Autoimmune hepatitis type 1 without evidence of hepatitis G virus infection

International ELSEVIER

Hepatology Communications 6 (1997) 219-224

Autoimmune hepatitis type 1 without evidence of hepatitis G virus infection Tetsuya Ichijo a, Yoshiyuki Nakatsuji b, Eiji Tanaka a, Harvey J. Alter b, Kaname Yoshizawa a, Haruhiko Imai ‘, Takeshi Sodeyama a, Kendo Kiyosawa a-* a Second

Department

b Department

of Internal of Transfusion

Medicine. Shinshu University Matsumoto 390, Japan Medicine, National Institute

School

of Medicine,

of Health,

Bethesda

3-l-l MD,

Asahi, USA

Received 30 September 1996; received in revised form 27 November 1996; accepted 3 December 1996

Abstract Hepatitis G virus (HGV) RNA was measured in sera from 60 patients satisfying the international diagnostic criteria of definite autoimmune hepatitis type 1 using a reverse transcription and polymerase chain reaction with primers of the putative NS5 region of the HGV genome. Five patients had a history of blood transfusion. Of the 60 patients, 55 (92%) were confirmed as having human leukocyte antigen (HLA) DR4 or DR2 which are genetic markers for susceptibility to autoimmune hepatitis in Japanese. None of the 60 patients had any serum markers suggesting hepatitis B virus infection and 5 (8%) had evidence of on-going hepatitis C virus infection. No patients had HGV RNA in serum. The absence of active HGV infection in this cohort suggests that HGV does not play a casual role in the development of autoimmune hepatitis in Japan. 0 1997 Elsevier Science Ireland Ltd. Keywords:

Autoimmune

* Corresponding

hepatitis;

Hepatitis

G virus; HGV

RNA;

HGV

author. Tel.: + 81 263 372634; fax: + 81 263 329412.

0928-4346/97/$17.00 0 1997 Elsevier Science Ireland Ltd. All rights reserved. PII

SO928-4346(96)00349-O

infection

220

T. Ichijo

et ul. 1 Internafiortnl

Heputologjj

Colllrnunic~ations

6 (1997)

219

X4

1. Introduction

Autoimmune hepatitis is discriminated from non-A, non-B, non-C viral hepatitis by its characteristics including female predominance, chronic aggressive hepatitis, marked hyper-yglobulinemia, complete response to the administration of steroid treatment and the presence of auto-antibodies such as anti-nuclear antibody (ANA) [l]. Autoimmune hepatitis now has an established definition and standardized diagnostic requirements [2]. Two forms of the disease have been proposed to ensure homogenous diagnostic categories [3,4]. Type 1 autoimmune hepatitis connotes the presence of anti-smooth muscle antibody (ASMA) and/or ANA in serum [3,4] and is the most common form of autoimmune hepatitis in Japan. Type 2 autoimmune hepatitis connotes the presence of antibodies to liver/kidney microsome 1 (ALKMl) in serum and is less frequent compared with type 1 [3,4]. Autoimmune hepatitis may be found in those with some of the other autoimmune diseases, and its occurrence is restricted genetically [5-81. The pathogenesis of autoimmune hepatitis remains unknown. Since viral infection may trigger autoimmune hepatitis [9- 111, we investigated the relationship of autoimmune hepatitis to the newly discovered hepatitis G virus (HGV). HGV has been cloned and sequenced [ 121 and shown to be closely related to hepatitis C virus (HCV) in general structure, but significantly distinct. Like HCV, HGV is transmissible through transfusion and may be associated with acute and chronic hepatitis [12- 141. In this study, we measured HGV RNA in serum using a reverse transcription and polymerase chain reaction (RT-PCR) procedure in Japanese patients with autoimmune hepatitis type 1 to determine the association of extent HGV in autoimmune hepatitis.

2. Patients .and methods

2.1. Patients Patients, 70, who satisfied the international diagnostic criteria of definite autoimmune hepatitis type 1 [2] were seen at Shinshu University Hospital between January 1978 and December 1995. The study subjects included 60 patients whose stored serum samples from the time of the diagnosis were available for testing. The study population included 11 males and 49 females aged from 32 to 74 years (mean 53.2 years). All patients were Japanese who were born in Japan, were heterosexual, had not lived abroad, had no previous contact with hepatitis patients and denied any abuse of drugs or alcohol. Five had a history of blood transfusion and the other 55 patients had no exposure to parenteral blood products before disease onset. Mean levels of biochemical liver function tests at the time of diagnosis were as follows; alanine aminotransferase (ALT) = 448 f 349 IUjl, total bilirubin = 5.2 f 5.9 mg/dl, and immunoglobulin G = 3541 f 1192 mg/dl. Liver histology was examined in 54 of the 60 patients; all showed severe piecemeal necrosis and portal tract infiltration.

T. Ichijo

et al. /International

Hepatology

Communications

6 (1997)

219-224

221

All 60 patients were treated with prednisolone just after the diagnosis was made. Patients, 57, responded completely to the therapy with the normal position of ALT and total bilirubin, but three patients died of disease exacerbation with histological findings of massive hepatic necrosis at autopsy despite the administration of 1000 mg prednisolone daily for 3 days. 2.2. HGV RNA

HGV RNA was measured by RT-PCR as described previously [13]. Briefly, total nucleic acids were extracted from 50 ~1 of serum sample using acid guanidinium thiocyanate-phenol-chloroform [ 15,161. After reverse transcription, 45 cycles of PCR were carried out with primers of the putative NS5 region of HGV genome: sense (CGAATGAGTCAGAGGACGGGGTAT) and anti-sense (CTCTTTGTGGTAGTAGCCGAGAGAT). PCR products were analyzed by dot blot hybridization with a 32P-labeled oligonucleotide probe (TCGGTTACTGAGAGCAGCTCAGATGAG). The sensitivity of this assay system was 1 HGV RNA copy equivalent per reaction, corresponding to approximately 20 copies equivalent per ml of starting serum. 2.3. Hepatitis viral markers

Hepatitis B surface (HBs) antigen, HBs antibody, hepatitis B core (HBc) antibody, hepatitis A virus (HAV) antibody and HCV antibody of second generation were measured by commercially available enzyme immuno-assay kits (Abbott Laboratories, IL). HCV RNA was measured by using the nested RT-PCR method as described elsewhere [16]. Serum samples collected before initiating corticosteroid therapy and stored at - 20°C were examined for hepatitis viral markers including HGV RNA. 2.4. Auto-antibodies

and human leukocyte antigen (HLA)

typing

Serum auto-antibodies including ANA, ASMA, anti-mitochondrial antibody (AMA) and ALKMl were detected by indirect immunofluorescence using HEp-2 cells for ANA, cryostat sections of rat liver, kidneys and stomach for ALKMl and AMA as substrates. A titer of 1:40 or greater was considered to be positive for those autoantibodies. HLA DR alleles were detected by a standard microlymphocytotoxicity assay using antibodies from One Lambda (Los Angeles, CA) as reported previously [S].

3. Results

Table 1 shows the immunological features at the time of diagnosis in all subjects. All 60 patients were positive for ANA but negative for ALKMl. Four patients were positive for AMA; only one of the four patients showed histological evidence

222

T. Ichijo

Table 1 Immunological

features

Immunological

features

et ul. /International

in 60 patients

Hepatology

with

Communications

autoimmune

hepatitis No.

Anti-nuclear antibody Anti-smooth muscle antibody Anti-mitochondrial antibody Anti-liver-kidney-microsome LE factor HLA DR4 HLA DR2

type

6 (1997)

219-2.223

1

positive

o/n positive

60 44 4 0 35 49 18

antibody

100 73 7 0 58 82 30

of coexisting PBC. HLA DR2 was detected in 18 (30.0%) patients and DR4 in 49 (81.7%). Three patients had neither DR4 nor DR2; the HLA DR pairs of these patients were DRl and DR8, DR6 and DR9, and DRl 1 and DR12, respectively. Table 2 shows the prevalence of hepatitis viral markers. HAV antibody was present in 63% of the patients. HBS antigen was not detected in any patients. While HBc antibody was present in 17%. However, no patient exhibited a high titer (positive at a dilution of 1:200) of HBc antibody. Six patients had HCV antibody and five of these patients also had HCV RNA in serum. All six patients with HCV markers had HLA DR2 or DR4, and responded well to prednisolone therapy. Serum HGV RNA was negative in all 60 patients examined.

4. Discussion

The role of immune mechanisms in the pathogenesis of autoimmune hepatitis has been studied extensively, but is still obscure. The initial damage in this disease has been speculated to be caused by viral infection or toxic exposure of the liver, with the ensuing autoimmune response influenced by the presence of susceptible HLA types that may facilitate the presentation of an organ-specific autoantigen to T cells Table 2 Serum hepatitis Hepatitis

viral

HAV antibody HBs antigen HBs antibody HBc antibody” HCV antibody HCV RNAb HGV RNA “No bAll

patient patients

virus

markers

in 60 patients

with

markers

of second

had a titer with HCV

autoimmune No.

generation

greater RNA

than 1:200. also had the HCV

38 0 5 10 6 5 0

antibody.

positive

hepatitis

type

1 ‘% positive 63 0 8 17 IO 8 0

T. Ichgo et al. /International

Hepatology Communications 6 (1997) 219-224

223

[17]. The susceptible HLA types were reportedly HLA B8 and DR3 in Caucasians [5-7,171, and HLA DR4 and DR2 in the Japanese. Almost all our subjects were confirmed to have the DR2 or DR4 HLA type, and were considered to be genetically susceptible to autoimmune hepatitis [8,18]. Although the agents that trigger autoimmune hepatitis have not been clarified sufficiently, suggested candidates are viruses such as measles virus [9], HAV [lo], HBV [l l] and recently HCV. The majority of our subjects had HAV antibody as has been reported [19]. However, these findings do not necessarily indicate that HAV infection is related to the onset of autoimmune hepatitis because the prevalence of the antibody is also high in the normal age-matched Japanese population [20]. No patient was found to have on-going HBV infection. On the other hand, five patients with on-going HCV infection showed typical clinical features of autoimmune hepatitis. Whether liver cell necrosis was caused by an autoimmune process or by an immune process targeted to a HCV antigen in these patients remains unknown. The quick response to corticosteroid therapy in patients with HCV infection as in patients without HCV infection suggests an autoimmune mechanism underlying the liver damage. Serum HGV RNA was not detected in any of the Japanese patients with autoimmune hepatitis despite the large number of patients examined, suggesting that there is no pathogenetical association between autoimmune hepatitis and on-going infection of HGV in Japanese patients. Similarly, the prevalence of HGV RNA was as low as 9.4% (5/53) in European patients with autoimmune hepatitis [12]. To clarify whether HGV infection triggers the development of autoimmune hepatitis, an antibody assay system for HGV must be developed. Acknowledgements

This research was supported by a Grant-in-Aid for Scientific Research (B) from the Ministry of Education, Science, Sport and Culture of Japan (No. 06454261) and by a Grant-in-Aid from the Ministry of Health and Welfare of Japan.

References [l] Mackay IR, Wood IJ. Lupoid hepatitis: A comparison of 22 cases with other types of chronic liver disease. Quant J Med 1962; 31: 485-507. [2] Johnson PJ, McFarlane IG, Alvarez F, et al. Meeting report: international autoimmune hepatitis group. Hepatology 1993; 18: 998-1005. [3] Homberg JC, Abuaf N, Bernard 0, et al. Chronic active hepatitis associated with antiliver/kidney microsome antibody type I: a second type of ‘autoimmune’ hepatitis. Hepatology 1987; 7: 133331339. [4] Strassburg CP, Manns MP. Autoimmune hepatitis versus viral hepatitis C. Liver 1995; 15: 225-232. [5] Opelz G, Vogrten AJ, Summerskill WH, Schalm SW, Terasaki PI. HLA determinants in chronic active liver disease: possible relation of HLA-Dw3 to prognosis. Tissue Antigens 1977; 9: 36-40. [6] Mackay IR, Tait BD. HLA association with autoimmune-type chronic active hepatitis: identification of B8-DRw3 haplotype by family studies. Gastroenterology 1980; 79; 95-98.

224

T. Ichijo

et al. /International

Hepatology

Communications

6 (1997)

219-224

[7] Tait BD, Mackay IR, Board P, Coggan M, Emery P, Eckardt G. HLA Al, B8, DR3 extended haplotypes in autoimmune chronic hepatitis. Gastroenterology 1989; 97: 479-481. [S] Seki T, Kiyosawa K. Inoko H, Ota M. Association of autoimmune hepatitis with HLA-Bw 54 and DR4 in Japan. Hepatology 1990; 12: 1300-1304. [9] Robertson DA, Zhang SL, Guy EC, Wright R. Persistent measles virus genome in autoimmune chronic active hepatitis. Lancet 1987; 2: 9-l 1. [lo] Vento S, Garofano T, Perri GD, Dolci L, Concia E, Bassetti D. Identification of hepatitis A virus as a trigger for autoimmune hepatitis type 1 in susceptible individuals. Lancet 1991; 337: 11831187. [II] Laskus T, Slusarczyk J. Autoimmune chronic active hepatitis developing after acute type B hepatitis. Dig Dis Sci 1989; 34: 1294- 1297. [12] Linnen J, Wages Jr. J, Zhang-Keck Z-Y, et al. Molecular cloning and disease association of hepatitis G virus: A transfusion-transmissible agent. Science 1996; 271: 5055508. [13] Nakatsuji Y, Shih JWK, Tanaka E, Kiyosawa K, Wges J, Kim JP, Alter HJ. Prevalence and disease association of hepatitis G virus infection in Japan. J Viral Hepatitis 1996; 3: 307-316. [14] Jeffers LJ, Piatak M, Bernstein DE, et al. Hepatitis G virus infection in patients with acute and chronic liver disease of unknown etiology. Hepatology 1995; 22(4pt 2): 182A. [15] Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanatephenol-chloroform extraction. Anal Biochem 1987; 162: 156- 159. [16] Nakatsuji Y, Matsumoto A, Tanaka E, Ogata H, Kiyosawa K. Detection of chronic hepatitis C virus infection by four diagnostic systems: first-generation and second generation enzyme-linked immunosorbent assay, second-generation recombinant immuno-blot assay and polymerase chain reaction analysis. Hepatology 1992; 16: 300-305. [17] Eckardt GS, O’Brien RM, Mackay IR, De Martinis L, Tait BD. Lack of informative HLA restriction fragment length polymorphism in autoimmune chronic active hepatitis. Tissue Antigens 1989; 34: 270-278. [18] Seki T, Ota M, Furuta S, et al. HLA class II molecules and autoimmune hepatitis susceptibility in Japanese patients. Gastroenterology 1992; 103: 1041- 1047. [19] Tanaka E, Kiyosawa K, Seki T, et al. Low prevalence of hepatitis C virus infection in patients with auto-immune hepatitis type 1. J Gastroenterol Hepatol 1993; 8: 442-447. [20] Ichida F, Suzuki S, Furuta S, et al. Age specific prevalence of anti HA in Japan from multi-institutional analysis. Gastroenterol Jpn 1981; 16: 3844388.