- Email: [email protected]
ATP release in human kidney cortex and its mitogenic effects in visceral glomerular epithelial cells
Kidney International, Vol. 61 (2002), pp. 1617–1626
ATP release in human kidney cortex and its mitogenic effects in visceral glomerular epithelial cells OLIVER VONEND, VITUS OBERHAUSER, IVAR VON KU¨GELGEN, THOMAS W. APEL, KERSTIN AMANN, EBERHARD RITZ, and LARS CHRISTIAN RUMP Department of Internal Medicine, University of Freiburg, Freiburg; Department of Internal Medicine, Marien Hospital Home, Ruhr-University Bochum, Bochum; Department of Internal Medicine, University of Heidelberg, Heidelberg; Department of Pharmacology, University of Bonn, Bonn; and Department of Pathology, University of Erlangen, Erlangen, Germany
ATP release in human kidney cortex and its mitogenic effects in visceral glomerular epithelial cells. Background. In chronic renal failure the sympathetic nervous system is activated. Sympathetic cotransmitters released within the kidney may contribute to the progression of renal disease through receptor-mediated proliferative mechanisms. Methods. In human renal cortex electrical stimulation induced adenosine 5⬘-triphosphate (ATP; luciferin-luciferase-assay) and norepinephrine (HPLC) release was measured. ATP release also was induced by ␣1- and ␣2-adrenergic agonists. [3H]-thymidine uptake was tested in human visceral glomerular epithelial cells (vGEC) and mitogen-activated protein kinase (MAPK42/44) activation in vGEC and kidney cortex. The involved P2-receptors were characterized pharmacologically and by RT-PCR. Results. Sympathetic nerve stimulation and ␣-adrenergic agonists induced release of ATP from human kidney cortex. Seventy-five percent of the ATP released originated from nonneuronal sources, mainly through activation of ␣2-adrenergic receptors. ATP (1 to 100 mol/L) and related nucleotides (1 to 100 mol/L) increased [3H]-thymidine uptake. The adenine nucleotides ATP, ATP␥S, ADP and ADPS were about equally potent. UTP, UDP and ␣,-methylene ATP had no effect. ATP, ADPS but not ␣,-methylene ATP activated MAPK42/44. ATP induced MAPK42/44 activation, and [3H]-thymidine uptake was abolished in the presence of the MAPK inhibitor PD 98059 (100 mol/L). mRNA for P2X4,5,6,7 and P2Y1,2,4,6,11 were detected in human vGEC by RT-PCR. Conclusions. In human renal cortex, adrenergic stimulation releases ATP from neuronal and non-neuronal sources. ATP has mitogenic effects in vGEC and therefore the potential to contribute to progression in chronic renal disease. The pattern of purinoceptor agonist effects on DNA synthesis together with the mRNA expression suggests a major contribution of a P2Y1like receptor.
Key words: adrenergic stimulation, adenosine 5⬘-triphosphate, purinergic receptors, chronic renal failure, cell proliferation. Received for publication July 9, 2001 and in revised form November 26, 2001 Accepted for publication December 17, 2001
2002 by the International Society of Nephrology
There is convincing evidence that overactivity of the sympathetic nervous system plays a dominant role in renal hypertensive disease [1–3]. The kidneys possess mechanoreceptors and chemoreceptors that are stimulated in damaged kidneys [4]. These afferent sensory signals travel to the central nervous system leading to enhanced efferent sympathetic activity [5]. It is our hypothesis that sympathetic overactivity of renal nerves contributes to progression of renal disease by a direct receptor-mediated stimulation of cell growth [2]. This is based on recent observations in a model of chronic renal failure characterized by sympathetic overactivity [6]. Treatment of subtotally nephrectomized rats with the sympatholytic drug moxonidine, known to inhibit neurotransmitter release within the kidney [7], or a -blocker [8] ameliorated proteinuria and reduced glomerular damage independent from blood pressure effects. There is experimental evidence that norepinephrine is not the only renal neurotransmitter. In kidneys of rats and humans ATP seems to be released as a cotransmitter of norepinephrine [9–13] and has been shown to act as mitogenic signaling molecule in rat mesangial [14] and human smooth muscle cells [15]. Thus, besides norepinephrine itself, the cotransmitter ATP is a prime candidate to be involved in progression of chronic renal disease in the presence of sympathetic overactivity. The present study tested the hypothesis that sympathetic stimulation leads to ATP release in the human kidney and that ATP possesses mitogenic effects in human glomerular epithelial cells (vGEC). We chose this cell type as a model because it is involved in progression of chronic renal failure [16]. A portion of this study was presented at the 4th Annual Meeting of the European Council for Blood Pressure and Cardiovascular Research in Nordwijkerhout (abstract; Rump et al, Hypertension 34:711, 1999). METHODS The present study was approved by the local ethics committee. Human kidneys were obtained from patients
1617
1618
Vonend et al: ATP release in human kidney
undergoing nephrectomy for renal cell carcinoma. Only macroscopic intact renal cortex tissue was used for cell preparation. Renal cortical slices were minced, pushed, and rinsed through a serial of stainless steel sieves of different pore sizes of 40, 80 and finally 120 mesh. Glomeruli retained by the 120 mesh sieves were collected in tubes and centrifuged at 1750 ⫻ g for eight minutes, and suspended in RPMI medium containing 20% fetal calf serum (FCS) with supplements (1% non-essential amino acids; 5 mmol/L HEPES; 1 mmol/L Na-pyruvate, 100 U/mL penicillin; 100 g/mL streptomycin; Biochrom, Berlin, Germany; 1% insulin-transferrin-selenite supplement, Roche Biochemicals, Mannheim, Germany). Glomeruli were then incubated at 37⬚C. Primary cultures and subcultures were maintained at 37⬚C in a 5% CO2 environment. Plates were left undisturbed for the next five to seven days to facilitate primary outgrowth of visceral epithelial cells (vGEC) from glomeruli. Then, the plated cells were trypsinized and passaged. All cells were studied within the first twelve passages. Cell identification of vGEC Cell purity was assessed by the peroxidase anti peroxidase (PAP) staining from Dako Corp. (Hamburg, Germany) following the manufacturer’s instructions. Primary antihuman antibodies used were mouse anti-factor VIII-related antigen, mouse anti-cytokeratin, mouse antivimentin, mouse anti-desmin, mouse anti-smooth muscle actin (all from Dako) and rabbit anti-Wilm’s tumor antigen (WT-1; Santa Cruz Biotechnology, Santa Cruz, CA, USA). Secondary antibodies were mouse anti-rabbit IgG and rabbit anti-mouse IgG (both 1:100; Dako). vGEC used for experiments were cytokeratin- and WT-1–positive, whereas mesangial and renal smooth muscle cells were cytokeratin-positive but showed no staining for WT-1. Analysis of mitogenic effects All experiments to study mitogenic effects were done under growth-arrested conditions. vGEC cells were plated at a density of 30,000 cells/well in 24-well plates and grown to 80% confluence in REBM (renal epithelial cell basis medium; Cellsystems, St. Katharinen, Germany) plus supplement (REGM, renal epithelial cell growth medium; Cellsystems) before they were placed in growth arrest medium (RPMI medium supplemented with 0.5% FCS; 5 g/mL insulin; Sigma, Deisendorf, Germany; and 100 U/mL penicillin/100 g/mL streptomycin) for 72 hours to decrease proliferation. Determination of DNA-synthesis DNA synthesis was measured using [3H]-thymidine incorporation. All studied substances were added to resting cells (4 wells for each concentration) and were present for 24 hours. The cells were incubated with [3H]-thymidine (1 Ci/mL) during the last six hours. The medium
was then aspirated, the cells washed three times with phosphate buffer and for DNA precipitation twice with ice-cold 10% trichloroacetic acid (TCA). The fixed cellular material was solubilized in 1 mL 0.5 mol/L NaOH for two hours and then mixed with 10 mL scintillation fluid (Canberra Packard, Ultima-Gold) to measure the amount of radioactivity present in the TCA insoluble fraction. Data are expressed as the mean of radioactivity present in the four wells with identical concentration. RNA extraction and reverse transcription-polymerase chain reaction of P2X and P2Y receptors RNA was gained from 2 ⫻ 106 cells using the RNAeasy Kit (Qiagen, Hilden, Germany). For the synthesis of the first strand 2 g RNA was used in the superscript firststrand system (Gibco-BRL, Karlsruhe, Germany). Due to a strong signal for P2X5-receptors, only 0.2 g RNA was used for this subtype. The amplification was performed in a volume of 50 L with 10% of the first strand cDNA with AmpliTaq Gold (Applied Biosystems, Weiterstadt, Germany), five minutes at 95⬚C, one minute at 95⬚C, one minute at 55⬚C, one minute at 72⬚C, 35 cycles, and for termination eight minutes at 72⬚C. Ten microliters of the reaction were then analyzed on a 1.5% agarose gel. Primers used were: P2Y1: TGCCAGCCCTGATCTTCTACTACT, ATAC GTGGCATAAACCCTGTCATT P2Y2: GCCGGGGCCGTGTGGGTGTT, CGGGTGA CGTGGAATGGCAGGAA P2Y4: GGGATGCAACGGCCACCTACA, GCACGA AGCAGACAGCAAAGACAG P2Y6: CCCTGCTGGCCTGCTACTGTCTCC, TTCTC CGCATGGTTTGGGGTTGGT P2Y11: CCCCCGCTGGCCGCCTACCTCTTA, GCCC AACCCCGCCAGCACCAG P2Y12: CTCTGTTGTCATCTGGGCATTCAT, GGTT TGGCTCAGGGTGTAAGGA P2X1: CTTTCCACGCTTCAAGGTCAACA, GCCAC CCCAAAGATGCCA AT P2X2: ACAAAGTGTGGGACGTGGAGGA, GGCA AACCTGAAGTTGTAGCCTGA P2X3: TCTGTGCTCCGGACCTGTGAGAT, AAGC GGATGCCAAAAGCCTTCA P2X4: CCTTCTGCCCCATATTCCGTCT, GTTGATC ATAGTGGGGATGATGTCA P2X5a/b: GAGTGCTGTCATCACCAAAGTCAA, CCA GTCGGAAGATGGGGCAGTA P2X6: CCTGTGAGATCTGGAGTTGGTGC, GTGTC CAGGTCACAATCCCAGT P2X7: CGACTTCCCCGGCCACAACTA, TGCCAA AAACCAGGATGTCAAAAC Determination of MAPK42/44 activation Kinetics of MAPK42/44 phosphorylation were done by stimulation of resting vGECs plated on six-well plates
Vonend et al: ATP release in human kidney
with ATP (100 mol/L) for 0, 2, 5, 10, 15 and 20 minutes. For experiments using the mitogen-activated protein (MAP) kinase (MAPK)/extracellular signal-regulated protein kinase (ERK) kinase (MEK) inhibitor PD-98059 (New England BioLabs; Beverly, MA, USA), cells were incubated for 30 minutes at 37⬚C in growth arresting medium that contained the inhibitor before the addition of agonists. After treatment, medium was aspirated and cells were solubilized in 200 L 2⫻ Laemmli sample buffer with 200 mmol/L dithiothreitol (DTT) followed by boiling for five minutes. Lysates were sonicated, and proteins were separated on 10% sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) gels. The proteins were electrophoretically transferred to nitrocellulose in buffer containing 25 mmol/L Tris, 192 mmol/L glycine, 20% methanol, and 0.02% SDS. The nitrocellulose was blocked with 5% nonfat dry milk in 20 mmol/L Tris, pH 7.4, 150 mmol/L NaCl, and 0.01% Tween 20. The membranes were probed either with a polyclonal phosphotyrosyl-MAP kinase-specific antibody (New England BioLabs), which recognizes only the tyrosine-phosphorylated (active) form of p44 MAP kinase (ERK1) and p42 MAP kinase (ERK2) or with a MAP kinase-specific antibody (New England BioLabs), which recognizes the total amount of ERK1 and ERK2. The buffer used for incubation contained 20 mmol/L Tris, pH 7.4, 150 mmol/L NaCl, 3% bovine serum albumin (BSA), and 0.01% Tween 20. The blots were then washed in 20 mmol/L Tris, pH 7.4, 150 mmol/L NaCl, and 0.01% Tween 20, and bound antibody was detected by a horseradish peroxidase-conjugated anti-rabbit IgG and enhanced chemiluminescence (Pierce, Rockford, IL, USA). The detection and estimation of the ratio between activated and total protein was performed with the Kodak Imaging System. The density ratio was used as the quantum of MAPK42/44 activation. MAPK42/44 phosphorylation induced by electrical stimulation at 5 Hz for four minutes (40 mA, 1 ms duration) or by ATP (100 mol/L) also was measured in superfused human renal cortex. ATP (100 mol/L) was added to the perfusion solution for 10 minutes. The tissue samples were harvested immediately after the stimulations and snap frozen. The experimental design of the superfused renal cortex is described in detail below. Norepinephrine and ATP release of human kidney slices by sympathetic nerve stimulation The cortical kidney slices of about 25 mg (diameter 6.5 mm, thickness 0.3 mm) were placed into eight superfusion chambers between two platinum electrodes and were kept in a bath at a temperature of 37⬚C [21]. The slices were superfused at a constant rate of 2 mL/min with Krebs-Henseleit solution [17]. After a stabilization period of 60 minutes there were two periods of electric field stimulation (S1, S2), each 20 Hz for one minute
1619
(40 mA, 1 ms duration). Drugs were applied 15 minutes before S2. Three three-minute samples of the superfusate were collected on ice by using a fraction collector, and were used for the simultaneous determination of norepinephrine and ATP as previously described in detail [10]. Briefly, aliquots (1 mL) of the three threeminute samples were immediately separated after each experiment and kept at ⫺20⬚C until determination of ATP levels, which were assessed by the luciferin-luciferase technique using a LB 953 luminometer (Berthold Systems, Germany). The remaining part of the fractions received 167 L of 1 mol/L HCl, 13.3 L of 0.067 mol/L ethylenediaminetetraacetic acid (EDTA) and 3.3 L of 1 mol/L NaSO4 to prevent norepinephrine degradation. Norepinephrine content was concentrated by adsorbing onto alumina and resolving in 250 L 0.1 mol/L HClO4 and determined by high-pressure liquid chromatography with electrochemical detection (HPLC-ECD; Waters, Eschborn, Germany). All values were corrected for recovery. The ATP release also induced was by adrenergic agonists. In this case, there was no electrical field stimulation but ␣-adrenergic agonists were added to the perfusion solution for one minute instead of S2. The three respective three-minute samples of S1 were taken as a reference value (control without any stimulation). When ␣-adrenergic antagonists were used in the latter experiments, they were added to the perfusion solution from 30 minutes before S1 to the end of the experiment (throughout). Statistics All data are expressed as means ⫾ SEM. Data were analyzed by the unpaired Student t test. Values of P ⬍ 0.05 were considered statistically significant. RESULTS Sympathetic nerve stimulation and release of ATP and norepinephrine in human cortical kidney slices Electric field stimulation of human cortical kidney slices induced concomitant release of ATP and norepinephrine in S1 and S2 (Fig. 1). Upon stimulation the slices released more ATP (total stimulation induced release in S1, 0.24 ⫾ 0.03 pmol/mg kidney cortex; N ⫽ 21) than norepinephrine (0.12 ⫾ 0.01 pmol/mg kidney cortex; N ⫽ 21). S2 to S1 ratios for ATP and norepinephrine were about 0.75 and set as 100% (control). When the sodium channel blocker tetrodotoxin (1 mol/L) was added before the second stimulation period, the ATP and norepinephrine release was abolished (Fig. 2). In the presence of complete ␣-adrenergic blockade by a combination of the preferential ␣1-adrenergic antagonist prazosin (3 mol/L) and the preferential ␣2-adrenergic antagonist rauwolscine (1 mol/L) the stimulation induced release of ATP was reduced to about 25% of control (Fig.
1620
Vonend et al: ATP release in human kidney
triphosphate (UTP; 1 to 100 mol/L), uridine diphosphate (UDP; 1 to 100 mol/L; data not shown) and ␣,methylene ATP (1 to 100 mol/L) had no effect in vGEC. BzATP (100 mol/L) and BzATP (300 mol/L) reduced [3H]-thymidine uptake to 49 ⫾ 8.4% (N ⫽ 8) and 24.2 ⫾ 2.3% of control (N ⫽ 7), respectively. The P2-receptor antagonist suramin (30 mol/L; Fig. 5), known to block a number of P2-subtypes, and the MAPK inhibitor PD 98059 (100 mol/L) reduced basal (23.1% ⫾ 2.2 of control; N ⫽ 3) and ATP induced [3H]-thymidine uptake in vGEC (Fig. 6A).
Fig. 1. Adenosine 5ⴕ-triphosphate (ATP) and norepinephrine release from human cortical kidney slices. There were two periods of electrical field stimulation in each experiment (S1 and S2), each for one minute at 20 Hz. (A) Release of endogenous ATP (N ⫽ 21). (B) Release of endogenous norepinephrine (N ⫽ 21). Data are means ⫾ SEM.
2A), whereas the norepinephrine release was slightly but not significantly enhanced (Fig. 2B). ATP release stimulated by ␣-adrenergic agonists in human kidney cortex The selective ␣2-adrenergic agonist UK 14304 (1 mol/L) potently stimulated ATP release and this effect was blocked by rauwolscine (0.1 mol/L; Fig. 3A) but not by prazosin (0.3 mol/L; data not shown). The selective ␣1-adrenergic agonist methoxamine (10 mol/L) stimulated ATP release (Fig. 3B), but this effect was much smaller than that of UK 14304. The effect of methoxamine was inhibited by prazosin (0.3 mol/L). Nucleotide-induced [3H]-thymidine uptake human glomerular epithelial cells (vGEC) in culture In human vGEC ATP (1 to 100 mol/L), adenosine diphosphate-S (ADPS; 1 to 100 mol/L), ADP (1 to 100 mol/L) and ATP␥S (1 to 100 mol/L) increased [3H]-thymidine uptake in a concentration dependent manner (Fig. 4). ATP, ATP␥S and ADP were about equally potent and effective. ADPS induced a smaller response at the concentration of 100 mol/L. Uridine
Involvement of the MAPK pathway In human visceral glomerular epithelial cells (vGEC) ATP (100 mol/L) and ADPS (100 mol/L) induced a fast activation of the MAPK42/44 pathway (Figs. 6B and 7). The maximum activation of MAPK42/44 by ATP and ADPS was observed five minutes after the addition of these nucleotides (Fig. 7). A more than twofold increase was still present 20 minutes after addition of the nucleotides (Fig. 7). ␣,-Methylene-ATP (100 mol/L) did not activate MAPK42/44 (Fig. 7). In the presence of the MAPK inhibitor PD 98059 (100 mol/L) phosphorylation of MAPK42/44 by ATP was prevented (Fig. 6B), and in parallel [3H]-thymidine uptake was abolished (Fig. 6A). Basal (0 min) MAPK phosphorylation also was inhibited by PD 98059 (100 mol/L; Fig. 6B). Data from two preliminary experiments in whole human renal cortex showed that electrical stimulation at 5 Hz and ATP (100 mol/L) induced an activation of the MAPK42/44 pathway within 10 minutes to 159% (N ⫽ 2) and 133% (N ⫽ 2), respectively. RT-PCR of P2X and P2Y receptors Under the conditions used significant mRNA levels were found in vGEC for P2X4,5,6,7 and P2Y1,2,4,6,11 receptors (Fig. 8), but not for P2X1,2,3 and P2Y12 receptors (Figs. 8 and 9). mRNA expression of the recently cloned P2Y12 receptor [18, 19] was shown in human lymphocytes demonstrating the ability of the primers to amplify a P2Y12 sequence (Fig. 9). Experiments without reverse transcriptase (⫺) confirmed that the PCR products originated from mRNA but not from genomic DNA. DISCUSSION The kidney is densely innervated by the sympathetic nervous system [20] and the renal nerves control sodium reabsorption, renin secretion and renal blood flow by releasing norepinephrine, which activates adrenergic receptors on vascular, tubular and glomerular structures of the kidney [5]. Moreover, -adrenergic receptors are involved in proliferative processes in renal cells [21, 22]. In accord with these findings, in an animal model of chronic renal failure with elevated sympathetic tone, we recently showed that the sympatholytic drug moxonidine
Vonend et al: ATP release in human kidney
1621
Fig. 2. Effects of tetrodotoxin (TTX) and complete ␣-adrenergic blockade on ATP and norepinephrine (NE) release from human cortical kidney slices. There were two periods of electrical field stimulation in each experiment (S1 and S2), each for one minute at 20 Hz. Drugs were added 15 minutes before S2. (A) Control (N ⫽ 21), TTX (N ⫽ 4), prazosin (PRA)/rauwolscine (RAU) (N ⫽ 9). (B) Control (N ⫽ 21), TTX (N ⫽ 4), PRA/ RAU (N ⫽ 8). Data are means ⫾ SEM. * Significant differences from control by the Student t test (P ⬍ 0.05).
and the -blocker metoprolol reduced renal damage independently from influences on blood pressure [6, 8]. In addition to norepinephrine ATP is released as a cotransmitter in many sympathetically innervated organs [23]. Our current study demonstrates the neuronal and nonneuronal release of ATP in human renal cortex and describes the mechanisms by which ATP has mitogenic effects in human visceral glomerular epithelial cells (vGEC) used as a model for cells involved in progression of proteinuric renal disease. ATP release in human kidney cortex Electrical field stimulation of superfused human cortical kidney slices induced concomitant release of ATP and norepinephrine. Electrically induced ATP and norepinephrine release was prevented by the sodium channel blocker tetrodotoxin, suggesting a neuronal source of both neurotransmitters. However, in several isolated tissues [24, 25] including the rat kidney [10], ATP release from non-neuronal cells due to activation of ␣-adrenergic receptors by endogenous norepinephrine has been demonstrated. To elucidate the relationship between neuronal and non-neuronal origin of the ATP release by sympathetic nerve stimulation, we eliminated the effects of endogenous norepinephrine by complete ␣-adrenergic blockade using a combination of prazosin and rauwolscine. This combination totally eliminates all ␣-adrenergic effects of norepinephrine [26]. In this situation, the elec-
trical stimulation-induced ATP release was reduced by 75%. For unknown reasons only a non-significant increase of norepinephrine release in the presence of the prazosin/rauwolscine combination was observed, in contrast to previous results [27]. The inhibitory effect of complete ␣-adrenoceptor blockade on the electricallyinduced ATP release suggests that neuronally released norepinephrine activates ␣-adrenoceptors on renal cortical cells to release ATP. On the other hand, 25% of the electrically-induced ATP release were resistant to ␣-adrenoceptor blockade and, therefore, are most likely of neuronal origin. This confirms the role of ATP as a neurotransmitter in the human kidney. ␣-Adrenergic receptors are divided into ␣1- and ␣2-subtypes [28], which are both activated by norepinephrine. Both subtypes have been found in human kidney by pharmacological and molecular techniques, although the evidence for expression at the protein level is most convincing for ␣2-adrenergic receptors [29]. To characterize the receptor subtype mediating non-neuronal ATP release in human renal cortex, we mimicked the effects of endogenous norepinephrine by the use of selective agonists. Both the ␣2-agonist UK 14304 and the ␣1-agonist methoxamine induced the release of ATP from human cortical kidney slices, but the effect of the ␣2-agonist was much more pronounced. Previous studies on isolated blood vessel or the vas deferens showed that the effect of endogenous norepinephrine on ATP release is mainly mediated by
1622
Vonend et al: ATP release in human kidney
Fig. 3. ␣-Adrenergic agonist-induced ATP release from human cortical kidney slices. (A) Effect of the ␣2-selective agonist UK 14304 in the absence (N ⫽ 20, control N ⫽ 15) and presence of rauwolscine (RAU; N ⫽ 10, control N ⫽ 5). (B) Effect of the ␣1-selective agonist methoxamine (MET) in the absence (N ⫽ 20, control N ⫽ 15) and presence of prazosin (PRA; N ⫽ 9, control N ⫽ 7). Data are means ⫾ SEM. * Significant differences from control by the Student t test (P ⬍ 0.05).
␣1-adrenergic receptors [30, 31]. In contrast, in human renal cortex ␣2-adrenergic receptors apparently play a dominant role. At present, for the kidney the source of non-neuronal ␣-adrenoceptor-stimulated ATP release is not known. ␣2-Adrenergic receptors also appear to dominate the regulation of renal blood flow in humans [32, 33]. Thus, it seems to be possible that the ␣2-receptor mediated vasoconstriction of cortical blood vessels induced the release of ATP in the kidney slices. The higher expression levels of ␣2-adrenergic receptors then would be the reason for the more pronounced effect of ␣2-receptor activation on ATP release. ATP release due to ␣2-receptor mediated vasoconstriction also may involve endothe-
lial cells, which have been shown to release ATP after mechanical stress [34]. ATP and DNA synthesis in human renal cells in culture After demonstrating the release of ATP, we examined its potential role to act as mitogenic factor in vGEC cells, since these cells are known to be altered in chronic renal failure [6, 16]. Physiological and pathophysiological effects of ATP are mediated by P2-receptors, which are divided into two classes: P2Y-receptors coupled to G-proteins and P2X-receptors representing ligand-gated ion channels. ATP induced stimulation of DNA synthesis was the consequence of P2-receptor activation as shown
Vonend et al: ATP release in human kidney
1623
Fig. 4. Effects of various nucleotides on [3H]thymidine uptake in visceral glomerular epithelial cells (vGECs). All experiments were performed under growth-arrested conditions. Substances were present for 24 hours, and cells were incubated with [3H]-thymidine during the last 6 hours. An increase in the concentration of fetal calf serum (FCS) from normal 0.5% (control) to 20% caused an increase in thymidine uptake. Data are means ⫾ SEM of 4 to 12 experiments for each concentration of nucleotides. * Significant differences from control by the Student t test (P ⬍ 0.05).
Fig. 5. Effect of suramin on basal and ATP-induced [3H]-thymidine uptake in vGECs. All experiments were performed under growtharrested conditions. ATP was present for 24 hours. Suramin was added one hour before ATP. Cells were incubated with [3H]-thymidine during the last 6 hours. Data are means ⫾ SEM of 6 to 12 experiments for each concentration of ATP. * Significant differences from control by the Student t test (P ⬍ 0.05). ⫹Significant differences from the respective value in the absence of suramin (Student t test, P ⬍ 0.05).
by the blockade by the P2-receptor antagonist suramin. Interestingly, suramin by itself inhibited basal DNA synthesis suggesting auto-stimulation by continuous release of endogenous ATP. Which P2-receptor subtype mediates the observed mitogenic effects of ATP? Effects on cell proliferation mediated by P2Y2 and/or P2Y4 receptors have been observed previously in rat mesangial cells [35]. In addition, P2X receptor activation has been linked to proliferation at least in human osteoblast-like cells and lymphoid cells transfected with the P2X7 receptor [36, 37]. Suramin at the concentration used (30 mol/L) blocks most of the known mammalian P2-receptor types excluding only
P2X4,6,7 and P2Y4 receptors [38–41]. The effect of ATP on [3H]-thymidine uptake in vGEC observed in the present study was mimicked by ATP␥S and the preferential P2Y1,12 receptor agonists ADP and ADPS, but neither by the P2X1,3/P2X7 agonists ␣,-methylene-ATP and BzATP, nor by the uracil nucleotides UTP and UDP, which activate P2Y2, P2Y4 and P2Y6 receptors [38–42]. The adenosine diphosphate analogs ADP and ADPS are potent agonists at cloned and expressed P2Y1 and P2Y12 receptors, but no or only weak agonists at P2X receptors or any of the remaining cloned mammalian P2Y subtypes [18, 19, 38–42]. The potent action of these diphosphate analogs on [3H]-thymidine uptake characterizes the receptor involved in the mitogenic effects of adenine nucleotides in vGEC as either P2Y1 or P2Y12 (or a yet not cloned receptor with very similar pharmacological properties). However, the RT-PCR experiments clearly demonstrated the expression of only P2Y1 but not P2Y12 receptors in these cells. Hence, P2Y1-like receptors mediate at least a substantial part of mitogenic effects of adenine nucleotides such as ATP and ADP in vGEC. An additional contribution of other receptor subtypes (such as, P2Y11 or P2X5 for which a strong mRNA expression has been detected) cannot be excluded. Activation of the mitogen-activated protein kinases Various growth factors like PDGF or TGF- stimulate the extracellular signal-regulated kinase (ERK/MAPK42/44), which appears to be a ubiquitous step for the induction of cell proliferation [43]. MAPK42/44 is phosphorylated and activated by the MAPK kinase (MEK). In the present study in vGEC, ATP and the preferential P2Y1,12receptor agonist ADPS showed a time- and concentration-dependent activation of MAPK42/44, whereas the P2X1,3 selective agonist ␣,-methylene ATP failed to do so. The MEK inhibitor PD 98059 prevented ATP mediated phosphorylation of MAPK42/44 and in parallel blocked
Fig. 6. Effects of ATP on [3H]-thymidine uptake and MAPk activation in vGECs. (A) Effect of the MEK inhibitor PD 98059 on ATP-induced [3H]-thymidine uptake. Data are means ⫾ SEM of 4 to 5 experiments. * Significant difference from control (Student t test, P ⬍ 0.05). (B) Representative Western blot of MAPK activation by ATP in the presence and absence of PD 98059 (⫽ 3).
Fig. 7. Representative time courses from three to six experiments of adenine nucleotide-induced MAPK activation. Symbols are: (䊉) ATP 100 mol/L; (䉲) ADPS 100 mol/L; ( ) ␣,-mATP 100 mol/L.
the ATP induced increase of [3H]-thymidine uptake in human vGEC cells. To link these mitogenic effects of ATP in vGEC with adrenergic stimulation-induced release of ATP, preliminary experiments were performed in whole tissue. In human renal cortex both electrical stimulation at 5 Hz and ATP induced activation of MAPK42/44. Thus, ATP may contribute to the cell proliferative processes in chronic renal failure acting via the MAPK42/44 pathway. Consistent with this conclusion, mitogenic signaling of adenine nucleotides via P2Y-receptors has been recently linked in cells from several distinct tissues to the extracellular signal-regulated kinase pathway [44–46].
Fig. 8. P2Y1,2,4,6,11 and P2X1-7 receptor subtype expression in human vGECs analyzed by RT-PCR. PCR with reverse transcriptase (⫹) showed mRNA encoding for P2Y1,2,4,6,11 and P2X4-7. Weight marker is 100 bp. PCR without RT (⫺) showed no amplification products.
CONCLUSION Chronic renal failure is a clinical condition characterized by an elevated sympathetic tone. Extracellular ATP released upon ␣-adrenergic receptor activation either as a sympathetic renal neurotransmitter or in a paracrine fashion, has the potential to contribute to proliferative processes responsible for progression in chronic renal
Fig. 9. P2Y12 receptor subtype expression in human vGEC and in human lymphocytes analyzed by RT-PCR. PCR was with RT (⫹) and as a negative control without RT (⫺) running along weight marker (100 bp).
Vonend et al: ATP release in human kidney
failure. Therefore, ATP receptor antagonists should be explored to prevent progression of chronic renal diseases as previously suggested for ADPKD [47]. ACKNOWLEDGMENTS This study was supported by the Deutsche Forschungsgemeinschaft (Ru 401/5-6). We thank the Department of Urology (Prof. Horst Sommerkamp) for supplying the human kidney cortex used in this study. The expert technical assistance of Petra Stunz is greatly acknowledged. Reprint requests to Lars Christian Rump, M.D., Medizinsche Klinik I, Marienhospital Herne, Universita¨tsklinik Ruhr-Universita¨t Bochun, Ho¨lkeskampring 40, 44625 Herne, Germany. E-mail: [email protected]
REFERENCES 1. Ye S, Ozgur B, Campese VM: Renal afferent impulses, the posterior hypothalamus, and hypertension in rats with chronic renal failure. Kidney Int 51:722–727, 1997 2. Rump LC, Amann K, Orth S, Ritz E: Sympathetic overactivity in renal disease: A window to understand progression and cardiovascular complications in uraemia? Nephrol Dial Transplant 15:1735–1738, 2000 3. Converse RL Jr, Jacobsen TN, Toto RD, et al: Sympathetic overactivity in patients with chronic renal failure. N Engl J Med 327: 1912–1918, 1992 4. Ye S, Gamburd M, Mozayeni P, et al: A limited renal injury may cause a permanent form of neurogenic hypertension. Am J Hypertens 11:723–728, 1998 5. DiBona GF, Kopp UC: Neural control of renal function. Physiol Rev 77:75–197, 1997 6. Amann K, Rump LC, Simonaviciene A, et al: Effects of low dose sympathetic inhibition on glomerulosclerosis and albuminuria in subtotally nephrectomized rats. J Am Soc Nephrol 11:1469– 1478, 2000 7. Bohmann C, Schollmeyer P, Rump LC: Effects of imidazolines on noradrenlaine release in rat isolated kidney. Naunyn-Schmiedebergs Arch Phamacol 349:118–124, 1994 8. Amann K, Koch A, Hofstetter J, et al: Glomerulosclerosis and progression: Effect of subantihypertensive doses of alpha and beta blockers. Kidney Int 60:1309–1323, 2001 9. Rump LC, Wilde K, Schollmeyer P: Prostaglandin E2 inhibits norepinephrine release and purinergic pressor responses to renal nerve stimulation at 1 Hz in isolated kidneys of young spontaneously hypertensive rats. J Hypertens 8:897–908, 1990 10. Bohmann C, Rump LC, Schaible U, von Ku¨gelgen I: ␣-Adrenoceptor modulation of norepinephrine and ATP release in isolated kidneys of spontaneously hypertensive rats. Hypertens 25:1224– 1231, 1995 11. Oberhauser V, Vonend O, Rump LC: Neuropeptide Y and ATP interact to control renovascular resistance in the rat. J Am Soc Nephrol 10:1179–1185, 1999 12. Rump LC, Bohmann C, Schwertfeger E, et al: Extracellular ATP in the human kidney: Mode of release and vascular effects. J Auton Pharmacol 16:371–376, 1996 13. Inscho EW: P2 receptors in regulation of renal microvascular function. Am J Physiol (Renal Physiol) 280:F927–F944, 2001 14. Schulze-Lohoff E, Ogilvie A, Sterzel RB: Extracellular nucleotides as signalling molecules for renal mesangial cells. J Auton Pharmacol 16:381–384, 1996 15. Erlinge D: Extracellular ATP: A growth factor for vascular smooth muscle cells. Gen Pharmacol 31:1–8, 1998 16. Amann K, Nichols C, To¨rning C, et al: Effect of ramipiril, nifedipine and moxonidine on glomerular morphology and podocyte structure in experimental renal failure. Nephrol Dial Transplant 14:1003–1011, 1996 17. Rump LC, Schwertfeger E, Schuster MJ, et al: Dopamine DA2receptor activation inhibits norepinephrine release in human kidney slices. Kidney Int 43:197–204, 1993
1625
18. Hollopeter G, Jantzen HM, Vincent D, et al: Identification of the platelet ADP receptor targeted by antithrombotic drugs. Nature 40:202–207, 2001 19. Zhang FL, Luo L, Gustafson E, et al: ADP is the cognate ligand for the orphan G protein-coupled receptor SP1999. J Biol Chem 276:8608–8615, 2001 20. Barajas L, Liu L, Powers K: Anatomy of the renal innervation: Intrarenal aspects and ganglia of origin. Can J Physiol Pharmacol 70:735–749, 1992 21. Malamud D, Malt RA: Stimulation of cell proliferation in mouse kidney by isoproterenol. Lab Invest 24:140–143, 1971 22. Wolf G, Helmchen U, Stahl RA: Isoproterenol stimulates tubular DNA replication in mice. Nephrol Dial Transplant 11:2288– 2292, 1996 23. Von Ku¨gelgen I, Starke K: Noradrenaline-ATP co-transmission in the sympathetic nervous system. Trends Pharmacol Sci 12:319– 324, 1991 24. Sedaa KO, Bjur RA, Shinozuka K, Westfall DP: Nerve and drug-induced release of adenine nucleosides and nucleotides from rabbit aorta. J Pharmacol Exp Ther 252:1060–1067, 1990 25. Von Ku¨gelgen I, Starke K: Release of noradrenaline and ATP by electrical stimulation and nicotine in guinea-pig vas deferens. Naunyn Schmiedebergs Arch Pharmacol 344:419–429, 1991 26. Rump LC, von Ku¨gelgen I: A study of ATP as a sympathetic cotransmitter in human saphenous vein. Br J Pharmacol 111:65– 72, 1994 27. Trendelenburg AU, Limberger N, Rump LC: Alpha 2-adrenergic receptors of the alpha 2c subtype mediate inhibition of norepinephrine release in human kidney cortex. Mol Pharmacol 45:1168– 1176, 1994 28. Insel PA: Adrenergic receptors – evolving concepts and clinical implications. N Engl J Med 334:580–585, 1996 29. Michel MC, Rump LC: ␣-Adrenergic regulation of human renal function. Fundam Clin Pharmacol 10:493–503, 1996 30. Takeuchi K, Shinozuka K, Akimoto H, et al: Methoxamineinduced release of endogenous ATP from rabbit pulmonary artery. Eur J Pharmacol 254:287–290, 1994 31. Vizi ES, Sperlagh B, Baranyi M: Evidence that ATP released from the postsynaptic site by noradrenaline, is involved in mechanical responses of guinea-pig vas deferens: Cascade transmission. Neuroscience 50:455–465, 1992 32. De Leeuw PW, van Es PN, de Bos R, Birkenhager WH: Role of alpha 1- and alpha 2-adrenergic receptors in the human hypertensive kidney. Hypertens 9:210–212, 1987 33. De Leeuw PW, de Bos R, van Es PN, Birkenhager WH: Effect of sympathetic stimulation and intrarenal alpha-blockade on the secretion of renin by the human kidney. Eur J Clin Invest 15:166– 170, 1985 34. Burnstock G: Release of vasoactive substances from endothelial cells by shear stress and purinergic mechanosensory transduction. J Anat 194:335–342, 1999 35. Harada H, Chan CM, Loesch A, et al: Induction of proliferation and apoptotic cell death via P2Y and P2X receptors, respectively, in rat glomerular mesangial cells. Kidney Int 57:949–958, 2000 36. Nakamura E, Uezono Y, Narusawa K, et al: ATP activates DNA synthesis by acting on P2X receptors in human osteoblast-like MG-63 cells. Am J Physiol (Cell Physiol) 279:C510–C519, 2000 37. Baricordi OR, Melchiorri L, Adinolfi E, et al: Increased proliferation rate of lymphoid cells transfected with the P2X(7) ATP receptor. J Biol Chem 274:33206–33208, 1999 38. Ralevic V, Burnstock G: Receptors for purines and pyrimidines. Pharmacol Rev 50:413–492, 1998 39. Lambrecht G: Agonists and antagonists acting at P2X receptors: Selectivity profiles and functional implications. Naunyn Schmiedebergs Arch Pharmacol 362:340–350, 2000 40. No¨renberg W, Illes P: Neuronal P2X receptors: Localisation and functional properties. Naunyn Schmiedebergs Arch Pharmacol 362:324–339, 2000 41. Von Ku¨gelgen I, Wetter A: Molecular pharmacology of P2Yreceptors. Naunyn Schmiedebergs Arch Pharmacol 362:310–323, 2000 42. Communi D, Robaye B, Boeynaems JM: Pharmacological charac-
1626
Vonend et al: ATP release in human kidney
terization of the human P2Y11 receptor. Br J Pharmacol 128:1199– 1206, 1999 43. Bokemeyer D, Guglielmi KE, McGinty A, et al: Activation of extracellular signal-regulated kinase in proliferative glomerulonephritis in rats. J Clin Invest 100:582–588, 1997 44. Wilden PA, Agazie YM, Kaufman R, Halenda SP: ATP-stimulated smooth muscle cell proliferation requires independent ERK and PI3K signaling pathways. Am J Physiol 275:H1209– H1215, 1998 45. Huwiler A, Wartmann M, van den Bosch H, Pfeilschifter J:
Extracellular nucleotides activate the p38-stress-activated protein kinase cascade in glomerular mesangial cells. Br J Pharmacol 129: 612–618, 2000 46. Neary JT, Kang Y, Bu Y, et al: Mitogenic signaling by ATP/ P2Y purinergic receptors in astrocytes: Involvement of a calciumindependent protein kinase C, extracellular signal-regulated protein kinase pathway distinct from the phosphatidylinositol-specific phospholipase C/calcium pathway. J Neurosci 19:4211–4220, 1999 47. Wilson PD, Hovater JS, Casey CC, et al: ATP release mechanisms in primary cultures of epithelia derived from the cysts of polycystic kidneys. J Am Soc Nephrol 10:218–229, 1999
ATP release in human kidney cortex and its mitogenic effects in visceral glomerular epithelial cells OLIVER VONEND, VITUS OBERHAUSER, IVAR VON KU¨GELGEN, THOMAS W. APEL, KERSTIN AMANN, EBERHARD RITZ, and LARS CHRISTIAN RUMP Department of Internal Medicine, University of Freiburg, Freiburg; Department of Internal Medicine, Marien Hospital Home, Ruhr-University Bochum, Bochum; Department of Internal Medicine, University of Heidelberg, Heidelberg; Department of Pharmacology, University of Bonn, Bonn; and Department of Pathology, University of Erlangen, Erlangen, Germany
ATP release in human kidney cortex and its mitogenic effects in visceral glomerular epithelial cells. Background. In chronic renal failure the sympathetic nervous system is activated. Sympathetic cotransmitters released within the kidney may contribute to the progression of renal disease through receptor-mediated proliferative mechanisms. Methods. In human renal cortex electrical stimulation induced adenosine 5⬘-triphosphate (ATP; luciferin-luciferase-assay) and norepinephrine (HPLC) release was measured. ATP release also was induced by ␣1- and ␣2-adrenergic agonists. [3H]-thymidine uptake was tested in human visceral glomerular epithelial cells (vGEC) and mitogen-activated protein kinase (MAPK42/44) activation in vGEC and kidney cortex. The involved P2-receptors were characterized pharmacologically and by RT-PCR. Results. Sympathetic nerve stimulation and ␣-adrenergic agonists induced release of ATP from human kidney cortex. Seventy-five percent of the ATP released originated from nonneuronal sources, mainly through activation of ␣2-adrenergic receptors. ATP (1 to 100 mol/L) and related nucleotides (1 to 100 mol/L) increased [3H]-thymidine uptake. The adenine nucleotides ATP, ATP␥S, ADP and ADPS were about equally potent. UTP, UDP and ␣,-methylene ATP had no effect. ATP, ADPS but not ␣,-methylene ATP activated MAPK42/44. ATP induced MAPK42/44 activation, and [3H]-thymidine uptake was abolished in the presence of the MAPK inhibitor PD 98059 (100 mol/L). mRNA for P2X4,5,6,7 and P2Y1,2,4,6,11 were detected in human vGEC by RT-PCR. Conclusions. In human renal cortex, adrenergic stimulation releases ATP from neuronal and non-neuronal sources. ATP has mitogenic effects in vGEC and therefore the potential to contribute to progression in chronic renal disease. The pattern of purinoceptor agonist effects on DNA synthesis together with the mRNA expression suggests a major contribution of a P2Y1like receptor.
Key words: adrenergic stimulation, adenosine 5⬘-triphosphate, purinergic receptors, chronic renal failure, cell proliferation. Received for publication July 9, 2001 and in revised form November 26, 2001 Accepted for publication December 17, 2001
2002 by the International Society of Nephrology
There is convincing evidence that overactivity of the sympathetic nervous system plays a dominant role in renal hypertensive disease [1–3]. The kidneys possess mechanoreceptors and chemoreceptors that are stimulated in damaged kidneys [4]. These afferent sensory signals travel to the central nervous system leading to enhanced efferent sympathetic activity [5]. It is our hypothesis that sympathetic overactivity of renal nerves contributes to progression of renal disease by a direct receptor-mediated stimulation of cell growth [2]. This is based on recent observations in a model of chronic renal failure characterized by sympathetic overactivity [6]. Treatment of subtotally nephrectomized rats with the sympatholytic drug moxonidine, known to inhibit neurotransmitter release within the kidney [7], or a -blocker [8] ameliorated proteinuria and reduced glomerular damage independent from blood pressure effects. There is experimental evidence that norepinephrine is not the only renal neurotransmitter. In kidneys of rats and humans ATP seems to be released as a cotransmitter of norepinephrine [9–13] and has been shown to act as mitogenic signaling molecule in rat mesangial [14] and human smooth muscle cells [15]. Thus, besides norepinephrine itself, the cotransmitter ATP is a prime candidate to be involved in progression of chronic renal disease in the presence of sympathetic overactivity. The present study tested the hypothesis that sympathetic stimulation leads to ATP release in the human kidney and that ATP possesses mitogenic effects in human glomerular epithelial cells (vGEC). We chose this cell type as a model because it is involved in progression of chronic renal failure [16]. A portion of this study was presented at the 4th Annual Meeting of the European Council for Blood Pressure and Cardiovascular Research in Nordwijkerhout (abstract; Rump et al, Hypertension 34:711, 1999). METHODS The present study was approved by the local ethics committee. Human kidneys were obtained from patients
1617
1618
Vonend et al: ATP release in human kidney
undergoing nephrectomy for renal cell carcinoma. Only macroscopic intact renal cortex tissue was used for cell preparation. Renal cortical slices were minced, pushed, and rinsed through a serial of stainless steel sieves of different pore sizes of 40, 80 and finally 120 mesh. Glomeruli retained by the 120 mesh sieves were collected in tubes and centrifuged at 1750 ⫻ g for eight minutes, and suspended in RPMI medium containing 20% fetal calf serum (FCS) with supplements (1% non-essential amino acids; 5 mmol/L HEPES; 1 mmol/L Na-pyruvate, 100 U/mL penicillin; 100 g/mL streptomycin; Biochrom, Berlin, Germany; 1% insulin-transferrin-selenite supplement, Roche Biochemicals, Mannheim, Germany). Glomeruli were then incubated at 37⬚C. Primary cultures and subcultures were maintained at 37⬚C in a 5% CO2 environment. Plates were left undisturbed for the next five to seven days to facilitate primary outgrowth of visceral epithelial cells (vGEC) from glomeruli. Then, the plated cells were trypsinized and passaged. All cells were studied within the first twelve passages. Cell identification of vGEC Cell purity was assessed by the peroxidase anti peroxidase (PAP) staining from Dako Corp. (Hamburg, Germany) following the manufacturer’s instructions. Primary antihuman antibodies used were mouse anti-factor VIII-related antigen, mouse anti-cytokeratin, mouse antivimentin, mouse anti-desmin, mouse anti-smooth muscle actin (all from Dako) and rabbit anti-Wilm’s tumor antigen (WT-1; Santa Cruz Biotechnology, Santa Cruz, CA, USA). Secondary antibodies were mouse anti-rabbit IgG and rabbit anti-mouse IgG (both 1:100; Dako). vGEC used for experiments were cytokeratin- and WT-1–positive, whereas mesangial and renal smooth muscle cells were cytokeratin-positive but showed no staining for WT-1. Analysis of mitogenic effects All experiments to study mitogenic effects were done under growth-arrested conditions. vGEC cells were plated at a density of 30,000 cells/well in 24-well plates and grown to 80% confluence in REBM (renal epithelial cell basis medium; Cellsystems, St. Katharinen, Germany) plus supplement (REGM, renal epithelial cell growth medium; Cellsystems) before they were placed in growth arrest medium (RPMI medium supplemented with 0.5% FCS; 5 g/mL insulin; Sigma, Deisendorf, Germany; and 100 U/mL penicillin/100 g/mL streptomycin) for 72 hours to decrease proliferation. Determination of DNA-synthesis DNA synthesis was measured using [3H]-thymidine incorporation. All studied substances were added to resting cells (4 wells for each concentration) and were present for 24 hours. The cells were incubated with [3H]-thymidine (1 Ci/mL) during the last six hours. The medium
was then aspirated, the cells washed three times with phosphate buffer and for DNA precipitation twice with ice-cold 10% trichloroacetic acid (TCA). The fixed cellular material was solubilized in 1 mL 0.5 mol/L NaOH for two hours and then mixed with 10 mL scintillation fluid (Canberra Packard, Ultima-Gold) to measure the amount of radioactivity present in the TCA insoluble fraction. Data are expressed as the mean of radioactivity present in the four wells with identical concentration. RNA extraction and reverse transcription-polymerase chain reaction of P2X and P2Y receptors RNA was gained from 2 ⫻ 106 cells using the RNAeasy Kit (Qiagen, Hilden, Germany). For the synthesis of the first strand 2 g RNA was used in the superscript firststrand system (Gibco-BRL, Karlsruhe, Germany). Due to a strong signal for P2X5-receptors, only 0.2 g RNA was used for this subtype. The amplification was performed in a volume of 50 L with 10% of the first strand cDNA with AmpliTaq Gold (Applied Biosystems, Weiterstadt, Germany), five minutes at 95⬚C, one minute at 95⬚C, one minute at 55⬚C, one minute at 72⬚C, 35 cycles, and for termination eight minutes at 72⬚C. Ten microliters of the reaction were then analyzed on a 1.5% agarose gel. Primers used were: P2Y1: TGCCAGCCCTGATCTTCTACTACT, ATAC GTGGCATAAACCCTGTCATT P2Y2: GCCGGGGCCGTGTGGGTGTT, CGGGTGA CGTGGAATGGCAGGAA P2Y4: GGGATGCAACGGCCACCTACA, GCACGA AGCAGACAGCAAAGACAG P2Y6: CCCTGCTGGCCTGCTACTGTCTCC, TTCTC CGCATGGTTTGGGGTTGGT P2Y11: CCCCCGCTGGCCGCCTACCTCTTA, GCCC AACCCCGCCAGCACCAG P2Y12: CTCTGTTGTCATCTGGGCATTCAT, GGTT TGGCTCAGGGTGTAAGGA P2X1: CTTTCCACGCTTCAAGGTCAACA, GCCAC CCCAAAGATGCCA AT P2X2: ACAAAGTGTGGGACGTGGAGGA, GGCA AACCTGAAGTTGTAGCCTGA P2X3: TCTGTGCTCCGGACCTGTGAGAT, AAGC GGATGCCAAAAGCCTTCA P2X4: CCTTCTGCCCCATATTCCGTCT, GTTGATC ATAGTGGGGATGATGTCA P2X5a/b: GAGTGCTGTCATCACCAAAGTCAA, CCA GTCGGAAGATGGGGCAGTA P2X6: CCTGTGAGATCTGGAGTTGGTGC, GTGTC CAGGTCACAATCCCAGT P2X7: CGACTTCCCCGGCCACAACTA, TGCCAA AAACCAGGATGTCAAAAC Determination of MAPK42/44 activation Kinetics of MAPK42/44 phosphorylation were done by stimulation of resting vGECs plated on six-well plates
Vonend et al: ATP release in human kidney
with ATP (100 mol/L) for 0, 2, 5, 10, 15 and 20 minutes. For experiments using the mitogen-activated protein (MAP) kinase (MAPK)/extracellular signal-regulated protein kinase (ERK) kinase (MEK) inhibitor PD-98059 (New England BioLabs; Beverly, MA, USA), cells were incubated for 30 minutes at 37⬚C in growth arresting medium that contained the inhibitor before the addition of agonists. After treatment, medium was aspirated and cells were solubilized in 200 L 2⫻ Laemmli sample buffer with 200 mmol/L dithiothreitol (DTT) followed by boiling for five minutes. Lysates were sonicated, and proteins were separated on 10% sodium dodecyl sulfatepolyacrylamide gel electrophoresis (SDS-PAGE) gels. The proteins were electrophoretically transferred to nitrocellulose in buffer containing 25 mmol/L Tris, 192 mmol/L glycine, 20% methanol, and 0.02% SDS. The nitrocellulose was blocked with 5% nonfat dry milk in 20 mmol/L Tris, pH 7.4, 150 mmol/L NaCl, and 0.01% Tween 20. The membranes were probed either with a polyclonal phosphotyrosyl-MAP kinase-specific antibody (New England BioLabs), which recognizes only the tyrosine-phosphorylated (active) form of p44 MAP kinase (ERK1) and p42 MAP kinase (ERK2) or with a MAP kinase-specific antibody (New England BioLabs), which recognizes the total amount of ERK1 and ERK2. The buffer used for incubation contained 20 mmol/L Tris, pH 7.4, 150 mmol/L NaCl, 3% bovine serum albumin (BSA), and 0.01% Tween 20. The blots were then washed in 20 mmol/L Tris, pH 7.4, 150 mmol/L NaCl, and 0.01% Tween 20, and bound antibody was detected by a horseradish peroxidase-conjugated anti-rabbit IgG and enhanced chemiluminescence (Pierce, Rockford, IL, USA). The detection and estimation of the ratio between activated and total protein was performed with the Kodak Imaging System. The density ratio was used as the quantum of MAPK42/44 activation. MAPK42/44 phosphorylation induced by electrical stimulation at 5 Hz for four minutes (40 mA, 1 ms duration) or by ATP (100 mol/L) also was measured in superfused human renal cortex. ATP (100 mol/L) was added to the perfusion solution for 10 minutes. The tissue samples were harvested immediately after the stimulations and snap frozen. The experimental design of the superfused renal cortex is described in detail below. Norepinephrine and ATP release of human kidney slices by sympathetic nerve stimulation The cortical kidney slices of about 25 mg (diameter 6.5 mm, thickness 0.3 mm) were placed into eight superfusion chambers between two platinum electrodes and were kept in a bath at a temperature of 37⬚C [21]. The slices were superfused at a constant rate of 2 mL/min with Krebs-Henseleit solution [17]. After a stabilization period of 60 minutes there were two periods of electric field stimulation (S1, S2), each 20 Hz for one minute
1619
(40 mA, 1 ms duration). Drugs were applied 15 minutes before S2. Three three-minute samples of the superfusate were collected on ice by using a fraction collector, and were used for the simultaneous determination of norepinephrine and ATP as previously described in detail [10]. Briefly, aliquots (1 mL) of the three threeminute samples were immediately separated after each experiment and kept at ⫺20⬚C until determination of ATP levels, which were assessed by the luciferin-luciferase technique using a LB 953 luminometer (Berthold Systems, Germany). The remaining part of the fractions received 167 L of 1 mol/L HCl, 13.3 L of 0.067 mol/L ethylenediaminetetraacetic acid (EDTA) and 3.3 L of 1 mol/L NaSO4 to prevent norepinephrine degradation. Norepinephrine content was concentrated by adsorbing onto alumina and resolving in 250 L 0.1 mol/L HClO4 and determined by high-pressure liquid chromatography with electrochemical detection (HPLC-ECD; Waters, Eschborn, Germany). All values were corrected for recovery. The ATP release also induced was by adrenergic agonists. In this case, there was no electrical field stimulation but ␣-adrenergic agonists were added to the perfusion solution for one minute instead of S2. The three respective three-minute samples of S1 were taken as a reference value (control without any stimulation). When ␣-adrenergic antagonists were used in the latter experiments, they were added to the perfusion solution from 30 minutes before S1 to the end of the experiment (throughout). Statistics All data are expressed as means ⫾ SEM. Data were analyzed by the unpaired Student t test. Values of P ⬍ 0.05 were considered statistically significant. RESULTS Sympathetic nerve stimulation and release of ATP and norepinephrine in human cortical kidney slices Electric field stimulation of human cortical kidney slices induced concomitant release of ATP and norepinephrine in S1 and S2 (Fig. 1). Upon stimulation the slices released more ATP (total stimulation induced release in S1, 0.24 ⫾ 0.03 pmol/mg kidney cortex; N ⫽ 21) than norepinephrine (0.12 ⫾ 0.01 pmol/mg kidney cortex; N ⫽ 21). S2 to S1 ratios for ATP and norepinephrine were about 0.75 and set as 100% (control). When the sodium channel blocker tetrodotoxin (1 mol/L) was added before the second stimulation period, the ATP and norepinephrine release was abolished (Fig. 2). In the presence of complete ␣-adrenergic blockade by a combination of the preferential ␣1-adrenergic antagonist prazosin (3 mol/L) and the preferential ␣2-adrenergic antagonist rauwolscine (1 mol/L) the stimulation induced release of ATP was reduced to about 25% of control (Fig.
1620
Vonend et al: ATP release in human kidney
triphosphate (UTP; 1 to 100 mol/L), uridine diphosphate (UDP; 1 to 100 mol/L; data not shown) and ␣,methylene ATP (1 to 100 mol/L) had no effect in vGEC. BzATP (100 mol/L) and BzATP (300 mol/L) reduced [3H]-thymidine uptake to 49 ⫾ 8.4% (N ⫽ 8) and 24.2 ⫾ 2.3% of control (N ⫽ 7), respectively. The P2-receptor antagonist suramin (30 mol/L; Fig. 5), known to block a number of P2-subtypes, and the MAPK inhibitor PD 98059 (100 mol/L) reduced basal (23.1% ⫾ 2.2 of control; N ⫽ 3) and ATP induced [3H]-thymidine uptake in vGEC (Fig. 6A).
Fig. 1. Adenosine 5ⴕ-triphosphate (ATP) and norepinephrine release from human cortical kidney slices. There were two periods of electrical field stimulation in each experiment (S1 and S2), each for one minute at 20 Hz. (A) Release of endogenous ATP (N ⫽ 21). (B) Release of endogenous norepinephrine (N ⫽ 21). Data are means ⫾ SEM.
2A), whereas the norepinephrine release was slightly but not significantly enhanced (Fig. 2B). ATP release stimulated by ␣-adrenergic agonists in human kidney cortex The selective ␣2-adrenergic agonist UK 14304 (1 mol/L) potently stimulated ATP release and this effect was blocked by rauwolscine (0.1 mol/L; Fig. 3A) but not by prazosin (0.3 mol/L; data not shown). The selective ␣1-adrenergic agonist methoxamine (10 mol/L) stimulated ATP release (Fig. 3B), but this effect was much smaller than that of UK 14304. The effect of methoxamine was inhibited by prazosin (0.3 mol/L). Nucleotide-induced [3H]-thymidine uptake human glomerular epithelial cells (vGEC) in culture In human vGEC ATP (1 to 100 mol/L), adenosine diphosphate-S (ADPS; 1 to 100 mol/L), ADP (1 to 100 mol/L) and ATP␥S (1 to 100 mol/L) increased [3H]-thymidine uptake in a concentration dependent manner (Fig. 4). ATP, ATP␥S and ADP were about equally potent and effective. ADPS induced a smaller response at the concentration of 100 mol/L. Uridine
Involvement of the MAPK pathway In human visceral glomerular epithelial cells (vGEC) ATP (100 mol/L) and ADPS (100 mol/L) induced a fast activation of the MAPK42/44 pathway (Figs. 6B and 7). The maximum activation of MAPK42/44 by ATP and ADPS was observed five minutes after the addition of these nucleotides (Fig. 7). A more than twofold increase was still present 20 minutes after addition of the nucleotides (Fig. 7). ␣,-Methylene-ATP (100 mol/L) did not activate MAPK42/44 (Fig. 7). In the presence of the MAPK inhibitor PD 98059 (100 mol/L) phosphorylation of MAPK42/44 by ATP was prevented (Fig. 6B), and in parallel [3H]-thymidine uptake was abolished (Fig. 6A). Basal (0 min) MAPK phosphorylation also was inhibited by PD 98059 (100 mol/L; Fig. 6B). Data from two preliminary experiments in whole human renal cortex showed that electrical stimulation at 5 Hz and ATP (100 mol/L) induced an activation of the MAPK42/44 pathway within 10 minutes to 159% (N ⫽ 2) and 133% (N ⫽ 2), respectively. RT-PCR of P2X and P2Y receptors Under the conditions used significant mRNA levels were found in vGEC for P2X4,5,6,7 and P2Y1,2,4,6,11 receptors (Fig. 8), but not for P2X1,2,3 and P2Y12 receptors (Figs. 8 and 9). mRNA expression of the recently cloned P2Y12 receptor [18, 19] was shown in human lymphocytes demonstrating the ability of the primers to amplify a P2Y12 sequence (Fig. 9). Experiments without reverse transcriptase (⫺) confirmed that the PCR products originated from mRNA but not from genomic DNA. DISCUSSION The kidney is densely innervated by the sympathetic nervous system [20] and the renal nerves control sodium reabsorption, renin secretion and renal blood flow by releasing norepinephrine, which activates adrenergic receptors on vascular, tubular and glomerular structures of the kidney [5]. Moreover, -adrenergic receptors are involved in proliferative processes in renal cells [21, 22]. In accord with these findings, in an animal model of chronic renal failure with elevated sympathetic tone, we recently showed that the sympatholytic drug moxonidine
Vonend et al: ATP release in human kidney
1621
Fig. 2. Effects of tetrodotoxin (TTX) and complete ␣-adrenergic blockade on ATP and norepinephrine (NE) release from human cortical kidney slices. There were two periods of electrical field stimulation in each experiment (S1 and S2), each for one minute at 20 Hz. Drugs were added 15 minutes before S2. (A) Control (N ⫽ 21), TTX (N ⫽ 4), prazosin (PRA)/rauwolscine (RAU) (N ⫽ 9). (B) Control (N ⫽ 21), TTX (N ⫽ 4), PRA/ RAU (N ⫽ 8). Data are means ⫾ SEM. * Significant differences from control by the Student t test (P ⬍ 0.05).
and the -blocker metoprolol reduced renal damage independently from influences on blood pressure [6, 8]. In addition to norepinephrine ATP is released as a cotransmitter in many sympathetically innervated organs [23]. Our current study demonstrates the neuronal and nonneuronal release of ATP in human renal cortex and describes the mechanisms by which ATP has mitogenic effects in human visceral glomerular epithelial cells (vGEC) used as a model for cells involved in progression of proteinuric renal disease. ATP release in human kidney cortex Electrical field stimulation of superfused human cortical kidney slices induced concomitant release of ATP and norepinephrine. Electrically induced ATP and norepinephrine release was prevented by the sodium channel blocker tetrodotoxin, suggesting a neuronal source of both neurotransmitters. However, in several isolated tissues [24, 25] including the rat kidney [10], ATP release from non-neuronal cells due to activation of ␣-adrenergic receptors by endogenous norepinephrine has been demonstrated. To elucidate the relationship between neuronal and non-neuronal origin of the ATP release by sympathetic nerve stimulation, we eliminated the effects of endogenous norepinephrine by complete ␣-adrenergic blockade using a combination of prazosin and rauwolscine. This combination totally eliminates all ␣-adrenergic effects of norepinephrine [26]. In this situation, the elec-
trical stimulation-induced ATP release was reduced by 75%. For unknown reasons only a non-significant increase of norepinephrine release in the presence of the prazosin/rauwolscine combination was observed, in contrast to previous results [27]. The inhibitory effect of complete ␣-adrenoceptor blockade on the electricallyinduced ATP release suggests that neuronally released norepinephrine activates ␣-adrenoceptors on renal cortical cells to release ATP. On the other hand, 25% of the electrically-induced ATP release were resistant to ␣-adrenoceptor blockade and, therefore, are most likely of neuronal origin. This confirms the role of ATP as a neurotransmitter in the human kidney. ␣-Adrenergic receptors are divided into ␣1- and ␣2-subtypes [28], which are both activated by norepinephrine. Both subtypes have been found in human kidney by pharmacological and molecular techniques, although the evidence for expression at the protein level is most convincing for ␣2-adrenergic receptors [29]. To characterize the receptor subtype mediating non-neuronal ATP release in human renal cortex, we mimicked the effects of endogenous norepinephrine by the use of selective agonists. Both the ␣2-agonist UK 14304 and the ␣1-agonist methoxamine induced the release of ATP from human cortical kidney slices, but the effect of the ␣2-agonist was much more pronounced. Previous studies on isolated blood vessel or the vas deferens showed that the effect of endogenous norepinephrine on ATP release is mainly mediated by
1622
Vonend et al: ATP release in human kidney
Fig. 3. ␣-Adrenergic agonist-induced ATP release from human cortical kidney slices. (A) Effect of the ␣2-selective agonist UK 14304 in the absence (N ⫽ 20, control N ⫽ 15) and presence of rauwolscine (RAU; N ⫽ 10, control N ⫽ 5). (B) Effect of the ␣1-selective agonist methoxamine (MET) in the absence (N ⫽ 20, control N ⫽ 15) and presence of prazosin (PRA; N ⫽ 9, control N ⫽ 7). Data are means ⫾ SEM. * Significant differences from control by the Student t test (P ⬍ 0.05).
␣1-adrenergic receptors [30, 31]. In contrast, in human renal cortex ␣2-adrenergic receptors apparently play a dominant role. At present, for the kidney the source of non-neuronal ␣-adrenoceptor-stimulated ATP release is not known. ␣2-Adrenergic receptors also appear to dominate the regulation of renal blood flow in humans [32, 33]. Thus, it seems to be possible that the ␣2-receptor mediated vasoconstriction of cortical blood vessels induced the release of ATP in the kidney slices. The higher expression levels of ␣2-adrenergic receptors then would be the reason for the more pronounced effect of ␣2-receptor activation on ATP release. ATP release due to ␣2-receptor mediated vasoconstriction also may involve endothe-
lial cells, which have been shown to release ATP after mechanical stress [34]. ATP and DNA synthesis in human renal cells in culture After demonstrating the release of ATP, we examined its potential role to act as mitogenic factor in vGEC cells, since these cells are known to be altered in chronic renal failure [6, 16]. Physiological and pathophysiological effects of ATP are mediated by P2-receptors, which are divided into two classes: P2Y-receptors coupled to G-proteins and P2X-receptors representing ligand-gated ion channels. ATP induced stimulation of DNA synthesis was the consequence of P2-receptor activation as shown
Vonend et al: ATP release in human kidney
1623
Fig. 4. Effects of various nucleotides on [3H]thymidine uptake in visceral glomerular epithelial cells (vGECs). All experiments were performed under growth-arrested conditions. Substances were present for 24 hours, and cells were incubated with [3H]-thymidine during the last 6 hours. An increase in the concentration of fetal calf serum (FCS) from normal 0.5% (control) to 20% caused an increase in thymidine uptake. Data are means ⫾ SEM of 4 to 12 experiments for each concentration of nucleotides. * Significant differences from control by the Student t test (P ⬍ 0.05).
Fig. 5. Effect of suramin on basal and ATP-induced [3H]-thymidine uptake in vGECs. All experiments were performed under growtharrested conditions. ATP was present for 24 hours. Suramin was added one hour before ATP. Cells were incubated with [3H]-thymidine during the last 6 hours. Data are means ⫾ SEM of 6 to 12 experiments for each concentration of ATP. * Significant differences from control by the Student t test (P ⬍ 0.05). ⫹Significant differences from the respective value in the absence of suramin (Student t test, P ⬍ 0.05).
by the blockade by the P2-receptor antagonist suramin. Interestingly, suramin by itself inhibited basal DNA synthesis suggesting auto-stimulation by continuous release of endogenous ATP. Which P2-receptor subtype mediates the observed mitogenic effects of ATP? Effects on cell proliferation mediated by P2Y2 and/or P2Y4 receptors have been observed previously in rat mesangial cells [35]. In addition, P2X receptor activation has been linked to proliferation at least in human osteoblast-like cells and lymphoid cells transfected with the P2X7 receptor [36, 37]. Suramin at the concentration used (30 mol/L) blocks most of the known mammalian P2-receptor types excluding only
P2X4,6,7 and P2Y4 receptors [38–41]. The effect of ATP on [3H]-thymidine uptake in vGEC observed in the present study was mimicked by ATP␥S and the preferential P2Y1,12 receptor agonists ADP and ADPS, but neither by the P2X1,3/P2X7 agonists ␣,-methylene-ATP and BzATP, nor by the uracil nucleotides UTP and UDP, which activate P2Y2, P2Y4 and P2Y6 receptors [38–42]. The adenosine diphosphate analogs ADP and ADPS are potent agonists at cloned and expressed P2Y1 and P2Y12 receptors, but no or only weak agonists at P2X receptors or any of the remaining cloned mammalian P2Y subtypes [18, 19, 38–42]. The potent action of these diphosphate analogs on [3H]-thymidine uptake characterizes the receptor involved in the mitogenic effects of adenine nucleotides in vGEC as either P2Y1 or P2Y12 (or a yet not cloned receptor with very similar pharmacological properties). However, the RT-PCR experiments clearly demonstrated the expression of only P2Y1 but not P2Y12 receptors in these cells. Hence, P2Y1-like receptors mediate at least a substantial part of mitogenic effects of adenine nucleotides such as ATP and ADP in vGEC. An additional contribution of other receptor subtypes (such as, P2Y11 or P2X5 for which a strong mRNA expression has been detected) cannot be excluded. Activation of the mitogen-activated protein kinases Various growth factors like PDGF or TGF- stimulate the extracellular signal-regulated kinase (ERK/MAPK42/44), which appears to be a ubiquitous step for the induction of cell proliferation [43]. MAPK42/44 is phosphorylated and activated by the MAPK kinase (MEK). In the present study in vGEC, ATP and the preferential P2Y1,12receptor agonist ADPS showed a time- and concentration-dependent activation of MAPK42/44, whereas the P2X1,3 selective agonist ␣,-methylene ATP failed to do so. The MEK inhibitor PD 98059 prevented ATP mediated phosphorylation of MAPK42/44 and in parallel blocked
Fig. 6. Effects of ATP on [3H]-thymidine uptake and MAPk activation in vGECs. (A) Effect of the MEK inhibitor PD 98059 on ATP-induced [3H]-thymidine uptake. Data are means ⫾ SEM of 4 to 5 experiments. * Significant difference from control (Student t test, P ⬍ 0.05). (B) Representative Western blot of MAPK activation by ATP in the presence and absence of PD 98059 (⫽ 3).
Fig. 7. Representative time courses from three to six experiments of adenine nucleotide-induced MAPK activation. Symbols are: (䊉) ATP 100 mol/L; (䉲) ADPS 100 mol/L; ( ) ␣,-mATP 100 mol/L.
the ATP induced increase of [3H]-thymidine uptake in human vGEC cells. To link these mitogenic effects of ATP in vGEC with adrenergic stimulation-induced release of ATP, preliminary experiments were performed in whole tissue. In human renal cortex both electrical stimulation at 5 Hz and ATP induced activation of MAPK42/44. Thus, ATP may contribute to the cell proliferative processes in chronic renal failure acting via the MAPK42/44 pathway. Consistent with this conclusion, mitogenic signaling of adenine nucleotides via P2Y-receptors has been recently linked in cells from several distinct tissues to the extracellular signal-regulated kinase pathway [44–46].
Fig. 8. P2Y1,2,4,6,11 and P2X1-7 receptor subtype expression in human vGECs analyzed by RT-PCR. PCR with reverse transcriptase (⫹) showed mRNA encoding for P2Y1,2,4,6,11 and P2X4-7. Weight marker is 100 bp. PCR without RT (⫺) showed no amplification products.
CONCLUSION Chronic renal failure is a clinical condition characterized by an elevated sympathetic tone. Extracellular ATP released upon ␣-adrenergic receptor activation either as a sympathetic renal neurotransmitter or in a paracrine fashion, has the potential to contribute to proliferative processes responsible for progression in chronic renal
Fig. 9. P2Y12 receptor subtype expression in human vGEC and in human lymphocytes analyzed by RT-PCR. PCR was with RT (⫹) and as a negative control without RT (⫺) running along weight marker (100 bp).
Vonend et al: ATP release in human kidney
failure. Therefore, ATP receptor antagonists should be explored to prevent progression of chronic renal diseases as previously suggested for ADPKD [47]. ACKNOWLEDGMENTS This study was supported by the Deutsche Forschungsgemeinschaft (Ru 401/5-6). We thank the Department of Urology (Prof. Horst Sommerkamp) for supplying the human kidney cortex used in this study. The expert technical assistance of Petra Stunz is greatly acknowledged. Reprint requests to Lars Christian Rump, M.D., Medizinsche Klinik I, Marienhospital Herne, Universita¨tsklinik Ruhr-Universita¨t Bochun, Ho¨lkeskampring 40, 44625 Herne, Germany. E-mail: [email protected]
REFERENCES 1. Ye S, Ozgur B, Campese VM: Renal afferent impulses, the posterior hypothalamus, and hypertension in rats with chronic renal failure. Kidney Int 51:722–727, 1997 2. Rump LC, Amann K, Orth S, Ritz E: Sympathetic overactivity in renal disease: A window to understand progression and cardiovascular complications in uraemia? Nephrol Dial Transplant 15:1735–1738, 2000 3. Converse RL Jr, Jacobsen TN, Toto RD, et al: Sympathetic overactivity in patients with chronic renal failure. N Engl J Med 327: 1912–1918, 1992 4. Ye S, Gamburd M, Mozayeni P, et al: A limited renal injury may cause a permanent form of neurogenic hypertension. Am J Hypertens 11:723–728, 1998 5. DiBona GF, Kopp UC: Neural control of renal function. Physiol Rev 77:75–197, 1997 6. Amann K, Rump LC, Simonaviciene A, et al: Effects of low dose sympathetic inhibition on glomerulosclerosis and albuminuria in subtotally nephrectomized rats. J Am Soc Nephrol 11:1469– 1478, 2000 7. Bohmann C, Schollmeyer P, Rump LC: Effects of imidazolines on noradrenlaine release in rat isolated kidney. Naunyn-Schmiedebergs Arch Phamacol 349:118–124, 1994 8. Amann K, Koch A, Hofstetter J, et al: Glomerulosclerosis and progression: Effect of subantihypertensive doses of alpha and beta blockers. Kidney Int 60:1309–1323, 2001 9. Rump LC, Wilde K, Schollmeyer P: Prostaglandin E2 inhibits norepinephrine release and purinergic pressor responses to renal nerve stimulation at 1 Hz in isolated kidneys of young spontaneously hypertensive rats. J Hypertens 8:897–908, 1990 10. Bohmann C, Rump LC, Schaible U, von Ku¨gelgen I: ␣-Adrenoceptor modulation of norepinephrine and ATP release in isolated kidneys of spontaneously hypertensive rats. Hypertens 25:1224– 1231, 1995 11. Oberhauser V, Vonend O, Rump LC: Neuropeptide Y and ATP interact to control renovascular resistance in the rat. J Am Soc Nephrol 10:1179–1185, 1999 12. Rump LC, Bohmann C, Schwertfeger E, et al: Extracellular ATP in the human kidney: Mode of release and vascular effects. J Auton Pharmacol 16:371–376, 1996 13. Inscho EW: P2 receptors in regulation of renal microvascular function. Am J Physiol (Renal Physiol) 280:F927–F944, 2001 14. Schulze-Lohoff E, Ogilvie A, Sterzel RB: Extracellular nucleotides as signalling molecules for renal mesangial cells. J Auton Pharmacol 16:381–384, 1996 15. Erlinge D: Extracellular ATP: A growth factor for vascular smooth muscle cells. Gen Pharmacol 31:1–8, 1998 16. Amann K, Nichols C, To¨rning C, et al: Effect of ramipiril, nifedipine and moxonidine on glomerular morphology and podocyte structure in experimental renal failure. Nephrol Dial Transplant 14:1003–1011, 1996 17. Rump LC, Schwertfeger E, Schuster MJ, et al: Dopamine DA2receptor activation inhibits norepinephrine release in human kidney slices. Kidney Int 43:197–204, 1993
1625
18. Hollopeter G, Jantzen HM, Vincent D, et al: Identification of the platelet ADP receptor targeted by antithrombotic drugs. Nature 40:202–207, 2001 19. Zhang FL, Luo L, Gustafson E, et al: ADP is the cognate ligand for the orphan G protein-coupled receptor SP1999. J Biol Chem 276:8608–8615, 2001 20. Barajas L, Liu L, Powers K: Anatomy of the renal innervation: Intrarenal aspects and ganglia of origin. Can J Physiol Pharmacol 70:735–749, 1992 21. Malamud D, Malt RA: Stimulation of cell proliferation in mouse kidney by isoproterenol. Lab Invest 24:140–143, 1971 22. Wolf G, Helmchen U, Stahl RA: Isoproterenol stimulates tubular DNA replication in mice. Nephrol Dial Transplant 11:2288– 2292, 1996 23. Von Ku¨gelgen I, Starke K: Noradrenaline-ATP co-transmission in the sympathetic nervous system. Trends Pharmacol Sci 12:319– 324, 1991 24. Sedaa KO, Bjur RA, Shinozuka K, Westfall DP: Nerve and drug-induced release of adenine nucleosides and nucleotides from rabbit aorta. J Pharmacol Exp Ther 252:1060–1067, 1990 25. Von Ku¨gelgen I, Starke K: Release of noradrenaline and ATP by electrical stimulation and nicotine in guinea-pig vas deferens. Naunyn Schmiedebergs Arch Pharmacol 344:419–429, 1991 26. Rump LC, von Ku¨gelgen I: A study of ATP as a sympathetic cotransmitter in human saphenous vein. Br J Pharmacol 111:65– 72, 1994 27. Trendelenburg AU, Limberger N, Rump LC: Alpha 2-adrenergic receptors of the alpha 2c subtype mediate inhibition of norepinephrine release in human kidney cortex. Mol Pharmacol 45:1168– 1176, 1994 28. Insel PA: Adrenergic receptors – evolving concepts and clinical implications. N Engl J Med 334:580–585, 1996 29. Michel MC, Rump LC: ␣-Adrenergic regulation of human renal function. Fundam Clin Pharmacol 10:493–503, 1996 30. Takeuchi K, Shinozuka K, Akimoto H, et al: Methoxamineinduced release of endogenous ATP from rabbit pulmonary artery. Eur J Pharmacol 254:287–290, 1994 31. Vizi ES, Sperlagh B, Baranyi M: Evidence that ATP released from the postsynaptic site by noradrenaline, is involved in mechanical responses of guinea-pig vas deferens: Cascade transmission. Neuroscience 50:455–465, 1992 32. De Leeuw PW, van Es PN, de Bos R, Birkenhager WH: Role of alpha 1- and alpha 2-adrenergic receptors in the human hypertensive kidney. Hypertens 9:210–212, 1987 33. De Leeuw PW, de Bos R, van Es PN, Birkenhager WH: Effect of sympathetic stimulation and intrarenal alpha-blockade on the secretion of renin by the human kidney. Eur J Clin Invest 15:166– 170, 1985 34. Burnstock G: Release of vasoactive substances from endothelial cells by shear stress and purinergic mechanosensory transduction. J Anat 194:335–342, 1999 35. Harada H, Chan CM, Loesch A, et al: Induction of proliferation and apoptotic cell death via P2Y and P2X receptors, respectively, in rat glomerular mesangial cells. Kidney Int 57:949–958, 2000 36. Nakamura E, Uezono Y, Narusawa K, et al: ATP activates DNA synthesis by acting on P2X receptors in human osteoblast-like MG-63 cells. Am J Physiol (Cell Physiol) 279:C510–C519, 2000 37. Baricordi OR, Melchiorri L, Adinolfi E, et al: Increased proliferation rate of lymphoid cells transfected with the P2X(7) ATP receptor. J Biol Chem 274:33206–33208, 1999 38. Ralevic V, Burnstock G: Receptors for purines and pyrimidines. Pharmacol Rev 50:413–492, 1998 39. Lambrecht G: Agonists and antagonists acting at P2X receptors: Selectivity profiles and functional implications. Naunyn Schmiedebergs Arch Pharmacol 362:340–350, 2000 40. No¨renberg W, Illes P: Neuronal P2X receptors: Localisation and functional properties. Naunyn Schmiedebergs Arch Pharmacol 362:324–339, 2000 41. Von Ku¨gelgen I, Wetter A: Molecular pharmacology of P2Yreceptors. Naunyn Schmiedebergs Arch Pharmacol 362:310–323, 2000 42. Communi D, Robaye B, Boeynaems JM: Pharmacological charac-
1626
Vonend et al: ATP release in human kidney
terization of the human P2Y11 receptor. Br J Pharmacol 128:1199– 1206, 1999 43. Bokemeyer D, Guglielmi KE, McGinty A, et al: Activation of extracellular signal-regulated kinase in proliferative glomerulonephritis in rats. J Clin Invest 100:582–588, 1997 44. Wilden PA, Agazie YM, Kaufman R, Halenda SP: ATP-stimulated smooth muscle cell proliferation requires independent ERK and PI3K signaling pathways. Am J Physiol 275:H1209– H1215, 1998 45. Huwiler A, Wartmann M, van den Bosch H, Pfeilschifter J:
Extracellular nucleotides activate the p38-stress-activated protein kinase cascade in glomerular mesangial cells. Br J Pharmacol 129: 612–618, 2000 46. Neary JT, Kang Y, Bu Y, et al: Mitogenic signaling by ATP/ P2Y purinergic receptors in astrocytes: Involvement of a calciumindependent protein kinase C, extracellular signal-regulated protein kinase pathway distinct from the phosphatidylinositol-specific phospholipase C/calcium pathway. J Neurosci 19:4211–4220, 1999 47. Wilson PD, Hovater JS, Casey CC, et al: ATP release mechanisms in primary cultures of epithelia derived from the cysts of polycystic kidneys. J Am Soc Nephrol 10:218–229, 1999