- Email: [email protected]
Autoclaved spent substrate of hatakeshimeji mushroom (Lyophyllum decastes Sing.) and its water extract protect cucumber from anthracnose
Crop Protection 30 (2011) 443e450
Contents lists available at ScienceDirect
Crop Protection journal homepage: www.elsevier.com/locate/cropro
Autoclaved spent substrate of hatakeshimeji mushroom (Lyophyllum decastes Sing.) and its water extract protect cucumber from anthracnose R.Y. Parada a, S. Murakami b, N. Shimomura a, M. Egusa a, H. Otani a, * a b
Faculty of Agriculture, Tottori University, 4-101 Koyama-Minami, Tottori 680-8553, Japan The Tottori Mycological Institute, 211 Kokoge, Tottori 689-1125, Japan
a r t i c l e i n f o
a b s t r a c t
Article history: Received 13 July 2010 Received in revised form 19 November 2010 Accepted 24 November 2010
The protective effect of fresh spent mushroom substrate (SMS) of hatakeshimeji (Lyophyllum decastes Sing.), a popular culinary-medicinal mushroom, and its water extract against anthracnose of cucumber was investigated. Plants were treated with water extract from SMS or autoclaved water extract by spraying the whole plant or by dipping the first true leaf, and inoculated with Colletotrichum orbiculare seven days later. Plants treated with either of the extracts showed a significant reduction of necrotic lesions. On the other hand, when plants were grown in a mixture (1:2, v/v) of SMS or autoclaved SMS and soil, a disease reduction of over 70% was observed in autoclaved SMS. The water extract showed no antifungal activity against spore germination and mycelial growth of the pathogen. Real-time PCR analyses of chitinase and b-1,3-glucanase genes revealed a significant increase of expressions after 24 h of pathogen inoculation in water extract-treated plants compared with the control plants. These results suggest that water-soluble and heat-stable compounds in SMS enhance the state of systemic acquired resistance and protect cucumbers from anthracnose. Thus, the use of SMS for disease control may offer a new technology for the recycling and management of waste from mushroom cultivation. Ó 2010 Elsevier Ltd. All rights reserved.
Keywords: Anthracnose Cucumber Hatakeshimeji (Lyophyllum decastes) Spent mushroom substrate Systemic acquired resistance
1. Introduction According to the Food and Agriculture Organization of the United Nations (2008), the global production of cultivated edible mushrooms had increased from 2.26 million tons in 1998 to 3.48 million tons in 2008. About 53% of cultivated edible mushrooms are produced in Asian countries, followed by European countries (32%) and the Americas (13%). In Japan, mushrooms are eaten and appreciated for their flavor, and used medicinally for their healing properties. In 2007, the production of edible mushrooms in Japan was estimated to be 423,224 t, and it is expected that this amount will increase in the future due to market demand. Despite the evident benefits of mushrooms, the exponential increase in their consumption worldwide is also generating a high volume of spent mushroom substrate (SMS). It has been reported that about 5 kg of substrate are needed to produce 1 kg of mushroom (Williams et al., 2001; Uzun, 2004; Finney et al., 2009), and about 17 million tons of SMS are produced each year. Consequently, one of the main problems faced by mushroom production companies is finding a way to properly dispose of the SMS without contaminating the * Corresponding author. Tel./fax: þ81 857 315355. E-mail address: [email protected] (H. Otani). 0261-2194/$ e see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.cropro.2010.11.021
water and soil. In fact, the lack of a sustainable waste management solution for SMS is the most significant barrier to the future development of the mushroom industry (Finney et al., 2009). Several studies have been carried out to demonstrate the benefits of SMS application in mushroom re-cultivation, enrichment of soils, restoring areas that have been destroyed through development, deforestation or environmental contamination (Sánchez, 2004), cultivation of vegetables, fruits and flowers in greenhouses and fields (Medina et al., 2009; Polat et al., 2009; Ribas et al., 2009), and soil amendment and degradation of organopollutants (Semple et al., 2001; Lau et al., 2003). The SMS can also be used as a potential energy feedstock (Williams et al., 2001; Finney et al., 2009), and ethanol production (Hideno et al., 2007). In plant-fungal interactions, carbohydrate and protein elicitors that induce defense mechanism in plants are released from the mycelia of fungal pathogens (Shibuya and Minami, 2001). Once the plants recognize elicitors, many plants develop an enhanced resistance to further pathogen attack also in the uninoculated organs. This type of induced resistance is called systemic acquired resistance (SAR) (Durrant and Dong, 2004; Vallad and Goodman, 2004; Da Rocha and Hammerschmidt, 2005; Walters et al., 2005; Conrath, 2006). Therefore, the mycelia of mushrooms that are prevalent in SMS are abundant sources of elicitors, and thus
444
R.Y. Parada et al. / Crop Protection 30 (2011) 443e450
application of SMS to plants may be useful for the control of plant diseases. However, the study of the potential role of SMS in disease control has not received adequate attention. In the few studies that have addressed this topic, the emphasis has been on exploiting the antibiotic-producing microorganisms in SMS by applying SMS as compost (Yohalem et al., 1994; Cronin et al., 1996; Viji et al., 2003; Choi et al., 2007). Hatakeshimeji (Lyophyllum decastes Sing.), a gray basidiomycete family Tricholomataceae, belongs to the same genus as honshimeji (Lyophyllum shimeji Hongo), which is well known as the most delicious mushroom (Ukawa et al., 2000; Pokhrel et al., 2006). In addition to its delicious taste and excellent texture, hatakeshimeji has been well studied for its medical properties. Recently, powder from this mushroom has been made commercially available and has been used as a health-promoting supplement for prevention and treatment of various diseases (Ukawa et al., 2007). The main objective of this work was to determine whether extracts from hatakeshimeji SMS can protect cucumber (Cucumis sativus L.) from anthracnose caused by Colletotrichum orbiculare (Berkeley & Montagne) Arx. In addition, SAR-related gene expression in water extract-treated cucumber was examined for analyzing the mechanism of disease resistance. 2. Materials and methods 2.1. Preparation of SMS The hatakeshimeji strain TMIC30940 was inoculated in polypropylene bags containing 2.5 kg mixtures of Japanese cedar, sorghum, soybean pulp, rice bran and wheat bran (8:0.5:1:0.9:0.3, v/v). The bags were incubated at 20e22 C for 65 days, and then incubated at 17e19 C for 30 days for fruit body formation. After the fruit bodies were harvested, SMS was used immediately for water extract preparation. 2.2. Water extract from SMS Spent mushroom substrate (200 g) was homogenized in a Waring blender (Nissei, Tokyo, Japan) with 500 ml of distilled water (DW) for 2 min at 1500 rpm. The homogenate was filtered through two layers of Miracloth (Calbiochem, La Jolla, CA) and then centrifuged for 5 min at 800 g. The supernatant was used immediately for leaf treatment or stored at 80 C until use as the water extract from SMS (hereinafter WESMS). WESMS was autoclaved at 121 C for 30 min (hereinafter AWESMS), and AWESMS was also used for leaf treatment. 2.3. Treatments with WESMS and SMS on cucumber 2.3.1. WESMS The cucumber (C. sativus) cultivar Natsusuzumi was grown in plastic pots (9 cm) containing soil mixed with Tanemaki soil (JA, Tokyo, Japan) and Nippi No. 1 soil (JA, Tokyo, Japan) in a climatecontrolled room at 25 C with a 14-h light and 10-h dark period. Cucumber plants (16e20 days old) with the first true leaf (next to cotyledon) and second true leaf fully expanded and the third true leaf one-third-one half of its full size were used for foliar application of WESMS. The first true leaf was dipped for 10 s in WESMS or the whole plants were sprayed with WESMS. The first true leaf or the whole plants of cucumber were also treated with AWESMS. DW was used as a control. 2.3.2. SMS Cucumber seeds were germinated in a cell tray containing Tanemaki soil. To examine the effects of SMS in soil on cucumber plants, the seedlings were transplanted after seven days to plastic pots (9 cm)
containing a mixture of SMS and Nippi No. 1 soil (1:2, v/v). The same experiment was conducted using SMS autoclaved at 121 C for 30 min (hereinafter ASMS). Seedlings were also grown in pots containing only Nippi No. 1 soil as a control. 2.4. Conidium inoculation and disease assessment The strain C-14 of C. orbiculare, which causes anthracnose of cucumber, was obtained from the ZEN-NOH Agricultural R & D Center (Hiratsuka, Japan). The culture was maintained on a potato dextrose agar (PDA) (Difco) plate (9 cm) at 25 C and sub-cultured on a PDY (PDA amended with 0.5% yeast) plate to obtain abundant conidia for the inoculation test. The conidial suspensions were prepared from 7e12 day-old cultures. For inoculation, conidia of C-14 were collected from the plate with DW, filtered through Kimwipes tissue S-200 (Nippon Paper Crecia, Tokyo, Japan) and washed three times by centrifugation (5 min at 800 g). The concentration was adjusted to 5 105 or 1 105 conidia/ml. The conidial suspensions (5 105 conidia/ml) were sprayed onto whole plants after seven days of treatment with WESMS or AWESMS. In the plants treated with SMS or ASMS, spore suspensions (1 105 conidia/ml) were applied as 5e10 drops (30 ml each) on the first and second true leaves after approximately 15 days of treatment. Inoculated plants were kept in the dark at 90% RH in a growth cabinet (MLR-351H) (Sanyo, Tokyo, Japan) for 24 h at 20 C, and then transferred to an incubator room at 25 C. The number of lesions on each examined leaf in the spray inoculation experiment and the lesion area on each leaf in the drop inoculation experiment were recorded 5e7 days later. 2.5. Antifungal activity of WESMS Conidia of C-14 were washed three times with DW by centrifugation. The spore pellets after centrifugation were mixed with WESMS and AWESMS passed through a 0.22-mm-pore filter unit (Millipore, Bedford, MA) and the concentration was adjusted to 5 105 conidia/ml. DW was used as a control. Conidial suspensions (3 ml) were sprayed on glass slides and incubated in a moist chamber at 25 C in the dark for 24 h. Conidial germination and germ-tube length were measured microscopically. For mycelial growth tests, mycelia discs (5 mm in diameter) were transferred onto potato dextrose yeast (PDY) or Czapek solution agar (Difco) (10 ml) plate (9 cm), supplemented with WESMS or AWESMS (1 ml/plate) sterilized by filtration. Sterile DW was added to each medium as a control. The plates were incubated at 25 C in the dark and radial colony growth of the fungus was recorded after three weeks. 2.6. Gene expression in the cucumber We selected six genes which have been reported to be involved in the defense response against biotic or abiotic stress in plants: callose synthase, lignin peroxidase, chitinase, b-1,3-glucanase, pathogenesis-related protein-1 and phenylalanine ammonia-lyase (Table 1). For RNA extraction, samples were harvested at 7 days after treatment and 1 day after the pathogen inoculation from the leaves of whole plants treated by spraying with WESMS. Cucumber leaves treated by spraying the whole plants with DW was used as a control. Samples were snap frozen in liquid nitrogen, and stored at 80 C until required. Total RNA was isolated using TRIzol-Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions, and treated with DNase (DNA-free; Ambion, Austin, TX). One microgram of RNA was reverse-transcribed with an RT reagent kit (Takara Bio, Tokyo, Japan) using a random 6-mer primer, according to the manufacturer’s instructions. Real-time PCR was performed on
R.Y. Parada et al. / Crop Protection 30 (2011) 443e450
445
Table 1 List of primers used in this study. Template
Reference or accession
Name
Sequence (50 -30 )
Amplicon (bp)
Callose synthase
Deepak et al., 2006 DQ641104
b-1,3-Glucanase
AB009974
Lignin peroxidase
Deepak et al., 2006
Pathogenesis-related protein-1
AF475286
Phenylalanine ammonia-lyase
AF529240
b-Actin
Deepak et al., 2006
TGTTACCTTGGCCAGAGACTTC CCTATCGAACACGTCTGGATGTC AGACGCCGCGATCAAAACTG ACATGCATGGCGGGTTGTTG TTGACAATGCAAGGACTTAC AAGTTTCAATAGCCCTTCCT CCAAGACGGCAGTTGAGAAGA TTGCAGCAACTGCAAGAATATCA GACTCACCTCAAGACTTCGT GTTTTGTCCCACTCAATCGG GTGCTGAGATTGCCATGGCT TGTTGCTCGGCACTTTGGAC TGTGAGTCACACTGTTCCCATCT AGCAAGGTCCAAACGGAGAA
79
Chitinase
Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
a LightCycler 330 system (Roche Diagnostics, Tokyo, Japan) using SYBR Green (Roche, Basel, Switzerland). A 5-ml cDNA sample was added to a total 20-ml reaction mixture containing 4 ml of SYBR Green Mastermix and 0.5 mM gene specific primers pair (Table 1) into the LightCycler glass capillaries. The following LightCycler experimental run protocol was used: an initial step of 95 C for 10 min followed by 40 cycles of 95 C for 10 s, primer-dependent temperature 60 C (except for chitinase that was performed at 65 C) for 10 s, and 72 C for 5 s, with a single fluorescence measurement. Subsequently, a melting program was applied with continuous fluorescence measurement at 95 C, and slowly heated from 65 to 95 C at 0.1 C s1. The b-actin gene was used as a reference (Deepak et al., 2006). Cucumber plants without any treatment were used as a control (no treatment control ¼ NTC), and the fold increase of the expression levels of each gene was calculated after normalization by the following formula:
Fold gene expression ¼
71 87 69 80 88 70
and 98% in disease respectively compared with the control plants (Table 2), indicating that maximal disease reduction by WEFB on treated plants requires 7 days before being challenged with the pathogen. Therefore, the disease-protective effect of WESMS and AWESMS was observed seven days after treatment. The first true leaf of cucumber was dipped in WESMS or AWESMS for 10 s. After seven days, the whole plants were inoculated with the pathogen by spraying conidial suspensions. The results showed that WESMS and AWESMS, as well as WEFB, significantly protected the second, third and fourth true leaves of cucumber plants from anthracnose (Table 3 and Fig. 1). To investigate whether the protective effect of WESMS and AWESMS is derived from the mycelia of hatakeshimeji in SMS, plants were treated with water extract from a substrate before inoculation of hatakeshimeji (hereinafter WES) and with autoclaved water extract from a substrate (hereinafter AWES). Seven days later, the whole plants were inoculated with conidial suspensions (5 105 conidia/ml)
Quantity of target gene=Quantity of reference gene Quantity of target gene in NTC=Quantity of reference gene
2.7. Statistical analysis All experiments to assess disease symptoms and gene expression were conducted at least three times and the data were combined into average values and presented in the same table or figure. Significant differences from the control values were determined using a t-test. 3. Results 3.1. Protective effect of WESMS and AWESMS against anthracnose of cucumber Prior to the investigation of disease protection by WESMS and AWESMS, a preliminary experiment was conducted using water extract from fruit bodies (Basidiocarps) (hereinafter WEFB) (50 g fruit body/250 ml DW). The first true leaf of cucumber plants grown in pots was dipped in WEFB for 10 s. The whole plants were inoculated with conidial suspensions (5 105 conidia/ml) of C. orbiculare after 5 h, 4 days or 7 days of treatment. Lesion formation on the inoculated leaves of the whole plants was examined five days after inoculation. Disease reduction was only 26% in the plants incubated for 5 h before spore inoculation. The plants incubated for 4 days and 7 days after WEFB treatment showed significant reductions of 86.1%
of C. orbiculare. The results (Table 4) showed that there was no significant difference in the symptoms on cucumber leaves between WES or AWES treatment and DW treatment, suggesting that the mycelial components of SMS are primarily responsible for the disease protection. Table 2 Effect of water extract from fruit body (WEFB) of hatakeshimeji on lesion formation by Colletotrichum orbiculare on cucumber plants. Treatmenta
Time after treatmentb
Lesionc (spots/leaf)
Disease reductiond (%)
WEFB DW WEFB DW WEFB DW
5h 5h 4 days 4 days 7 days 7 days
35.0 16.0 47.3 18.1 4.3 7.5 31.0 7.0 1.3 2.3 63.6 19.5
26.0 e 86.1* e 98.0* e
a
The first true leaf of cucumber plants was treated by dipping for 10 s. The treated plants were incubated for the indicated time. The plants were inoculated by spraying with conidial suspensions (5 105 conidia/ml) of C. orbiculare, and assessed for symptoms on second, third and fourth true leaves after 5e7 days of inoculation. Each value is the average of three replications with standard deviation. d Disease reduction ¼ [(S V)/S] 100, where S is the number of lesions after distilled water (DW) treatment and V is the number of lesions after WEFB treatment. Asterisks indicate significant differences compared to the results by DW treatment (t-test, P < 0.05). b c
446
R.Y. Parada et al. / Crop Protection 30 (2011) 443e450
Table 3 Effect of water extract from fruit body (WEFB), water extract from SMS (WESMS) and autoclaved WESMS (AWESMS) of hatakeshimeji on lesion formation by Colletotrichum orbiculare on cucumber plants. Treatmenta
Cucumber plant 2nd true leaf b
WEFB WESMS AWESMS DW
3rd true leaf c
4th true leaf
Lesion (spots/leaf)
Disease reduction (%)
Lesion (spots/leaf)
Disease reduction (%)
Lesion (spots/leaf)
Disease reduction (%)
2.0 1.7 7.5 2.1 1.6 2.0 76.6 44.4
97.4* 90.2* 97.9* e
4.6 4.0 5.5 3.5 0.0 0.0 128.6 23.7
96.4* 95.7* 100.0* e
2.3 2.0 16.0 5.6 0.6 1.1 131.0 10.1
98.2* 87.8* 99.5* e
a
The first true leaf of cucumber plants was treated by dipping for 10 s and incubated for 7 days. The plants were inoculated with C. orbiculare by spraying with conidial suspensions (5 105 conidia/ml), and assessed for symptoms on each leaf except for the first true leaf after 5e7 days of inoculation. Each value is the average of three replications with standard deviation. c Disease reduction ¼ [(S V)/S] 100, where S is the number of lesions after distilled water (DW) treatment and V is the number of lesions after WEFB, WESMS or AWESMS treatment. Asterisks indicate significant differences compared to the results by DW treatment (t-test, P < 0.05). b
The disease reduction effect of WESMS was compared with that of the spraying of whole plants and dipping the first true leaf. In this experiment, cucumber plants were inoculated by placing a 30-ml drop of conidial suspensions (1 105 conidia/ml) of C. orbiculare on 10 sites of the first and second true leaves in spraying treatment and on the second true leaf in dipping treatment, and the area of necrotic lesions formed on the drop sites were observed after seven days. The results showed that the cucumber plants treated with WESMS were protected from anthracnose by either the spraying or the dipping treatment (Table 5 and Fig. 2A). 3.2. Protective effect of SMS and ASMS mixed in soil on anthracnose of cucumber To observe the disease-protective effect of SMS and ASMS mixed in soil, cucumber seedlings were planted in pots containing mixtures of SMS or ASMS and soil (1:2, v/v), and tested for disease protection. In cucumber seedlings grown in soil mixed with SMS, disease protection was not detected; the values on the first and second true leaves were 1.5% and 17.5%, respectively. In contrast, in plants grown in soil mixed with ASMS, significant disease reductions of 70.7% and 74.5% were observed in the first and second true leaves, respectively (Table 6 and Fig. 2B). 3.3. Antifungal activity of WESMS and AWESMS The inhibitory activity of WESMS and AWESMS on conidial germination and germ-tube elongation of C. orbiculare was tested.
The results (Table 7) showed that both conidial germination and germ-tube elongation were more vigorous in the presence of WESMS and AWESMS. Mycelial growth of C. orbiculare on PDY agar and Czapek solution agar plates containing WESMS and AWESMS also was not suppressed (Table 7). 3.4. Gene expression in cucumber plants treated with WESMS Analysis of gene expression using real-time PCR showed that when WESMS-treated plants were inoculated with spores of C. orbiculare by spraying the whole plants, the expression of the chitinase and b-1,3-glucanase genes was significantly enhanced in compared with control plants at 24 h (Fig. 3). The gene expression of pathogenesis-related protein-1 and phenylalanine ammonialyase in WESMS-treated plants had no significant difference in the expression in comparison with the DW control with or without spore inoculation, and expression of the callose synthase and lignin peroxidase genes was not detected. 4. Discussion In this study, cucumber plants were protected systemically from anthracnose by spraying the whole plants with or by dipping the first true leaf in WESMS or AWESMS. WESMS and AWESMS did not exert any direct action on C. orbiculare because no antifungal activities were observed. WES and AWES from substrate before mushroom inoculation did not protect plants from anthracnose. These results indicate that WESMS and AWESMS contain water-
Fig. 1. Suppression of anthracnose on the leaves of cucumber plants treated with autoclaved water extract from spent mushroom substrate (AWESMS). Leaves of cucumber plants were treated by dipping the first true leaf in distilled water (DW) (control) (A) and AWESMS (B). Cucumber plants treated with DW and AWESMS were inoculated by spraying with conidial suspensions of Colletotrichum orbiculare (5 105 conidia/ml) 7 days after treatment.
R.Y. Parada et al. / Crop Protection 30 (2011) 443e450
447
Table 4 Effect of water extract from substrate without inoculation of hatakeshimeji (WES) and autoclaved WES (AWES) on lesion formation by Colletotrichum orbiculare on cucumber plants. Treatmenta
Cucumber plant 2nd true leaf
3rd true leaf
b
WES AWES DW
c
4th true leaf
Lesion (spots/leaf)
Disease reduction (%)
Lesion (spots/leaf)
Disease reduction (%)
Lesion (spots/leaf)
Disease reduction (%)
79.0 9.6 77.3 15.8 99.0 27.0
20.2 21.9 e
75.7 17.9 79.0 34.4 75.0 7.8
0.9 5.3 e
111.0 10.5 100.0 18.5 112.3 34.5
1.2 11.0 e
a
The first true leaf of cucumber plants was treated by dipping for 10 s and incubated for 7 days. The plants were inoculated with C. orbiculare by spraying with conidial suspensions (5 105 conidia/ml), and assessed for symptoms on each leaf except for the first true leaf after 5e7 days of inoculation. Each value is the average of three replications with standard deviation. c Disease reduction ¼ [(S V)/S] 100, where S is the number of lesions after distilled water (DW) treatment and V is the number of lesions after WES or AWES treatment. No significant difference was detected between WES or AWES treatment and DW treatment (t-test). b
soluble and heat-stable elicitors for inducing systemic acquired resistance (SAR) in cucumber plants. Several studies have reported the use of the elicitors from the cell walls of fungal pathogens and nonpathogens to induce resistance in plants (Côté and Hahn, 1994; Shibuya and Minami, 2001). Chitins and glucans are the main skeletal polysaccharides of fungal cell walls, and these fragments have been recognized as general elicitors of a plant defense response for many years (West, 1981; Shibuya and Minami, 2001; Walters et al., 2005). Therefore, interest has been growing in using chitin and glucan fragments from fungal cell walls in agriculture to control plant disease (Khan et al., 2003; Tanabe et al., 2006; Wolski et al., 2005; Wolski et al., 2006). In mushrooms, Kobayashi et al. (1987) and Di Piero et al. (2006) have reported the purification of elicitors from the fruit body of shiitake (Lentinula edodes) and its use for disease control. Hence, fragments of glucan and chitin from the mycelial cell walls in SMS may serve as elicitors for inducing SAR in cucumber plants. However, the components that are most effective for disease control in SMS require further investigation. In plants expressing SAR, several defense mechanisms are known to be induced upon inoculation with pathogens. The accumulation of pathogenesis-related (PR) proteins is well known to be implicated in the SAR induced in cucumber plants by certain chemical elicitors (Narusaka et al., 1999; Ishii, 2003). In this study, we investigated the expression of genes involved in the defense response in cucumber plants treated with WESMS. In cucumber plants treated with
Table 5 Comparative effect of treatments by spraying the whole plants and by dipping the first true leaf with water extract from SMS (WESMS) of hatakeshimeji on lesion formation by Colletotrichum orbiculare on cucumber plants. Treatmenta Spraying the whole plant First true leaf Second true leaf Dipping the first true leaf Second true leaf
Lesion areab (mm2)
Disease reductionc (%)
WESMS DW WESMS DW
20.6 5.4 74.6 18.9 24.7 14.3 82.9 11.2
72.4* e 70.2* e
WESMS DW
19.8 8.8 75.9 28.5
73.9* e
a Cucumber plants were treated with WESMS and distilled water (DW) by spraying the whole plants or by dipping the first true leaf for 10 s and incubated for 7 days. b The first and second true leaves of the plant were inoculated with C. orbiculare by dropping (30 ml each) conidial suspensions (1 105 conidia/ml) onto 10 portions of each leaf, and assessed for symptoms after 5e7 days of inoculation. Each value is the average of three replications with standard deviation. c Disease reduction ¼ [(S V)/S] 100, where S is the area of the lesions after DW treatment and V is the area of the lesions after WESMS treatment. Asterisks indicate significant differences compared with the results after DW treatment (t-test, P < 0.05).
WESMS for seven days, the levels of the chitinase and b-1,3-glucanase genes encoding PR proteins were increased 24 h after the inoculation with C. orbiculare. Previous papers have reported that the simultaneous expression of chitinase and glucanase genes after inoculation of pathogens in plants treated with elicitors was detected in tobacco treated against Cercospora nicotianae (Zhu et al., 1994), in tomato treated against Fusarium oxysporum (Jongedijk et al., 1995), and in potato treated against Rhizoctonia solani and Fusarium solani (Wolski et al., 2006). Therefore, the rapid expression of the chitinase and b-1,3-glucanase genes observed in cucumber plants treated with WESMS of hatakeshimeji may contribute to the disease protection. Zhang et al. (1998) found that a composted pine bark mix fortified with biocontrol agents and its water extract induced SAR in cucumber and Arabidopsis, and protected respective host from anthracnose caused by C. orbiculare and bacterial speck caused by Pseudomonas syringae pv. maculicola. They showed that b-1,3-glucanase activity was induced at high level in plants treated with compost mix and compost water extract, indicating that b-1,3-glucanase activity in plants associates closely with SAR expression. However, the induction pattern of b-1,3-glucanase activity differed from compost mix between water extract. b-1,3-Glucanase activity was low in plants treated with compost mix, but the activity was induced to higher level when the pathogen was inoculated. On the contrary, water extract from compost induced b-1,3-glucanase activity in plants not inoculated with the pathogen. The expression pattern of b-1,3-glucanase gene in cucumber treated with WESMS resembles the results of compost mix rather than water extract. However, the induction mechanism of b-1,3-glucanase activity in plants remains unknown. Recently, Inagaki and Yamaguchi (2009) reported that expression of the peroxidase (POD) gene was higher in cucumber plants grown in soil containing SMS and ASMS of shiitake than in control plants. However, they did not determine the level of the enhancement of this gene after pathogen inoculation. In the present study, the expression of the POD gene was not detected in cucumber plants after WESMS treatment and pathogen inoculation. In addition to pathogenesis-related (PR) proteins, many other defense mechanisms have been reported to participate in resistance-induced cucumber plants, such as lignification of the epidermal cells (Hammerschmidt and Ku c, 1982), increase of papilla (callose) formation, accumulation of phenolics and increase of enzyme activity (Ishii, 2003). Future investigations will be needed to determine the biochemical events in SAR induction in cucumber plants treated with WESMS and AWESMS of hatakeshimeji. In this work, we investigated the use of SMS in soil as an agent of disease control. When cucumber seedlings were sown in a mixture of SMS and soil (1:2, v/v), the application of SMS did not result in significant disease reduction. In contrast, application of ASMS remarkably inhibited the lesion formation in cucumber leaves (over 70%), suggesting that disease reduction is due to elicitors released
448
R.Y. Parada et al. / Crop Protection 30 (2011) 443e450
Fig. 2. Suppression of anthracnose on the leaves of cucumber plants treated with water extract from spent mushroom substrate (WESMS). Leaves of cucumber plants were treated by dipping the first true leaf in WESMS (A) and cucumber seedling treated by planting in pots containing a mixture of autoclaved SMS (ASMS) and soil (1:2, v/v) (B). The second true leaf of cucumber plants treated with WESMS or the second true leaf of plants growing in ASMS was inoculated with 30 ml drops of a conidial suspension of Colletotrichum orbiculare after 7 or 15 days of treatment, respectively. In A and B, the right and left photos show typical results for the treatment and control leaves.
from the cell wall by heat treatment of SMS. Inagaki and Yamaguchi (2009) reported that SMS and ASMS of shiitake were effective for controlling anthracnose in cucumber, and that substrate without mycelia also reduced anthracnose, indicating that the substrate Table 6 Effect of SMS and autoclaved SMS (ASMS) of hatakeshimeji mixed with soil on lesion formation by Colletotrichum orbiculare on cucumber plants Treatmenta
Cucumber plant 1st true leaf
SMS ASMS Soil (control)
block material itself induces SAR in cucumber. In our investigation, the protective effect of the substrate without mycelia was not investigated because growth inhibition by substrate was observed in cucumber plants (data not shown). However, the substrate for hatakeshimeji cultivation may not have elicitor activity, because WES and AWES did not protect cucumber plants from anthracnose. In this study, different proportions of SMS and soil were tested (0:1, 1:2, 1:1, 2:1,1:0, v/v), and the high concentrations of SMS (more
2nd true leaf
Lesion areab (mm2)
Disease reductionc (%)
Lesion area (mm2)
Disease reduction (%)
19.5 11.7 5.8 3.6 19.8 4.5
1.5 70.7* e
16.5 6.3 5.1 3.9 20.0 3.7
17.5 74.5* e
Table 7 Effect of water extract from SMS (WESMS) and autoclaved WESMS (AWESMS) of hatakeshimeji on conidial germination, germ-tube elongation and mycelial growth of Colletotrichum orbiculare. Treatment
Conidial germinationa (%)
Germ-tube lengtha (mm)
WESMS AWESMS DW
97.0 3.0 98.0 1.5 74.0 3.0
366.2 99.3 356.2 87.9 143.3 41.7
a
Cucumber seeds were sowed on a cell tray in Tanemaki soil and incubated for 7 days. Seedlings were transplanted into pots containing a mixture of SMS or ASMS and soil (1:2, v/v), and incubated for approximately 15 days. As a control, seedlings were transplanted into soil without SMS or ASMS. b The first and second true leaves of the plant were inoculated with C. orbiculare by dropping (30 ml each) conidial suspensions (1 105 conidia/ml) onto 10 portions of each leaf, and assessed for symptoms after 5e7 days of inoculation. Each value is the average of three replications with standard deviation. c Disease reduction ¼ [(S V)/S] 100, where S is the area of the lesions after DW treatment and V is the area of the lesions after SMS or ASMS treatment. Asterisks indicate significant differences compared with the results of the control (t-test, P < 0.05).
Mycelial growthb (cm) PDY
Czapeck
8.0 9.0 8.1
8.5 7.6 7.8
a Spores of C. orbiculare were suspended in WESMS, AWESMS or distilled water (DW), and sprayed onto slide glasses in a moist chamber. After incubation for 24 h at 25 C in the dark, spore germination and germ-tube length were measured. Each value is the average of three replications with standard deviation. b Mycelial discs of C. orbiculare (5 mm in diameter) were placed on Petri dishes (9 cm in diameter) containing PDY or Czapek solution agar media supplemented with WESMS, AWESMS or DW. The diameter (cm) of the mycelial colonies on the media was measured after three weeks of incubation.
R.Y. Parada et al. / Crop Protection 30 (2011) 443e450
Fig. 3. Real-time PCR analysis of chitinase (A) and b-1,3-glucanase (B) gene expressions in cucumber plants treated with water extract from spent mushroom substrate (WESMS). Whole plants sprayed with WESMS (-) and DW (,) as a control were incubated for 7 days and sprayed with spore suspensions of Colletotrichum orbiculare. RNA was extracted from plants at 7 days after treatment (7 DAT, before inoculation) and 1 day after spore inoculation (1 DAI, after inoculation). Each value is the average of two replications and the bar indicates the standard deviation. Asterisks indicate significant differences compared with the results after DW treatment (t-test, P < 0.05).
than 50%) were not suitable for cucumber plants because some toxic symptoms and growth inhibition were observed (data not shown). Some studies have indicated that the high salt contents found in SMS limit its immediate use as a growth medium for plants (Chong and Rinker, 1994; Gou et al., 2001). Further research will be needed to determine the SMS concentration that achieves the best protective effect without negatively impacting cucumber growth. In conclusion, the present study indicates that SMS of hatakeshimeji induces genes associated with SAR following inoculation of cucumber plants under controlled conditions, and protects cucumber plants against anthracnose. Therefore, the use of SMS for disease control may offer a new technology for the recycling and management of waste from mushroom cultivation. However, the use of SMS for disease control will require further evaluation in greenhouse and especially field systems.
Acknowledgments We thank Dr. Hideo Ishii of the National Institute for AgroEnvironmental Sciences for his helpful suggestions. This research was supported by the Grant-in-Aid for the Global COE Program “Advanced Utilization of Fungus/Mushroom Resources for Sustainable Society in Harmony with Nature” from the Ministry of Education, Culture, Sports, Science and Technology (MEXT) of Japan, and a Grant-in-Aid for Scientific Research (20658012) from the Japan Society for the Promotion of Science.
References Choi, H.W., Chung, I.M., Sin, M.H., Kim, Y.S., Sim, J.B., Kim, J.W., Kim, K.D., Chun, S.C., 2007. The effect of spent mushroom sawdust compost mixes, calcium cyanamide and solarization on basal stem rot of the cactus Hylocereus trigonus caused by Fusarium oxysporum. Crop. Prot. 26, 162e168. Chong, C., Rinker, S.L., 1994. Use of spent mushroom substrate (SMS) for growing containerized woody ornaments: an overview. Compost Sci. Util. 2, 45e54. Conrath, U., 2006. Systemic acquired resistance. Plant Signal. Behav. 1 (4), 179e184. Côté, F., Hahn, M.G., 1994. Oligosaccharins: structure and signal transduction. Plant Mol. Biol. 26, 1379e1411.
449
Cronin, M.J., Yohalem, D.S., Harris, R.F., Andrews, J.H., 1996. Putative mechanism and dynamics of inhibition of the apple scab pathogen Venturia inequalis by compost extracts. Soil Biol. Biochem. 28, 1241e1249. Da Rocha, A.R., Hammerschmidt, R., 2005. History and perspectives on the use of disease resistance inducers on horticultural crops. HortTechnology 15, 518e529. Deepak, S.A., Ishii, H., Park, P., 2006. Acibenzolar-S-methyl primes cell wall strengthening genes and reactive oxygen species forming/scavenging enzymes in cucumber after fungal pathogen attack. Physiol. Mol. Plant Pathol. 69, 52e61. Di Piero, R.M., Wulff, N.A., Pascholati, S.F., 2006. Partial purification of elicitor from Lentinula edodes basidiocarps protenting cucumber seedlings against Colletotrichum lagenarium. Braz. J. Microbiol. 37, 175e180. Durrant, W.E., Dong, X., 2004. Systemic acquired resistance. Annu. Rev. Phytopathol. 42, 185e209. Finney, K.N., Ryu, C., Sharifi, V.D., Swithenbank, J., 2009. The reuse of spent mushroom compost and coal tailings for energy recovery: comparison of thermal treatment technologies. Bioresour. Technol. 100, 310e315. Food and Agriculture Organization of the United Nations, 2008. FAOSTAT [online] Available from: faostat.fao.org (accessed 29.03.10). Gou, M., Chorover, J., Rosario, F., Fox, R.H., 2001. Leachate chemistry of fieldweathered spent mushroom substrate. J. Environ. Qual. 30, 1699e1709. Hammerschmidt, R., Ku c, J., 1982. Lignification as a mechanism for induced systemic resistance in cucumber. Physiol. Plant Pathol. 20, 61e71. Hideno, A., Aoyagi, H., Isobe, S., Tanaka, H., 2007. Utilization of spent sawdust matrix after cultivation of Grifola frondosa as substrate for ethanol production by simultaneous saccharification and fermentation. Food Sci. Technol. Res. 13, 111e117. Inagaki, R., Yamaguchi, A., 2009. Spent substrate of shiitake (Lentinula edodes) inhibits symptoms of anthracnose in cucumber. Mushroom Science and Biotechnology 17, 113e115. Ishii, H., 2003. Potential of novel resistance inducers in crop disease control. Annu. Rev. Plant Pathol. 2, 129e144. Jongedijk, E., Tigelaar, H., Van Roekel, J.S.C., Bres-Vloemans, S.A., Dekker, I., Van den Elzen, P.J.M., Cornelissen, B.J.C., Melchers, L.S., 1995. Synergistic activity of chitinases and 1,3-glucanases enhances fungal resistance in transgenic tomato plants. Euphytica 85, 173e180. Khan, W., Prithiviraj, B., Smith, D., 2003. Chitosan and chitin oligomers increase phenylalanine ammonia-lyase and tyroine ammonia-lyase activities in soybean leaves. J. Plant Physiol. 160, 859e863. Kobayashi, N., Hiramatsu, A., Akatsuka, T., 1987. Purification and chemical properties of an inhibitor of plant virus infection from fruiting bodies of Lentinus edodes. Agric. Biol. Chem. 51, 883e890. Lau, K.L., Tsang, Y.Y., Chiu, S.W., 2003. Use of spent mushroom compost to bioremediate PAH-contaminated samples. Chemosphere 52, 1539e1546. Medina, E., Paredes, C., Pérez-Murcia, M.D., Bustamante, M.A., Moral, R., 2009. Spent mushroom substrates as component of growing media for germination and growth of horticultural plants. Bioresour. Technol. 100, 4227e4232. Narusaka, Y., Narusaka, M., Horio, T., Ishii, H., 1999. Comparison of local and systemic induction of acquired disease resistance in cucumber plants treated with benzothiadiazoles or salicylic acid. Plant Cell Physiol. 40, 388e395. Pokhrel, C.P., Sumikawa, S., Lida, S., Ohga, S., 2006. Growth and productivity of Lyophylum decastes on compost enriched with various supplements. Micol. Apl. Int. 18, 21e28. lu, B., Önal, K., Onus, A.N., Karaca, M., 2009. Effects of Polat, E., Uzun, H.I., Topçuog spent mushroom compost on quality and productivity of cucumber (Cucumis sativus L.) grown in greenhouses. Afr. J. Biotechnol. 8, 176e180. Ribas, L.C.C., Mendoça, M.M., Camelini, C.M., Soares, C.H.L., 2009. Use of spent mushroom subtrates from Agaricus subrufescens (syn. A. blazei, A. brasiliensis) and Lentinula edodes productions in the enrichment of a soil-based potting media for lettuce (Lactuca sativa) cultivation: growth promotion and soil bioremediation. Bioresour. Technol. 100, 4750e4757. Sánchez, C., 2004. Modern aspects of mushroom culture technology. Appl. Microbiol. Biotechnol. 64, 756e762. Semple, K.T., Reid, B.J., Fermor, T.R., 2001. Impact of composting strategies of the treatment of soil contaminated with organic pollutants: a review. Environ. Pollut. 112, 269e283. Shibuya, N., Minami, E., 2001. Oligosaccharide signaling for defense responses in plant. Physiol. Mol. Plant Pathol. 59, 223e233. Tanabe, S., Okada, M., Jikumaru, Y., Yamane, H., Kaku, H., Shibuya, N., Minami, E., 2006. Induction of resistance against rice blast fungus in rice plants treated with a potent elicitor, N-acetylchitooligosaccharide. Biosci. Biotechnol. Biochem. 70, 1599e1605. Ukawa, Y., Ito, H., Hisamatsu, M., 2000. Antitumor effects of (1 / 3)-b-D-glucan and (1 / 6)-b-D-glucan purified from newly cultivated mushroom, hatakeshimeji (Lyophyllum decastes Sing.). J. Biosci. Bioeng. 90, 98e104. Ukawa, Y., Izumi, Y., Ohbuchi, T., Takahashi, T., Ikemizu, S., Kojima, Y., 2007. Oral administration of the extract from hatakeshimeji (Lyophyllum decastes Sing.) mushroom inhibits the development of atopic dermatitis-like skin lesion in NC/Nga mice. J. Nutr. Sci. Vitaminol. 53, 293e296. Uzun, I., 2004. Use of spent mushroom compost in sustainable fruit production. J. Fruit Ornam. Plant Res. 12, 157e165. Vallad, G.E., Goodman, R.M., 2004. Systemic acquired resistance and induced systemic resistance in conventional agriculture. Crop Sci. 44, 1920e1934. Viji, G., Uddin, W., Romaine, C.P., 2003. Suppression of gray leaf spot (blast) of perennial ryegrass turf by Pseudomonas aeruginosa from spent mushroom substrate. Biol. Control 26, 233e243.
450
R.Y. Parada et al. / Crop Protection 30 (2011) 443e450
Walters, D., Walsh, D., Newton, A., Lyon, G., 2005. Induced resistance for plant disease control: maximizing the efficacy of resistance elicitors. Phytopathology 95, 1368e1373. West, C., 1981. Fungal elicitors of the phytoalexin response in higher plants. Naturwissenschaften 68, 447e457. Williams, B.C., McMullan, J.T., McCahey, S., 2001. An initial assessment of spent mushroom compost as a potential energy feedstock. Bioresour. Technol. 79, 227e230. Wolski, E., Lima, C., Agusti, R., Daleo, G.R., Andreu, A.B., De Lederkremer, R.M., 2005. An a-glucan elicitor from the cell wall of a biocontrol binucleate Rhizoctonia isolate. Carbohyd. Res. 340, 619e627.
Wolski, E.A., Maldonado, S., Daleo, G.R., Andreu, A.B., 2006. A novel a-1,3-glucan elicits plant defence response in potato and induces protection against Rhizoctonia solani AG-3 and Fusarium solani f.sp. eumartii. Physiol. Mol. Plant Pathol. 69, 93e103. Yohalem, D.S., Harris, R.F., Andrews, J.H., 1994. Aqueous extracts of spent mushroom substrate for foliar disease control. Compost Sci. Util. 2, 67e74. Zhang, W., Han, D.Y., Dick, W.A., Davis, K.R., Hoitink, H.A.J., 1998. Compost and compost water extract-induced systemic acquired resistance in cucumber and Arabidopsis. Phytopathology 88, 450e455. Zhu, Q., Maher, E.A., Masoud, S., Dixon, R.A., Lamb, C.J., 1994. Enhanced protection against fungal attack by constitutive co-expression of chitinase and glucanase genes in transgenic tobacco. Nat. Biotechnol. 12, 807e812.
Contents lists available at ScienceDirect
Crop Protection journal homepage: www.elsevier.com/locate/cropro
Autoclaved spent substrate of hatakeshimeji mushroom (Lyophyllum decastes Sing.) and its water extract protect cucumber from anthracnose R.Y. Parada a, S. Murakami b, N. Shimomura a, M. Egusa a, H. Otani a, * a b
Faculty of Agriculture, Tottori University, 4-101 Koyama-Minami, Tottori 680-8553, Japan The Tottori Mycological Institute, 211 Kokoge, Tottori 689-1125, Japan
a r t i c l e i n f o
a b s t r a c t
Article history: Received 13 July 2010 Received in revised form 19 November 2010 Accepted 24 November 2010
The protective effect of fresh spent mushroom substrate (SMS) of hatakeshimeji (Lyophyllum decastes Sing.), a popular culinary-medicinal mushroom, and its water extract against anthracnose of cucumber was investigated. Plants were treated with water extract from SMS or autoclaved water extract by spraying the whole plant or by dipping the first true leaf, and inoculated with Colletotrichum orbiculare seven days later. Plants treated with either of the extracts showed a significant reduction of necrotic lesions. On the other hand, when plants were grown in a mixture (1:2, v/v) of SMS or autoclaved SMS and soil, a disease reduction of over 70% was observed in autoclaved SMS. The water extract showed no antifungal activity against spore germination and mycelial growth of the pathogen. Real-time PCR analyses of chitinase and b-1,3-glucanase genes revealed a significant increase of expressions after 24 h of pathogen inoculation in water extract-treated plants compared with the control plants. These results suggest that water-soluble and heat-stable compounds in SMS enhance the state of systemic acquired resistance and protect cucumbers from anthracnose. Thus, the use of SMS for disease control may offer a new technology for the recycling and management of waste from mushroom cultivation. Ó 2010 Elsevier Ltd. All rights reserved.
Keywords: Anthracnose Cucumber Hatakeshimeji (Lyophyllum decastes) Spent mushroom substrate Systemic acquired resistance
1. Introduction According to the Food and Agriculture Organization of the United Nations (2008), the global production of cultivated edible mushrooms had increased from 2.26 million tons in 1998 to 3.48 million tons in 2008. About 53% of cultivated edible mushrooms are produced in Asian countries, followed by European countries (32%) and the Americas (13%). In Japan, mushrooms are eaten and appreciated for their flavor, and used medicinally for their healing properties. In 2007, the production of edible mushrooms in Japan was estimated to be 423,224 t, and it is expected that this amount will increase in the future due to market demand. Despite the evident benefits of mushrooms, the exponential increase in their consumption worldwide is also generating a high volume of spent mushroom substrate (SMS). It has been reported that about 5 kg of substrate are needed to produce 1 kg of mushroom (Williams et al., 2001; Uzun, 2004; Finney et al., 2009), and about 17 million tons of SMS are produced each year. Consequently, one of the main problems faced by mushroom production companies is finding a way to properly dispose of the SMS without contaminating the * Corresponding author. Tel./fax: þ81 857 315355. E-mail address: [email protected] (H. Otani). 0261-2194/$ e see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.cropro.2010.11.021
water and soil. In fact, the lack of a sustainable waste management solution for SMS is the most significant barrier to the future development of the mushroom industry (Finney et al., 2009). Several studies have been carried out to demonstrate the benefits of SMS application in mushroom re-cultivation, enrichment of soils, restoring areas that have been destroyed through development, deforestation or environmental contamination (Sánchez, 2004), cultivation of vegetables, fruits and flowers in greenhouses and fields (Medina et al., 2009; Polat et al., 2009; Ribas et al., 2009), and soil amendment and degradation of organopollutants (Semple et al., 2001; Lau et al., 2003). The SMS can also be used as a potential energy feedstock (Williams et al., 2001; Finney et al., 2009), and ethanol production (Hideno et al., 2007). In plant-fungal interactions, carbohydrate and protein elicitors that induce defense mechanism in plants are released from the mycelia of fungal pathogens (Shibuya and Minami, 2001). Once the plants recognize elicitors, many plants develop an enhanced resistance to further pathogen attack also in the uninoculated organs. This type of induced resistance is called systemic acquired resistance (SAR) (Durrant and Dong, 2004; Vallad and Goodman, 2004; Da Rocha and Hammerschmidt, 2005; Walters et al., 2005; Conrath, 2006). Therefore, the mycelia of mushrooms that are prevalent in SMS are abundant sources of elicitors, and thus
444
R.Y. Parada et al. / Crop Protection 30 (2011) 443e450
application of SMS to plants may be useful for the control of plant diseases. However, the study of the potential role of SMS in disease control has not received adequate attention. In the few studies that have addressed this topic, the emphasis has been on exploiting the antibiotic-producing microorganisms in SMS by applying SMS as compost (Yohalem et al., 1994; Cronin et al., 1996; Viji et al., 2003; Choi et al., 2007). Hatakeshimeji (Lyophyllum decastes Sing.), a gray basidiomycete family Tricholomataceae, belongs to the same genus as honshimeji (Lyophyllum shimeji Hongo), which is well known as the most delicious mushroom (Ukawa et al., 2000; Pokhrel et al., 2006). In addition to its delicious taste and excellent texture, hatakeshimeji has been well studied for its medical properties. Recently, powder from this mushroom has been made commercially available and has been used as a health-promoting supplement for prevention and treatment of various diseases (Ukawa et al., 2007). The main objective of this work was to determine whether extracts from hatakeshimeji SMS can protect cucumber (Cucumis sativus L.) from anthracnose caused by Colletotrichum orbiculare (Berkeley & Montagne) Arx. In addition, SAR-related gene expression in water extract-treated cucumber was examined for analyzing the mechanism of disease resistance. 2. Materials and methods 2.1. Preparation of SMS The hatakeshimeji strain TMIC30940 was inoculated in polypropylene bags containing 2.5 kg mixtures of Japanese cedar, sorghum, soybean pulp, rice bran and wheat bran (8:0.5:1:0.9:0.3, v/v). The bags were incubated at 20e22 C for 65 days, and then incubated at 17e19 C for 30 days for fruit body formation. After the fruit bodies were harvested, SMS was used immediately for water extract preparation. 2.2. Water extract from SMS Spent mushroom substrate (200 g) was homogenized in a Waring blender (Nissei, Tokyo, Japan) with 500 ml of distilled water (DW) for 2 min at 1500 rpm. The homogenate was filtered through two layers of Miracloth (Calbiochem, La Jolla, CA) and then centrifuged for 5 min at 800 g. The supernatant was used immediately for leaf treatment or stored at 80 C until use as the water extract from SMS (hereinafter WESMS). WESMS was autoclaved at 121 C for 30 min (hereinafter AWESMS), and AWESMS was also used for leaf treatment. 2.3. Treatments with WESMS and SMS on cucumber 2.3.1. WESMS The cucumber (C. sativus) cultivar Natsusuzumi was grown in plastic pots (9 cm) containing soil mixed with Tanemaki soil (JA, Tokyo, Japan) and Nippi No. 1 soil (JA, Tokyo, Japan) in a climatecontrolled room at 25 C with a 14-h light and 10-h dark period. Cucumber plants (16e20 days old) with the first true leaf (next to cotyledon) and second true leaf fully expanded and the third true leaf one-third-one half of its full size were used for foliar application of WESMS. The first true leaf was dipped for 10 s in WESMS or the whole plants were sprayed with WESMS. The first true leaf or the whole plants of cucumber were also treated with AWESMS. DW was used as a control. 2.3.2. SMS Cucumber seeds were germinated in a cell tray containing Tanemaki soil. To examine the effects of SMS in soil on cucumber plants, the seedlings were transplanted after seven days to plastic pots (9 cm)
containing a mixture of SMS and Nippi No. 1 soil (1:2, v/v). The same experiment was conducted using SMS autoclaved at 121 C for 30 min (hereinafter ASMS). Seedlings were also grown in pots containing only Nippi No. 1 soil as a control. 2.4. Conidium inoculation and disease assessment The strain C-14 of C. orbiculare, which causes anthracnose of cucumber, was obtained from the ZEN-NOH Agricultural R & D Center (Hiratsuka, Japan). The culture was maintained on a potato dextrose agar (PDA) (Difco) plate (9 cm) at 25 C and sub-cultured on a PDY (PDA amended with 0.5% yeast) plate to obtain abundant conidia for the inoculation test. The conidial suspensions were prepared from 7e12 day-old cultures. For inoculation, conidia of C-14 were collected from the plate with DW, filtered through Kimwipes tissue S-200 (Nippon Paper Crecia, Tokyo, Japan) and washed three times by centrifugation (5 min at 800 g). The concentration was adjusted to 5 105 or 1 105 conidia/ml. The conidial suspensions (5 105 conidia/ml) were sprayed onto whole plants after seven days of treatment with WESMS or AWESMS. In the plants treated with SMS or ASMS, spore suspensions (1 105 conidia/ml) were applied as 5e10 drops (30 ml each) on the first and second true leaves after approximately 15 days of treatment. Inoculated plants were kept in the dark at 90% RH in a growth cabinet (MLR-351H) (Sanyo, Tokyo, Japan) for 24 h at 20 C, and then transferred to an incubator room at 25 C. The number of lesions on each examined leaf in the spray inoculation experiment and the lesion area on each leaf in the drop inoculation experiment were recorded 5e7 days later. 2.5. Antifungal activity of WESMS Conidia of C-14 were washed three times with DW by centrifugation. The spore pellets after centrifugation were mixed with WESMS and AWESMS passed through a 0.22-mm-pore filter unit (Millipore, Bedford, MA) and the concentration was adjusted to 5 105 conidia/ml. DW was used as a control. Conidial suspensions (3 ml) were sprayed on glass slides and incubated in a moist chamber at 25 C in the dark for 24 h. Conidial germination and germ-tube length were measured microscopically. For mycelial growth tests, mycelia discs (5 mm in diameter) were transferred onto potato dextrose yeast (PDY) or Czapek solution agar (Difco) (10 ml) plate (9 cm), supplemented with WESMS or AWESMS (1 ml/plate) sterilized by filtration. Sterile DW was added to each medium as a control. The plates were incubated at 25 C in the dark and radial colony growth of the fungus was recorded after three weeks. 2.6. Gene expression in the cucumber We selected six genes which have been reported to be involved in the defense response against biotic or abiotic stress in plants: callose synthase, lignin peroxidase, chitinase, b-1,3-glucanase, pathogenesis-related protein-1 and phenylalanine ammonia-lyase (Table 1). For RNA extraction, samples were harvested at 7 days after treatment and 1 day after the pathogen inoculation from the leaves of whole plants treated by spraying with WESMS. Cucumber leaves treated by spraying the whole plants with DW was used as a control. Samples were snap frozen in liquid nitrogen, and stored at 80 C until required. Total RNA was isolated using TRIzol-Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions, and treated with DNase (DNA-free; Ambion, Austin, TX). One microgram of RNA was reverse-transcribed with an RT reagent kit (Takara Bio, Tokyo, Japan) using a random 6-mer primer, according to the manufacturer’s instructions. Real-time PCR was performed on
R.Y. Parada et al. / Crop Protection 30 (2011) 443e450
445
Table 1 List of primers used in this study. Template
Reference or accession
Name
Sequence (50 -30 )
Amplicon (bp)
Callose synthase
Deepak et al., 2006 DQ641104
b-1,3-Glucanase
AB009974
Lignin peroxidase
Deepak et al., 2006
Pathogenesis-related protein-1
AF475286
Phenylalanine ammonia-lyase
AF529240
b-Actin
Deepak et al., 2006
TGTTACCTTGGCCAGAGACTTC CCTATCGAACACGTCTGGATGTC AGACGCCGCGATCAAAACTG ACATGCATGGCGGGTTGTTG TTGACAATGCAAGGACTTAC AAGTTTCAATAGCCCTTCCT CCAAGACGGCAGTTGAGAAGA TTGCAGCAACTGCAAGAATATCA GACTCACCTCAAGACTTCGT GTTTTGTCCCACTCAATCGG GTGCTGAGATTGCCATGGCT TGTTGCTCGGCACTTTGGAC TGTGAGTCACACTGTTCCCATCT AGCAAGGTCCAAACGGAGAA
79
Chitinase
Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
a LightCycler 330 system (Roche Diagnostics, Tokyo, Japan) using SYBR Green (Roche, Basel, Switzerland). A 5-ml cDNA sample was added to a total 20-ml reaction mixture containing 4 ml of SYBR Green Mastermix and 0.5 mM gene specific primers pair (Table 1) into the LightCycler glass capillaries. The following LightCycler experimental run protocol was used: an initial step of 95 C for 10 min followed by 40 cycles of 95 C for 10 s, primer-dependent temperature 60 C (except for chitinase that was performed at 65 C) for 10 s, and 72 C for 5 s, with a single fluorescence measurement. Subsequently, a melting program was applied with continuous fluorescence measurement at 95 C, and slowly heated from 65 to 95 C at 0.1 C s1. The b-actin gene was used as a reference (Deepak et al., 2006). Cucumber plants without any treatment were used as a control (no treatment control ¼ NTC), and the fold increase of the expression levels of each gene was calculated after normalization by the following formula:
Fold gene expression ¼
71 87 69 80 88 70
and 98% in disease respectively compared with the control plants (Table 2), indicating that maximal disease reduction by WEFB on treated plants requires 7 days before being challenged with the pathogen. Therefore, the disease-protective effect of WESMS and AWESMS was observed seven days after treatment. The first true leaf of cucumber was dipped in WESMS or AWESMS for 10 s. After seven days, the whole plants were inoculated with the pathogen by spraying conidial suspensions. The results showed that WESMS and AWESMS, as well as WEFB, significantly protected the second, third and fourth true leaves of cucumber plants from anthracnose (Table 3 and Fig. 1). To investigate whether the protective effect of WESMS and AWESMS is derived from the mycelia of hatakeshimeji in SMS, plants were treated with water extract from a substrate before inoculation of hatakeshimeji (hereinafter WES) and with autoclaved water extract from a substrate (hereinafter AWES). Seven days later, the whole plants were inoculated with conidial suspensions (5 105 conidia/ml)
Quantity of target gene=Quantity of reference gene Quantity of target gene in NTC=Quantity of reference gene
2.7. Statistical analysis All experiments to assess disease symptoms and gene expression were conducted at least three times and the data were combined into average values and presented in the same table or figure. Significant differences from the control values were determined using a t-test. 3. Results 3.1. Protective effect of WESMS and AWESMS against anthracnose of cucumber Prior to the investigation of disease protection by WESMS and AWESMS, a preliminary experiment was conducted using water extract from fruit bodies (Basidiocarps) (hereinafter WEFB) (50 g fruit body/250 ml DW). The first true leaf of cucumber plants grown in pots was dipped in WEFB for 10 s. The whole plants were inoculated with conidial suspensions (5 105 conidia/ml) of C. orbiculare after 5 h, 4 days or 7 days of treatment. Lesion formation on the inoculated leaves of the whole plants was examined five days after inoculation. Disease reduction was only 26% in the plants incubated for 5 h before spore inoculation. The plants incubated for 4 days and 7 days after WEFB treatment showed significant reductions of 86.1%
of C. orbiculare. The results (Table 4) showed that there was no significant difference in the symptoms on cucumber leaves between WES or AWES treatment and DW treatment, suggesting that the mycelial components of SMS are primarily responsible for the disease protection. Table 2 Effect of water extract from fruit body (WEFB) of hatakeshimeji on lesion formation by Colletotrichum orbiculare on cucumber plants. Treatmenta
Time after treatmentb
Lesionc (spots/leaf)
Disease reductiond (%)
WEFB DW WEFB DW WEFB DW
5h 5h 4 days 4 days 7 days 7 days
35.0 16.0 47.3 18.1 4.3 7.5 31.0 7.0 1.3 2.3 63.6 19.5
26.0 e 86.1* e 98.0* e
a
The first true leaf of cucumber plants was treated by dipping for 10 s. The treated plants were incubated for the indicated time. The plants were inoculated by spraying with conidial suspensions (5 105 conidia/ml) of C. orbiculare, and assessed for symptoms on second, third and fourth true leaves after 5e7 days of inoculation. Each value is the average of three replications with standard deviation. d Disease reduction ¼ [(S V)/S] 100, where S is the number of lesions after distilled water (DW) treatment and V is the number of lesions after WEFB treatment. Asterisks indicate significant differences compared to the results by DW treatment (t-test, P < 0.05). b c
446
R.Y. Parada et al. / Crop Protection 30 (2011) 443e450
Table 3 Effect of water extract from fruit body (WEFB), water extract from SMS (WESMS) and autoclaved WESMS (AWESMS) of hatakeshimeji on lesion formation by Colletotrichum orbiculare on cucumber plants. Treatmenta
Cucumber plant 2nd true leaf b
WEFB WESMS AWESMS DW
3rd true leaf c
4th true leaf
Lesion (spots/leaf)
Disease reduction (%)
Lesion (spots/leaf)
Disease reduction (%)
Lesion (spots/leaf)
Disease reduction (%)
2.0 1.7 7.5 2.1 1.6 2.0 76.6 44.4
97.4* 90.2* 97.9* e
4.6 4.0 5.5 3.5 0.0 0.0 128.6 23.7
96.4* 95.7* 100.0* e
2.3 2.0 16.0 5.6 0.6 1.1 131.0 10.1
98.2* 87.8* 99.5* e
a
The first true leaf of cucumber plants was treated by dipping for 10 s and incubated for 7 days. The plants were inoculated with C. orbiculare by spraying with conidial suspensions (5 105 conidia/ml), and assessed for symptoms on each leaf except for the first true leaf after 5e7 days of inoculation. Each value is the average of three replications with standard deviation. c Disease reduction ¼ [(S V)/S] 100, where S is the number of lesions after distilled water (DW) treatment and V is the number of lesions after WEFB, WESMS or AWESMS treatment. Asterisks indicate significant differences compared to the results by DW treatment (t-test, P < 0.05). b
The disease reduction effect of WESMS was compared with that of the spraying of whole plants and dipping the first true leaf. In this experiment, cucumber plants were inoculated by placing a 30-ml drop of conidial suspensions (1 105 conidia/ml) of C. orbiculare on 10 sites of the first and second true leaves in spraying treatment and on the second true leaf in dipping treatment, and the area of necrotic lesions formed on the drop sites were observed after seven days. The results showed that the cucumber plants treated with WESMS were protected from anthracnose by either the spraying or the dipping treatment (Table 5 and Fig. 2A). 3.2. Protective effect of SMS and ASMS mixed in soil on anthracnose of cucumber To observe the disease-protective effect of SMS and ASMS mixed in soil, cucumber seedlings were planted in pots containing mixtures of SMS or ASMS and soil (1:2, v/v), and tested for disease protection. In cucumber seedlings grown in soil mixed with SMS, disease protection was not detected; the values on the first and second true leaves were 1.5% and 17.5%, respectively. In contrast, in plants grown in soil mixed with ASMS, significant disease reductions of 70.7% and 74.5% were observed in the first and second true leaves, respectively (Table 6 and Fig. 2B). 3.3. Antifungal activity of WESMS and AWESMS The inhibitory activity of WESMS and AWESMS on conidial germination and germ-tube elongation of C. orbiculare was tested.
The results (Table 7) showed that both conidial germination and germ-tube elongation were more vigorous in the presence of WESMS and AWESMS. Mycelial growth of C. orbiculare on PDY agar and Czapek solution agar plates containing WESMS and AWESMS also was not suppressed (Table 7). 3.4. Gene expression in cucumber plants treated with WESMS Analysis of gene expression using real-time PCR showed that when WESMS-treated plants were inoculated with spores of C. orbiculare by spraying the whole plants, the expression of the chitinase and b-1,3-glucanase genes was significantly enhanced in compared with control plants at 24 h (Fig. 3). The gene expression of pathogenesis-related protein-1 and phenylalanine ammonialyase in WESMS-treated plants had no significant difference in the expression in comparison with the DW control with or without spore inoculation, and expression of the callose synthase and lignin peroxidase genes was not detected. 4. Discussion In this study, cucumber plants were protected systemically from anthracnose by spraying the whole plants with or by dipping the first true leaf in WESMS or AWESMS. WESMS and AWESMS did not exert any direct action on C. orbiculare because no antifungal activities were observed. WES and AWES from substrate before mushroom inoculation did not protect plants from anthracnose. These results indicate that WESMS and AWESMS contain water-
Fig. 1. Suppression of anthracnose on the leaves of cucumber plants treated with autoclaved water extract from spent mushroom substrate (AWESMS). Leaves of cucumber plants were treated by dipping the first true leaf in distilled water (DW) (control) (A) and AWESMS (B). Cucumber plants treated with DW and AWESMS were inoculated by spraying with conidial suspensions of Colletotrichum orbiculare (5 105 conidia/ml) 7 days after treatment.
R.Y. Parada et al. / Crop Protection 30 (2011) 443e450
447
Table 4 Effect of water extract from substrate without inoculation of hatakeshimeji (WES) and autoclaved WES (AWES) on lesion formation by Colletotrichum orbiculare on cucumber plants. Treatmenta
Cucumber plant 2nd true leaf
3rd true leaf
b
WES AWES DW
c
4th true leaf
Lesion (spots/leaf)
Disease reduction (%)
Lesion (spots/leaf)
Disease reduction (%)
Lesion (spots/leaf)
Disease reduction (%)
79.0 9.6 77.3 15.8 99.0 27.0
20.2 21.9 e
75.7 17.9 79.0 34.4 75.0 7.8
0.9 5.3 e
111.0 10.5 100.0 18.5 112.3 34.5
1.2 11.0 e
a
The first true leaf of cucumber plants was treated by dipping for 10 s and incubated for 7 days. The plants were inoculated with C. orbiculare by spraying with conidial suspensions (5 105 conidia/ml), and assessed for symptoms on each leaf except for the first true leaf after 5e7 days of inoculation. Each value is the average of three replications with standard deviation. c Disease reduction ¼ [(S V)/S] 100, where S is the number of lesions after distilled water (DW) treatment and V is the number of lesions after WES or AWES treatment. No significant difference was detected between WES or AWES treatment and DW treatment (t-test). b
soluble and heat-stable elicitors for inducing systemic acquired resistance (SAR) in cucumber plants. Several studies have reported the use of the elicitors from the cell walls of fungal pathogens and nonpathogens to induce resistance in plants (Côté and Hahn, 1994; Shibuya and Minami, 2001). Chitins and glucans are the main skeletal polysaccharides of fungal cell walls, and these fragments have been recognized as general elicitors of a plant defense response for many years (West, 1981; Shibuya and Minami, 2001; Walters et al., 2005). Therefore, interest has been growing in using chitin and glucan fragments from fungal cell walls in agriculture to control plant disease (Khan et al., 2003; Tanabe et al., 2006; Wolski et al., 2005; Wolski et al., 2006). In mushrooms, Kobayashi et al. (1987) and Di Piero et al. (2006) have reported the purification of elicitors from the fruit body of shiitake (Lentinula edodes) and its use for disease control. Hence, fragments of glucan and chitin from the mycelial cell walls in SMS may serve as elicitors for inducing SAR in cucumber plants. However, the components that are most effective for disease control in SMS require further investigation. In plants expressing SAR, several defense mechanisms are known to be induced upon inoculation with pathogens. The accumulation of pathogenesis-related (PR) proteins is well known to be implicated in the SAR induced in cucumber plants by certain chemical elicitors (Narusaka et al., 1999; Ishii, 2003). In this study, we investigated the expression of genes involved in the defense response in cucumber plants treated with WESMS. In cucumber plants treated with
Table 5 Comparative effect of treatments by spraying the whole plants and by dipping the first true leaf with water extract from SMS (WESMS) of hatakeshimeji on lesion formation by Colletotrichum orbiculare on cucumber plants. Treatmenta Spraying the whole plant First true leaf Second true leaf Dipping the first true leaf Second true leaf
Lesion areab (mm2)
Disease reductionc (%)
WESMS DW WESMS DW
20.6 5.4 74.6 18.9 24.7 14.3 82.9 11.2
72.4* e 70.2* e
WESMS DW
19.8 8.8 75.9 28.5
73.9* e
a Cucumber plants were treated with WESMS and distilled water (DW) by spraying the whole plants or by dipping the first true leaf for 10 s and incubated for 7 days. b The first and second true leaves of the plant were inoculated with C. orbiculare by dropping (30 ml each) conidial suspensions (1 105 conidia/ml) onto 10 portions of each leaf, and assessed for symptoms after 5e7 days of inoculation. Each value is the average of three replications with standard deviation. c Disease reduction ¼ [(S V)/S] 100, where S is the area of the lesions after DW treatment and V is the area of the lesions after WESMS treatment. Asterisks indicate significant differences compared with the results after DW treatment (t-test, P < 0.05).
WESMS for seven days, the levels of the chitinase and b-1,3-glucanase genes encoding PR proteins were increased 24 h after the inoculation with C. orbiculare. Previous papers have reported that the simultaneous expression of chitinase and glucanase genes after inoculation of pathogens in plants treated with elicitors was detected in tobacco treated against Cercospora nicotianae (Zhu et al., 1994), in tomato treated against Fusarium oxysporum (Jongedijk et al., 1995), and in potato treated against Rhizoctonia solani and Fusarium solani (Wolski et al., 2006). Therefore, the rapid expression of the chitinase and b-1,3-glucanase genes observed in cucumber plants treated with WESMS of hatakeshimeji may contribute to the disease protection. Zhang et al. (1998) found that a composted pine bark mix fortified with biocontrol agents and its water extract induced SAR in cucumber and Arabidopsis, and protected respective host from anthracnose caused by C. orbiculare and bacterial speck caused by Pseudomonas syringae pv. maculicola. They showed that b-1,3-glucanase activity was induced at high level in plants treated with compost mix and compost water extract, indicating that b-1,3-glucanase activity in plants associates closely with SAR expression. However, the induction pattern of b-1,3-glucanase activity differed from compost mix between water extract. b-1,3-Glucanase activity was low in plants treated with compost mix, but the activity was induced to higher level when the pathogen was inoculated. On the contrary, water extract from compost induced b-1,3-glucanase activity in plants not inoculated with the pathogen. The expression pattern of b-1,3-glucanase gene in cucumber treated with WESMS resembles the results of compost mix rather than water extract. However, the induction mechanism of b-1,3-glucanase activity in plants remains unknown. Recently, Inagaki and Yamaguchi (2009) reported that expression of the peroxidase (POD) gene was higher in cucumber plants grown in soil containing SMS and ASMS of shiitake than in control plants. However, they did not determine the level of the enhancement of this gene after pathogen inoculation. In the present study, the expression of the POD gene was not detected in cucumber plants after WESMS treatment and pathogen inoculation. In addition to pathogenesis-related (PR) proteins, many other defense mechanisms have been reported to participate in resistance-induced cucumber plants, such as lignification of the epidermal cells (Hammerschmidt and Ku c, 1982), increase of papilla (callose) formation, accumulation of phenolics and increase of enzyme activity (Ishii, 2003). Future investigations will be needed to determine the biochemical events in SAR induction in cucumber plants treated with WESMS and AWESMS of hatakeshimeji. In this work, we investigated the use of SMS in soil as an agent of disease control. When cucumber seedlings were sown in a mixture of SMS and soil (1:2, v/v), the application of SMS did not result in significant disease reduction. In contrast, application of ASMS remarkably inhibited the lesion formation in cucumber leaves (over 70%), suggesting that disease reduction is due to elicitors released
448
R.Y. Parada et al. / Crop Protection 30 (2011) 443e450
Fig. 2. Suppression of anthracnose on the leaves of cucumber plants treated with water extract from spent mushroom substrate (WESMS). Leaves of cucumber plants were treated by dipping the first true leaf in WESMS (A) and cucumber seedling treated by planting in pots containing a mixture of autoclaved SMS (ASMS) and soil (1:2, v/v) (B). The second true leaf of cucumber plants treated with WESMS or the second true leaf of plants growing in ASMS was inoculated with 30 ml drops of a conidial suspension of Colletotrichum orbiculare after 7 or 15 days of treatment, respectively. In A and B, the right and left photos show typical results for the treatment and control leaves.
from the cell wall by heat treatment of SMS. Inagaki and Yamaguchi (2009) reported that SMS and ASMS of shiitake were effective for controlling anthracnose in cucumber, and that substrate without mycelia also reduced anthracnose, indicating that the substrate Table 6 Effect of SMS and autoclaved SMS (ASMS) of hatakeshimeji mixed with soil on lesion formation by Colletotrichum orbiculare on cucumber plants Treatmenta
Cucumber plant 1st true leaf
SMS ASMS Soil (control)
block material itself induces SAR in cucumber. In our investigation, the protective effect of the substrate without mycelia was not investigated because growth inhibition by substrate was observed in cucumber plants (data not shown). However, the substrate for hatakeshimeji cultivation may not have elicitor activity, because WES and AWES did not protect cucumber plants from anthracnose. In this study, different proportions of SMS and soil were tested (0:1, 1:2, 1:1, 2:1,1:0, v/v), and the high concentrations of SMS (more
2nd true leaf
Lesion areab (mm2)
Disease reductionc (%)
Lesion area (mm2)
Disease reduction (%)
19.5 11.7 5.8 3.6 19.8 4.5
1.5 70.7* e
16.5 6.3 5.1 3.9 20.0 3.7
17.5 74.5* e
Table 7 Effect of water extract from SMS (WESMS) and autoclaved WESMS (AWESMS) of hatakeshimeji on conidial germination, germ-tube elongation and mycelial growth of Colletotrichum orbiculare. Treatment
Conidial germinationa (%)
Germ-tube lengtha (mm)
WESMS AWESMS DW
97.0 3.0 98.0 1.5 74.0 3.0
366.2 99.3 356.2 87.9 143.3 41.7
a
Cucumber seeds were sowed on a cell tray in Tanemaki soil and incubated for 7 days. Seedlings were transplanted into pots containing a mixture of SMS or ASMS and soil (1:2, v/v), and incubated for approximately 15 days. As a control, seedlings were transplanted into soil without SMS or ASMS. b The first and second true leaves of the plant were inoculated with C. orbiculare by dropping (30 ml each) conidial suspensions (1 105 conidia/ml) onto 10 portions of each leaf, and assessed for symptoms after 5e7 days of inoculation. Each value is the average of three replications with standard deviation. c Disease reduction ¼ [(S V)/S] 100, where S is the area of the lesions after DW treatment and V is the area of the lesions after SMS or ASMS treatment. Asterisks indicate significant differences compared with the results of the control (t-test, P < 0.05).
Mycelial growthb (cm) PDY
Czapeck
8.0 9.0 8.1
8.5 7.6 7.8
a Spores of C. orbiculare were suspended in WESMS, AWESMS or distilled water (DW), and sprayed onto slide glasses in a moist chamber. After incubation for 24 h at 25 C in the dark, spore germination and germ-tube length were measured. Each value is the average of three replications with standard deviation. b Mycelial discs of C. orbiculare (5 mm in diameter) were placed on Petri dishes (9 cm in diameter) containing PDY or Czapek solution agar media supplemented with WESMS, AWESMS or DW. The diameter (cm) of the mycelial colonies on the media was measured after three weeks of incubation.
R.Y. Parada et al. / Crop Protection 30 (2011) 443e450
Fig. 3. Real-time PCR analysis of chitinase (A) and b-1,3-glucanase (B) gene expressions in cucumber plants treated with water extract from spent mushroom substrate (WESMS). Whole plants sprayed with WESMS (-) and DW (,) as a control were incubated for 7 days and sprayed with spore suspensions of Colletotrichum orbiculare. RNA was extracted from plants at 7 days after treatment (7 DAT, before inoculation) and 1 day after spore inoculation (1 DAI, after inoculation). Each value is the average of two replications and the bar indicates the standard deviation. Asterisks indicate significant differences compared with the results after DW treatment (t-test, P < 0.05).
than 50%) were not suitable for cucumber plants because some toxic symptoms and growth inhibition were observed (data not shown). Some studies have indicated that the high salt contents found in SMS limit its immediate use as a growth medium for plants (Chong and Rinker, 1994; Gou et al., 2001). Further research will be needed to determine the SMS concentration that achieves the best protective effect without negatively impacting cucumber growth. In conclusion, the present study indicates that SMS of hatakeshimeji induces genes associated with SAR following inoculation of cucumber plants under controlled conditions, and protects cucumber plants against anthracnose. Therefore, the use of SMS for disease control may offer a new technology for the recycling and management of waste from mushroom cultivation. However, the use of SMS for disease control will require further evaluation in greenhouse and especially field systems.
Acknowledgments We thank Dr. Hideo Ishii of the National Institute for AgroEnvironmental Sciences for his helpful suggestions. This research was supported by the Grant-in-Aid for the Global COE Program “Advanced Utilization of Fungus/Mushroom Resources for Sustainable Society in Harmony with Nature” from the Ministry of Education, Culture, Sports, Science and Technology (MEXT) of Japan, and a Grant-in-Aid for Scientific Research (20658012) from the Japan Society for the Promotion of Science.
References Choi, H.W., Chung, I.M., Sin, M.H., Kim, Y.S., Sim, J.B., Kim, J.W., Kim, K.D., Chun, S.C., 2007. The effect of spent mushroom sawdust compost mixes, calcium cyanamide and solarization on basal stem rot of the cactus Hylocereus trigonus caused by Fusarium oxysporum. Crop. Prot. 26, 162e168. Chong, C., Rinker, S.L., 1994. Use of spent mushroom substrate (SMS) for growing containerized woody ornaments: an overview. Compost Sci. Util. 2, 45e54. Conrath, U., 2006. Systemic acquired resistance. Plant Signal. Behav. 1 (4), 179e184. Côté, F., Hahn, M.G., 1994. Oligosaccharins: structure and signal transduction. Plant Mol. Biol. 26, 1379e1411.
449
Cronin, M.J., Yohalem, D.S., Harris, R.F., Andrews, J.H., 1996. Putative mechanism and dynamics of inhibition of the apple scab pathogen Venturia inequalis by compost extracts. Soil Biol. Biochem. 28, 1241e1249. Da Rocha, A.R., Hammerschmidt, R., 2005. History and perspectives on the use of disease resistance inducers on horticultural crops. HortTechnology 15, 518e529. Deepak, S.A., Ishii, H., Park, P., 2006. Acibenzolar-S-methyl primes cell wall strengthening genes and reactive oxygen species forming/scavenging enzymes in cucumber after fungal pathogen attack. Physiol. Mol. Plant Pathol. 69, 52e61. Di Piero, R.M., Wulff, N.A., Pascholati, S.F., 2006. Partial purification of elicitor from Lentinula edodes basidiocarps protenting cucumber seedlings against Colletotrichum lagenarium. Braz. J. Microbiol. 37, 175e180. Durrant, W.E., Dong, X., 2004. Systemic acquired resistance. Annu. Rev. Phytopathol. 42, 185e209. Finney, K.N., Ryu, C., Sharifi, V.D., Swithenbank, J., 2009. The reuse of spent mushroom compost and coal tailings for energy recovery: comparison of thermal treatment technologies. Bioresour. Technol. 100, 310e315. Food and Agriculture Organization of the United Nations, 2008. FAOSTAT [online] Available from: faostat.fao.org (accessed 29.03.10). Gou, M., Chorover, J., Rosario, F., Fox, R.H., 2001. Leachate chemistry of fieldweathered spent mushroom substrate. J. Environ. Qual. 30, 1699e1709. Hammerschmidt, R., Ku c, J., 1982. Lignification as a mechanism for induced systemic resistance in cucumber. Physiol. Plant Pathol. 20, 61e71. Hideno, A., Aoyagi, H., Isobe, S., Tanaka, H., 2007. Utilization of spent sawdust matrix after cultivation of Grifola frondosa as substrate for ethanol production by simultaneous saccharification and fermentation. Food Sci. Technol. Res. 13, 111e117. Inagaki, R., Yamaguchi, A., 2009. Spent substrate of shiitake (Lentinula edodes) inhibits symptoms of anthracnose in cucumber. Mushroom Science and Biotechnology 17, 113e115. Ishii, H., 2003. Potential of novel resistance inducers in crop disease control. Annu. Rev. Plant Pathol. 2, 129e144. Jongedijk, E., Tigelaar, H., Van Roekel, J.S.C., Bres-Vloemans, S.A., Dekker, I., Van den Elzen, P.J.M., Cornelissen, B.J.C., Melchers, L.S., 1995. Synergistic activity of chitinases and 1,3-glucanases enhances fungal resistance in transgenic tomato plants. Euphytica 85, 173e180. Khan, W., Prithiviraj, B., Smith, D., 2003. Chitosan and chitin oligomers increase phenylalanine ammonia-lyase and tyroine ammonia-lyase activities in soybean leaves. J. Plant Physiol. 160, 859e863. Kobayashi, N., Hiramatsu, A., Akatsuka, T., 1987. Purification and chemical properties of an inhibitor of plant virus infection from fruiting bodies of Lentinus edodes. Agric. Biol. Chem. 51, 883e890. Lau, K.L., Tsang, Y.Y., Chiu, S.W., 2003. Use of spent mushroom compost to bioremediate PAH-contaminated samples. Chemosphere 52, 1539e1546. Medina, E., Paredes, C., Pérez-Murcia, M.D., Bustamante, M.A., Moral, R., 2009. Spent mushroom substrates as component of growing media for germination and growth of horticultural plants. Bioresour. Technol. 100, 4227e4232. Narusaka, Y., Narusaka, M., Horio, T., Ishii, H., 1999. Comparison of local and systemic induction of acquired disease resistance in cucumber plants treated with benzothiadiazoles or salicylic acid. Plant Cell Physiol. 40, 388e395. Pokhrel, C.P., Sumikawa, S., Lida, S., Ohga, S., 2006. Growth and productivity of Lyophylum decastes on compost enriched with various supplements. Micol. Apl. Int. 18, 21e28. lu, B., Önal, K., Onus, A.N., Karaca, M., 2009. Effects of Polat, E., Uzun, H.I., Topçuog spent mushroom compost on quality and productivity of cucumber (Cucumis sativus L.) grown in greenhouses. Afr. J. Biotechnol. 8, 176e180. Ribas, L.C.C., Mendoça, M.M., Camelini, C.M., Soares, C.H.L., 2009. Use of spent mushroom subtrates from Agaricus subrufescens (syn. A. blazei, A. brasiliensis) and Lentinula edodes productions in the enrichment of a soil-based potting media for lettuce (Lactuca sativa) cultivation: growth promotion and soil bioremediation. Bioresour. Technol. 100, 4750e4757. Sánchez, C., 2004. Modern aspects of mushroom culture technology. Appl. Microbiol. Biotechnol. 64, 756e762. Semple, K.T., Reid, B.J., Fermor, T.R., 2001. Impact of composting strategies of the treatment of soil contaminated with organic pollutants: a review. Environ. Pollut. 112, 269e283. Shibuya, N., Minami, E., 2001. Oligosaccharide signaling for defense responses in plant. Physiol. Mol. Plant Pathol. 59, 223e233. Tanabe, S., Okada, M., Jikumaru, Y., Yamane, H., Kaku, H., Shibuya, N., Minami, E., 2006. Induction of resistance against rice blast fungus in rice plants treated with a potent elicitor, N-acetylchitooligosaccharide. Biosci. Biotechnol. Biochem. 70, 1599e1605. Ukawa, Y., Ito, H., Hisamatsu, M., 2000. Antitumor effects of (1 / 3)-b-D-glucan and (1 / 6)-b-D-glucan purified from newly cultivated mushroom, hatakeshimeji (Lyophyllum decastes Sing.). J. Biosci. Bioeng. 90, 98e104. Ukawa, Y., Izumi, Y., Ohbuchi, T., Takahashi, T., Ikemizu, S., Kojima, Y., 2007. Oral administration of the extract from hatakeshimeji (Lyophyllum decastes Sing.) mushroom inhibits the development of atopic dermatitis-like skin lesion in NC/Nga mice. J. Nutr. Sci. Vitaminol. 53, 293e296. Uzun, I., 2004. Use of spent mushroom compost in sustainable fruit production. J. Fruit Ornam. Plant Res. 12, 157e165. Vallad, G.E., Goodman, R.M., 2004. Systemic acquired resistance and induced systemic resistance in conventional agriculture. Crop Sci. 44, 1920e1934. Viji, G., Uddin, W., Romaine, C.P., 2003. Suppression of gray leaf spot (blast) of perennial ryegrass turf by Pseudomonas aeruginosa from spent mushroom substrate. Biol. Control 26, 233e243.
450
R.Y. Parada et al. / Crop Protection 30 (2011) 443e450
Walters, D., Walsh, D., Newton, A., Lyon, G., 2005. Induced resistance for plant disease control: maximizing the efficacy of resistance elicitors. Phytopathology 95, 1368e1373. West, C., 1981. Fungal elicitors of the phytoalexin response in higher plants. Naturwissenschaften 68, 447e457. Williams, B.C., McMullan, J.T., McCahey, S., 2001. An initial assessment of spent mushroom compost as a potential energy feedstock. Bioresour. Technol. 79, 227e230. Wolski, E., Lima, C., Agusti, R., Daleo, G.R., Andreu, A.B., De Lederkremer, R.M., 2005. An a-glucan elicitor from the cell wall of a biocontrol binucleate Rhizoctonia isolate. Carbohyd. Res. 340, 619e627.
Wolski, E.A., Maldonado, S., Daleo, G.R., Andreu, A.B., 2006. A novel a-1,3-glucan elicits plant defence response in potato and induces protection against Rhizoctonia solani AG-3 and Fusarium solani f.sp. eumartii. Physiol. Mol. Plant Pathol. 69, 93e103. Yohalem, D.S., Harris, R.F., Andrews, J.H., 1994. Aqueous extracts of spent mushroom substrate for foliar disease control. Compost Sci. Util. 2, 67e74. Zhang, W., Han, D.Y., Dick, W.A., Davis, K.R., Hoitink, H.A.J., 1998. Compost and compost water extract-induced systemic acquired resistance in cucumber and Arabidopsis. Phytopathology 88, 450e455. Zhu, Q., Maher, E.A., Masoud, S., Dixon, R.A., Lamb, C.J., 1994. Enhanced protection against fungal attack by constitutive co-expression of chitinase and glucanase genes in transgenic tobacco. Nat. Biotechnol. 12, 807e812.