- Email: [email protected]
Autogenous particulate bone collected with a piezo-electric surgical device and bone trap: a microbiological and histomorphometric study
Archives of Oral Biology (2006) 51, 883—891
www.intl.elsevierhealth.com/journals/arob
Autogenous particulate bone collected with a piezo-electric surgical device and bone trap: a microbiological and histomorphometric study Stefano Sivolella a,*, Mario Berengo a, Marino Scarin b, Francesca Mella a, Franco Martinelli a a
Department of Oral Surgery, University of Padova, Institute of Clinical Dentistry, via Giustintiani, 2, Padova 35100, Italy b ` Operativa di Microbiologia e Virologia, Azienda Ospedaliera di Padova, Via Gabelli, Unita Padua 63-35121, Italy Accepted 4 April 2006
KEYWORDS Microbial analysis; Piezosurgery; Collected bone debris; Decontamination; Rifamycin
Summary The aims of this study were to determine the microbiological and particle size characteristics of particulate bone collected with a piezosurgery device and bone trap, and to reduce bacterial contamination after treatment of debris with rifamycin SV. Samples were taken from 10 patients who underwent surgical extraction of their third lower molars. The ostectomy was performed with a piezosurgery device, and the debris was collected with a surgical aspiration set equipped with a bone trap. Two aliquots were taken from each sample, one of which was treated with rifamycin SV. The second aliquot, used as a control, was treated with a physiological solution. In the samples immersed in antibiotic solution, there was a statistically significant (P < 0.005) reduction in bacterial contamination. The stringent protocol followed in this study has proved valid for collection of material, and treatment with rifamycin SV was found to reduce bacterial contamination in collected material. # 2006 Elsevier Ltd. All rights reserved.
Introduction In oral surgery, grafting materials are often used for correcting osseous defects for implantation and periodontal purposes.1,2 Autogenous bone is considered to be the ideal grafting material for its osteoconductive, osteoinductive and osteogenic properties.3—6 * Corresponding author. Tel.: +39 049 8212049/329 2167026; fax: +39 049 8218229. E-mail address: [email protected] (S. Sivolella).
A method for intra-oral collection of autogenous bone is the aspiration of bone debris, derived from milling of donor sites.7,8 It can also be obtained during dental implant surgery using a bone trap. The choice of aspiration system, with regard to the pore diameter of the mesh,9,10 is of fundamental importance in the use of this method. A piezosurgery device (Mectron Piezosurgery1, Medical Technology, Carasco, GE, Italy) has recently been proposed for use in performing osteotomies and ostectomies11—13 instead of rotary instruments.
0003–9969/$ — see front matter # 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.archoralbio.2006.04.001
884 The combination of piezosurgery and a bone trap allows for the collection of large quantities of autogenous intra-oral bone. The morphological characteristics of the collected bone and the potential for microbiological contamination of the sample following contact with oral secretions are not well understood. The morphology and dimensions of bone debris have been studied in relation to the success of grafting itself. In general, it is assumed that a dimension smaller than 200 mm leads to overly rapid resorption of fragments, which does not guarantee sufficient osteoconductivity for the new bone formation process in the receiving site. On the contrary, bone fragments greater than 1 mm in dimension require longer healing times.14—17 Bacterial contamination has been examined previously using many methods.18—20 From these studies, it emerges that salivary contamination of collected bone is a constant occurrence, and varies according to the surgical protocol: skin and mucosa disinfection prior to surgery; type of bone collector device; number of dedicated aspirators used; and dental and periodontal health of the patient.18—20 In orthopaedic surgery, it has been proposed that bacterial contamination of bone grafts could be decreased by immersion of the graft in an antibiotic solution (rifampicine, first- and second-generation cephalosporins, aminoglycosides).21 This technique has proved useful for killing off the initial bacteria, and bone graft healing does not seem to be inhibited or clinically influenced by the use of a topical antibiotic.22,23 Among the topical antibiotics, rifamycin, a bactericidal drug active with regard to Grampositive and Gram-negative pathogens, is often used in oral and maxillofacial surgery as it is effective and simple to use. The aims of this study were: (1) to evaluate the bacterial contamination of autogenous particulate bone collected intra-orally with a piezosurgery device and bone trap; (2) to evaluate the efficacy of treatment of bone debris with rifamycin SV (Rifocin solution for local use, LEPETIT, Lainate, MI, Italy) to reduce bacterial contamination; and (3) to determine, through histomorphometric techniques, the dimensions of the collected bone chips.
Materials and methods Selection of patients Ten patients (five females and five males, aged 13— 35 years, mean age 18.7 years) in need of surgical extraction of the impacted lower third molar or excision of the lower third molar tooth germ for
S. Sivolella et al. orthodontic reasons were selected. The surgery was performed at the University of Padua General Hospital’s Dental Clinic. Patients were entered into this study if they had no evidence of active inflammatory or periodontal pathologies upon examination of the oral cavity. Likewise, the medical histories taken found no significant systemic pathologies or contraindications to surgical procedures, and none of the patients reported that they had been undergoing pharmacological therapy of any type for the 30 days prior to the surgery. Patients were informed of the procedures and gave their consent.
Clinical procedures All surgeries considered in this study were carried out by one of the authors. Locoregional anaesthesia was obtained through blocking the lower alveolar nerve with mepivacaine hydrochloride, and blocking the buccinator nerve with mepivacaine hydrochloride and adrenalin 1:100,000. A releasing incision, from the distal aspect of the second molar to its buccal sulcus, was made and a full-thickness flap was elevated and gently retracted. The access ostectomy necessary for extraction of the impacted tooth was performed with a piezosurgery device (Mectron Piezosurgery, Medical Technology, Carasco, GE, Italy) equipped with a bone osteoplastic osteotome scalpel with a reversed trapezoid tip (OP1 insert). Sterile physiological solution, connected to the instrument by a sterile disposable tube, was used as cooling irrigation. Bone tissue samples were collected with a bone trap (Omniasurg ASP 100; Omnia srl, Fidenza, PR, Italy). The trap filter was equipped with a removable internal mesh with a pore diameter of 300 mm. Two distinct systems were used for aspiration and bone collection. The first system, devoted to the control of saliva and bleeding, was positioned approximately 1.5 cm from the ostectomy site. The second aspiration system was sterile and disposable, and comprised a filter for collecting bone chips and a plastic suction tube. It was only used at the start of the procedure for removing bone tissue around the impacted element. Throughout the ostectomy, the suction tube was held as close as possible to the cutting insert of the piezosurgery device in order to collect the bone debris and reduce the aspiration of saliva to a minimum. Upon completion of the ostectomy, the material collected in the filter was washed, by aspiration, with 500 ml of sterile physiological solution. The bone chips, still inside the filter, were weighed with a precision electronic scale (BP-61, Sartorius AG, Gottingen, Germany). The net weight of the material was obtained by subtracting the weight of the filter.
Autogenous particulate bone collected with a piezo-electric surgical device and bone trap
885
The filter was opened in aseptic conditions and three aliquots were collected at random: two of the three aliquots, 0.4 g each, were transferred to two 50-ml Falcon screw-capped, sterile tubes (Sarstedt AG & Co. Nu ¨mbrecht, Germany). The third aliquot, the amount of which was variable, was immersed in formalin and used to carry out the histomorphometric evaluation. Sixteen millilitres of 0.5% rifamycin SV (Rifocin solution for local use, LEPETIT, Lainate, MI, Italy) solution was added to one Falcon tube. The drug was diluted according to the manufacturer’s instructions, i.e. 90 mg of active ingredient (rifamycin SV) in 16.20 ml of water for injectable preparations. In the second test bottle, used as a control, 16 ml of sterile physiological solution was added. The bone chips remained in contact with the antibiotic, or with the physiological solution, for 10 min before proceeding to microbiological examination for bacterial quantification.
Isolation of the bacterial species resistant to treatment with rifamycin SV
Microbial analysis of the sample
Genotyping of the bacterial species
The microbial investigations were carried out in the Microbiology and Virology Laboratory of the University of Padua General Hospital. The tubes were centrifuged at 4000 g for 4 min using a refrigerated centrifuge to separate the bone chips from the supernatant. The centrifuge temperature was regulated at 4 8C in order to limit any microbic replication during this phase as much as possible. The supernatant was eliminated from the tubes and the bone debris was transferred, in anaerobic conditions, to a sterile mortar. The material was resuspended in 2 ml of sterile physiological solution, mixed and crushed manually with a pestle. Of the homogenate obtained, 200 ml was removed and underwent serial dilution in thioglycolate medium (101—107). In addition, 200-ml aliquots were taken from both the homogenate sample in the mortar and the culture in thioglycolate medium, and plated out for incubation at 37 8C in both aerobic and anaerobic conditions, as well as in a 10% CO2-enriched atmosphere. Samples were plated out on to both Schaedler agar, particularly indicated for the culture of anaerobic bacteria, and chocolate agar, a highly fertile medium (Becton Dickinson Italia, Buccinasco, MI, Italy). For each type of medium, three plates were prepared and incubated in different conditions. All the thioglycolate tubes and the plates were incubated for 48 h at a constant temperature of 37 8C before proceeding with identification. The number of colonies present on each agar medium was multiplied by the dilution factor of the sample. Using this procedure, the total number of colony-forming units (CFUs)/ml of sample was calculated.
A single bacterial colony was resuspended in 100 ml of distilled water and incubated for 15 min at 99 8C. After centrifugation at 10,000 g for 2 min, 5 ml of supernatant was used for the polymerase chain reaction (PCR), which was prepared using Ready Mix RED Taq PCR Reaction Mix (Sigma Aldrich, Milan, Italy) and a pair of universal primers, 355: 50 CCCGTCAATTCCTTTGAGTT0 3 and 910: 50 CCTACGGGAGGCAGCAG0 3, whose sequences are found in a well-preserved region of the 16S ribosomal gene and allow for amplification of these regions in any bacterial species. The primer concentration used was 10 pmol/l in a final volume of 50 ml. Thermal cycling reactions consisted of an initial denaturation (95 8C, 5 min) followed by 40 cycles of denaturation (94 8C, 1 min), annealing (56 8C, 1 min), and extension (72 8C, 1 min). The reaction took place in a dedicated automated DNA thermal cycler (model 2400; Applied Byosistems Division Headquarters, Foster City, CA, USA). The resulting amplification was verified by loading 5 ml of the PCR product in a gel containing 2% ethidium bromide (0.5 mg/ml), in which the expected band was 588 bp. The PCR product was purified in small Microcon100 columns (Millipore, Vimodrone, Milan, Italy) in order to eliminate primers and nucleotides. The sequence reaction was set up using the diagnostic system ‘Big Dye1 Terminator Cycle Sequencing Ready Reaction’ (Applied Biosystems, Foster City, CA, USA). The reaction was prepared in a final volume of 20 ml in the presence of 3.2 pmol of primer (355 and 910) and 8 ml of the kit mix. The thermal cycler was programmed as follows: 95 8C for 30 min, 30 cycles;
For the samples treated with rifamycin SV, identification of the single bacterial species present on the sample was achieved. After 48 h of incubation, plates were observed and different morphotypes were identified. For each colony, a slide was set up and Gram stained for preliminary identification under the microscope. Subculturing was performed in order to obtain pure colonies for identification. These subcultures were incubated for 48 h at 37 8C in either a CO2-rich atmosphere, or in anaerobic or aerobic conditions using the original conditions that allowed for development of the single colony under consideration. After incubation, plates were reexamined. A colony was removed from each isolation culture with a sterile loop and transferred to a 2-ml microtube (Sarstedt, Verona, Italy) with 100 ml of sterile distilled water.
886 50 8C for 10 min; and 60 8C for 4 min. The product of the sequencing reaction was precipitated with 1/10 of the volume of sodium acetate (3M, pH 5.2) and two volumes of ethanol, and resuspended in water in order to be loaded into the genetic analyser (ABI Prism1 3100-Avant; Applied Biosystems, Foster City, CA, USA). The sequences obtained were lined up and compared with those present in GeneBank using BLAST software (http://www.ncbi.nlm.nih.gov/BLAST/).
Study of chip dimensions The collected bone chips were used to carry out histomorphometric evaluation. The bone chips, fixed in 10% formalin in phosphate buffer 0.2 M (pH 7.3), were embedded in paraffin and coloured with haematoxylin-eosin. Linear measurements of the largest and smallest diameters of each bone chip were taken through an operative system comprising an optical microscope (Axioplan 2 Imaging, Carl Zeiss AG, Germany), a video camera (Axiocam, Carl Zeiss AG, Germany), hardware (Fujitsu Siemens, Pentium 4) and Image Pro-plus 4.1 software (Media Cybernetics, Silver Spring, MD, USA).
Statistical analysis of the results The results obtained were analysed using the Wilcoxon signed-rank test, a test for paired data that takes into account the fact that each pair of samples comes from the same patient.
Results The quantity of material collected with a bone trap (Omniasurg ASP 100; Omnia srl, Fidenza, PR, Italy) was, on average, 0.93 g (range 0.82—1.45 g). The average bacterial count for the samples in physiological solution was 1.707 105 CFU/ml [standard deviation (S.D.) 2.281 105]. The samples treated with rifamycin SV had an average microbiological count of 0.0131 105 CFU/ml (S.D. 0.015 105). Comparison of bacterial contamination values in the samples treated with rifamycin SV and the samples used as a control (physiological solution) reveals a reduction in the former compared with the latter, as shown in Table 1. This reduction was found to be statistically significant using Wilcoxon signed-rank test (P < 0.005). In the samples treated with rifamycin SV, bacterial species that were still present and able to resist exposure to the drug for 10 min (time set by the authors) were identified. The bacterial species identified are listed in Table 2.
S. Sivolella et al. Table 1 Effect of bone debris on bacterial contamination after treatment with or without rifamycin SV Sample
Total bacterial contamination [CFU/ml (105)] Treatment with rifamycin SV
Treatment without rifamycin SV
S.1 S.2 S.3 S.4 S.5 S.6 S.7 S.8 S.9 S.10
0.005 0.00195 0.05 0.028 0.0155 0.01925 0.00385 0.00267 0.00032 0.5
0.5 0.0067 0.5 5 5 0.5 0.05 0.5 0.016 500
Average
0.01315 (S.D. 0.015)
1.70727 (S.D. 2.281)
CFU: colony-forming unit; S.D.: standard deviation.
The majority of identified micro-organisms were obligate or facultative aerobic strains (84.62%), and only 15.38% of the isolated species were strictly anaerobic. The percentage of Gram-negative micro-organisms identified (80.75%) was greater than the percentage of Gram-positive micro-organisms (19.25%). Data are reported in Tables 3 and 4. The collected bone chips presented great variability with regard to their dimensions. For each bone chip observed, the maximum and minimum diameters were recorded. The average dimensions were 1451.649 mm 460.26 mm, the largest bone chip measured 6034 mm 1125.7 mm, and the smallest bone chip measured 73.12 mm 29.9 mm. It was not possible to carry out a statistical evaluation of the measurements taken as the choice of bone chips to be measured was not made in a systematic manner. For each sample, a small portion of the bone chips collected in the bone trap was removed at random and used for the histomorphometric evaluation. These data provide an indicative value of the dimensions of bone chips that can be obtained using the piezo-electric surgical device and a bone trap.
Discussion Collection of particulate bone with the piezo-electric surgical device and a bone trap is a technique that allows for attainment of a quantity of autogenous bone sufficient for correction of localised defects during oral surgery. Various systems for collecting bone debris have been designed and studied in order to guarantee the maximum clinical efficiency and best quality of the collected material.8—10
Autogenous particulate bone collected with a piezo-electric surgical device and bone trap
887
Table 2 Bacterial species found in the individual samples after treatment with rifamycin SV Bacterial species found Bifidobacterium spp. Facklamia hominis Haemophilus parainfluenzae Haemophilus segnis Kaistella koreensis Neisseria spp. Neisseria bacilliformis Neisseria elongata Neisseria perflava Neisseria pharingis Neisseria subflava Peptostreptococcus spp. Pseudomonas aeruginosa Streptococcus acidominimus Streptococcus mitis Terrahaemophilus aromaticivoran Veillonella spp. Total species/sample
S.1
S.2
S.3
S.4
S.5
S.6
S.7
S.8
S.9
S.10
1
3
3
3
4
2
5
3
1
1
A sterile and disposable aspiration set with a plastic suction tube and filter equipped with an internal mesh with a pore diameter of 300 mm (Omniasurg ASP 100; Omnia srl, Fidenza, PR, Italy) was used to collect bone fragments in this study. Studies in the literature have demonstrated that 300-mm meshes are capable of
catching most of the suctioned material, without the problems of frequent blocking of the aspiration system from obstruction of the filter.8—10 Meshes with a smaller pore diameter are rapidly saturated by the large amount of trapped bone debris. The filter may also be blocked by blood suctioned along with the
Table 3 Total number of aerobic and anaerobic strains found (and percentage of total) in all the samples treated with rifamycin SV
Table 4 Total number (and percentage of total) Gram-positive and Gram-negative strains found in all samples treated with rifamycin SV
Facultative aerobes
Gram-positive
Total no. strains found
Bifidobacterium spp. Facklamia hominis Peptostreptococcus spp. Streptococcus acidominimus Streptococcus mitis
1 1 1 1 1
Total Gram-positive
5 (19.25%)
Gram-negative
Total no. strains found
Haemophilus parainfluenzae Haemophilus segnis Neisseria spp. Neisseria bacilliformis Neisseria elongata Neisseria perflava Neisseria pharingis Neisseria subflava Facklamia hominis Pseudomonas aeruginosa Streptococcus acidominimus Streptococcus mitis Kaistella koreensis Total aerobes Facultative anaerobes
Total no. strains found 7 1 2 1 1 1 1 3 1 1 1 1 1
(26.92%) (3.83%) (7.69%) (3.83%) (3.83%) (3.83%) (3.83%) (11.53%) (3.83%) (3.83%) (3.83%) (3.83%) (3.83%)
22 (84.62%) Total no. strains found
Bifidobacterium spp. Peptostreptococcus spp. Terrahaemophilus aromat Veillonella spp.
1 1 1 1
(3.83%) (3.83%) (3.83%) (3.83%)
Total anaerobes
4 (15.38%)
Haemophilus parainfluenzae Haemophilus segnis Kaistella koreensis Neisseria spp. Neisseria bacilliformis Neisseria elongata Neisseria perflava Neisseria pharingis Neisseria subflava Pseudomonas aeruginosa Terrahaemophilus aromat Veillonella spp. Total Gram-negative
(3.85%) (3.83%) (3.83%) (3.83%) (3.83%)
7 1 1 2 1 1 1 1 3 1 1 1
(26.85%) (3.85%) (3.83%) (7.69%) (3.83%) (3.83%) (3.83%) (3.83%) (11.53%) (3.83%) (3.83%) (3.83%)
21 (80.75%)
888 bone chips; this coagulates in the mesh and obstructs the passage of fluids.8 Throughout this study, there were no problems with filter blockage during collection. Although the diameter of the pores was 300 mm, bone chips of smaller dimensions (approximately 70 mm) were trapped. It appears that the dimensions of the fragments can vary in function with the ‘packing’ of the collected material on the filter mesh. Therefore, the pore dimensions of the mesh do not imply collection of material that is homogeneous in size. The two distinct aspiration tubes used for chip collection and control of salivation and bleeding enabled the oral fluids in the collection site to be reduced. Moreso, the piezo-electric surgical device used for performing the ostectomy, was able to keep the operating area free of blood due to cavitation.13 This characteristic, combined with abundant irrigation with a sterile physiological solution, allowed for significant reduction of blood suctioning and the consequent formation of coagulum inside the filter. Washing the aspiration system and bone trap with 500 ml of sterile physiological solution further reduced the presence of contaminants in the collected material. Microbial contamination was found in all the samples of bone tissue collected in this study. Young et al.18 conducted the first studies to establish the extent of contamination of a bone sample collected with a bone trap during an intra-oral ostectomy performed with rotary instruments. The contamination of bone fragments found by Young et al.18 in two successive studies was 9.634 and 7.55 105 CFU/ml per sample, respectively. Bacterial contamination can be reduced, according to Young et al.,18 to 3.168 105 CFU/ml using two separate aspiration systems.18,24 The average bacterial contamination found in this study was 1.707 105 CFU/ml. The extracted dental element was completely bony impacted, not in contact with the oral cavity, and asymptomatic. Therefore, prior to incision of the flap and the beginning of the ostectomy, it was in a sterile condition. The collection protocol was very accurate; two distinct aspiration systems were used and the filter for bone chip collection was removed from its sterile packaging and put into use only at inception of the ostectomy, in order to reduce the risk of contamination of collected material. The source of contamination of the collected bone debris is represented, therefore, by the microbial community in the oral cavity, present in high concentrations in the saliva, the mucus and the teeth surfaces. It should be noted that patients in the present study had a younger average age compared with the patients in the studies of Young et al., and none of them presented periodontal pathologies.
S. Sivolella et al. Although considered acceptable by Young et al. and other authors,18,20,24 the bacterial contamination of bone fragments collected in the present study (1.707 105 CFU/ml) does not guarantee that the grafting of the material will be completely free of systemic or local infective complications. The authors decided to treat the bone samples with rifamycin SV because it is a bactericidal drug commonly used in oral and maxillofacial surgery for washing abscessed cavities, treating pericoronaritis, traumatic lesions and infected alveoli following extraction. It is even utilised in orthopaedic surgery and its topical application on bone tissue is well tolerated and limits the incidence of infective complications.25,26 It is active with regard to Grampositive and Gram-negative pathogens, and is effective in the treatment of polymicrobic infections.27 It is often used in the treatment of osteomyelitis and for infections associated with orthopaedic prostheses as it possesses an elevated capacity for spreading inside the bone tissue.28—32 Direct application of rifamycin on bone tissue and the combined use of the drug with other grafting materials does not seem to have a negative effect on osteogenesis.33 In all the samples treated with rifamycin SV, a statistically significant (P < 0.005) reduction in bacterial contamination was observed compared with the value found in the control samples. The contact time with the drug was 10 min. The choice of this parameter is connected to clinical considerations and a generic assessment of the times involved in oral surgery from harvesting to grafting. The concentration of the drug used, 0.5%, was that advised by the manufacturer for the topical application of the product, which was demonstrated to be well tolerated by the tissues. Witso et al.34 demonstrated that autogenous particulate bone soaked, by immersion, in rifampin (or other antibiotics) and grafted can carry the drug to the grafting site. One can therefore assume that, in addition to the immediate effect of reducing the bacterial contamination of bone debris, there is an added antibacterial effect due to the presence of drug in the grafting site.34 Treatment of collected bone debris was more effective than other methods applied to reduce bacterial contamination in the samples. According to Young et al., temporarily reducing the bacterial level present inside the oral cavity with a chlorhexidine-based mouthwash, administered to the patient immediately prior to the operation, limits the average contamination value of collected bone debris to 0.72 105 CFU/ ml.24 The contamination level found in this study after treatment of bone debris with antibiotic was notably lower. These methods could be applied
Autogenous particulate bone collected with a piezo-electric surgical device and bone trap jointly in order to further limit the bacterial count present in the samples. In the samples that were not treated with rifamycin SV, only a quantitative evaluation of the bacterial contamination was performed. In the samples treated with rifamycin SV, both quantitative and qualitative evaluations were performed. The bactericidal effect of rifamycin SV allowed for the isolation of some bacterial strains (resistant to the drug used in the specific conditions of exposure, e.g. time and concentration). Selection of the bacterial strains seems to be related to several factors: choice of donor site; presence of specific bacterial species on different oral tissue surfaces;35 technique used for bone chip collection; manipulation of bone samples from time of collection to microbiological evaluation; and bactericidal effect of rifamycin. In each sample of bone debris treated with rifamycin SV, an average of 2.6 bacterial strains that were resistant to the antibiotic treatment were isolated. Micro-organisms belonging to the Haemophilus spp. and Neisseria spp. groups were identified most frequently (65.38% of the total isolations). In particular, Haemophilus parainfluenzae was identified in 70% of the samples. The majority of bacterial species identified (84.62%) were aerobes or facultative anaerobes. This may be due, in part, to the fact that patients selected for this study did not present periodontal pathologies, sustained prevalently by Gram-negative anaerobic micro-organisms. In addition, treatment of the samples inevitably led to their exposure to the air, despite the fact that the plating out and incubation of the samples was carried out within 30 min of collection. This exposure probably contributed to the death of a portion of the obligatory anaerobic micro-organisms. It must, however, be highlighted that even the clinical use of bone chips as grafting material leads to air exposure matching that in this study, with a consequent reduction in the anaerobic component of micro-organisms present. A high percentage of micro-organisms that are resistant to treatment with rifamycin SV are Gram-negative. Rifamycin is active, both in vivo and in vitro, on Gram-positive micro-organisms, while the action of the drug on Gram-negative bacteria occurs at higher concentrations. By using higher concentrations of the drug for decontamination treatment, it will be possible to further reduce the bacterial count. It must, however, be established at what dose the drug is well tolerated by the bone tissue and does not interfere with the osteogenesis process. The bacteria isolated in this study are regular components of the bacterial flora found in the oral cavity. The majority of the isolated bacterial species are defined as commensal, and have a low patho-
889
genicity. However, they can cause infective complications in subjects with compromised immune systems, such as H. parainfluenzae, Neisseria subflava and Pseudomonas aeruginosa.35,36 Some of these micro-organisms have been isolated from post-operative infections in the head and neck, the aetiology of which is usually polymicrobic. Among the micro-organisms isolated in this study, Streptococcus mitis is frequently associated with post-operative infective complications, and with oral and maxillofacial suppurative infections.37 The potential pathogenicity of Veillonella spp. is fairly high; this micro-organism is potentially correlated with infectious endocarditis and osteomyelitis.38,39 Peptostreptococcus spp. has a high potential pathogenicity; it is correlated with endodontic infections, suppurative infections of the oral cavity and, probably, with periodontal pathology.40 Haemophilus segnis, Neisseria elongata and Streptococcus acidominimus are correlated with infectious endocarditis.41—43 Given that the micro-organisms of the oral cavity include a very high number of different species, it is very difficult for one sole antibiotic to be capable of eliminating all the micro-organisms that can contaminate a bone sample from in this site.44 Further studies are needed to determine the effects of combinations of antibiotics in order to broaden the range of action to Gram-positive and Gram-negative micro-organisms. The aliquots of bone chips for histomorphometric analysis and the aliquots for microbiological evaluation were selected randomly from the bone trap. However, it cannot be confirmed that the bone chips examined in this study represent the dimensions of all the chips collected in the bone trap. The measurement of linear dimensions only provides an indicative value of the size of bone chips that can be obtained using the piezo-electric device equipped with the OP1 insert in association with a bone trap with a 300-mm-diameter filter. The linear dimensions of the collected bone chips presented great variability, ranging between 73.12 mm 29.9 mm and 6034 mm 1125.7 mm. Some chips had smaller dimensions than the mesh of the filter used for collection (300 mm), but were still trapped. Bone chips of such reduced dimensions are rapidly resorbed. On the other hand, very large bone chips undergo slow incorporation and the graft may a require longer healing time.14—16,40,45 Nonetheless, the ideal dimensions of autogenous bone chips, used as grafting material, have not yet been clarified and the values reported in the literature are not uniform. One can, however, presume that the presence of bone chips with such varied dimensions as those collected in this study combines the advantages of the bone being subjected to early
890 remodelling of the small-sized chips, and the mechanical support provided by the larger particles. The latter, in fact, undergo slower remodelling and constitute a valid scaffold for new bone formation in the grafting site.17
Conclusions The piezo-electric surgical device proved to be a valid device for collecting autogenous particulate bone. The collection protocol applied must always foresee the use of an aspiration system for the control of saliva and bleeding, as well as a surgical aspiration set equipped with a bone trap for the collection of bone chips, in order to limit bacterial contamination of the collected bone debris. The use of rifamycin SV for treatment of the bone chips allowed the authors to reduce bacterial contamination significantly. According to the literature, bone chips collected and treated using the methods described in this study can be considered as a valid grafting material for the correction of minor bone defects during oral surgery operations.8,18,19 It must also be taken into consideration that bone chips treated with antibiotic solution are impregnated with the drug and may leave it in the grafting site.34 This additional antibacterial effect, already studied in vitro by some authors, could be examined in vivo in future studies, which could provide information on the effect of rifamycin on the properties of autogenous particulate bone grafting.
References 1. Stricker A, Voss PJ, Gutwald R, Schramm A, Schmelzeisen R. Maxillary sinus floor augmention with autogenous bone grafts to enable placement of SLA-surfaced implants: preliminary results after 15—40 months. Clin Oral Implants Res 2003;14:207—12. 2. Williamson RA. Rehabilitation of the resorbed maxilla and mandible using autogenous bone grafts and osseointegrated implants. Int J Oral Maxillofac Implants 1996;11: 476—88. 3. Lorenzetti M, Mozzati M, Campanino PP, Valente G. Bone augmentation of the inferior floor of the maxillary sinus with autogenous bone or composite bone grafts: a histologichistomorphometric preliminary report. Int J Oral Maxillofac Implants 1998;13:69—76. 4. Moy PK, Lundgren S, Holmes RE. Maxillary sinus augmentation: histomorphometric analysis of graft materials for maxillary sinus floor augmentation. J Oral Maxillofac Surg 1993;51:857—62. 5. Hallman M, Sennerby L, Lundgren S. A clinical and histologic evaluation of implant integration in the posterior maxilla after sinus floor augmentation with autogenous bone, bovine hydroxyapatite, or a 20:80 mixture. Int J Oral Maxillofac Implants 2002;17:635—43.
S. Sivolella et al. 6. Matsumoto MA, Filho HN, Francischone E, Consolaro A. Microscopic analysis of reconstructed maxillary alveolar ridges using autogenous bone grafts from the chin and iliac crest. Int J Oral Maxillofac Implants 2002;17:507—16. 7. Savant TD, Smith KS, Sullivan SM, Owen WL. Bone volume collected from dental implant sites during osteotomy. J Oral Maxillofac Surg 2001;59:905—7. 8. Young MP, Worthington HV, Lloyd RE, Drucker DB, Sloan P, Carter DH. Bone collected during dental implant surgery: a clinical and histological study. Clin Oral Implants Res 2002;13:298—303. 9. Kainulainen V, Oikarinen K. Comparison of four bone collectors designed for oral and maxillofacial surgery–—an in vitro study. Clin Oral Implants Res 1998;9:327—32. 10. Oikarinen K, Kainulainen V, Kainulainen T. A method of harvesting corticocancellous bone chips for reconstructive maxillofacial surgery. Int J Oral Maxillofac Surg 1997;26: 103—5. 11. Robiony M, Polini F, Costa F, Vercellotti T, Politi M. Piezoelectric bone cutting in multipiece maxillary osteotomies. J Oral Maxillofac Surg 2004;62:759—61. 12. Vercellotti T. Technological characteristics and clinical indications of piezoelectric bone surgery. Minerva Stomatol 2004;53:207—14. 13. O’Leary R, Sved AM, Davies EH, Leighton TG, Wilson M, Kieser JB. The bactericidal effects of dental ultrasound on Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis. An in vitro investigation. J Clin Periodontol 1997;24: 432—9. 14. Schepers EJ, Ducheyne P. Bioactive glass particles of narrow size range for the treatment of oral bone defects: a 1—24 month experiment with several materials and particle sizes and size ranges. J Oral Rehabil 1997;24:171—81. 15. Shapoff CA, Bowers GM, Levy B, Mellonig JT, Yukna RA. The effect of particle size on the osteogenic activity of composite grafts of allogeneic freeze-dried bone and autogenous marrow. J Periodontol 1980;51:625—30. 16. Pallesen L, Schou S, Aaboe M, Hjorting-Hansen E, Nattestad A, Melsen F. Influence of particle size of autogenous bone grafts on the early stages of bone regeneration: a histologic and stereologic study in rabbit calvarium. Int J Oral Maxillofac Implants 2002;17:498—506. 17. Fucini SE, Quintero G, Gher ME, Black BS, Richardson AC. Small versus large particles of demineralised freeze-dried bone allografts in human intrabony periodontal defects. J Periodontol 1993;64:844—7. 18. Young MP, Carter DH, Worthington H, Korachi M, Drucker DB. Microbial analysis of bone collected during implant surgery: a clinical and laboratory study. Clin Oral Implants Res 2001;12: 95—103. 19. Glaser B, Hodel Y, Meyer J, Lambrecht JT. Bacterial contamination of bony particles from the bone collection trap. Schweiz Monatsschr Zahnmed 2004;114:337—41. 20. Blay A, Tunchel S, Sendyk WR. Viability of autogenous bone grafts obtained by using bone collectors: histological and microbiological study. Pesqui Odontol Bras 2003;17:234— 40. 21. Hirn M, Laitinen M, Pirkkalainen S, Vuento R. Cefuroxime, rifampicin and pulse lavage in decontamination of allograft bone. J Hosp Infect 2004;56:198—201. 22. Petri 3rd WH, Schaberg SJ. The effects of antibiotic-supplemented bone allografts on contaminated, partially avulsive fractures of the canine ulna. J Oral Maxillofac Surg 1984;42: 699—704. 23. Petri 3rd WH, Wilson TM. Clinical evaluation of antibioticsupplemented bone allograft. J Oral Maxillofac Surg 1993;51:982—5.
Autogenous particulate bone collected with a piezo-electric surgical device and bone trap 24. Young MP, Korachi M, Carter DH, Worthington HV, McCord JF, Drucker DB. The effects of an immediately pre-surgical chlorhexidine oral rinse on the bacterial contaminants of bone debris collected during dental implant surgery. Clin Oral Implants Res 2002;13:20—9. 25. Fabre L, Chami G. Experimentation clinique de la rifamycine S.V. en oto-rhino-laryngologie et chirurgie maxillo-faciale (article the ´rapeutique). Les Cahiers d’ORL 1979;14:407—12. 26. de Carvalho PS, Mariano RC, Okamoto T. Treatment of fibrinolytic alveolitis with rifamycin B diethylamide associated with gelfoam: a histological study. Braz Dent J 1997;8:3—8. 27. armaceuSweetman S, ed. Martindale: The Complete Drug Reference. [Internet database]. London: Phtical Press. Electronic version, Greenwood Village, Colo: Thomson Micromedex. Updated periodically. http://www.micromedex.com/ products/martindale/. 28. Norden CW, Keleti E. Treatment of experimental staphylococcal osteomyelitis with rifampin and trimethoprim, alone and in combination. Antimicrob Agents Chemother 1980;17: 591—4. 29. Drancourt M, Stein A, Argenson JN, Roiron R, Groulier P, Raoult D. Oral treatment of Staphylococcus spp. infected orthopaedic implants with fusidic acid or ofloxacin in combination with rifampicin. J Antimicrob Chemother 1997;39: 235—40. 30. Sirot J, Prive L, Lopitaux R, Glanddier Y. Diffusion of rifampicin into spongy and compact bone tissue during total hip prosthesis operation. Pathol Biol (Paris) 1983;31:438—41. 31. Cluzel RA, Lopitaux R, Sirot J, Rampon S. Rifampicin in the treatment of osteoarticular infections due to staphylococci. J Antimicrob Chemother 1984;13(Suppl C):23—9. 32. Roth B. Penetration of parenterally administered rifampicin into bone tissue. Chemotherapy 1984;30:358—65. 33. Varlet A, Dauchy P, Hingrez M. Osteogenesis induced by the addition of demineralised bone matrix to plaster pellets with
34. 35.
36.
37.
38. 39.
40.
41.
42.
43. 44.
45.
891
antibiotics. Animal experiment. Rev Chir Orthop Reparatrice Appar Mot 1985;71:73—8. Witso E, Persen L, Loseth K, Benum P, Bergh K. Cancellous bone as an antibiotic carrier. Acta Orthop Scand 2000;71:80—4. Tada A, Watanabe T, Yokoe H, Hanada N, Tanzawa H. Oral bacteria influenced by the functional status of the elderly people and the type and quality of facilities for the bedridden. J Appl Microbiol 2002;93:487—91. Kaplan JB, Fine DH. Biofilm dispersal of Neisseria subflava and other phylogenetically diverse oral bacteria. Appl Environ Microbiol 2002;68:4943—50. Bancescu G, Dumitriu S, Bancescu A, et al. Susceptibility testing of Streptococcus mitis group isolates. Indian J Med Res 2004;119(Suppl):257—61. Fisher RG, Denison MR. Veillonella parvula bacteremia without an underlying source. J Clin Microbiol 1996;34:3235—6. Boo TW, Cryan B, O’Donnell A, Fahy G. Prosthetic valve endocarditis caused by Veillonella parvula. J Infect 2005;50:81—3. Rolph HJ, Lennon A, Riggio MP, et al. Molecular identification of microorganisms from endodontic infections. J Clin Microbiol 2001;39:3282—9. Lau SK, Woo PC, Mok MY, et al. Characterisation of Haemophilus segnis, an important cause of bacteremia, by 16S rRNA gene sequencing. J Clin Microbiol 2004;42:877—80. Haddow LJ, Mulgrew C, Ansari A, et al. Neisseria elongata endocarditis: case report and literature review. Clin Microbiol Infect 2003;9:426—30. Brachlow A, Awadallah S, Chatterjee A. Endocarditis due to Streptococcus acidominimus. Pediatr Cardiol 2003;24:161—3. Mager DL, Ximenez-Fyvie LA, Haffajee AD, Socrannsky SS. Distribution of selected bacterial species on intraoral surfaces. J Clin Periodontol 2003;30:644—54. Xu H, Shimizu Y, Asai S, Ooya K. Experimental sinus grafting with the use of deproteinised bone particles of different sizes. Clin Oral Implants Res 2003;14:548—55.
www.intl.elsevierhealth.com/journals/arob
Autogenous particulate bone collected with a piezo-electric surgical device and bone trap: a microbiological and histomorphometric study Stefano Sivolella a,*, Mario Berengo a, Marino Scarin b, Francesca Mella a, Franco Martinelli a a
Department of Oral Surgery, University of Padova, Institute of Clinical Dentistry, via Giustintiani, 2, Padova 35100, Italy b ` Operativa di Microbiologia e Virologia, Azienda Ospedaliera di Padova, Via Gabelli, Unita Padua 63-35121, Italy Accepted 4 April 2006
KEYWORDS Microbial analysis; Piezosurgery; Collected bone debris; Decontamination; Rifamycin
Summary The aims of this study were to determine the microbiological and particle size characteristics of particulate bone collected with a piezosurgery device and bone trap, and to reduce bacterial contamination after treatment of debris with rifamycin SV. Samples were taken from 10 patients who underwent surgical extraction of their third lower molars. The ostectomy was performed with a piezosurgery device, and the debris was collected with a surgical aspiration set equipped with a bone trap. Two aliquots were taken from each sample, one of which was treated with rifamycin SV. The second aliquot, used as a control, was treated with a physiological solution. In the samples immersed in antibiotic solution, there was a statistically significant (P < 0.005) reduction in bacterial contamination. The stringent protocol followed in this study has proved valid for collection of material, and treatment with rifamycin SV was found to reduce bacterial contamination in collected material. # 2006 Elsevier Ltd. All rights reserved.
Introduction In oral surgery, grafting materials are often used for correcting osseous defects for implantation and periodontal purposes.1,2 Autogenous bone is considered to be the ideal grafting material for its osteoconductive, osteoinductive and osteogenic properties.3—6 * Corresponding author. Tel.: +39 049 8212049/329 2167026; fax: +39 049 8218229. E-mail address: [email protected] (S. Sivolella).
A method for intra-oral collection of autogenous bone is the aspiration of bone debris, derived from milling of donor sites.7,8 It can also be obtained during dental implant surgery using a bone trap. The choice of aspiration system, with regard to the pore diameter of the mesh,9,10 is of fundamental importance in the use of this method. A piezosurgery device (Mectron Piezosurgery1, Medical Technology, Carasco, GE, Italy) has recently been proposed for use in performing osteotomies and ostectomies11—13 instead of rotary instruments.
0003–9969/$ — see front matter # 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.archoralbio.2006.04.001
884 The combination of piezosurgery and a bone trap allows for the collection of large quantities of autogenous intra-oral bone. The morphological characteristics of the collected bone and the potential for microbiological contamination of the sample following contact with oral secretions are not well understood. The morphology and dimensions of bone debris have been studied in relation to the success of grafting itself. In general, it is assumed that a dimension smaller than 200 mm leads to overly rapid resorption of fragments, which does not guarantee sufficient osteoconductivity for the new bone formation process in the receiving site. On the contrary, bone fragments greater than 1 mm in dimension require longer healing times.14—17 Bacterial contamination has been examined previously using many methods.18—20 From these studies, it emerges that salivary contamination of collected bone is a constant occurrence, and varies according to the surgical protocol: skin and mucosa disinfection prior to surgery; type of bone collector device; number of dedicated aspirators used; and dental and periodontal health of the patient.18—20 In orthopaedic surgery, it has been proposed that bacterial contamination of bone grafts could be decreased by immersion of the graft in an antibiotic solution (rifampicine, first- and second-generation cephalosporins, aminoglycosides).21 This technique has proved useful for killing off the initial bacteria, and bone graft healing does not seem to be inhibited or clinically influenced by the use of a topical antibiotic.22,23 Among the topical antibiotics, rifamycin, a bactericidal drug active with regard to Grampositive and Gram-negative pathogens, is often used in oral and maxillofacial surgery as it is effective and simple to use. The aims of this study were: (1) to evaluate the bacterial contamination of autogenous particulate bone collected intra-orally with a piezosurgery device and bone trap; (2) to evaluate the efficacy of treatment of bone debris with rifamycin SV (Rifocin solution for local use, LEPETIT, Lainate, MI, Italy) to reduce bacterial contamination; and (3) to determine, through histomorphometric techniques, the dimensions of the collected bone chips.
Materials and methods Selection of patients Ten patients (five females and five males, aged 13— 35 years, mean age 18.7 years) in need of surgical extraction of the impacted lower third molar or excision of the lower third molar tooth germ for
S. Sivolella et al. orthodontic reasons were selected. The surgery was performed at the University of Padua General Hospital’s Dental Clinic. Patients were entered into this study if they had no evidence of active inflammatory or periodontal pathologies upon examination of the oral cavity. Likewise, the medical histories taken found no significant systemic pathologies or contraindications to surgical procedures, and none of the patients reported that they had been undergoing pharmacological therapy of any type for the 30 days prior to the surgery. Patients were informed of the procedures and gave their consent.
Clinical procedures All surgeries considered in this study were carried out by one of the authors. Locoregional anaesthesia was obtained through blocking the lower alveolar nerve with mepivacaine hydrochloride, and blocking the buccinator nerve with mepivacaine hydrochloride and adrenalin 1:100,000. A releasing incision, from the distal aspect of the second molar to its buccal sulcus, was made and a full-thickness flap was elevated and gently retracted. The access ostectomy necessary for extraction of the impacted tooth was performed with a piezosurgery device (Mectron Piezosurgery, Medical Technology, Carasco, GE, Italy) equipped with a bone osteoplastic osteotome scalpel with a reversed trapezoid tip (OP1 insert). Sterile physiological solution, connected to the instrument by a sterile disposable tube, was used as cooling irrigation. Bone tissue samples were collected with a bone trap (Omniasurg ASP 100; Omnia srl, Fidenza, PR, Italy). The trap filter was equipped with a removable internal mesh with a pore diameter of 300 mm. Two distinct systems were used for aspiration and bone collection. The first system, devoted to the control of saliva and bleeding, was positioned approximately 1.5 cm from the ostectomy site. The second aspiration system was sterile and disposable, and comprised a filter for collecting bone chips and a plastic suction tube. It was only used at the start of the procedure for removing bone tissue around the impacted element. Throughout the ostectomy, the suction tube was held as close as possible to the cutting insert of the piezosurgery device in order to collect the bone debris and reduce the aspiration of saliva to a minimum. Upon completion of the ostectomy, the material collected in the filter was washed, by aspiration, with 500 ml of sterile physiological solution. The bone chips, still inside the filter, were weighed with a precision electronic scale (BP-61, Sartorius AG, Gottingen, Germany). The net weight of the material was obtained by subtracting the weight of the filter.
Autogenous particulate bone collected with a piezo-electric surgical device and bone trap
885
The filter was opened in aseptic conditions and three aliquots were collected at random: two of the three aliquots, 0.4 g each, were transferred to two 50-ml Falcon screw-capped, sterile tubes (Sarstedt AG & Co. Nu ¨mbrecht, Germany). The third aliquot, the amount of which was variable, was immersed in formalin and used to carry out the histomorphometric evaluation. Sixteen millilitres of 0.5% rifamycin SV (Rifocin solution for local use, LEPETIT, Lainate, MI, Italy) solution was added to one Falcon tube. The drug was diluted according to the manufacturer’s instructions, i.e. 90 mg of active ingredient (rifamycin SV) in 16.20 ml of water for injectable preparations. In the second test bottle, used as a control, 16 ml of sterile physiological solution was added. The bone chips remained in contact with the antibiotic, or with the physiological solution, for 10 min before proceeding to microbiological examination for bacterial quantification.
Isolation of the bacterial species resistant to treatment with rifamycin SV
Microbial analysis of the sample
Genotyping of the bacterial species
The microbial investigations were carried out in the Microbiology and Virology Laboratory of the University of Padua General Hospital. The tubes were centrifuged at 4000 g for 4 min using a refrigerated centrifuge to separate the bone chips from the supernatant. The centrifuge temperature was regulated at 4 8C in order to limit any microbic replication during this phase as much as possible. The supernatant was eliminated from the tubes and the bone debris was transferred, in anaerobic conditions, to a sterile mortar. The material was resuspended in 2 ml of sterile physiological solution, mixed and crushed manually with a pestle. Of the homogenate obtained, 200 ml was removed and underwent serial dilution in thioglycolate medium (101—107). In addition, 200-ml aliquots were taken from both the homogenate sample in the mortar and the culture in thioglycolate medium, and plated out for incubation at 37 8C in both aerobic and anaerobic conditions, as well as in a 10% CO2-enriched atmosphere. Samples were plated out on to both Schaedler agar, particularly indicated for the culture of anaerobic bacteria, and chocolate agar, a highly fertile medium (Becton Dickinson Italia, Buccinasco, MI, Italy). For each type of medium, three plates were prepared and incubated in different conditions. All the thioglycolate tubes and the plates were incubated for 48 h at a constant temperature of 37 8C before proceeding with identification. The number of colonies present on each agar medium was multiplied by the dilution factor of the sample. Using this procedure, the total number of colony-forming units (CFUs)/ml of sample was calculated.
A single bacterial colony was resuspended in 100 ml of distilled water and incubated for 15 min at 99 8C. After centrifugation at 10,000 g for 2 min, 5 ml of supernatant was used for the polymerase chain reaction (PCR), which was prepared using Ready Mix RED Taq PCR Reaction Mix (Sigma Aldrich, Milan, Italy) and a pair of universal primers, 355: 50 CCCGTCAATTCCTTTGAGTT0 3 and 910: 50 CCTACGGGAGGCAGCAG0 3, whose sequences are found in a well-preserved region of the 16S ribosomal gene and allow for amplification of these regions in any bacterial species. The primer concentration used was 10 pmol/l in a final volume of 50 ml. Thermal cycling reactions consisted of an initial denaturation (95 8C, 5 min) followed by 40 cycles of denaturation (94 8C, 1 min), annealing (56 8C, 1 min), and extension (72 8C, 1 min). The reaction took place in a dedicated automated DNA thermal cycler (model 2400; Applied Byosistems Division Headquarters, Foster City, CA, USA). The resulting amplification was verified by loading 5 ml of the PCR product in a gel containing 2% ethidium bromide (0.5 mg/ml), in which the expected band was 588 bp. The PCR product was purified in small Microcon100 columns (Millipore, Vimodrone, Milan, Italy) in order to eliminate primers and nucleotides. The sequence reaction was set up using the diagnostic system ‘Big Dye1 Terminator Cycle Sequencing Ready Reaction’ (Applied Biosystems, Foster City, CA, USA). The reaction was prepared in a final volume of 20 ml in the presence of 3.2 pmol of primer (355 and 910) and 8 ml of the kit mix. The thermal cycler was programmed as follows: 95 8C for 30 min, 30 cycles;
For the samples treated with rifamycin SV, identification of the single bacterial species present on the sample was achieved. After 48 h of incubation, plates were observed and different morphotypes were identified. For each colony, a slide was set up and Gram stained for preliminary identification under the microscope. Subculturing was performed in order to obtain pure colonies for identification. These subcultures were incubated for 48 h at 37 8C in either a CO2-rich atmosphere, or in anaerobic or aerobic conditions using the original conditions that allowed for development of the single colony under consideration. After incubation, plates were reexamined. A colony was removed from each isolation culture with a sterile loop and transferred to a 2-ml microtube (Sarstedt, Verona, Italy) with 100 ml of sterile distilled water.
886 50 8C for 10 min; and 60 8C for 4 min. The product of the sequencing reaction was precipitated with 1/10 of the volume of sodium acetate (3M, pH 5.2) and two volumes of ethanol, and resuspended in water in order to be loaded into the genetic analyser (ABI Prism1 3100-Avant; Applied Biosystems, Foster City, CA, USA). The sequences obtained were lined up and compared with those present in GeneBank using BLAST software (http://www.ncbi.nlm.nih.gov/BLAST/).
Study of chip dimensions The collected bone chips were used to carry out histomorphometric evaluation. The bone chips, fixed in 10% formalin in phosphate buffer 0.2 M (pH 7.3), were embedded in paraffin and coloured with haematoxylin-eosin. Linear measurements of the largest and smallest diameters of each bone chip were taken through an operative system comprising an optical microscope (Axioplan 2 Imaging, Carl Zeiss AG, Germany), a video camera (Axiocam, Carl Zeiss AG, Germany), hardware (Fujitsu Siemens, Pentium 4) and Image Pro-plus 4.1 software (Media Cybernetics, Silver Spring, MD, USA).
Statistical analysis of the results The results obtained were analysed using the Wilcoxon signed-rank test, a test for paired data that takes into account the fact that each pair of samples comes from the same patient.
Results The quantity of material collected with a bone trap (Omniasurg ASP 100; Omnia srl, Fidenza, PR, Italy) was, on average, 0.93 g (range 0.82—1.45 g). The average bacterial count for the samples in physiological solution was 1.707 105 CFU/ml [standard deviation (S.D.) 2.281 105]. The samples treated with rifamycin SV had an average microbiological count of 0.0131 105 CFU/ml (S.D. 0.015 105). Comparison of bacterial contamination values in the samples treated with rifamycin SV and the samples used as a control (physiological solution) reveals a reduction in the former compared with the latter, as shown in Table 1. This reduction was found to be statistically significant using Wilcoxon signed-rank test (P < 0.005). In the samples treated with rifamycin SV, bacterial species that were still present and able to resist exposure to the drug for 10 min (time set by the authors) were identified. The bacterial species identified are listed in Table 2.
S. Sivolella et al. Table 1 Effect of bone debris on bacterial contamination after treatment with or without rifamycin SV Sample
Total bacterial contamination [CFU/ml (105)] Treatment with rifamycin SV
Treatment without rifamycin SV
S.1 S.2 S.3 S.4 S.5 S.6 S.7 S.8 S.9 S.10
0.005 0.00195 0.05 0.028 0.0155 0.01925 0.00385 0.00267 0.00032 0.5
0.5 0.0067 0.5 5 5 0.5 0.05 0.5 0.016 500
Average
0.01315 (S.D. 0.015)
1.70727 (S.D. 2.281)
CFU: colony-forming unit; S.D.: standard deviation.
The majority of identified micro-organisms were obligate or facultative aerobic strains (84.62%), and only 15.38% of the isolated species were strictly anaerobic. The percentage of Gram-negative micro-organisms identified (80.75%) was greater than the percentage of Gram-positive micro-organisms (19.25%). Data are reported in Tables 3 and 4. The collected bone chips presented great variability with regard to their dimensions. For each bone chip observed, the maximum and minimum diameters were recorded. The average dimensions were 1451.649 mm 460.26 mm, the largest bone chip measured 6034 mm 1125.7 mm, and the smallest bone chip measured 73.12 mm 29.9 mm. It was not possible to carry out a statistical evaluation of the measurements taken as the choice of bone chips to be measured was not made in a systematic manner. For each sample, a small portion of the bone chips collected in the bone trap was removed at random and used for the histomorphometric evaluation. These data provide an indicative value of the dimensions of bone chips that can be obtained using the piezo-electric surgical device and a bone trap.
Discussion Collection of particulate bone with the piezo-electric surgical device and a bone trap is a technique that allows for attainment of a quantity of autogenous bone sufficient for correction of localised defects during oral surgery. Various systems for collecting bone debris have been designed and studied in order to guarantee the maximum clinical efficiency and best quality of the collected material.8—10
Autogenous particulate bone collected with a piezo-electric surgical device and bone trap
887
Table 2 Bacterial species found in the individual samples after treatment with rifamycin SV Bacterial species found Bifidobacterium spp. Facklamia hominis Haemophilus parainfluenzae Haemophilus segnis Kaistella koreensis Neisseria spp. Neisseria bacilliformis Neisseria elongata Neisseria perflava Neisseria pharingis Neisseria subflava Peptostreptococcus spp. Pseudomonas aeruginosa Streptococcus acidominimus Streptococcus mitis Terrahaemophilus aromaticivoran Veillonella spp. Total species/sample
S.1
S.2
S.3
S.4
S.5
S.6
S.7
S.8
S.9
S.10
1
3
3
3
4
2
5
3
1
1
A sterile and disposable aspiration set with a plastic suction tube and filter equipped with an internal mesh with a pore diameter of 300 mm (Omniasurg ASP 100; Omnia srl, Fidenza, PR, Italy) was used to collect bone fragments in this study. Studies in the literature have demonstrated that 300-mm meshes are capable of
catching most of the suctioned material, without the problems of frequent blocking of the aspiration system from obstruction of the filter.8—10 Meshes with a smaller pore diameter are rapidly saturated by the large amount of trapped bone debris. The filter may also be blocked by blood suctioned along with the
Table 3 Total number of aerobic and anaerobic strains found (and percentage of total) in all the samples treated with rifamycin SV
Table 4 Total number (and percentage of total) Gram-positive and Gram-negative strains found in all samples treated with rifamycin SV
Facultative aerobes
Gram-positive
Total no. strains found
Bifidobacterium spp. Facklamia hominis Peptostreptococcus spp. Streptococcus acidominimus Streptococcus mitis
1 1 1 1 1
Total Gram-positive
5 (19.25%)
Gram-negative
Total no. strains found
Haemophilus parainfluenzae Haemophilus segnis Neisseria spp. Neisseria bacilliformis Neisseria elongata Neisseria perflava Neisseria pharingis Neisseria subflava Facklamia hominis Pseudomonas aeruginosa Streptococcus acidominimus Streptococcus mitis Kaistella koreensis Total aerobes Facultative anaerobes
Total no. strains found 7 1 2 1 1 1 1 3 1 1 1 1 1
(26.92%) (3.83%) (7.69%) (3.83%) (3.83%) (3.83%) (3.83%) (11.53%) (3.83%) (3.83%) (3.83%) (3.83%) (3.83%)
22 (84.62%) Total no. strains found
Bifidobacterium spp. Peptostreptococcus spp. Terrahaemophilus aromat Veillonella spp.
1 1 1 1
(3.83%) (3.83%) (3.83%) (3.83%)
Total anaerobes
4 (15.38%)
Haemophilus parainfluenzae Haemophilus segnis Kaistella koreensis Neisseria spp. Neisseria bacilliformis Neisseria elongata Neisseria perflava Neisseria pharingis Neisseria subflava Pseudomonas aeruginosa Terrahaemophilus aromat Veillonella spp. Total Gram-negative
(3.85%) (3.83%) (3.83%) (3.83%) (3.83%)
7 1 1 2 1 1 1 1 3 1 1 1
(26.85%) (3.85%) (3.83%) (7.69%) (3.83%) (3.83%) (3.83%) (3.83%) (11.53%) (3.83%) (3.83%) (3.83%)
21 (80.75%)
888 bone chips; this coagulates in the mesh and obstructs the passage of fluids.8 Throughout this study, there were no problems with filter blockage during collection. Although the diameter of the pores was 300 mm, bone chips of smaller dimensions (approximately 70 mm) were trapped. It appears that the dimensions of the fragments can vary in function with the ‘packing’ of the collected material on the filter mesh. Therefore, the pore dimensions of the mesh do not imply collection of material that is homogeneous in size. The two distinct aspiration tubes used for chip collection and control of salivation and bleeding enabled the oral fluids in the collection site to be reduced. Moreso, the piezo-electric surgical device used for performing the ostectomy, was able to keep the operating area free of blood due to cavitation.13 This characteristic, combined with abundant irrigation with a sterile physiological solution, allowed for significant reduction of blood suctioning and the consequent formation of coagulum inside the filter. Washing the aspiration system and bone trap with 500 ml of sterile physiological solution further reduced the presence of contaminants in the collected material. Microbial contamination was found in all the samples of bone tissue collected in this study. Young et al.18 conducted the first studies to establish the extent of contamination of a bone sample collected with a bone trap during an intra-oral ostectomy performed with rotary instruments. The contamination of bone fragments found by Young et al.18 in two successive studies was 9.634 and 7.55 105 CFU/ml per sample, respectively. Bacterial contamination can be reduced, according to Young et al.,18 to 3.168 105 CFU/ml using two separate aspiration systems.18,24 The average bacterial contamination found in this study was 1.707 105 CFU/ml. The extracted dental element was completely bony impacted, not in contact with the oral cavity, and asymptomatic. Therefore, prior to incision of the flap and the beginning of the ostectomy, it was in a sterile condition. The collection protocol was very accurate; two distinct aspiration systems were used and the filter for bone chip collection was removed from its sterile packaging and put into use only at inception of the ostectomy, in order to reduce the risk of contamination of collected material. The source of contamination of the collected bone debris is represented, therefore, by the microbial community in the oral cavity, present in high concentrations in the saliva, the mucus and the teeth surfaces. It should be noted that patients in the present study had a younger average age compared with the patients in the studies of Young et al., and none of them presented periodontal pathologies.
S. Sivolella et al. Although considered acceptable by Young et al. and other authors,18,20,24 the bacterial contamination of bone fragments collected in the present study (1.707 105 CFU/ml) does not guarantee that the grafting of the material will be completely free of systemic or local infective complications. The authors decided to treat the bone samples with rifamycin SV because it is a bactericidal drug commonly used in oral and maxillofacial surgery for washing abscessed cavities, treating pericoronaritis, traumatic lesions and infected alveoli following extraction. It is even utilised in orthopaedic surgery and its topical application on bone tissue is well tolerated and limits the incidence of infective complications.25,26 It is active with regard to Grampositive and Gram-negative pathogens, and is effective in the treatment of polymicrobic infections.27 It is often used in the treatment of osteomyelitis and for infections associated with orthopaedic prostheses as it possesses an elevated capacity for spreading inside the bone tissue.28—32 Direct application of rifamycin on bone tissue and the combined use of the drug with other grafting materials does not seem to have a negative effect on osteogenesis.33 In all the samples treated with rifamycin SV, a statistically significant (P < 0.005) reduction in bacterial contamination was observed compared with the value found in the control samples. The contact time with the drug was 10 min. The choice of this parameter is connected to clinical considerations and a generic assessment of the times involved in oral surgery from harvesting to grafting. The concentration of the drug used, 0.5%, was that advised by the manufacturer for the topical application of the product, which was demonstrated to be well tolerated by the tissues. Witso et al.34 demonstrated that autogenous particulate bone soaked, by immersion, in rifampin (or other antibiotics) and grafted can carry the drug to the grafting site. One can therefore assume that, in addition to the immediate effect of reducing the bacterial contamination of bone debris, there is an added antibacterial effect due to the presence of drug in the grafting site.34 Treatment of collected bone debris was more effective than other methods applied to reduce bacterial contamination in the samples. According to Young et al., temporarily reducing the bacterial level present inside the oral cavity with a chlorhexidine-based mouthwash, administered to the patient immediately prior to the operation, limits the average contamination value of collected bone debris to 0.72 105 CFU/ ml.24 The contamination level found in this study after treatment of bone debris with antibiotic was notably lower. These methods could be applied
Autogenous particulate bone collected with a piezo-electric surgical device and bone trap jointly in order to further limit the bacterial count present in the samples. In the samples that were not treated with rifamycin SV, only a quantitative evaluation of the bacterial contamination was performed. In the samples treated with rifamycin SV, both quantitative and qualitative evaluations were performed. The bactericidal effect of rifamycin SV allowed for the isolation of some bacterial strains (resistant to the drug used in the specific conditions of exposure, e.g. time and concentration). Selection of the bacterial strains seems to be related to several factors: choice of donor site; presence of specific bacterial species on different oral tissue surfaces;35 technique used for bone chip collection; manipulation of bone samples from time of collection to microbiological evaluation; and bactericidal effect of rifamycin. In each sample of bone debris treated with rifamycin SV, an average of 2.6 bacterial strains that were resistant to the antibiotic treatment were isolated. Micro-organisms belonging to the Haemophilus spp. and Neisseria spp. groups were identified most frequently (65.38% of the total isolations). In particular, Haemophilus parainfluenzae was identified in 70% of the samples. The majority of bacterial species identified (84.62%) were aerobes or facultative anaerobes. This may be due, in part, to the fact that patients selected for this study did not present periodontal pathologies, sustained prevalently by Gram-negative anaerobic micro-organisms. In addition, treatment of the samples inevitably led to their exposure to the air, despite the fact that the plating out and incubation of the samples was carried out within 30 min of collection. This exposure probably contributed to the death of a portion of the obligatory anaerobic micro-organisms. It must, however, be highlighted that even the clinical use of bone chips as grafting material leads to air exposure matching that in this study, with a consequent reduction in the anaerobic component of micro-organisms present. A high percentage of micro-organisms that are resistant to treatment with rifamycin SV are Gram-negative. Rifamycin is active, both in vivo and in vitro, on Gram-positive micro-organisms, while the action of the drug on Gram-negative bacteria occurs at higher concentrations. By using higher concentrations of the drug for decontamination treatment, it will be possible to further reduce the bacterial count. It must, however, be established at what dose the drug is well tolerated by the bone tissue and does not interfere with the osteogenesis process. The bacteria isolated in this study are regular components of the bacterial flora found in the oral cavity. The majority of the isolated bacterial species are defined as commensal, and have a low patho-
889
genicity. However, they can cause infective complications in subjects with compromised immune systems, such as H. parainfluenzae, Neisseria subflava and Pseudomonas aeruginosa.35,36 Some of these micro-organisms have been isolated from post-operative infections in the head and neck, the aetiology of which is usually polymicrobic. Among the micro-organisms isolated in this study, Streptococcus mitis is frequently associated with post-operative infective complications, and with oral and maxillofacial suppurative infections.37 The potential pathogenicity of Veillonella spp. is fairly high; this micro-organism is potentially correlated with infectious endocarditis and osteomyelitis.38,39 Peptostreptococcus spp. has a high potential pathogenicity; it is correlated with endodontic infections, suppurative infections of the oral cavity and, probably, with periodontal pathology.40 Haemophilus segnis, Neisseria elongata and Streptococcus acidominimus are correlated with infectious endocarditis.41—43 Given that the micro-organisms of the oral cavity include a very high number of different species, it is very difficult for one sole antibiotic to be capable of eliminating all the micro-organisms that can contaminate a bone sample from in this site.44 Further studies are needed to determine the effects of combinations of antibiotics in order to broaden the range of action to Gram-positive and Gram-negative micro-organisms. The aliquots of bone chips for histomorphometric analysis and the aliquots for microbiological evaluation were selected randomly from the bone trap. However, it cannot be confirmed that the bone chips examined in this study represent the dimensions of all the chips collected in the bone trap. The measurement of linear dimensions only provides an indicative value of the size of bone chips that can be obtained using the piezo-electric device equipped with the OP1 insert in association with a bone trap with a 300-mm-diameter filter. The linear dimensions of the collected bone chips presented great variability, ranging between 73.12 mm 29.9 mm and 6034 mm 1125.7 mm. Some chips had smaller dimensions than the mesh of the filter used for collection (300 mm), but were still trapped. Bone chips of such reduced dimensions are rapidly resorbed. On the other hand, very large bone chips undergo slow incorporation and the graft may a require longer healing time.14—16,40,45 Nonetheless, the ideal dimensions of autogenous bone chips, used as grafting material, have not yet been clarified and the values reported in the literature are not uniform. One can, however, presume that the presence of bone chips with such varied dimensions as those collected in this study combines the advantages of the bone being subjected to early
890 remodelling of the small-sized chips, and the mechanical support provided by the larger particles. The latter, in fact, undergo slower remodelling and constitute a valid scaffold for new bone formation in the grafting site.17
Conclusions The piezo-electric surgical device proved to be a valid device for collecting autogenous particulate bone. The collection protocol applied must always foresee the use of an aspiration system for the control of saliva and bleeding, as well as a surgical aspiration set equipped with a bone trap for the collection of bone chips, in order to limit bacterial contamination of the collected bone debris. The use of rifamycin SV for treatment of the bone chips allowed the authors to reduce bacterial contamination significantly. According to the literature, bone chips collected and treated using the methods described in this study can be considered as a valid grafting material for the correction of minor bone defects during oral surgery operations.8,18,19 It must also be taken into consideration that bone chips treated with antibiotic solution are impregnated with the drug and may leave it in the grafting site.34 This additional antibacterial effect, already studied in vitro by some authors, could be examined in vivo in future studies, which could provide information on the effect of rifamycin on the properties of autogenous particulate bone grafting.
References 1. Stricker A, Voss PJ, Gutwald R, Schramm A, Schmelzeisen R. Maxillary sinus floor augmention with autogenous bone grafts to enable placement of SLA-surfaced implants: preliminary results after 15—40 months. Clin Oral Implants Res 2003;14:207—12. 2. Williamson RA. Rehabilitation of the resorbed maxilla and mandible using autogenous bone grafts and osseointegrated implants. Int J Oral Maxillofac Implants 1996;11: 476—88. 3. Lorenzetti M, Mozzati M, Campanino PP, Valente G. Bone augmentation of the inferior floor of the maxillary sinus with autogenous bone or composite bone grafts: a histologichistomorphometric preliminary report. Int J Oral Maxillofac Implants 1998;13:69—76. 4. Moy PK, Lundgren S, Holmes RE. Maxillary sinus augmentation: histomorphometric analysis of graft materials for maxillary sinus floor augmentation. J Oral Maxillofac Surg 1993;51:857—62. 5. Hallman M, Sennerby L, Lundgren S. A clinical and histologic evaluation of implant integration in the posterior maxilla after sinus floor augmentation with autogenous bone, bovine hydroxyapatite, or a 20:80 mixture. Int J Oral Maxillofac Implants 2002;17:635—43.
S. Sivolella et al. 6. Matsumoto MA, Filho HN, Francischone E, Consolaro A. Microscopic analysis of reconstructed maxillary alveolar ridges using autogenous bone grafts from the chin and iliac crest. Int J Oral Maxillofac Implants 2002;17:507—16. 7. Savant TD, Smith KS, Sullivan SM, Owen WL. Bone volume collected from dental implant sites during osteotomy. J Oral Maxillofac Surg 2001;59:905—7. 8. Young MP, Worthington HV, Lloyd RE, Drucker DB, Sloan P, Carter DH. Bone collected during dental implant surgery: a clinical and histological study. Clin Oral Implants Res 2002;13:298—303. 9. Kainulainen V, Oikarinen K. Comparison of four bone collectors designed for oral and maxillofacial surgery–—an in vitro study. Clin Oral Implants Res 1998;9:327—32. 10. Oikarinen K, Kainulainen V, Kainulainen T. A method of harvesting corticocancellous bone chips for reconstructive maxillofacial surgery. Int J Oral Maxillofac Surg 1997;26: 103—5. 11. Robiony M, Polini F, Costa F, Vercellotti T, Politi M. Piezoelectric bone cutting in multipiece maxillary osteotomies. J Oral Maxillofac Surg 2004;62:759—61. 12. Vercellotti T. Technological characteristics and clinical indications of piezoelectric bone surgery. Minerva Stomatol 2004;53:207—14. 13. O’Leary R, Sved AM, Davies EH, Leighton TG, Wilson M, Kieser JB. The bactericidal effects of dental ultrasound on Actinobacillus actinomycetemcomitans and Porphyromonas gingivalis. An in vitro investigation. J Clin Periodontol 1997;24: 432—9. 14. Schepers EJ, Ducheyne P. Bioactive glass particles of narrow size range for the treatment of oral bone defects: a 1—24 month experiment with several materials and particle sizes and size ranges. J Oral Rehabil 1997;24:171—81. 15. Shapoff CA, Bowers GM, Levy B, Mellonig JT, Yukna RA. The effect of particle size on the osteogenic activity of composite grafts of allogeneic freeze-dried bone and autogenous marrow. J Periodontol 1980;51:625—30. 16. Pallesen L, Schou S, Aaboe M, Hjorting-Hansen E, Nattestad A, Melsen F. Influence of particle size of autogenous bone grafts on the early stages of bone regeneration: a histologic and stereologic study in rabbit calvarium. Int J Oral Maxillofac Implants 2002;17:498—506. 17. Fucini SE, Quintero G, Gher ME, Black BS, Richardson AC. Small versus large particles of demineralised freeze-dried bone allografts in human intrabony periodontal defects. J Periodontol 1993;64:844—7. 18. Young MP, Carter DH, Worthington H, Korachi M, Drucker DB. Microbial analysis of bone collected during implant surgery: a clinical and laboratory study. Clin Oral Implants Res 2001;12: 95—103. 19. Glaser B, Hodel Y, Meyer J, Lambrecht JT. Bacterial contamination of bony particles from the bone collection trap. Schweiz Monatsschr Zahnmed 2004;114:337—41. 20. Blay A, Tunchel S, Sendyk WR. Viability of autogenous bone grafts obtained by using bone collectors: histological and microbiological study. Pesqui Odontol Bras 2003;17:234— 40. 21. Hirn M, Laitinen M, Pirkkalainen S, Vuento R. Cefuroxime, rifampicin and pulse lavage in decontamination of allograft bone. J Hosp Infect 2004;56:198—201. 22. Petri 3rd WH, Schaberg SJ. The effects of antibiotic-supplemented bone allografts on contaminated, partially avulsive fractures of the canine ulna. J Oral Maxillofac Surg 1984;42: 699—704. 23. Petri 3rd WH, Wilson TM. Clinical evaluation of antibioticsupplemented bone allograft. J Oral Maxillofac Surg 1993;51:982—5.
Autogenous particulate bone collected with a piezo-electric surgical device and bone trap 24. Young MP, Korachi M, Carter DH, Worthington HV, McCord JF, Drucker DB. The effects of an immediately pre-surgical chlorhexidine oral rinse on the bacterial contaminants of bone debris collected during dental implant surgery. Clin Oral Implants Res 2002;13:20—9. 25. Fabre L, Chami G. Experimentation clinique de la rifamycine S.V. en oto-rhino-laryngologie et chirurgie maxillo-faciale (article the ´rapeutique). Les Cahiers d’ORL 1979;14:407—12. 26. de Carvalho PS, Mariano RC, Okamoto T. Treatment of fibrinolytic alveolitis with rifamycin B diethylamide associated with gelfoam: a histological study. Braz Dent J 1997;8:3—8. 27. armaceuSweetman S, ed. Martindale: The Complete Drug Reference. [Internet database]. London: Phtical Press. Electronic version, Greenwood Village, Colo: Thomson Micromedex. Updated periodically. http://www.micromedex.com/ products/martindale/. 28. Norden CW, Keleti E. Treatment of experimental staphylococcal osteomyelitis with rifampin and trimethoprim, alone and in combination. Antimicrob Agents Chemother 1980;17: 591—4. 29. Drancourt M, Stein A, Argenson JN, Roiron R, Groulier P, Raoult D. Oral treatment of Staphylococcus spp. infected orthopaedic implants with fusidic acid or ofloxacin in combination with rifampicin. J Antimicrob Chemother 1997;39: 235—40. 30. Sirot J, Prive L, Lopitaux R, Glanddier Y. Diffusion of rifampicin into spongy and compact bone tissue during total hip prosthesis operation. Pathol Biol (Paris) 1983;31:438—41. 31. Cluzel RA, Lopitaux R, Sirot J, Rampon S. Rifampicin in the treatment of osteoarticular infections due to staphylococci. J Antimicrob Chemother 1984;13(Suppl C):23—9. 32. Roth B. Penetration of parenterally administered rifampicin into bone tissue. Chemotherapy 1984;30:358—65. 33. Varlet A, Dauchy P, Hingrez M. Osteogenesis induced by the addition of demineralised bone matrix to plaster pellets with
34. 35.
36.
37.
38. 39.
40.
41.
42.
43. 44.
45.
891
antibiotics. Animal experiment. Rev Chir Orthop Reparatrice Appar Mot 1985;71:73—8. Witso E, Persen L, Loseth K, Benum P, Bergh K. Cancellous bone as an antibiotic carrier. Acta Orthop Scand 2000;71:80—4. Tada A, Watanabe T, Yokoe H, Hanada N, Tanzawa H. Oral bacteria influenced by the functional status of the elderly people and the type and quality of facilities for the bedridden. J Appl Microbiol 2002;93:487—91. Kaplan JB, Fine DH. Biofilm dispersal of Neisseria subflava and other phylogenetically diverse oral bacteria. Appl Environ Microbiol 2002;68:4943—50. Bancescu G, Dumitriu S, Bancescu A, et al. Susceptibility testing of Streptococcus mitis group isolates. Indian J Med Res 2004;119(Suppl):257—61. Fisher RG, Denison MR. Veillonella parvula bacteremia without an underlying source. J Clin Microbiol 1996;34:3235—6. Boo TW, Cryan B, O’Donnell A, Fahy G. Prosthetic valve endocarditis caused by Veillonella parvula. J Infect 2005;50:81—3. Rolph HJ, Lennon A, Riggio MP, et al. Molecular identification of microorganisms from endodontic infections. J Clin Microbiol 2001;39:3282—9. Lau SK, Woo PC, Mok MY, et al. Characterisation of Haemophilus segnis, an important cause of bacteremia, by 16S rRNA gene sequencing. J Clin Microbiol 2004;42:877—80. Haddow LJ, Mulgrew C, Ansari A, et al. Neisseria elongata endocarditis: case report and literature review. Clin Microbiol Infect 2003;9:426—30. Brachlow A, Awadallah S, Chatterjee A. Endocarditis due to Streptococcus acidominimus. Pediatr Cardiol 2003;24:161—3. Mager DL, Ximenez-Fyvie LA, Haffajee AD, Socrannsky SS. Distribution of selected bacterial species on intraoral surfaces. J Clin Periodontol 2003;30:644—54. Xu H, Shimizu Y, Asai S, Ooya K. Experimental sinus grafting with the use of deproteinised bone particles of different sizes. Clin Oral Implants Res 2003;14:548—55.