenBank data mining was performed by running BLAST searches using well-characterized CC chemokine sequences from zebrafish; channel catfish and rainbow trout as queries. ESTs corresponding to Atlantic cod CC chemokines were screened to identify the relevant open reading frames; which were then translated to amino acid sequences; followed by clustering using BioEdit 7.0 (Hall, 1999). Sequence alignments were performed using Muscle (Edgar, 2004) or Clustal X (Thompson et al., 1994) and edited with BioEdit 7.0 (Hall, 1999). Phylogenetic analyses employed Neighbor-Joining (Poisson; Dayhoff and JTT models; pairwise deletion; bootstrap value 1000; rates among sites gamma distributed; gamma parameter 2); Maximum-Likelihood (JTT model; gamma estimated; number of replicates 100); and Bayesian inference (WAG model; 1,000,000 generations; gamma 4; sample frequency 100; burnin 2000) and were performed using MEGA 4.0 (Tamura et al., 2007); PHYML (Guindon and Gascuel, 2003); and Mr. Bayes 3.1 (Ronquist and Huelsenbeck, 2003); respectively. The phylogenetic trees resulting from analyses were displayed using TreeView (Page, 1996). CC chemokines identified in this study were named using the genus and species heading and the “SCYA” designation (small secreted cytokine; subfamily A) as proposed by Kuroda et al. (2003). EST sequences corresponding to the 32 different Atlantic cod CC chemokines; their GenBank accession numbers and the tissue from which they were isolated; are listed in Supplemental data 1. 2.2. Selection of Atlantic cod CC chemokine sequences for expression studies Phylogenetic analyses indicate that, similar to other fish sequences, Atlantic cod CC chemokines tend to group in several clades. We decided to investigate the mRNA expression of at least one Atlantic cod CC chemokine sequence from each of the clades we identified by using RT-PCR and QPCR. Based on these criteria, we selected 12 Atlantic cod CC chemokine sequences for expression analysis. The primers used to amplify these sequences are listed in Table 1; they were designed to match a unique Atlantic cod CC chemokine open reading frame (ORF), incorporating the polymorphisms related to allelic variation (Supplemental data 2 and 3). 2.3. Fish husbandry, bacterial antigen and polyriboinosinic polyribocytidylic acid (pIC) stimulation, and tissue sampling Juvenile Atlantic cod were obtained from the CGP and maintained in tanks with flowing seawater (10 ◦ C, 90% O2 saturation) under a 12 h light/12 h dark photoperiod. The fish were fed daily (at 1.5% body mass/day) with a commercial fish feed. Bacterial antigen stimulation was performed as follows: prior to stimulation, seven individuals (0 h controls) were killed by a lethal dose (0.4 g/L) of tricaine methanesulphonate (TMS) (Syndel Laboratories, Vancouver, BC, Canada). Blood, head kidney, liver and spleen tissues were placed individually in 1.5 ml tubes containing RNAlater (Ambion/Applied Biosystems, Austin, TX, USA), incubated

906

T. Borza et al. / Developmental and Comparative Immunology 34 (2010) 904–913

Table 1 Primers used to amplify the 12 selected Atlantic cod CC chemokines. Amplification efficiency values were incorporated into the relative quantity calculations. CC chemokine transcript

Primer orientation

Sequence (5 to 3 )

GmSCYA101

F R

CAGGAATCTGAAGCGGTTGTTGAT TCACAGAGTGGTTGGCGAAGCATTTGTG

90.3

246

GmSCYA102

F R

TTCAGGAATCTGAAGCGGTGGGC TCACAGAGTGGTTGGCGAAGCATTTGTG

89.7

251

GmSCYA106a, b

F R

ACCGGACGAGGATCTGCAGATCG CCTCATCACCCAGGGCTCATCATG

98.3

189

GmSCYA108

F R

CCGGACAAGGATCTGCAGTTGAG CCTCATCACCCAGGGCTCATCAAA

89.6

191

GmSCYA109

F R

CGGACAAGGATCTGCAGCAGTTCC CGTCATCACCCAGGGCTCATCAAA

94.2

190

GmSCYA113

F R

CGGACAAGGATCTGCAGTAGCTCA CTTCCTCACCCAGGGCTCATCGTG

92.4

190

GmSCYA114

F R

TACCGTGGCCGACAGCGGAATTG TTAGGAGTTGCGCTGATCCAGTCGTG

100.4

220

GmSCYA118a-c

F R

ATTGACCGTGGCCAACTATGGAGC TCAAAGGTTGATCTGATCGAGTCGTTC

101.7

229

GmSCYA120

F R

GTATCCTTCTTGTGCCTCTTCTCATCG CAGACGGCATGATGGTCTTTTCTGC

98.4

158

GmSCYA122

F R

ATGAAGTCTGCACTGCTGATCATTCTG GTGCGACGGCTTCTTCTTCATGAAG

88.3

213

GmSCYA123

F R

GGACTTTAGGAGAGGTCCCAGTGG CATCCACAGCAGTTATACATGCTCTC

95.5

210

GmSCYA124a, b

F R

ATGAGGTTTCAGATGCTCTCCTTCC GCGCAAATGAACCTTCCCTTCTTG

97.2

215

at 4 ◦ C overnight and then stored at −80 ◦ C prior to RNA extraction. After 0 h control samples were taken, the remaining individuals were captured with a dip net and lightly anaesthetized in an aqueous solution of 0.1 g/L TMS, and then received an intraperitoneal injection of 100 ␮l of formalin-inactivated atypical Aeromonas salmonicida (4% formalin w/v) suspended in a phosphate-buffered saline solution, pH 7.2 at an OD600 of 1.0. The bacterial antigen preparation was similar to that described elsewhere (Feng et al., 2009). At 1, 3, 6, 12, 24, 72 h and at 1 week post-injection, individuals were captured, euthanized, and sampled as previously described for the 0 h control individuals. pIC stimulation was performed similarly to that of bacterial stimulation, but following anaesthesia, the fish received a 100 ␮l intraperitoneal injection of a 0.5 mg/ml solution of pIC in phosphate-buffered saline solution, pH 7.2 (50 mg of pIC per fish). 2.4. Sample preparation for RNA isolation Liver, head kidney and spleen samples were ground in liquid nitrogen, reconstituted in RLT buffer from the RNeasy Mini Kit (Qiagen, Burlington, ON, Canada), and homogenized using a PT 2100 Polytron homogenizer (Kinematica Inc., Bohemia, NY, USA). The isolation of total RNA included the optional on-column DNase digestion step and was performed using the RNeasy Mini Kit animal tissues protocol according to the manufacturer’s instructions. Red blood cells (RBCs) were separated from plasma and RNAlater by centrifugation at 3000 × g for 1 min, resuspended in RLT buffer from the RNeasy Mini Kit and processed as described above for the other three tissues. For semi-quantitative RT-PCR experiments, equal amounts of liver, head kidney, spleen and blood mRNA samples from the different A. salmonicida or pIC challenge time points were pooled to determine an “early” response (1–12 h postinjection) and “late” response (24 h–1 week post-injection). The early response pool contained two individuals from each of the first four time points (1, 3, 6 and 12 h), while the late pool contained two

Amplification efficiency (%)

Amplicon size (nt)

individuals from each of the last three time points (24, 72 h and 1 week). Unstimulated (control) samples for each of the four tissue types, consisted of a pool of five individuals. For QPCR experiments the same time points were pooled but the early and late response pools were duplicated. The early response replicate consisted of two pools, both containing one individual from each of the first four time points (i.e. two replicates × four individuals) while both late response replicates consisted of one individual from each of the last three time points (i.e., two replicates × three individuals). Unstimulated samples for each of the four tissue types, consisted of two pools of three individuals. 2.5. Reverse-transcription PCR (RT-PCR) The quality and quantity of total RNA samples was assessed both by separating these samples on a 1% native agarose gel, and by using a ND-1000 spectrophotometer (NanoDrop Technologies, Inc., Wilmington, DE, USA). Semi-quantitative one-step RT-PCR was performed using Ambion’s RETROscript kit (Ambion/Applied Biosystems, Austin, TX, USA) following the manufacturer’s instructions. Cycling parameters consisted of one denaturing cycle of 94 ◦ C for 2 min, followed by 25 or 30 cycles, respectively, of 94 ◦ C for 30 s, 58 ◦ C for 30 s, and 72 ◦ C for 40 s. The primers used to distinguish among the various CC chemokines are listed in Table 1, with primer localization on the different CC chemokine sequences shown in Supplemental data 3. The same primers sets were used in both, RT-PCR and QPCR experiments. The screening by semi-quantitative RT-PCR (25 and 30 cycles, respectively) was performed to determined if a single product is amplified for each CC chemokine and to find out if the various CC chemokines show different expression patterns upon stimulation with A. salmonicida or pIC. The results from semi-quantitative RT-PCR (data not shown) confirmed that only one product was obtained for each Atlantic cod CC chemokines and indicated that inducers affect their expression; therefore we decided to analyze all 12 CC chemokines by QPCR.

T. Borza et al. / Developmental and Comparative Immunology 34 (2010) 904–913

2.6. Quantitative reverse-transcription-polymerase chain reaction (QPCR) The expression level of the 12 CC chemokines was analyzed by QPCR using Fast SYBR Green® and the StepOne Real-Time PCR system (Applied Biosystems, Foster City, CA). QPCR primers were identical to those employed in the RT-PCR experiments (Table 1). RT-PCR amplification using these primers, followed by gel electrophoresis, indicated that a single product of the correct size was obtained for each primer pair; in addition, following QPCR amplification, melt-curves (0.3 ◦ C from 50 to 95 ◦ C) were used to verify that a single amplicon was obtained, and that no primer-dimer products were present. QPCR was performed in a 20 ␮l reaction volume using 2 ␮l of cDNA (20 ng total RNA), 1 ␮l 4 ␮M each of forward and reverse primers and 10 ␮l 2X Fast SYBR Green® Master Mix. Expression levels of CC chemokine genes were normalized to the ubiquitin gene. The decision to use ubiquitin as the endogenous control was based on supporting literature (Saele et al., 2009; Olsvik et al., 2008) and on previous experiments (Borza et al., 2009). Cycling parameters consisted of one denaturing cycle of 95 ◦ C for 2 min, followed by 40 cycles of 95 ◦ C for 30 s and 60 ◦ C for 1 min. Cycled 48-well plates contained duplicate samples for each target gene together with the endogenous control. The fluorescence threshold cycle (CT ) was determined automatically using StepOne software (version 2.0) for comparative CT experiments. Transcript abundance was determined using the comparative CT method for relative quantification (Livak and Schmittgen, 2001), by employing the time point samples and the tissue with the lowest gene expression as calibrators. Amplification efficiency (E = (10)(−1/slope) ) was assessed by running six (1:4) serial dilutions, using a starting concentration of cDNA corresponding to 40 ng of total RNA. Amplification efficiency was calculated using StepOne software (version 2.0). 3. Results 3.1. Identification and clustering of Atlantic cod CC chemokine transcripts The search of the approximately 206,000 Atlantic cod ESTs deposited in GenBank led to the identification of more than 200 ESTs corresponding to CC chemokines. Neighbor-Joining (JTT model) analysis of these ESTs followed by EST clustering resulted in 32 distinct CC chemokine sequences (Supplemental data 1–3). In some cases, it was difficult to assess if differences found among the various ESTs and/or among contigs correspond to polymorphisms present within a certain CC chemokine gene (i.e., allelic polymorphism) or to transcripts originating from different genes that exhibit significant sequence conservation. Ultimately, a threshold of less than 95% identity at the level of amino acids was chosen to distinguish between different CC chemokine genes. Sequences showing less polymorphism, affecting mainly synonymous sites, were considered to be allelic variants. This threshold assigned 24 sequences as putative CC chemokine genes and eight sequences as allelic variants. The number of ESTs corresponding to each of the CC chemokine genes defined in this study varies from one to several dozen, with GmSCYA123 having the highest representation (>70 ESTs) in the Atlantic cod EST database. Also, EST data suggests that the expression of some CC chemokines is restricted to certain tissues while other CC chemokines seem to be expressed in a wide selection of tissues. For example, ESTs corresponding to CC chemokines such as GmSCYA109, GmSCYA112, GmSCYA113 and GmSCYA114a have been identified only in head kidney libraries whereas GmSCYA106, GmSCYA108, GmSCYA111 appear only in kidney and spleen libraries. The opposite situation was found in CC chemokines such as GmSCYA124 which was found in larvae,

907

liver, intestine, digestive tissue, pyloric caeca and gill libraries or GmSCYA123, which displays the broadest tissue distribution, with ESTs identified in liver, spleen, kidney, gill, pyloric caeca and brain libraries (Supplemental data 1). 3.2. Classification of Atlantic cod CC chemokines, their relation to other functional groups and their diversity By convention, chemokine genes are designated by SCY (small inducible cytokine) followed by a letter, A, B, C, or D, corresponding to the chemokine subfamilies CC (or ␤), CXC (or ␣), C (or ␥), and CX3C (or ␦), respectively, and a number (see Online Mendelian Inheritance in Man—OMIM; http://www.ncbi.nlm.nih.gov/omim) (Rossi and Zlotnik, 2000; Zlotnik and Yoshie, 2000; Murphy et al., 2000; Peatman and Liu, 2007; Kuroda et al., 2003). For Atlantic cod, we adopted this nomenclature with the minor changes proposed for fish CC chemokine sequences by Kuroda et al. (2003). To prevent confusion between human and fish symbols, Kuroda et al. (2003) recommended to number fish CC chemokines in a 100 series (i.e., SCYA101, SCYA102, etc.) and prefix them with a abbreviated form of the scientific genus and species name. Where necessary, a letter was added after the number, to indicate allelic variants. Multiple alignments and phylogenetic analyses of Atlantic cod CC chemokines revealed the presence of seven clusters of sequences, likely resulting from species-specific gene duplications, and two unique sequences (Fig. 1, Supplemental data 2–4). Phylogeny was unsuccessful in revealing orthologous relationships between any of these sequences and the mammalian SCYA/CCL sequences (mammalian genes are designated SCYA1 through SCYA27 in the standardized nomenclature system while the corresponding proteins are referred to as CCL–CC chemokine ligands (Rossi and Zlotnik, 2000; Zlotnik and Yoshie, 2000; Murphy et al., 2000)). In the absence of a clear orthology between Atlantic cod CC chemokines and other fish and mammalian CC chemokines, we numbered the Atlantic cod CC chemokines based on their distribution in the aforementioned seven clusters, starting with sequences clustering within the Fish CC chemokine group described by Peatman and Liu (2007) (Fig. 1, Supplemental data 4). The Fish CC chemokine group represents the only major phylogenetic clade showing significant statistical support; this group comprises only teleost sequences and has no equivalent in mammals (Nomiyama et al., 2008; Peatman and Liu, 2007; Laing and Secombes, 2004b). Most CC chemokines in the Fish group show species-specific clustering suggesting that these sequences resulted from multiple gene duplications that occurred within all taxa; therefore true orthologs are difficult to identify in this group (Fig. 1, Supplemental data 4). To distinguish between the Fish CC chemokine group described by Peatman and Liu (2007), and the other fishes-only clade identified in this study (see below), the Fish group sensu Peatman and Liu (2007) was labelled henceforth as Fish group 1. Two well-supported Atlantic cod CC chemokine clades are apparent in this group; the first cluster comprises three sequences (GmSCYA101–103) while the second, larger one, contains 12 distinct sequences, i.e. 10 putative genes and 2 allelic variants (GmSCYA104–113) (Fig. 1, Supplemental data 1–4). The ORFs of most Atlantic cod CC chemokines in the Fish clade consist of approximately 100 amino acids; however, GmSCYA108, GmSCYA109 and GmSCYA111 represent exceptions from this observation, as they have considerable longer ORFs, with a maximum length of 140 amino acids observed for GmSCYA109. Notably, these differences in length are due to large insertions, which may have resulted from unequal recombination events, affecting the stop codon region but not the 5 and 3 untranslated regions (UTRs), which are highly conserved in all GmSCYA104–113 sequences (Supplemental data 3). Also, it appears that GmSCYA103 was either generated through multiple recombination events involv-

908

T. Borza et al. / Developmental and Comparative Immunology 34 (2010) 904–913

Fig. 1. Bayesian analysis of CC chemokines from different teleost fishes, human and mouse. (WAG model; 1,000,000 generations; gamma 4, sample frequency 100; burnin 2000). Atlantic cod (Gm), channel catfish (Ip), zebrafish (Dr), rainbow trout (Om) human (Hs) and mouse (Mm) CC chemokine sequences. MIP–macrophage inflammatory protein group; MCP–monocyte chemotactic protein group; CCL–CC chemokine ligand. GenBank accession numbers of the sequences used in phylogeny are listed in Supplemental Data 4. The statistical support for internal nodes is shown at the corresponding branches; only values ≥0.6 are shown. The nomenclature of the CC chemokine groups is similar to that used by Peatman and Liu (2007) and Nomiyama et al. (2008). Atlantic cod CC chemokines whose expression was analyzed in four immune-related tissues are indicated by a dot. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.).

ing different genes, or represents a trans-spliced form, since its ORF shows intermediate characteristics between GmSCYA101 and GmSCYA102, whereas its 3 UTR is identical to that of GmSCYA102 (Supplemental data 2 and 3). These examples suggest that, in addition to duplication events, other evolutionary mechanisms appear to contribute to CC chemokine diversification in Atlantic cod. CC chemokines GmSCYA114–118 are grouped in a long branching cluster which we have designated as the Atlantic cod clade by analogy with other species-specific clades described by Nomiyama et al. (2008). This cluster, containing exclusively Atlantic cod sequences, is loosely related to a large number of sequences that comprise, or show affinities with, three functional groups described in mammals, i.e., the macrophage inflammatory protein group (MIP), the monocyte chemotactic protein (MCP) group, and the 17/22 group (Fig. 1, Supplemental data 4) (Laing and Secombes, 2004a; Nomiyama et al., 2008; Peatman and Liu, 2007; Laing and Secombes, 2004b). The Atlantic cod CC chemokines from this clade are 91 amino acids long, with one exception (GmSCYA118c), and show high levels of sequence conservation in their 5 UTR and coding regions, but their 3 UTR is clearly divergent, for example when GmSCYA114 to GmSCYA117 are compared with GmSCYA118 variants (Supplemental data 2 and 3).

CC chemokines GmSCYA119–121 tend to cluster in one clade in NJ (JTT model) and Bayesian analyses; these sequences and other fish CC chemokines were assigned to a group described here as Fish group 2. The evolutionary affinities of this group to other groups described in mammals are unclear; however, some weak affinities could be ascertained with the CCL groups 19, 20 and 27/28, described by Peatman and Liu (2007) (Fig. 1, Supplemental data 4). Analysis of the translated and untranslated regions of GmSCYA119 and GmSCYA120 indicate that these CC chemokines probably resulted from a single gene duplication event. These sequences are only remotely related to the two forms of GmSCYA121, which are characterized by an extended C-terminus (Supplemental data 2 and 3). All phylogenetic methods employed in this study revealed the tendency of GmSCYA122 and GmSCYA124 to cluster with the channel catfish, rainbow trout and zebrafish CC chemokines IpSCYA103, OmCK9 and Dr11a, respectively, but failed to reveal a well-supported relationship between this cluster and other fish and mammalian sequences. However, some topologies suggest weak affinities with fish and mammalian sequences related to the CCL groups 21 or 25 (Fig. 1, Supplemental data 4). GmSCYA123 is the only Atlantic cod CC chemokine that clusters with other fish and

T. Borza et al. / Developmental and Comparative Immunology 34 (2010) 904–913

909

Table 2 The expression (relative quantity) of the 12 Atlantic cod CC chemokine genes in four immune-related tissues. QPCR analysis was performed using the Ct method and ubiquitin as a reporter gene. Data for every CC chemokine and tissue type was normalized relative to the tissue with the lowest expression. Atlantic cod CC chemokine

Functional group assignment

Fold difference relative to the tissue with the lowest expression (mean ± SD) Head kidney

GmSCYA 101 GmSCYA102 GmSCYA106a, b GmSCYA108 GmSCYA109 GmSCYA113 GmSCYA 114 GmSCYA 118a-c GmSCYA 120 GmSCYA 122 GmSCYA 123 GmSCYA 124a, b

Fish group Fish group Fish group Fish group Fish group Fish group Atlantic cod clade Atlantic cod clade Fish group 2 CCL21 or 25 CCL19 CCL21 or 25

105.9 5.3 1.2 1.0 2.6 7.5 3.4 3.1 8.2 632.0 6. 9 4.4

mammalian sequences into the CCL 19 group. Two allelic variants were assigned to GmSCYA124 whereas only limited polymorphism was observed for GmSCYA123 despite a very large number of ESTs (>70 ESTs) identified in GenBank as corresponding to this CC chemokine (Supplemental data 1–3). 3.3. QPCR analyses of the expression of 12 CC chemokines in unstimulated immune-related tissues Phylogenetic analyses indicate that Atlantic cod CC chemokines tend to group in several more or less well-defined clades; at least one sequence from each of these clades was selected for expression studies. From the total number of 12 CC chemokines that were selected six belong to the Fish group 1, two to the Atlantic cod clade and CCL21/25, respectively, while one sequence was selected from each, the Fish group 2 and CCL19 (Table 2). QPCR analyses revealed that all of the 12 putative CC chemokines are expressed in all of the unstimulated immune-related tissues (head kidney, liver, spleen and blood) but their expression varied broadly, with some of them showing relatively higher levels of expression in particular tissues (Table 2, Supplemental data 5). The largest difference in expression among tissues was observed for GmSCYA122 where transcript abundance in spleen was >5000 times higher than in blood, ∼9 times higher than in head kidney and ∼90 times higher than in liver. Large differences were also observed for GmSCYA101 which also had relatively high levels of expression in head kidney, liver and spleen samples when compared to the blood samples. These large fold changes originate in part from the fact that GmSCYA101 and GmSCYA122 had the lowest levels of expression in blood samples of all the CC chemokines analyzed, and not because these genes display higher levels of expression in all tissues examined (Supplemental data 5). In the cases of GmSCYA114, GmSCYA120, and GmSCYA123 relatively high levels of expression were observed in only one of the four tissues analyzed (Table 2). Expression patterns of the CC chemokines assigned to the Fish group 1 varied considerably despite high levels of sequence similarity; GmSCYA102, GmSCYA106 and GmSCYA113 displayed the highest levels of expression in spleen, GmSCYA108 and GmSCYA109 in blood while GmSCYA101 showed the highest level of expression in liver (Table 2). 3.4. Induction of CC chemokines by A. salmonicida and pIC analyzed by QPCR Stimulation with formalin-killed atypical A. salmonicida, or the viral mimic pIC, resulted in increased expression for almost all of the Atlantic cod CC chemokines analyzed, but the degree

± ± ± ± ± ± ± ± ± ± ± ±

8.9 0.7 0.2 0.2 0.5 2.3 0.4 0.3 0.5 120.7 0.7 1.9

Liver 208.5 4.9 1.5 2.3 4.5 2.4 53.4 1.0 6.3 59.2 3.1 2.6

Spleen ± ± ± ± ± ± ± ± ± ± ± ±

22.7 0.3 0.1 0.1 2.4 0.3 6.8 0.1 0.2 5.2 0.3 1.0

142.2 7.1 9.0 1.8 1.1 12.4 7.9 8.4 55.4 5451.1 58.1 1.2

Blood ± ± ± ± ± ± ± ± ± ± ± ±

20.9 0.6 0.3 0.3 0.5 3.4 0.4 1.4 0.6 382.7 4.8 0.4

1.0 1.0 1.0 2.9 9.3 1.0 1.0 1.6 1.0 1.0 1.0 1.9

± ± ± ± ± ± ± ± ± ± ± ±

0.2 0.2 0.2 0.3 0.6 0.2 0.2 0.4 0.2 0.2 0.2 1.0

and timing of activation, and the tissues involved, varied widely (Tables 3 and 4). Low levels of activation (<2-fold up-regulation) by A. salmonicida were observed in GmSCYA106, GmSCYA114 and GmSCYA118. Conversely, GmSCYA101, GmSCYA108 and GmSCYA123 showed large changes in expression (i.e., at least a 5-fold increase) in at least one tissue. A stronger early activation (i.e., early response fold increase > late response values) triggered by A. salmonicida was observed in GmSCYA101 GmSCYA102, GmSCYA108 and GmSCYA113 while GmSCYA109, GmSCYA120, GmSCYA122, GmSCYA123 and GmSCYA124 displayed a stronger late response in at least one tissue. The pattern of activation triggered by the viral mimic pIC was also complex. Low levels of activation (<2-fold up-regulation) were found in GmSCYA109, GmSCYA114 and GmSCYA118 while large changes in expression (i.e., at least a 10-fold increase) were determined in GmSCYA108, GmSCYA113, GmSCYA123 and GmSCYA124. A strong early response was determined in CC chemokines such as GmSCYA108 (all four tissues) and GmSCYA124 (liver and blood) while substantial up-regulation in all four tissues analyzed at both early and late time points, was observed in GmSCYA123. The activation pattern of the 12 Atlantic cod chemokines in response to the two inducers was similar in some cases. For example, both inducers enhanced the expression of GmSCYA108 and GmSCYA123 in almost all immune-related tissues. However, the timing of activation was different in some situations; e.g., GmSCYA113 showed an early response upon stimulation with A. salmonicida but a late response following stimulation with pIC in liver samples. Conversely, pIC triggered a dramatic early response of GmSCYA124 in liver samples and a minor response in blood samples while moderate, late response effects, were elicited in liver, spleen and blood by A. salmonicida. GmSCYA123 represents the only Atlantic cod CC chemokine whose expression was previously analyzed (Feng et al., 2009; Rise et al., 2008); these studies, using spleen and head kidney samples with A. salmonicida as inducer (Feng et al., 2009), or spleen samples with pIC as inducer (Rise et al., 2008), also reported a strong up-regulation of GmSCYA123 in these tissues. Interesting patterns of activation were obvious also for CC chemokines from the Fish group 1 such as GmSCYA101 and GmSCYA102, or GmSCYA108 and GmSCYA109, that show high sequence similarity (Fig. 1, Supplemental data 2–4), indicating that though these CC chemokines diverge by only a few amino acid residues their inducer- and tissue- specificity can be dramatically different. Overall, these results suggest that many of the Atlantic cod CC chemokines can be regarded as inflammatory, or having mixed functions, as they displayed a significant increase in expression in blood samples, likely reflective of leukocyte response, and in the other immune-related tissues, caused by either, or both, of the inducers.

910

T. Borza et al. / Developmental and Comparative Immunology 34 (2010) 904–913 Table 3 The expression (relative quantity) of the 12 Atlantic cod CC chemokine genes in four immune-related tissues after induction with formalin-killed A. salmonicida. QPCR analysis was performed using the Ct method and ubiquitin as a reporter gene. Data for every CC chemokine and tissue type was normalized relative to uninduced tissue. The numbers in black boxes correspond to >2-fold average up-regulation while the numbers in grey boxes to >2-fold average down-regulation.

4. Discussion The ESTs corresponding to the various Atlantic cod CC chemokines were sequenced from a number of cDNA libraries generated from various tissues; moreover, many individual fish of different geographical origin contributed to these cDNA libraries, some of which were also subjected to stimuli such as thermal stress (Hori et al., 2010) or administration of the formalin-killed atypical A. salmonicida (Feng et al., 2009) or the viral mimic pIC (Bowman et al., in press; Rise et al., 2008). As a result, in addition to inherent difficulties of clustering ESTs corresponding to members

of a fast evolving gene family, characterized by multiple duplications, rearrangements and high substitution rates (Waterston et al., 2002; CTCSaA, 2005) we had to cope with polymorphisms that could also represent variation of genes within, or between, individuals. Sequence variability in CC chemokines is well documented, especially in humans, where polymorphisms found in 14 of the 26 members of the CC chemokine family are associated with diseases (Colobran et al., 2007a,b; Mortier et al., 2008). To overcome this intrinsic problem we performed extensive Neighbor-Joining phylogenetic analyses, before EST clustering, to assess the relatedness of the ESTs corresponding to each of the Atlantic cod CC

Table 4 The expression (relative quantity) of the 12 Atlantic cod CC chemokine genes in four immune-related tissues after induction with pIC. QPCR analysis was performed using the Ct method and ubiquitin as a reporter gene. Data for every CC chemokine and tissue type was normalized relative to uninduced tissue. The numbers in black boxes correspond to >2-fold average up-regulation while the numbers in grey boxes to >2-fold average down-regulation.

T. Borza et al. / Developmental and Comparative Immunology 34 (2010) 904–913

chemokines described in this study. Also, in most cases, polymorphisms were found to be shared by several ESTs, so we are confident that clustering did not reduce sequence diversity and our analysis provides a thorough representation of the variability present at cod CC chemokine loci. We identified 32 unique Atlantic cod CC chemokine sequences; 24 of these are likely to correspond to different genes while the rest are predicted to be allelic variants. Recently, a comparative study of zebrafish, torafugu and spotted green pufferfish, for which extensive genome sequence data is available, reported 81 zebrafish CC chemokine genes, with only 11 genes reported for each of the other two species that have compact genomes (Nomiyama et al., 2008; Johansen et al., 2009). However, not all of the CC chemokine genes identified in zebrafish have matching transcripts among the zebrafish ESTs (Nomiyama et al., 2008; Peatman and Liu, 2007), raising questions regarding of how many of the duplicated loci are expressed (Peatman and Liu, 2007). The search of 431,774 ESTs from Atlantic salmon (S. salar) resulted in the identification of 30 CC chemokines (Peatman and Liu, 2007) while 17 CC chemokines have been identified in rainbow trout (Peatman and Liu, 2007; Laing and Secombes, 2004b) and 28 in channel catfish (Peatman and Liu, 2007). Therefore the number of Atlantic cod CC chemokine sequences indentified in this study is within the range of CC chemokines reported for various fishes. Clearly, the total number of Atlantic cod CC chemokine genes will be ascertained only when the genome of this species is made available; however, taking into account the large ESTs dataset we analyzed, we anticipate that this study succeeded in characterizing the majority of the CC chemokines expressed in this species. Several studies have used phylogenetic analyses with the aim of relating fish CC chemokines with the various groups of CC chemokines described in the mammalian taxa (Peatman et al., 2005; Peatman and Liu, 2007; He et al., 2004; Laing and Secombes, 2004b; Kuroda et al., 2003). The assignment of the various fish sequences to the CC chemokine functional groups described in mammals by phylogeny is difficult because most of the phylogenetic analyses of vertebrate CC chemokine show low bootstrap values and/or inconsistent/different grouping (Peatman et al., 2005, 2006; Laing and Secombes, 2004b; Kuroda et al., 2003; Peatman and Liu, 2006), as well as unresolved branching order (He et al., 2004). Moreover, the overall topology of phylogenetic trees is strongly influenced by the number of sequences included in analyses, the sequence alignment generated and the method used in phylogeny (Nomiyama et al., 2008; Peatman and Liu, 2007). Using CC chemokine data from zebrafish, channel catfish, trout, salmon, mouse and human, Peatman and Liu (2007) indicated that phylogeny allows the assignment of fish and mammalian sequences to seven groups, six of which are represented by fish/mammalian sequences and only one by fish sequences. Our phylogenetic analyses used, in addition to Atlantic cod data, most of the CC chemokines and taxa used by Peatman and Liu (2007). All methods that we used for phylogenetic analyses failed to find any support for the monocyte chemotactic protein and macrophage inflammatory protein groups, while some limited affinities could be ascertained to the clades corresponding to human CCL 19, 21 and 25. Stronger support was observed for the groups CCL20, CCL17/22 and CCL27/28 and for the Fish group 1 (Fig. 1, Supplemental data 4). Using an expanded dataset of fish sequences, Nomiyama et al. (2008) also reported the lack of support for the large MIP and MCP groups whereas the other CC chemokine groups seemed to hold in their analyses. Additionally, Nomiyama et al. (2008) described several well-supported clades that are species-specific, i.e., two channel catfish-specific clades (IpSCYA104, 105, 108, 120 and 124 and IpSCYA111, 117, 121, 122) and several zebrafish-specific clades. Our analyses support the presence of these groups and suggest that Atlantic cod CC chemokines such as GmSCYA114–118 followed a similar evolutionary path entailing substantial sequence diver-

911

gence. It is possible that this group of Atlantic cod CC chemokines, which show extensive sequence divergence and, therefore, long branches when compared with other CC chemokines, occurred through evolutionary mechanisms including neofunctionalization by weak gene conversion and high substitution rates (Osada and Innan, 2008) and frequent birth-and-death of duplicated genes. Conversely, we found that GmSCYA119–121 tend to cluster with IpSCYA 116 and 118, OmCK6 and Dr2c defining a second “fish-only” group (Fish group 2). Interestingly, Nomiyama et al. (2008) found that CC chemokines from this group are related to zebrafish CXC chemokines and to the newly described CX chemokine subfamily; clearly, more data including diverse fish CXC chemokines is needed to substantiate this relationship. Overall, the distribution of Atlantic cod CC chemokines among the various functional groups did not conform to the general pattern observed in other fish species. For example, previous studies (Nomiyama et al., 2008; Peatman and Liu, 2007), as well as our analyses (Fig. 1, Supplemental data 4), indicate that CCL17/22, CCL 20 and CCL27/28 groups comprise both fish and mammalian sequences, and that every species contributes at least one CC chemokine sequence to each of these groups. However, extensive tblastn searches of Atlantic cod EST data with fish and mammalian sequences, as well as molecular phylogentic analyses, failed to identify any homologous sequences to these groups in Atlantic cod. At this point we can speculate that either these homologs remain to be identified in Atlantic cod as their expression is very low, thus it was not possible to find them with the current depth of EST sequencing data. Alternatively, it is possible that Atlantic cod lacks homologous sequences to these groups and, therefore, its immune system exhibits peculiar traits in addition to its known ineffectiveness in producing specific antibodies upon immunization (Pilström et al., 2005). Comparative genomic analyses revealed that mammalian CC chemokines are fast evolving proteins (Waterston et al., 2002; CTCSaA, 2005) and, therefore, the identification of orthologous sequences is difficult even within this taxonomic group (Murphy et al., 2000; Nomiyama et al., 2003; Mestas and Hughes, 2004). The problem of studying CC chemokine in fish species such as Atlantic cod, channel catfish, rainbow trout and zebrafish is that most of these taxa belong to teleost groups that diverged earlier than the appearance of placental mammals (Nomiyama et al., 2008; DeVries et al., 2006). As a consequence, while differences between mouse and human CC chemokines, for example, are likely to reflect evolutionary patterns and to offer clues in understanding their biological functions, differences between evolutionarily highly divergent fish species may be too large to allow us to infer functional roles based on phylogenetic relatedness. This might also hold true for the observation that there is a correlation between CC chemokine genomic architecture and the inducibility of their expression, with inflammatory CC chemokines found on large clusters, and a few homeostatic CC chemokines distributed among several chromosomes (Murphy et al., 2000; Nomiyama et al., 2008, 2003, 2001; He et al., 2004; Colobran et al., 2007b). Although this correlation might be valid in mammals and birds it remains to be demonstrated in teleost fish. For example, our data and other studies (Feng et al., 2009; Rise et al., 2008) indicate that the expression of GmSCYA123 is strongly enhanced in immune-related tissues upon stimulation with formalin-killed atypical A. salmonicida or the viral mimic pIC; therefore it can be considered as an inducible (inflammatory) CC chemokine. However, all molecular phylogenetic analyses employed in this study indicated that GmSCYA123 shows affinities to the CCL19 group, though human SCYA19/CCL19 is a member of homeostatic (constitutive) CC chemokines. On the other hand, recent studies pointed out that the expression of all CC chemokines analyzed in rainbow trout and gilthead seabream (Sparus aurata) can be induced by specific inducers in at least one distinct tissue (Cuesta et al., 2010; Montero et al., 2009; Sanchez et

912

T. Borza et al. / Developmental and Comparative Immunology 34 (2010) 904–913

al., 2007). Similarly, we found that all Atlantic cod CC chemokines we examined were expressed constitutively in all of the immunerelated tissues examined; in addition, all displayed significant up-regulation in at least one of the four immune-related tissues analyzed, caused by either, or both, of the inducers employed in this study. Taken together, our results suggest that these 12 Atlantic cod CC chemokines should be regarded as having both homeostatic and inflammatory functions. These results, along with those of other authors (Cuesta et al., 2010; Montero et al., 2009; Sanchez et al., 2007), suggests that many fish CC chemokines will likely have such a dual role, raising the question of whether the division into inflammatory (inducible) or homeostatic (constitutive) groups is valid for fish (Cuesta et al., 2010). It is our opinion that direct analyses of gene expression, tissue specificity and response to various inducers represent a more reliable, though demanding, way to assess the function of fish CC chemokines. Our finding that Atlantic cod CC chemokines such as GmSCYA101 and GmSCYA102, or GmSCYA108 and GmSCYA109, display different tissue expression patterns and dissimilar response to inducers, despite having considerable sequence conservation, provides additional support for this observation. Acknowledgements This study was supported by Genome Canada, Genome Atlantic, and the Atlantic Canada Opportunities Agency through the Atlantic Cod Genomics and Broodstock Development Project and through an NSERC Discovery grant to Sharen Bowman. A complete list of supporting partners can be found at www.codgene.ca/partners.php. We would like to thank Dr. Amber Garber and the staff of the Huntsman Marine Sciences Centre/St. Andrews Biological Station for spawning and rearing the fish used in these experiments and to Dr. Luis Afonso (BC Centre for Aquatic Health Sciences, Campbell River, BC) for helping with fish inoculation and sampling. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.dci.2010.03.011. References Bao, B., Peatman, E., Peng, X., Baoprasertkul, P., Wang, G., Liu, Z., 2006. Characterization of 23 CC chemokine genes and analysis of their expression in channel catfish (Ictalurus punctatus). Dev. Comp. Immunol. 30 (9), 783–796. Barinka, C., Prahl, A., Lubkowski, J., 2008. Structure of human monocyte chemoattractant protein 4 (MCP-4/CCL13). Acta Crystallogr. D Biol. Crystallogr. 64 (Pt 3), 273–278. Borza, T., Stone, C., Gamperl, A.K., Bowman, S., 2009. Atlantic cod (Gadus morhua) hemoglobin genes: multiplicity and polymorphism. BMC Genet. 10, 51. Bowman, S., Hubert, S., Higgins, B., Stone, C., Kimball, J., Borza, T. et al. An integrated approach to gene discovery and marker development in Atlantic cod (Gadus morhua). Mar. Biotechnol., doi:10.1007/s10126-010-9285-z, in press. Colobran, R., Pujol-Borrell, R., Armengol, M.P., Juan, M., 2007a. The chemokine network. I. How the genomic organization of chemokines contains clues for deciphering their functional complexity. Clin. Exp. Immunol. 148 (2), 208–217. Colobran, R., Pujol-Borrell, R., Armengol, M.P., Juan, M., 2007b. The chemokine network. II. On how polymorphisms and alternative splicing increase the number of molecular species and configure intricate patterns of disease susceptibility. Clin. Exp. Immunol. 150 (1), 1–12. Consortium TCSaA, 2005. Initial sequence of the chimpanzee genome and comparison with the human genome. Nature 437 (7055), 69–87. Cuesta, A., Dios, S., Figueras, A., Novoa, B., Esteban, M.A., Meseguer, J., et al., 2010. Identification of six novel CC chemokines in gilthead seabream (Sparus aurata) implicated in the antiviral immune response. Mol. Immunol. 47 (6), 1235–1243. DeVries, M.E., Kelvin, A.A., Xu, L., Ran, L., Robinson, J., Kelvin, D.J., 2006. Defining the origins and evolution of the chemokine/chemokine receptor system. J. Immunol. 176 (1), 401–415. Edgar, R.C., 2004. MUSCLE: a multiple sequence alignment method with reduced time and space complexity. BMC Bioinform. 5, 113. Feng, C.Y., Johnson, S.C., Hori, T.S., Rise, M., Hall, J.R., Gamperl, A.K., et al., 2009. Identification and analysis of differentially expressed genes in immune tissues

of Atlantic cod stimulated with formalin-killed, atypical Aeromonas salmonicida. Physiol. Genomics 37 (3), 149–163. Guindon, S., Gascuel, O., 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol. 52 (5), 696–704. Hall, T.A., 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for windows 95/98/NT. Nucl. Acids Symp. Ser., 4195–4198. He, C., Peatman, E., Baoprasertkul, P., Kucuktas, H., Liu, Z., 2004. Multiple CC chemokines in channel catfish and blue catfish as revealed by analysis of expressed sequence tags. Immunogenetics 56 (5), 379–387. Hori, T.S., Gamperl, A.K., Afonso, L.O., Johnson, S.C., Hubert, S., Kimball, J., et al., 2010. Heat-shock responsive genes identified and validated in Atlantic cod (Gadus morhua) liver, head kidney and skeletal muscle using genomic techniques. BMC Genomics 11 (1), 72. Johansen, S.D., Coucheron, D.H., Andreassen, M., Karlsen, B.O., Furmanek, T., Jorgensen, T.E., et al., 2009. Large-scale sequence analyses of Atlantic cod. N. Biotechnol. 25 (5), 263–271. Koski, L.B., Gray, M.W., Lang, B.F., Burger, G., 2005. AutoFACT: an automatic functional annotation and classification tool. BMC Bioinform. 6, 151. Kuroda, N., Uinuk-ool, T.S., Sato, A., Samonte, I.E., Figueroa, F., Mayer, W.E., et al., 2003. Identification of chemokines and a chemokine receptor in cichlid fish, shark, and lamprey. Immunogenetics 54 (12), 884–895. Laing, K.J., Secombes, C.J., 2004a. Chemokines. Dev. Comp. Immunol. 28 (5), 443–460. Laing, K.J., Secombes, C.J., 2004b. Trout CC chemokines: comparison of their sequences and expression patterns. Mol. Immunol. 41 (8), 793–808. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) Method. Methods 25 (4), 402–408. Mestas, J., Hughes, C.C., 2004. Of mice and not men: differences between mouse and human immunology. J. Immunol. 172 (5), 2731–2738. Montero, J., Chaves-Pozo, E., Cuesta, A., Tafalla, C., 2009. Chemokine transcription in rainbow trout (Oncorhynchus mykiss) is differently modulated in response to viral hemorrhagic septicaemia virus (VHSV) or infectious pancreatic necrosis virus (IPNV). Fish Shellfish Immunol. 27 (6), 661–669. Mortier, A., Van Damme, J., Proost, P., 2008. Regulation of chemokine activity by posttranslational modification. Pharmacol. Ther. 120 (2), 197–217. Murphy, P.M., Baggiolini, M., Charo, I.F., Hebert, C.A., Horuk, R., Matsushima, K., et al., 2000. International union of pharmacology. XXII. Nomenclature for chemokine receptors. Pharmacol. Rev. 52 (1), 145–176. Nomiyama, H., Mera, A., Ohneda, O., Miura, R., Suda, T., Yoshie, O., 2001. Organization of the chemokine genes in the human and mouse major clusters of CC and CXC chemokines: diversification between the two species. Genes Immun. 2 (2), 110–113. Nomiyama, H., Egami, K., Tanase, S., Miura, R., Hirakawa, H., Kuhara, S., et al., 2003. Comparative DNA sequence analysis of mouse and human CC chemokine gene clusters. J. Interferon. Cytokine Res. 23 (1), 37–45. Nomiyama, H., Hieshima, K., Osada, N., Kato-Unoki, Y., Otsuka-Ono, K., Takegawa, S., et al., 2008. Extensive expansion and diversification of the chemokine gene family in zebrafish: identification of a novel chemokine subfamily CX. BMC Genomics 9, 222. Olsvik, P.A., Softeland, L., Lie, K.K., 2008. Selection of reference genes for qRT-PCR examination of wild populations of Atlantic cod Gadus morhua. BMC Res. Notes 1, 47. Osada, N., Innan, H., 2008. Duplication and gene conversion in the Drosophila melanogaster genome. PLoS Genet. 4 (12), e1000305. Page, R.D., 1996. TreeView: an application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 12 (4), 357–358. Peatman, E., Liu, Z., 2006. CC chemokines in zebrafish: evidence for extensive intrachromosomal gene duplications. Genomics 88 (3), 381–385. Peatman, E., Liu, Z., 2007. Evolution of CC chemokines in teleost fish: a case study in gene duplication and implications for immune diversity. Immunogenetics 59 (8), 613–623. Peatman, E., Bao, B., Baoprasertkul, P., Liu, Z., 2005. In silico identification and expression analysis of 12 novel CC chemokines in catfish. Immunogenetics 57 (6), 409–419. Peatman, E., Bao, B., Peng, X., Baoprasertkul, P., Brady, Y., Liu, Z., 2006. Catfish CC chemokines: genomic clustering, duplications, and expression after bacterial infection with Edwardsiella ictaluri. Mol. Genet. Genomics 275 (3), 297–309. Pilström, L., Warr, G.W., Strömberg, S., 2005. Why is the antibody response of Atlantic cod so poor? The search for a genetic explanation. Fish. Sci., 71961–71971. Rise, M.L., Hall, J., Rise, M., Hori, T., Gamperl, A.K., Kimball, J., et al., 2008. Functional genomic analysis of the response of Atlantic cod (Gadus morhua) spleen to the viral mimic polyriboinosinic polyribocytidylic acid (pIC). Dev. Comp. Immunol. 32 (8), 916–931. Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19 (12), 1572–1574. Rossi, D., Zlotnik, A., 2000. The biology of chemokines and their receptors. Annu. Rev. Immunol., 18217–18242. Saele, O., Nordgreen, A., Hamre, K., Olsvik, P.A., 2009. Evaluation of candidate reference genes in Q-PCR studies of Atlantic cod (Gadus morhua) ontogeny, with emphasis on the gastrointestinal tract. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 152 (1), 94–101. Sanchez, E., Coll, J., Tafalla, C., 2007. Expression of inducible CC chemokines in rainbow trout (Oncorhynchus mykiss) in response to a viral haemorrhagic septicemia virus (VHSV) DNA vaccine and interleukin 8. Dev. Comp. Immunol. 31 (9), 916–926.

T. Borza et al. / Developmental and Comparative Immunology 34 (2010) 904–913 Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary Genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol. 24 (8), 1596–1599. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22 (22), 4673–4680.

913

Waterston, R.H., Lindblad-Toh, K., Birney, E., Rogers, J., Abril, J.F., Agarwal, P., et al., 2002. Initial sequencing and comparative analysis of the mouse genome. Nature 420 (6915), 520–562. Zlotnik, A., Yoshie, O., 2000. Chemokines: a new classification system and their role in immunity. Immunity 12 (2), 121–127.