Attenuation of porcine circovirus type-2b by replacement with the Rep gene of porcine circovirus type-1

Virus Research 173 (2013) 270–279

Contents lists available at SciVerse ScienceDirect

Virus Research journal homepage: www.elsevier.com/locate/virusres

Attenuation of porcine circovirus type-2b by replacement with the Rep gene of porcine circovirus type-1 Tao Hua, Xianwei Wang, Juan Bai, Lili Zhang, Jie Liu, Ping Jiang ∗ Key Laboratory of Animal Diseases Diagnostic and Immunology, Ministry of Agriculture, College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210095, China

a r t i c l e

i n f o

Article history: Received 6 December 2012 Received in revised form 18 February 2013 Accepted 18 February 2013 Available online 27 February 2013 Keywords: PCV2b Chimeric virus Ori Rep Pathogenicity

a b s t r a c t Porcine circovirus type-2 (PCV2) is the primary causative agent of porcine circovirus-associated diseases and has 4 main ORFs, ORF1 (Rep gene), ORF2 (Cap gene), ORF3 within ORF1, and ORF4, which is overlapped with ORF3, and 1 origin (Ori) of replication located between ORF1 and ORF2. The chimeric PCV1-2, containing the PCV2 capsid, PCV1 rep, and Ori genes, is attenuated in pigs. In order to verify the role of the Rep gene or Ori in the virulence of PCV2, 3 chimeric viruses [PCV2b-Ori1 (PCV1 Ori gene cloned into the backbone of PCV2b), PCV2b-rep1 (PCV1 Rep gene cloned into the backbone of PCV2b), and PCV2brep1-Ori1 (PCV1 Rep and Ori genes cloned into the backbone of PCV2b)] and 2 wild-type recombinant PCV2b and PCV1 were constructed and identified. The experimental results in piglets showed that clinical symptoms, viremia, viral load, lesions in lymphoid and lung tissues, and IL-10 and TNF-␣ expression levels in PBMCs in the PCV2b-rep1-Ori1 and PCV2b-rep1 groups were significantly decreased, compared to PCV2-infected piglets. Meanwhile, histological lesions of lymphoid and lung tissues, viral loads in lymphoid tissues, viremia, and TNF-␣ expression in PBMCs were not significantly different between groups PCV2b-Ori1 and PCV2b, suggesting that the Rep gene (ORF1) likely contributes to viral pathogenicity in vivo. © 2013 Elsevier B.V. All rights reserved.

1. Introduction Porcine circovirus was first discovered in 1974 as a contaminant of the porcine kidney (PK)-15 cell line and named porcine circovirus type 1 (PCV1), which is non-pathogenic in pigs (Allan et al., 1995; Tischer et al., 1974). A variant strain of this virus, designated PCV2, was identified in Canada in the mid-1990s as the causative agent of post-weaning multisystemic wasting syndrome (Allan et al., 1998; Ellis et al., 1998) and is recognized as one of the most economically important viral pathogens in all major swine-producing countries. PCV is a small, non-enveloped DNA virus, which belongs to the Circovirus genus of the Circoviridae family. Although the genomic organizations of pathogenic PCV2 and non-pathogenic PCV1 are similar, they share only approximately 68–76% nucleotide sequence identity (Fenaux et al., 2004c; Hamel et al., 1998; Tischer et al., 1982). ORF1 gene encodes two viral replication-associated proteins, Rep and Rep , produced by differential splicing (Cheung, 2003, 2004b; Mankertz and Hillenbrand, 2001; Mankertz et al., 2003). The ORF2 gene encodes the viral capsid protein, which is the primary immunogenic protein (Nawagitgul et al., 2000). The PCV2 ORF3 gene, which is located within ORF1 in the reverse direction, encodes the ORF3 protein, which is an

∗ Corresponding author. Tel.: +86 25 84395504; fax: +86 25 84396640. E-mail addresses: [email protected], [email protected] (P. Jiang). 0168-1702/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.virusres.2013.02.007

inducer of apoptosis (Liu et al., 2005). ORF3 expression in PCV1 induced a greater amount of apoptotic cell death than PCV2 ORF3 in different cell types (Chaiyakul et al., 2010). The origin of replication is located in the intergenic region between ORF1 and ORF2 and is responsible for viral replication (Cheung, 2004a, 2006, 2007; Mankertz and Hillenbrand, 2001; Mankertz et al., 1997; Steinfeldt et al., 2001, 2006). PCV1 and PCV2 share approximately 80, 82, and 62% nucleotide sequence identity in the Ori, Rep, and Cap genes, respectively (Mankertz et al., 2004). A comparison between the PCV1 and PCV2 ORF3 translated regions revealed only 60% amino acid sequence identity (Finsterbusch and Mankertz, 2009). The chimeric viruses PCV1-2a and PCV1-2b, which code the capsid proteins of PCV2a and PCV2b in the genomic backbone of PCV1, are attenuated in pigs compared to the wild-type PCV2a and PCV2b serotypes (Beach et al., 2010b; Fenaux et al., 2004a). Two other chimeric viruses, PCV2-Ori1 (containing the Ori gene of PCV1 in the genomic backbone of PCV2a) and PCV2-rep1 (containing the rep gene of PCV1 in the genomic backbone of PCV2a) exhibited increased replication efficiencies compared to wild-type PCV2a (Beach et al., 2010a). However, it is uncertain whether the Ori and Rep genes of PCV2 are crucial to viral virulence in swine. In the present study, three chimeric viruses, PCV2b-Ori1 (containing the Ori of PCV1 in the genomic backbone of PCV2b), PCV2b-rep1 (containing the rep gene of PCV1 in the genomic backbone of PCV2b), and PCV2b-rep1-Ori1 (containing the cap gene of PCV2b in the genomic backbone of PCV1) were constructed and the

T. Hua et al. / Virus Research 173 (2013) 270–279

pathogenicity of these chimeric viruses were evaluated in piglets. Our results suggest that the Rep and Ori sequences of PCV2 are important to PCV2 virulence in swine, and the Rep sequence likely contributes to viral pathogenicity in vivo. 2. Methods and materials 2.1. Cells and viruses PK15 cells free of PCV-1 and PCV-2 were maintained in minimum essential medium (Gibco, Carlsbad, CA, USA) supplemented with 5% fetal calf serum (Gibco) and 1% penicillin and streptomycin (Sigma–Aldrich, St. Louis, MO, USA). PCV1 strain NJ03 (GenBank accession no.: JX566507) was isolated from tissue homogenate of inguinal lymph nodes from a healthy pig. PCV2b strain WG06 was isolated from a tissue homogenate of inguinal lymph nodes from a pig with PMWS (GenBank accession no.: JX679498). 2.2. Construction of genomic DNA clones of PCV2b, chimeric PCV2b-Ori1, PCV2b-rep1, and PCV2b-rep1-Ori1 The primers EcoR I–F and EcoR I–R (Table 1) were designed based on the published sequence of PCV2b/WG06 to amplify the complete PCV2b genome with an overlapping region containing the unique EcoR I restriction enzyme site. The construction of the PCV1 full-genomic DNA clone was very similar to that for PCV2b. Briefly, primers Kpn I-F and Kpn I-R (Table 1) were designed to amplify the complete PCV1 genome with an overlapping region containing the unique Kpn I restriction enzyme site (Fenaux et al., 2003). The complete genomes of PCV2b/WG06 and PCV1/NJ03 were cloned into pEASY-Blunt simple vectors (Transgene Biopharmaceuticals Technology, Shanghai, China) to produce the recombinant plasmid pEasy-PCV2b (Fig. 1) and pEasy-PCV1 (Fig. 1). The full-length chimeric genome was assembled from two overlapping polymerase chain reaction (PCR) fragments for chimera PCV2-Ori1 with primers EcoR I-F + PCV2b-Ori1-down and PCV2bOri1-up + EcoR I-R on a PCV2b backbone. The chimeric fusion product was cloned into pEASY-Blunt simple vectors to produce the clone pEasy-PCV2b-Ori1 (Fig. 1). Four fragments (F1–4), used to assemble chimera PCV2brep1, were amplified with primers EcoR I-F + PCV2b-rep1-up-1 and PCV2b-rep1-down-2 + EcoR I-R on a PCV2b backbone, and primers PCV2b-rep1-up-3 + Kpn I-R and Kpn I-F + PCV2b-rep1-down-4 on a PCV1 backbone. The F12 fragment of chimeric PCV2b-rep1 was assembled by fusion PCR with primers EcoR I-F + Kpn I-R on a F1 + F2 backbone. After Kpn I and EcoR I digestion, the F12 fragment was cloned into pcDNA3.1+ to produce the recombinant plasmid pcDNA3.1-F12. The F34 fragment of the chimeric PCV2rep1 genome was assembled by fusion PCR with primers Xho I-Kpn I-F + EcoR I-R on a F3 + F4 backbone and cloned into pEASY-Blunt simple vectors. After Xho I and EcoR I digestion, the F34 fragment was cloned into pcDNA3.1-F12 to produce the recombinant plasmid pcDNA3.1-PCV2-rep1 (Fig. 1). The construction of the PCV2b-rep1-Ori1 full-genomic DNA clone was very similar to the method for PCV2b-rep1. The F5 and F6 fragments of the chimeric PCV2b-rep1-Ori1 genome were PCR-amplified with primers EcoR I-F + PCV2b-rep1-Ori1-down on a PCV2b backbone and primers PCV2b – rep1-Ori1-up + Kpn I-R on a PCV1 backbone. The F56 fragment of the chimeric PCV2b-rep1-Ori1 genome was assembled by fusion PCR with primers EcoR I-F + Kpn I-R on a F5 + F6 backbone. After EcoR I and Kpn I digestion, the F56 fragment was cloned into pcDNA3.1+ and named pcDNA3.1-F56. The above-described F34 fragment, digested with Xho I and EcoR I, was cloned into pcDNA3.1-F56 to produce the clone pcDNA3.1PCV2b-rep1-Ori1 (Fig. 1).

271

2.3. In vitro PCV transfection and rescue After EcoR I or Kpn I digestion, the entire genome of PCV2b, chimera PCV2b-Ori1, PCV2b-rep1 and PCV2b-rep1-Ori1 were produced from the plasmids pEasy-PCV2b, pEasy-PCV2b-Ori1, pcDNA3.1-PCV2b-rep1, and pcDNA3.1- PCV2b-rep1-Ori1, respectively. One microgram of the purified genome was self-ligated using T4 DNA ligase (TaKaRa Bio, Dalian, China) to produce doublestranded circular genomes, which were then transfected into PK 15 cells using Lipofectamine 2000 Transfection Reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocols. After transfection at 37 ◦ C for 72 h, the plates were subjected to three freeze/thaw cycles to produce the viral stock. After inoculation into PK-15 cell monolayers of each viral stock, recombinant PCV were detected using an indirect immunofluorescence assay (IFA) with monoclonal antibody against the capsid protein of PCV2 (made in our lab). After passage of viral stocks several times, the viral titers were determined by IFA (see Section 2.4) according to the Kärber method. 2.4. IFA PK-15 cells, inoculated with the rescued viruses in 96-well culture plates, were rinsed with phosphate buffered saline (PBS) and fixed with cold 80% acetone and 20% methanol for 10 min at 4 ◦ C. The cells were washed, and then incubated with 1:100-diluted antiPCV2 monoclonal antibody for 1 h at 37 ◦ C. After washing with PBS-0.5% Tween 20 (PBS-T), the cells were incubated with goat anti-mouse IgG conjugated with fluorescein (1:50 diluted in PBST) (Boshide, Wuhan, China) for 45 min at 37 ◦ C. After rinsing five times, the cells were observed under a fluorescence microscope (Carl Zeiss AG, Oberkochen, Germany). 2.5. One-step growth curves of PCV2b, PCV2b-Ori1, PCV2b-rep1 and PCV2b-rep1-Ori1 in PK-15 cells PK-15 cells free of PCV1 were grown on 24-well plates. Each plate was infected with PCV2b, PCV2b-Ori1, PCV2b-rep1, PCV2brep1-Ori1 and PCV1, respectively, at a multiplicity of infection (MOI) of 0.1. Maintenance medium (2% bovine calf serum and 1% antibiotics) was subsequently added to each well and the infected cells were continuously incubated at 37 ◦ C. The medium and cells from triplicate wells of each inoculation group were harvested every 12 h through 96 h post infection (hpi) and stored at −80 ◦ C until virus titration. The viral titers were determined by IFA in PK15 cells according to the Kärber method. 2.6. Animal experiments Twenty-five 4-week-old piglets, free of PCV2, porcine reproductive and respiratory syndrome virus, classical swine fever virus, pseudorabies virus, porcine parvovirus, swine influenza virus, and Mycoplasma hyopneumoniae infection, were randomly assigned to 5 groups of 5 piglets each and housed separately. The pigs in group 1 were inoculated with PBS (2 mL intranasally and 2 mL intramuscularly) as an uninfected control. Groups 2–5 were each inoculated with 4 mL of 105 median tissue culture infective dose (TCID50 )/mL of the recombinant PCV2b-Ori1, PCV2b-rep1, PCV2b-rep1-Ori1, and PCV2b virus stock (2 mL intranasally and 2 mL intramuscularly), respectively. All piglets were stimulated with keyhole limpet hemocyanin (KLH) emulsified in incomplete Freund’s adjuvant and thioglycollate broth (glycan) as described by Krakowka et al. (2001) and Wang et al. (2007). Post-challenge, all pigs were monitored for 29 days for rectal temperatures and clinical signs. Blood and sera samples were collected from all animals on 0, 7, 11, 19, and 29 days post infection (dpi) for detection of PCV2 using real-time

272

T. Hua et al. / Virus Research 173 (2013) 270–279

Table 1 Oligonucleotide primers used in this study. Primers

Primer sequences(5 –3 )

Application

EcoR I–F EcoR I–R Kpn I–F Kpn I–R PCV2b-Ori1-up PCV2b-Ori1-down PCV2b-rep1-up-1 PCV2b-rep1-down-2 PCV2b-rep1-up-3 PCV2b-rep1-down-4 Xho I-Kpn I–F PCV2b-rep1-Ori1-up PCV2b-rep1-Ori1-down

GCGAATTCAACCTTAACCTTTCTTATTC ATTGAATTCTGGCCCTGCTCCCC TTTGGTACCCGAAGGCCGATT ATTGGTACCTCCGTGGATTGTTCT AGTATTACCAGCGCACTTCGGCAGCGGCAGCACCTCGGCAGCGTC AGTGAAAATGCCAAGCAAGAA TGCCGCTGCCGAAGTGCGCTGGTAATACTACAGCAGCGCACTTCT TTCACTTTTATAGGATGACGT CGGGCCGCTTTTCTTGCTTGGCATGTTGCTGCTGAGGTGCTGCC CCCATATAAAATAAATTACTGAGTCTTTTTTATCACTTCGTAA GGCAGCACCTCAGCAGCAACATGCCAAGCAAGAAAAGCGGCCCG TTACGAAGTGATAAAAAAGACTCAGTAATTTATTTTATATGGGA TTCTCGAGGGTACCCGAAGGCCGATTTGAAGCAG GCCTCCTTGGATACGTCATCCTATAAAAGTGAAAGAAGTGCG TTCTTTCACTTTTATAGGATGACGTATCCAAGGAGGCGTTT

PCV2b/WG06 DNA clone construction PCV2b/WG06 DNA clone construction PCV1/NJ03 DNA clone construction PCV1/NJ03 DNA clone construction PCV2b-Ori1 DNA clone construction PCV2b-Ori1 DNA clone construction PCV2b-rep1 DNA clone construction PCV2b-rep1 DNA clone construction PCV2b-rep1 DNA clone construction PCV2b-rep1 DNA clone construction PCV2b-rep1 DNA clone construction PCV2b-rep1-Ori1 DNA clone construction PCV2b-rep1-Ori1 DNA clone construction

PCR and antibody to the PCV2 cap protein via an enzyme-linked immunosorbent assay (ELISA). Pigs were individually weighed on 0 and 29 dpi and relative daily weight gains (RDWG; expressed as daily weight gains/primary body weight) were determined. At the end of the experiment, all piglets were euthanized and pathological examinations were performed. All experimental protocols were approved by the Institutional Animal Care and Ethics Committee of Nanjing Agricultural University (Nanjing, Jiangsu, China) (permit no.: IACECNAU20111005) and met the standards of the International Guiding Principles for Biomedical Research Involving Animals.

2.7. ELISA for PCV2-specific antibody PCV2-specific antibody responses were measured at 0, 7, 11, 19, and 29 dpi of each serum sample using an ELISA as previously described (Wang et al., 2006). Briefly, 96-well plates were coated with purified GST-Cap protein at a concentration of 5 ␮g/mL. The sera samples were diluted in PBS-T and bound antibodies were detected with a 1/10,000 dilution of Staphylococcal protein A with horseradish peroxidase conjugated with horseradish peroxidase as a secondary antibody (Boshide, Wuhan, China). Meanwhile, the sera samples from the control group (PBS-treated) were used as a negative control. The spectrographic results are reported as the ratio of OD490 produced by the serum samples compared to negative control serum (P/N). A P/N value ≥ 2.1 was considered positive.

The titers are expressed as the highest dilution of antibody producing a P/N value ≥ 2.1. 2.8. Pathological examination Necropsies were performed at 29 dpi on all piglets and superficial inguinal lymph node and lung tissues were collected, fixed by immersion in 10% formalin, embedded in paraffin wax using standard methods, sectioned (4 ␮m thick), and hematoxylin and eosin (HE)-stained for microscopic examination. Depending on the number of depleted lymphocytes, macrophages, epithelium-like macrophages, and affected alveoli, the histological lesions were scored using a 3-point system from light (1) to severe (3) (Wang et al., 2007). The depletion of lymphocytes in the lymph node tissues were subjectively graded as follows: 1, ≤5% affected lymphocytes; 2, 5–20% affected lymphocyte; and 3, ≥20% affected lymphocyte; and histiocytic replacement of follicles as: 0, no affected lymphocytes or lung lesion; 1, ≤10% of the alveolus wall affected; 2, 10–30% of the alveolus wall affected; and 3, ≥30% of the alveolus wall affected with dense inflammatory infiltration. 2.9. Quantitative real-time PCR to determine viral DNA loads Serum samples were collected from all animals on 0, 7, 11, 19 and 29 dpi and viral DNA was extracted using DNAzol reagent (Invitrogen) according to the manufacturer’s instructions. Next,

Fig. 1. Organization and construction of the complete infectious genome. The complete genomes of PCV2b, PCV1, and the chimeric virus PCV2b-Ori1 were ligated into pEasy blunt vectors. The complete genomes of the chimeric viruses PCV2b-rep1 and PCV2b-rep1-Ori1 were cloned into pcDNA3.1 vectors.

T. Hua et al. / Virus Research 173 (2013) 270–279

273

Fig. 2. Detection of the capsid protein following infection of PK-15 with each lysate of transfection cells of the 4 double-stranded circular genomes. The capsid protein was detected with an anti-Cap monoclonal antibody and confirmed that both the wild-type and chimeric double-stranded circular genomes were infectious. (A) PCV2b-Ori1, (B) PCV2b-rep1, (C) PCV2b-rep1-Ori1, and (D) PCV2b, (E) PBS.

total DNA was extracted from the inguinal lymph node samples using DNAzol reagent. The viral load of PCV2b and each chimera in the sera of infected animals were determined using a verified quantitative real-time PCR (qPCR) assay to detect the cap gene of PCV2b and each chimera (Feng et al., 2008, 2006) using the sense primer PCV2F: 5 -CCAGGAGGGCGTTCTGACT-3 , the antisense primer PCV2R: 5 -CGTTACCGCTGGAGAAGGAA-3 , and the probe 5 -FAM-AATGGCATCTTCAACACCCGCCTC-TARAM-3 on an ABI7300 Sequence Detection System (v.1.3; Applied Biosystems, Foster City, CA, USA).

Fig. 3. In vitro transfection of PK-15 cells with PCV2b, PCV2b-Ori1, PCV2b-rep1, PCV2b-rep1-Ori1, and PCV1 double-stranded circular genomes followed by 5 serial passages of the viruses in PK-15 cells. PK-15 cells were transfected each with 4 ␮g of PCV2b, PCV2b-Ori1, PCV2b-rep1, PCV2b-rep1-Ori1 and PCV1. The infectious titers were determined at each passage according to the Kärber method. The wild-type PCV2b, chimeric PCV2b-Ori1, PCV2b-rep1, and PCV2b-rep1-Ori1 recombinants had similar infectious viral titers after the initial transfection.

2.10. Cytokine detection Ten to 15 mL of ethylenediaminetetra-acetic acid-stabilized blood was collected from each piglet at 7, 19, and 29 dpi. Peripheral blood mononuclear cells (PBMCs) were isolated by density gradient centrifugation using lymphocyte separation medium (TBD, Tianjin, China). Washed cells were resuspended in Roswell Park Memorial Institute-1640 medium supplemented with 10% fetal calf serum, 2 mM glutamine, and 1% penicillin and streptomycin at a concentration of 5 × 106 cells/mL, and then dispensed in 96-well plates (5 × 105 cells per well) and stimulated with concanavalin A (ConA; Sigma–Adrich) at a final concentration of 10 ␮g/mL. After

Fig. 4. One-step viral growth curves. Synchronized PK-15 cell cultures were each infected with PCV2b-Ori1, PCV2b-rep1, PCV2b-rep1-Ori1, PCV2b, and PCV1 at an MOI of 0.1. After incubation for the indicated periods, the medium and cells from triplicate wells of each inoculation group were harvested and the viral titers were determined by IFA in PK-15 cells according to the Kärber method. The results are mean values from three independent experiments.

274

T. Hua et al. / Virus Research 173 (2013) 270–279

incubation for 72 h at 37 ◦ C under a 5% CO2 atmosphere, supernatant from the PBMCs cultures were stored at −80 ◦ C and evaluated for porcine IFN-␥, IL-10, TNF-␣, and IL-1␤ using ELISA kits (R&D Systems, Inc., Minneapolis, MN, USA) following the manufacturer’s protocols. 2.11. Statistical analysis Comparisons of in vitro viral growth characterizations, microscopic lesions, RDWG values, rectal temperatures, serological parameters, viral loads, and cytokine levels between the control and treatment groups were carried out using the SYSTAT 9 software package (SPSS Inc., Chicago, IL, USA) with a statistical significance set at p < 0.05.

Fig. 5. PCV2b capsid-specific antibody responses in piglets of each group experimentally inoculated with PCV2b-Ori1, PCV2b-rep1, PCV2b-rep1-Ori1, and wild-type PCV2b. The mean antibody titer of serum ± SEM was plotted for each treatment group.

3. Results 3.1. The parental and each chimeric double-stranded circular genome were infectious in vitro The ability of wild-type and chimeric genomes to generate infectious viral particles was assessed by infecting PK-15 cells with each viral stock from the respective previously transfected cells following three freeze/thaw cycles. The lysates recovered from previously transfected PK15 cells successfully infected naïve PK15 cells as evidenced by the IFA results presented in Fig. 2 showing that the parental and each chimeric circular genome were infectious in vitro and produced infectious viral particles. 3.2. Characterization of the chimeric viruses in vitro After the initial transfection, the replication levels of PCV2b, PCV2b-Ori1, PCV2b-rep1, and PCV2b-rep1-Ori1 were detected in PK15 cells. The results showed that all viral stocks, originating from the transfected cells, had low initial titers (Fig. 3). After five passages, the titers of the viral stocks gradually increased to 106.16 , 105.29 , 105 , and 105.16 TCID50 /mL in PCV2b, PCV2b-rep1, PCV2bOri1, and PCV2b-rep1-Ori1, respectively. The growth characteristics of the wild-type and chimeric PCVs were further determined by a one-step growth curve performed simultaneously. As shown in Fig. 4, PCV2b replicated efficiently as did PCV1 (p ≥ 0.05). The chimeric PCV2b-Ori1, PCV2b-rep1 and PCV2b-rep1-Ori1 grew slowly and had significantly lower infectious titers than did wild-type PCV2b at 36, 48, 60, 72, 84, and 96 hpi (p < 0.05). 3.3. Clinical signs evaluation After challenge with the recombinant viruses, all piglets were observed for 29 days. As shown in Table 2, the number of days with rectal temperature >40.0 ◦ C was significantly greater in group PCV2b compared to groups PCV2b-Ori1, PCV2b-rep1, and PCV2brep1-Ori1 (p < 0.05). The RDWG in group PCV2b was significantly lower than those in the PCV2b-rep, PCV2b-rep1-Ori1, and control groups (p < 0.05). However, there was no significant difference in RDWG between the PCV2b-rep1, PCV2b-rep1-Ori1, and control groups. Furthermore, one piglet inoculated with PCV2b showed dyspnea, wasting, a rough hair-coat, and lethargy from 11 dpi to necropsy.

at 11 dpi. At 19 dpi, all piglets in the virally challenged groups were seropositive, although the antibody levels were not significantly different between the groups. Further, no seroconversion was detected in the control group during the trial. 3.5. Viremia detection As shown in Fig. 6, the viral genomic copy numbers in sera of piglets infected with PCV2b was significantly higher than those in the other virally challenged groups from 7 to 29 dpi. Even though the viral load in the PCV2b-Ori1 group was low from 7 to 19 dpi, the levels were close to that in the PCV2b group at 29 dpi, and significantly higher than those in the PCV2b-rep1-Ori1 and PCV2brep1 groups at that time. Although the genomic copy number in the PCV2b-rep1-Ori1 group was the lowest compared to those in the other virally challenged groups, the incidence of PCV2b-rep1 viremia did not significantly change throughout the experiment. 3.6. Detection of cytokine in PBMCs PBMCs were isolated from the porcine blood samples at 7, 19, and 29 dpi. After stimulation with ConA, the levels of IFN-␥, IL-10, TNF-␣, and IL-1␤ in the cultured cells were detected via ELISA. As shown in Fig. 7, TNF-␣ expression levels in the PCV2b and PCV2bOri1 groups were significantly up-regulated compared to those in the PCV2b-rep1, PCV2b-rep1-Ori1, and control groups from 19 to 29 dpi (p < 0.05). Further, TNF-␣ secretion in PBMCs from only the PCV2b-rep1-infected piglets was significantly higher than that in the control group at 7 dpi (p < 0.05). The TNF-␣ concentration of group PCV2b-rep1-Ori1 was similar to that in the control group at all time points.

3.4. Antibody to the PCV2 Cap protein At 0, 7, 11, 19, and 29 dpi, blood samples were collected and serum PCV2-specific antibodies were measured via indirect ELISA. As shown in Fig. 5, the first seroconversion was detected in only 1 or 2 pigs in the PCV2b-rep1, PCV2b-rep1-Ori1, and PCV2b groups

Fig. 6. Detection and quantification of viral DNA loads in serum of pigs experimentally inoculated with PCV2b-Ori1, PCV2b-rep1, PCV2b-rep1-Ori1, and wild-type PCV2b. Quantification of viral DNA loads in sera was detected by qPCR. The mean log viral genomic copies/mL of serum ± SEM was plotted for each treatment group.

T. Hua et al. / Virus Research 173 (2013) 270–279

275

Table 2 Clinical characteristics of different swine groups post-infection. Groups

PBS

PCV2b-Ori1

rPCV2b-rep1

PCV2b-rep1-Ori1

PCV2b

*

No. of pigs

1 2 3 4 5 Mean 6 7 8 9 10 Mean 11 12 13 14 15 Mean 16 17 18 19 20 Mean 21 22 23 24 25 Mean

The days with fever (≥40 ◦ C) after infection

0 1 0 0 0 0.2 ± 0.447 a 2 1 1 2 2 1.6 ± 0. 447 a 2 2 0 1 1 1.2 ± 0.836 a 0 1 1 2 0 0.8 ± 0.836 a 1 4 3 1 2 2.23 ± 1.128 b

Relative daily weight gains after challenge

Body weight at 0 dac (kg)

Body weight at 29 dac (kg)

RDWG*

5.8 6.2 6 5.3 5.5 – 5.15 5.55 5.5 5.25 6.5 – 5.25 5.05 6.55 5.35 6.8 – 6.85 5.75 6.2 6.3 5.65 – 5.75 5.55 5.7 7.25 6.1 –

11.75 13.25 14.3 11.4 11.65 – 10.95 9.95 10.8 9.15 11.75 – 10.8 11.5 12.95 11.75 13.05 – 15.95 11.05 12.7 13.26 10.95 – 10.55 10.95 7.95 13.2 11.95 –

0.035375 0.03921 0.047701 0.039688 0.038558 0.0401 ± 0.00457 a* 0.038835 0.027338 0.033229 0.025615 0.027851 0.0306 ± 0.00543 bc 0.036453 0.044042 0.033693 0.04125 0.031694 0.0374 ± 0.00515 ac 0.045809 0.031784 0.036151 0.038095 0.032347 0.0368 ± 0.00566 ac 0.028786 0.033551 0.013739 0.0283 0.03307 0.0275 ± 0.00811 b

Letters indicate statistically significantly differences between groups (p < 0.05).

IL-10 levels in group PCV2b was significantly higher than those in the PCV2b-rep1, PCV2b-rep1-Ori1, and control groups at 19 and 29 dpi (p < 0.05), but there was no significant difference between groups PCV2b and PCV2b-Ori1 at 29 dpi (p > 0.05). Meanwhile, IL-1␤ levels in all virally infected groups were significantly upregulated compared to the control group at 7 and 19 dpi (p < 0.05), but there was no significant difference between all groups at 29 dpi. In addition, IFN-␥ levels in PBMCs supernatant from each group were not significantly different at all tested time points (7, 19, and 29 dpi).

3.7. Pathological lesions At the end of the experiment, all piglets were euthanized for pathological examination, which showed no significant gross lesions in the PCV2b-rep1, PCV2b-rep1-Ori1, and control groups. In contrast, one piglet in group PCV2b showed moderate to severe lesions in the lung, lymph node, and kidney tissue samples. Next, all lymph node and lung samples were collected and the histological lesions were examined. As shown in Table 3, mild to severe histological lesions accompanied

Fig. 7. Cytokine levels in supernatants from PBMCs from each chimeric- or PCV2b-infected piglet were determined by ELISA.

276

T. Hua et al. / Virus Research 173 (2013) 270–279

Fig. 8. Histological lesions of lung (upper) and lymph nodes (lower) in experimental piglets. Mildly thick alveolar walls and lymphoid depletion or replacement in lymph nodes were observed in the piglets infected with PCV2b-rep1-Ori1 and PCV2b-rep1. Moderately thicker alveolar walls, macrophage infiltration of the lungs, and severe lymphoid depletion or replacement in the lymph nodes were indicated in piglets infected with PCV2b-Ori1 and wild-type PCV2b. Normal alveolar walls and lymphatic nodules were observed in the piglets inoculated with PBS.

by severe interstitial pneumonia were observed in the lungs of 4 piglets inoculated with PCV2b and in 3 inoculated with PCV2b-Ori1, which showed mild to severe thickening of the alveolar walls and macrophage infiltration of the alveolar septa (Fig. 8). The mean lung histological lesion scores in groups PCV2b and PCV2b-Ori1 were significantly higher than those in the PCV2b-rep1, PCV2b-rep1-Ori1, and control groups (p < 0.05). Meanwhile, the histological lesions in tissues from piglets in groups PCV2b and PCV2b-Ori1 showed moderate to severe lymphoid depletion and lymphoid replacement of the cortex and paracortex with epithelioid macrophages and cytoplasmic inclusions in the lymph nodes (Fig. 8). The mean lymphoid depletion and replacement scores in groups PCV2b and PCV2b-Ori1 were significantly higher than those in the PCV2b-rep1, PCV2b-rep1-Ori1 and control groups (p < 0.05) (Table 3). 3.8. Viral loads in lymphoid tissues As shown in Fig. 9, the viral load presented in the inguinal lymph node tissue in group PCV2b-rep1-Ori1 was significantly lower than those in groups PCV2b and PCV2b-Ori1 at 29 dpi (p < 0.05),

but there was no statistically significant difference between groups PCV2b-rep1-Ori1 and PCV2b-rep1. Meanwhile, all inguinal lymph node samples were negative for viral DNA in the control group. 4. Discussion Porcine circovirus-associated (PCVAD) diseases lead to major global porcine epidemics and cause substantial economic losses to the swine industry; however, the molecular mechanisms of PCV2 replication and pathogenesis remain poorly understood. PCV1 has been adapted to grow in PK-15 cells and both the ori and rep proteins of PCV1 enhance the replication efficiencies of chimeric viruses PCV2-Ori1 and PCV2-rep1 with PCV2a backbones compared to the wild-type PCV2a virus (Beach et al., 2010a). In this study, three chimeric viruses (PCV2b-Ori1, PCV2b-rep1, and PCV2b-rep1Ori1) were constructed by replacement of the PCV2b Rep and/or Ori genes with those of PCV1 and they replicated efficiently in PK15 cells with titers similar to that of the wild-type PCV2b by five passages in PK-15 cells. However, the one-step growth curve results indicated that the PCV2b-Ori1, PCV2b-rep1, and PCV2brep1-Ori1 chimeras had lower replication efficiencies compared to

Table 3 Microscopic lesions of lung and lymph node tissues of piglets inoculated with the chimeric viruses PCV2b-Ori1, PCV2b-rep1, PCV2b-rep1-Ori1, and PCV2b at 29 dpi. Inocula

No. of positive pigs/no. necropsied (mean lesion) Lung*

PBS PCV2b-Ori1 PCV2b-rep1 PCV2b-rep1-Ori1 PCV2b

0/5 3/5 (1.4)b 2/5 (0.6)a 1/5 (0.5)a 4/5 (2.0)b

Lymph node** 0/5 (0) 3/5 (1.8)a 2/5 (0.8)b 1/5 (0.6)b 4/5 (2.4)a

a, b: the superscript letters indicate significant differences between groups (p < 0.05). * Average scores of 0 (normal) to 3 (severe) indicate the presence and severity of interstitial pneumonia. ** Average scores of 0 (normal) to 3 (severe) for lymphoid depletion and histiocytic inflammation and replacement of follicles.

Fig. 9. Detection and quantification of viral DNA loads in inguinal lymph node tissues in pigs experimentally inoculated with PCV2b-Ori1, PCV2b-rep1, PCV2brep1-Ori1, and wild-type PCV2b. Quantification of viral DNA load in inguinal lymph node tissues was detected by qPCR. The mean log 10 viral genomic copies/g of tissues ± SEM was plotted for each treatment group.

T. Hua et al. / Virus Research 173 (2013) 270–279

PCV2b in vitro, which was in contrast to that previously reported for PCV2-Ori1 and PCV2-rep1 using PCV2a as backbone. One possible explanation for this discrepancy is that the viral strains may have been different, as the previous study employed a PCV2a gene type strain (Fenaux et al., 2000), while the present used PCV2b. Reportedly, a more robust accumulation of viral proteins in the nucleus is associated with motif-2b than with motif-2a (Cheung and Greenlee, 2011). A strain of PCV2a (P120) containing the P110A and R191S mutations in the PCV2a capsid enhanced the growth ability of PCV2 in vitro and attenuated the virus in vivo (Fenaux et al., 2004b). Thus the minute differences in the PCV2 genome can impact its replication efficiency in vitro and pathology in vivo. Many experimental models have been developed to investigate PCV2 infection combined with co-factors such as bacteria, other viruses, or immunostimulation to increase the severity of clinical signs and the incidence of PMWS. To evaluate the pathogenicity of the chimeric viruses in piglets, we selected PCV2-free test animals and challenged them with PCV and KLH emulsified in Freund’s adjuvant as described by (Krakowka et al., 2001; Wang et al., 2007). The results showed that RDWG of the piglets in groups PCV2b and PCV2b-Ori1were significantly lower than those in the PCV2b-rep1, PCV2b-rep1-Ori1, and control groups at 29 dpi (p < 0.05). Further, the microscopic lesions in the lung and lymph node tissues of piglets in groups PCV2b and PCV2b-Ori1 were more severe than those of groups PCV2b-rep1 and PCV2b-rep1-Ori1. But, there was no significant difference in RDWG and microscopic lesions observed between the PCV2b-rep1, PCV2b-rep1-Ori1, and control groups (p > 0.05). Furthermore, the viral load in serum and inguinal lymphoid node tissues obtained from groups PCV2b and PCV2b-Ori1 was higher than those in groups PCV2b-rep1 and PCV2b-rep1-Ori1 at 29 dpi. In addition, the viral genomes were PCR-amplified from the lymphoid tissue samples from each virally challenged group. Sequence analyses of the PCR products revealed that the recovered viruses from the infected piglets were genetically the same as the original inoculums and the viral antigens could be detected by immunohistochemistry in inguinal lymph node samples from each challenged group (data not shown). Our results indicated that the virulence of PCV2b-rep1 and PCV2b-rep1Ori1 was lower than that of PCV2b and PCV2b-Ori1. Because of the limitation of our animal housing facility, PCV1 was not used as control as previously reported. However, this should not impact on our conclusions because PCV1 is not pathogenic to pigs. Cytokines are important regulators of the mammalian immune system and IFN-␥ has potent antiviral properties that contribute to the control of acute viral infections and is an important mediator of cellular responses. However, PCV2 replication has been found to be enhanced by IFN-␥ in vitro (Meerts et al., 2005). In this study, INF␥ levels were not significantly different among all virally infected groups at all time points and there was no evidence to indicate a correlation between IFN-␥ levels and viral replication in vivo. IL-10 has potent immunosuppressive properties that include suppressing immune responses and PCV2, but not PCV1, can induce production of the immunosuppressive cytokine IL-10 in PBMCs, CD 172a+ cells, and bone marrow-derived dendritic cells (Kekarainen et al., 2008). High levels of IL-10 were correlated with the viremic peak of infection in subclinically PCV2-infected pigs (Darwich et al., 2008). Here, our results showed that at 19 dpi, PCV2b-inoculated piglets produced higher amounts of IL-10, compared to those in the control, PCV2b-rep1, and PCV2b-rep1-Ori1 groups. The viral load of serum determined by qPCR was also correlated to IL-10 production. TNF-␣ is a pleiotropic cytokine that plays important roles in the induction and regulation of inflammatory responses. PCV2 infection can regulate TNF-␣ mRNA expression in PBMCs (Shi et al., 2010). In this study, TNF-␣ expression in group PCV2b was significantly higher than that in the control and PCV2b-rep1-Ori1

277

groups at all time points. TNF-␣ expression in group PCV2b-Ori1 also showed significant up-regulation compared to the control and PCV2b-rep1-Ori1 groups at 19 and 29 dpi. IL-1␤ is an important mediator of the inflammatory response and is involved in a variety of cellular activities, including cell proliferation, differentiation, and apoptosis (Darwich et al., 2003a). However, IL-1␤ mRNA expression from the inguinal and bronchial lymph nodes, tonsils, spleen, and thymus was not significantly different between healthy and PMWS groups (Darwich et al., 2003b). Here, IL-1␤ expression in groups PCV2b-rep1 and PCV2b-rep1-Ori1 was significantly higher than those in the control group at 7 and 19 dpi (p < 0.05), but not at 29 dpi, indicating that the Rep gene (ORF1) plays a role in suppression of immune response during PCV2 infection. Immune stimulation was found to activate PCV2 replication and exacerbate the clinical outcome of infection. Treatment of PCV2-infected cells with INF-␥ or IFN-␣ increased PCV2 replication in vitro and an interferon-stimulated response element (ISRE) sequence was identified in the Ori sequence of PCV2 (Ramamoorthy et al., 2009). Animal experiment results showed that a mutation of the PCV2 ISRE caused an apparent increase in pathogenicity in pigs coinfected with PCV2 and PRRSV, even though replication of the ISRE mutant virus to peak time was delayed compared with the parental virus in vivo (Ramamoorthy et al., 2011). Recently, a functional viral ISRE sequence, 5 -CTGAAAACGAAAGA-3 , was identified in Rep gene promoter (Prep) of PCV2 (Gu et al., 2012), but not in the Rrep sequence of PCV1, suggesting that the ISRE element plays a putative role in the replication efficiency and pathogenesis of PCV2 in vivo and in vitro. In this study, the replication of chimeric PCV2b-Ori1 and PCV2b-rep1-Ori1 significantly decreased viral load in vivo at 19 dpi, compared to that of PCV2b and the virulence of PCV2b-Ori1 and PCV2b-rep1-Ori1 was lower than those of PCV2b in the infected piglets, suggesting that the lack of an ISRE sequence in PCV2b-Ori1 and PCV2b-rep1-Ori1 plays putative role in the attenuation of the chimeric viruses. The ORF3 gene is located within ORF1 in the reverse direction and has different lengths in PCV1 and PCV2 and its role in apoptosis and/or pathogenesis remains highly debatable. Some reports have proposed that ORF3 is responsible for the induction of apoptosis and the ORF3-deficient PCV2 is attenuated in its pathogenesis in mice and piglets (Karuppannan et al., 2009; Liu et al., 2006). In addition, the ORF3 also plays a role in the systemic dissemination of the PCV2 infection (Karuppannan and Kwang, 2011). However, Juhan et al. created an ORF3-null PCV2 mutant (muPCV2) by site-directed mutagenesis and found that the evidence of reduced pathogenicity was limited in pigs infected by muPCV2 although the results did show that ORF3 was dispensable for PCV2 replication in pigs (Juhan et al., 2010). Mandrioli et al. (2004) reported that decreased cell proliferation and not increased apoptosis was the most important variable leading to cell depletion in PMWS lymphoid tissues. Chaiyakul et al. found that a nonpathogenic PCV1 ORF3 protein induced a greater amount of apoptosis than that of PCV2 in different cell types. Truncation of PCV1 and elongation of PCV2 ORF3 proteins revealed that the first 104 amino acids contain a domain capable of inducing cell death, whereas the C terminus of PCV1 ORF3 contains a domain possibly responsible for enhancing cell death. Analysis of over 250 PCV2 and 30 PCV1 variants showed a consistent singlenucleotide substitution in the ORF3 of PCV2 resulting in a stop codon and a protein that is half the size of PCV1 ORF3 (Chaiyakul et al., 2010). Thus, immune suppression and attenuated virulence is either not a function of the ORF 3 protein or not solely determined by the ORF3 protein. Moreover, a newly discovered viral protein (ORF4) was reported by He et al. in 2012 (He et al., 2012), who reported that it was not essential for PCV2 replication, but rather played a role in suppressing caspase activity and decreased levels of CD4(+) and CD8(+) T lymphocytes during PCV2 infection (He et al., 2012). Because the ORF4 gene overlaps with ORF3 in the

278

T. Hua et al. / Virus Research 173 (2013) 270–279

same direction, ORF4 expression in the chimeric PCV2b-rep1 and PCV2b-rep1-Ori1 models should be detected in the future. In summary, we first demonstrated that PCV2b-rep1-Ori1 and PCV2b-rep1 were attenuated based on RDWG, histological lesions, viral load in lymphoid and lung tissues, viremia, and expression levels of TNF-␣ and cytokines in the experimental pigs. The ORF1 (Rep gene) likely contributes to PCV2 pathogenicity in vivo, thus the virulence of PCV2b-rep1 should be evaluated in older, healthy piglets in the future. Acknowledgements This work was supported by grants of agriculture from Jiangsu province (BE2012368), China agricultural research system foundation (CARS-36), the special fund for agro-scientific research in the public interest (200903036-4, 201203039), and priority academic program development of Jiangsu higher education institutions (PAPD). References Allan, G.M., McNeilly, F., Cassidy, J.P., Reilly, G.A., Adair, B., Ellis, W.A., McNulty, M.S., 1995. Pathogenesis of porcine circovirus; experimental infections of colostrum deprived piglets and examination of pig foetal material. Veterinary Microbiology 44 (1), 49–64. Allan, G.M., McNeilly, F., Kennedy, S., Daft, B., Clarke, E.G., Ellis, J.A., Haines, D.M., Meehan, B.M., Adair, B.M., 1998. Isolation of porcine circovirus-like viruses from pigs with a wasting disease in the USA and Europe. Journal of Veterinary Diagnostic Investigation: Official Publication of the American Association of Veterinary Laboratory Diagnosticians Inc. 10 (1), 3–10. Beach, N.M., Juhan, N.M., Cordoba, L., Meng, X.J., 2010a. Replacement of the replication factors of porcine circovirus (PCV) type 2 with those of PCV type 1 greatly enhances viral replication in vitro. Journal of Virology 84 (17), 8986–8989. Beach, N.M., Ramamoorthy, S., Opriessnig, T., Wu, S.Q., Meng, X.J., 2010b. Novel chimeric porcine circovirus (PCV) with the capsid gene of the emerging PCV2b subtype cloned in the genomic backbone of the non-pathogenic PCV1 is attenuated in vivo and induces protective and cross-protective immunity against PCV2b and PCV2a subtypes in pigs. Vaccine 29 (2), 221–232. Chaiyakul, M., Hsu, K., Dardari, R., Marshall, F., Czub, M., 2010. Cytotoxicity of ORF3 proteins from a nonpathogenic and a pathogenic porcine circovirus. Journal of Virology 84 (21), 11440–11447. Cheung, A.K., 2003. The essential and nonessential transcription units for viral protein synthesis and DNA replication of porcine circovirus type 2. Virology 313 (2), 452–459. Cheung, A.K., 2004a. Identification of an octanucleotide motif sequence essential for viral protein, DNA, and progeny virus biosynthesis at the origin of DNA replication of porcine circovirus type 2. Virology 324 (1), 28–36. Cheung, A.K., 2004b. Identification of the essential and non-essential transcription units for protein synthesis, DNA replication and infectious virus production of porcine circovirus type 1. Archives of Virology 149 (5), 975–988. Cheung, A.K., 2006. Rolling-circle replication of an animal circovirus genome in a theta-replicating bacterial plasmid in Escherichia coli. Journal of Virology 80 (17), 8686–8694. Cheung, A.K., 2007. A stem-loop structure, sequence non-specific, at the origin of DNA replication of porcine circovirus is essential for termination but not for initiation of rolling-circle DNA replication. Virology 363 (1), 229–235. Cheung, A.K., Greenlee, J.J., 2011. Identification of an amino acid domain encoded by the capsid gene of porcine circovirus type 2 that modulates intracellular viral protein distribution during replication. Virus Research 155 (1), 358–362. Darwich, L., Balasch, M., Plana-Duran, J., Segales, J., Domingo, M., Mateu, E., 2003a. Cytokine profiles of peripheral blood mononuclear cells from pigs with postweaning multisystemic wasting syndrome in response to mitogen, superantigen or recall viral antigens. The Journal of General Virology 84 (Pt 12), 3453–3457. Darwich, L., Pie, S., Rovira, A., Segales, J., Domingo, M., Oswald, I.P., Mateu, E., 2003b. Cytokine mRNA expression profiles in lymphoid tissues of pigs naturally affected by postweaning multisystemic wasting syndrome. The Journal of General Virology 84 (Pt 8), 2117–2125. Darwich, L., Segale’s, J., Resendes, A., Balasch, M., Plana-Dura’n, J., Mateu, E., 2008. Transient correlation between viremia levels and IL-10 expression in pigs subclinically infected with porcine circovirus type 2 (PCV2). Research in Veterinary Science 84, 194–198. Ellis, J., Hassard, L., Clark, E., Harding, J., Allan, G., Willson, P., Strokappe, J., Martin, K., McNeilly, F., Meehan, B., Todd, D., Haines, D., 1998. Isolation of circovirus from lesions of pigs with postweaning multisystemic wasting syndrome. The Canadian Veterinary Journal. La revue Veterinaire Canadienne 39 (1), 44–51. Fenaux, M., Halbur, P.G., Gill, M., Toth, T.E., Meng, X.J., 2000. Genetic characterization of type 2 porcine circovirus (PCV-2) from pigs with postweaning multisystemic wasting syndrome in different geographic regions of North America and development of a differential PCR-restriction fragment length polymorphism assay

to detect and differentiate between infections with PCV-1 and PCV-2. Journal of Clinical Microbiology 38 (7), 2494–2503. Fenaux, M., Opriessnig, T., Halbur, P.G., Elvinger, F., Meng, X.J., 2004a. A chimeric porcine circovirus (PCV) with the immunogenic capsid gene of the pathogenic PCV type 2 (PCV2) cloned into the genomic backbone of the nonpathogenic PCV1 induces protective immunity against PCV2 infection in pigs. Journal of Virology 78 (12), 6297–6303. Fenaux, M., Opriessnig, T., Halbur, P.G., Elvinger, F., Meng, X.J., 2004b. Two amino acid mutations in the capsid protein of type 2 porcine circovirus (PCV2) enhanced PCV2 replication in vitro and attenuated the virus in vivo. Journal of Virology 78 (24), 13440–13446. Fenaux, M., Opriessnig, T., Halbur, P.G., Meng, X.J., 2003. Immunogenicity and pathogenicity of chimeric infectious DNA clones of pathogenic porcine circovirus type 2 (PCV2) and nonpathogenic PCV1 in weanling pigs. Journal of Virology 77 (20), 11232–11243. Fenaux, M., Opriessnig, T., Halbur, P.G., Xu, Y., Potts, B., Meng, X.J., 2004c. Detection and in vitro and in vivo characterization of porcine circovirus DNA from a porcine-derived commercial pepsin product. The Journal of General Virology 85 (Pt 11), 3377–3382. Feng, Z., Jiang, P., Wang, X., Li, Y., Jiang, W., 2008. Adenovirus-mediated shRNA interference against porcine circovirus type 2 replication both in vitro and in vivo. Antiviral Research 77 (3), 186–194. Feng, Z.X., Jiang, P., Wang, X.W., Li, Y.F., Xu, J.R., 2006. Development of a real-time PCR method for detection of type 2 porcine circovirus. Virologica Sinica 21, 371–374. Finsterbusch, T., Mankertz, A., 2009. Porcine circoviruses – small but powerful. Virus Research 143 (2), 177–183. Gu, J., Zhang, Y., Lian, X., Sun, H., Wang, J., Liu, W., Meng, G., Li, P., Zhu, D., Jin, Y., Cao, R., 2012. Functional analysis of the interferon-stimulated response element of porcine circovirus type 2 and its role during viral replication in vitro and in vivo. Virology Journal 9, 152. Hamel, A.L., Lin, L.L., Nayar, G.P., 1998. Nucleotide sequence of porcine circovirus associated with postweaning multisystemic wasting syndrome in pigs. Journal of Virology 72 (6), 5262–5267. He, J., Cao, J., Zhou, N., Jin, Y., Wu, J., Zhou, J., 2012. Identification and functional analysis of the novel ORF4 protein encoded by porcine circovirus type 2. Journal of Virology. Juhan, N.M., LeRoith, T., Opriessnig, T., Meng, X.J., 2010. The open reading frame 3 (ORF3) of porcine circovirus type 2 (PCV2) is dispensable for virus infection but evidence of reduced pathogenicity is limited in pigs infected by an ORF3-null PCV2 mutant. Virus Research 147 (1), 60–66. Karuppannan, A.K., Jong, M.H., Lee, S.H., Zhu, Y., Selvaraj, M., Lau, J., Jia, Q., Kwang, J., 2009. Attenuation of porcine circovirus 2 in SPF piglets by abrogation of ORF3 function. Virology 383 (2), 338–347. Karuppannan, A.K., Kwang, J., 2011. ORF3 of porcine circovirus 2 enhances the in vitro and in vivo spread of the of the virus. Virology 410 (1), 248–256. Kekarainen, T., Montoya, M., Mateu, E., Segales, J., 2008. Porcine circovirus type 2-induced interleukin-10 modulates recall antigen responses. The Journal of General Virology 89 (Pt 3), 760–765. Krakowka, S., Ellis, J.A., McNeilly, F., Ringler, S., Rings, D.M., Allan, G., 2001. Activation of the immune system is the pivotal event in the production of wasting disease in pigs infected with porcine circovirus-2 (PCV-2). Veterinary Pathology 38 (1), 31–42. Liu, J., Chen, I., Du, Q., Chua, H., Kwang, J., 2006. The ORF3 protein of porcine circovirus type 2 is involved in viral pathogenesis in vivo. Journal of Virology 80 (10), 5065–5073. Liu, J., Chen, I., Kwang, J., 2005. Characterization of a previously unidentified viral protein in porcine circovirus type 2-infected cells and its role in virus-induced apoptosis. Journal of Virology 79 (13), 8262–8274. Mandrioli, L., Sarli, G., Panarese, S., Baldoni, S., Marcato, P.S., 2004. Apoptosis and proliferative activity in lymph node reaction in postweaning multisystemic wasting syndrome (PMWS). Veterinary Immunology and Immunopathology 97 (1/2), 25–37. Mankertz, A., Caliskan, R., Hattermann, K., Hillenbrand, B., Kurzendoerfer, P., Mueller, B., Schmitt, C., Steinfeldt, T., Finsterbusch, T., 2004. Molecular biology of porcine circovirus: analyses of gene expression and viral replication. Veterinary Microbiology 98 (2), 81–88. Mankertz, A., Hillenbrand, B., 2001. Replication of porcine circovirus type 1 requires two proteins encoded by the viral rep gene. Virology 279 (2), 429–438. Mankertz, A., Mueller, B., Steinfeldt, T., Schmitt, C., Finsterbusch, T., 2003. New reporter gene-based replication assay reveals exchangeability of replication factors of porcine circovirus types 1 and 2. Journal of Virology 77 (18), 9885–9893. Mankertz, A., Persson, F., Mankertz, J., Blaess, G., Buhk, H.J., 1997. Mapping and characterization of the origin of DNA replication of porcine circovirus. Journal of Virology 71 (3), 2562–2566. Meerts, P., Misinzo, G., Nauwynck, H.J., 2005. Enhancement of porcine circovirus 2 replication in porcine cell lines by IFN-gamma before and after treatment and by IFN-alpha after treatment. Journal of Interferon and Cytokine Research 25 (11), 684–693. Nawagitgul, P., Morozov, I., Bolin, S.R., Harms, P.A., Sorden, S.D., Paul, P.S., 2000. Open reading frame 2 of porcine circovirus type 2 encodes a major capsid protein. The Journal of General Virology 81 (Pt 9), 2281–2287. Ramamoorthy, S., Huang, F.F., Huang, Y.W., Meng, X.J., 2009. Interferon-mediated enhancement of in vitro replication of porcine circovirus type 2 is influenced by an interferon-stimulated response element in the PCV2 genome. Virus Research 145 (2), 236–243.

T. Hua et al. / Virus Research 173 (2013) 270–279 Ramamoorthy, S., Opriessnig, T., Pal, N., Huang, F.F., Meng, X.J., 2011. Effect of an interferon-stimulated response element (ISRE) mutant of porcine circovirus type 2 (PCV2) on PCV2-induced pathological lesions in a porcine reproductive and respiratory syndrome virus (PRRSV) co-infection model. Veterinary Microbiology 147 (1/2), 49–58. Shi, K.C., Guo, X., Ge, X.N., Liu, Q., Yang, H.C., 2010. Cytokine mRNA expression profiles in peripheral blood mononuclear cells from piglets experimentally co-infected with porcine reproductive and respiratory syndrome virus and porcine circovirus type 2. Veterinary Microbiology 140 (1/2), 155–160. Steinfeldt, T., Finsterbusch, T., Mankertz, A., 2001. Rep and Rep’ protein of porcine circovirus type 1 bind to the origin of replication in vitro. Virology 291 (1), 152–160. Steinfeldt, T., Finsterbusch, T., Mankertz, A., 2006. Demonstration of nicking/joining activity at the origin of DNA replication associated with the rep and rep’ proteins of porcine circovirus type 1. Journal of Virology 80 (13), 6225–6234.

279

Tischer, I., Gelderblom, H., Vettermann, W., Koch, M.A., 1982. A very small porcine virus with circular single-stranded DNA. Nature 295 (5844), 64–66. Tischer, I., Rasch, R., Tochtermann, G., 1974. Characterization of papovavirus-and picornavirus-like particles in permanent pig kidney cell lines. Zentralblatt fur bakteriologie, parasitenkunde, infektionskrankheiten und hygiene. Erste abteilung originale. Reihe A: Medizinische Mikrobiologie und Parasitologie 226 (2), 153–167. Wang, X., Jiang, P., Li, Y., Jiang, W., Dong, X., 2007. Protection of pigs against post-weaning multisystemic wasting syndrome by a recombinant adenovirus expressing the capsid protein of porcine circovirus type 2. Veterinary Microbiology 121 (3/4), 215–224. Wang, X., Jiang, W., Jiang, P., Li, Y., Feng, Z., Xu, J., 2006. Construction and immunogenicity of recombinant adenovirus expressing the capsid protein of porcine circovirus 2 (PCV2) in mice. Vaccine 24 (16), 3374–3380.